
==== Front
J Parasitol
J Parasitol
para
The Journal of Parasitology
0022-3395
1937-2345
American Society of Parasitologists

37498779
10.1645/22-97
Ectoparasitology
GENETIC VARIATION OF LEPTOTROMBIDIUM (ACARI: TROMBICULIDAE) MITES CARRYING ORIENTIA TSUTSUGAMUSHI, THE BACTERIAL PATHOGEN CAUSING SCRUB TYPHUS
https://orcid.org/0000-0002-5516-0998
Ogawa Motohiko 1
Takada Nobuhiro 2
Noda Shinichi 3
Takahashi Mamoru 4
Matsutani Minenosuke 5
Kageyama Daisuke 6
Ebihara Hideki 1
1 Department of Virology I, National Institute of Infectious Diseases, 1-23-1, Toyama, Shinjuku-ku, Tokyo 162-8640, Japan.
2 Faculty of Medical Sciences, University of Fukui, 23-3 Matsuoka, Eiheiji, Fukui 910-1193, Japan.
3 Research Center for the Pacific Islands, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-8580, Japan.
4 Department of Anesthesiology, Saitama Medical University, 38 Moroyama-Machi, Iruma-Gun, Saitama, 350-0495, Japan.
5 NODAI Genome Research Center, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya, Tokyo 156-8502, Japan.
6 Institute of Agrobiological Sciences, National Agriculture and Food Research Organization, 1-2, Owashi, Tsukuba, Ibaraki 305-0851, Japan.
Correspondence should be sent to Motohiko Ogawa (http://orcid.org/0000-0002-5516-0998) at: ogawam@nih.go.jp
Jul-Aug 2023
27 7 2023
109 4 340348
© American Society of Parasitologists 2023
2023
https://creativecommons.org/licenses/by-nc-nd/4.0/ This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Leptotrombidium (Acari: Trombiculidae) mites are carriers of Orientia tsutsugamushi, the bacterial pathogen causing scrub typhus in humans. Classification of Leptotrombidium is vital because limited mite species carry O. tsutsugamushi. Generally, Leptotrombidium at the larval stage (approximately 0.2 mm in size) are used for morphological identification. However, morphological identification is often challenging because it requires considerable skills and taxonomic expertise. In this study, we found that the full-length sequences of the mitochondrial cytochrome c oxidase subunit 1 gene varied among the significant Leptotrombidium. On the basis of these, we modified the canonical deoxyribonucleic acid (DNA) barcoding method for animals by redesigning the primer set to be suitable for Leptotrombidium. Polymerase chain reaction with the redesigned primer set drastically increased the detection sensitivity, especially against Leptotrombidium scutellare (approximately 17% increase), one of the significant mites carrying O. tsutsugamushi. Phylogenetic analysis showed that the samples morphologically classified as L. scutellare and Leptotrombidium pallidum were further split into 3 and 2 distinct subclusters respectively. The mean genetic distance (p-distance) between L. scutellare and L. pallidum was 0.2147, whereas the mean distances within each species were 0.052 and 0.044, respectively. Within L. scutellare, the mean genetic distances between the 3 subclusters were 0.1626–0.1732, whereas the distances within each subcluster were 0.003–0.017. Within L. pallidum, the mean genetic distance between the 2 subclusters was 0.1029, whereas the distances within each subcluster were 0.010–0.013. The DNA barcoding uncovered a broad genetic diversity of Leptotrombidium, especially of L. scutellare and L. pallidum, the notable species carrying O. tsutsugamushi. We conclude that the DNA barcoding using our primers enables precise and detailed classification of Leptotrombidium and implies the existence of a subgenotype in Leptotrombidium that had not been found by morphological identification.

DNA barcoding
Mitochondrial cytochrome c oxidase subunit I (COI)
Subgenotype
Morphological classification
==== Body
pmcLeptotrombidium (Acari: Trombiculidae) mites are important from a public health perspective because of their role as carriers of Orientia tsutsugamushi, a bacterial pathogen causing scrub typhus in humans in the regions of the Pacific Rim such as East and Southeast Asian countries including Japan, Pacific islands and northern Australia, and the parts of the Indian Ocean Rim including India and Pakistan, which is an area referred as “tsutsugamushi triangle” (Tamura et al., 1995). For the mites, O. tsutsugamushi is a maternally inherited endosymbiont but can cause diseases (scrub typhus in humans) when transmitted to mammals upon feeding (Kawamura et al., 1995). The mites feed on mammals (wild rodents or other animals, including humans) only once during the larval stage (their earliest developmental stage, also called chiggers), whereas in their later stages, they feed on the arthropod eggs in the soil (Kawamura et al., 1995). By feeding on mammals heavily infected with O. tsutsugamushi, uninfected larval mites can acquire O. tsutsugamushi, which, however, are not transmitted to their progeny (Takahashi et al., 1988).

Several serotypes of O. tsutsugamushi were reported in Japan (Kawamura et al., 1995) with varying degrees of pathogenicity against mice; Kato, Karp, and Gilliam serotypes were virulent in mice, whereas Kuroki, Kawasaki, and Shimokoshi were less virulent or avirulent (Nagano et al., 1996). Notably, it has been reported that the serotypes of O. tsutsugamushi depend on the mite species; Leptotrombidium akamushi is the reservoir for the Karp serotype, Leptotrombidium pallidum for Gilliam and Karp serotypes (Takahashi et al., 1990, 2004a), and Leptotrombidium scutellare for Kuroki and Kawasaki serotypes (Yamashita et al., 1994; Kawamura et al., 1995). Recently, Leptotrombidium palpale was proposed as the reservoir for the Shimokoshi type (Seto et al., 2013). Although several species of Leptotrombidium are reported, the number of carrier species of O. tsutsugamushi is limited. Therefore, the classification of larval mites is vital for the epidemiological survey of mites, especially for the surveillance of scrub typhus vectors.

Within the reservoir species, carrier rates of O. tsutsugamushi remain at a few percent (Kawamura et al., 1995). Because maternally transmitted endosymbionts should have linkage disequilibrium with mitochondria (Perlman et al., 2015), we hypothesized that the mitochondrial haplotype variation can help explain the presence or absence of O. tsutsugamushi in these mites. For this, we utilized deoxyribonucleic acid (DNA) barcoding targeting mitochondrial gene sequences widely used for taxonomic identification and classification of eukaryotes (Beebe, 2018; Ahmed et al., 2022). The universal primer set LCO1490 and HCO2198, designed initially against highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across several taxa, were commonly used for DNA barcoding of invertebrate species (Folmer et al., 1994). However, it was reported that the universal primers should be redesigned for some taxonomic groups (Sharma and Kobayashi, 2014).

The objective of our study was to redesign a COI primer set for DNA barcoding using consensus sequences derived from different Leptotrombidium species, which are significant carriers of O. tsutsugamushi, and then apply this improved DNA barcoding for the classification of Leptotrombidium to evaluate the genetic variation of major species carrying O. tsutsugamushi in Japan.

MATERIALS AND METHODS

A sampling of mites and DNA extraction

Unfed larval mites inhabiting the soil were collected using the modified “black cloth method” (Uchikawa et al., 1994; Takada et al., 2001), and engorged larval mites were collected from wild rodents as described previously (Takahashi et al., 1988, 2004b) from 7 geographically separated regions of Japan (Fig. 1). Species of the mites for sequencing a full-length COI gene (Fig. 2) were carefully identified by observing detailed morphological features under a stereomicroscope. In contrast, the mites used for DNA barcoding were briefly identified by following only a few major morphological characteristics (Table I). For DNA extraction, the mites were cut or punctured with a 21-gauge needle on a clean glass slide placed under a stereomicroscope, transferred into PrepMan™ Ultra sample preparation reagent (Thermo Fisher Scientific K.K., Tokyo, Japan) in a microtube, and then heated at 96 C for 5 min. The samples were directly used for polymerase chain reaction (PCR). All the obtained sequences were deposited in the DNA data bank Japan (DDBJ) of National Institute of Genetics (NIG), Japan.

Figure 1. Geographic locations of 7 prefectures where Leptotrombidium and other mites were sampled.

Figure 2. Phylogenetic tree of full-length mitochondrial cytochrome c oxidase subunit 1 (COI) genes (1,533 base pairs) of Leptotrombidium. We sequenced the full-length COI genes of Leptotrombidium scutellare, Leptotrombidium fuji, Leptotrombidium palpale, and 2 Leptotrombidium pallidum mites. The phylogenetic tree was constructed using the neighbor-joining method. Bootstrap values greater than 70 are shown at nodes. The sequence of Walchia hayashii (NC_010595.1) was used as the outgroup.

Table I Comparison of detection rates by polymerase chain reaction with original and improved primer sets.

Mites*	Detection rates	
Original primer set	Improved primer set	
Genus Leptotrombidium	
 L. scutellare	118/213 (55.3)†	155/213 (72.8)	
 L. pallidum	31/32 (96.9)	31/32 (96.9)	
 L. fuji	14/16 (87.5)	14/16 (87.5)	
 Not determined	16/16 (100)	15/16 (93.8)	
Genus Walchia	
 W. masoni	14/14 (100)	14/14 (100)	
Total	193/291 (66.3)	229/291 (78.7)	
* Mites used in this analysis were simply morphologically classified by using a stereomicroscope.

† Numbers of positive samples/numbers of tested samples (percentage).

DNA sequencing of full-length COI genes

For sequencing of a full-length COI gene, PCR was performed with the primer set COX1fullF (5′–TTCTTTAAATTTGCAATTTAATWTC–3′) and COX1fullR (5′–AAAATAGATTGTCAGATTGGCA–3′) using EX Taq HS polymerase (Takara Bio Inc., Shiga, Japan). These primers were designed on the basis of the consensus sequences from the references of L. akamushi (NC_007601), L. pallidum (NC_007177), and Leptotrombidium delicense (NC_007600), which were obtained from the database of National Center for Biotechnology Information (NCBI, Bethesda, Maryland). DNA extracted from L. scutellare, Leptotrombidium fuji, L. palpale, and 2 L. pallidum mites, morphologically identified under a stereomicroscope, were used for PCR. Thermal conditions of PCR were as follows: denaturation at 94 C for 1 min followed by 30 cycles of amplification (denaturation at 94 C for 30 sec, annealing at 55 C for 30 sec, and extension at 68 C for 1 min) and a final extension at 68 C for 10 min. DNA sequencing was determined by dye terminator using ABI 3500 Genetic Analyzer for Resequencing & Fragment Analysis (Thermo Fisher Scientific K.K.) following the manufacturer's protocol.

Phylogenetic analysis

COI sequences aligned using ClustalW implemented in MEGA6 software (Tamura et al., 1995) were subjected to phylogenetic tree reconstruction using the neighbor-joining method with bootstrap analysis of 1,000 pseudoreplicates by MEGA6. On the basis of a previous report, a bootstrap value ≥70% was considered the threshold for reasonable confidence (Hillis and Bull, 1993). In the analysis, sequences of Walchia hayashii (NC_010595.1), obtained from the database of NCBI along with those of Leptotrombidium, were used. These sequences were either obtained in this study or from the database. Mean genetic distances (p-distance) within or between clusters and subclusters were estimated by MEGA6.

To perform network analysis, COI sequences were aligned using ClustalW implemented in MEGA6, and ambiguous sites containing degenerate nucleotides were manually removed. The cleaned sequence was subjected to draw a maximum parsimony TCS network (Clement et al., 2000) using the software PopART (Leigh and Bryant, 2015).

DNA barcoding of Leptotrombidium

We improved the universal primer set LCO1490 and HCO2198 for DNA barcoding on the basis of the COI gene using the consensus sequence of significant Leptotrombidium, which are carefully and definitively identified by morphological classification using a stereomicroscope (Fig. 2). DNA barcoding was performed by PCR using the improved degenerate primer set LCO1490_Ltromb (5′–TTTCHACWAAYCCYAARGAYATTGG–3′) and HCO2186_Ltromb (5′–GWCCRAARAAYCARAAHARATGTTG–3′), as well as a conventional universal primer, set LCO1490 (5′–GGTCAACAAATCATAAAGATATTGG–3′) and HCO2198 (5′–TAAACTTCAGGGTGACCAAAAAATCA–3′; Folmer et al., 1994). For DNA barcoding, DNA extracted from 213 L. scutellare, 32 L. pallidum, 16 L. fuji, and 14 Walchia masoni (suspected) mites roughly morphologically identified using a stereomicroscope as well as from 16 unidentified mites were used. PCR was performed under the following cycling conditions: initial denaturation at 94 C for 1 min followed by 30 cycles of amplification (denaturation at 94 C for 5 sec, annealing at 55 C for 1 sec, and extension at 68 C for 40 sec) and final extension at 68 C for 1 min. The expected PCR product size is 697 base pairs (bp) with the improved primer set and 709 bp with the conventional primer set. DNA sequencing was performed using the same improved PCR primers as described above. All the obtained sequences were deposited in DDBJ of NIG, Japan.

RESULTS

DNA sequences and phylogenetic analysis of full-length COI genes

We obtained full-length sequences of COI genes (1,533 bp) from L. scutellare (LC681948), L. fuji (LC681944), L. palpale (LC681945), and the 2 L. pallidum mites (LC681946 and LC6819476). Phylogenetic analysis showed that sequences of L. pallidum formed a single clade clustered with L. fuji (Fig. 2), whereas L. scutellare formed a clade with L. akamushi/L. deliense. However, the position of L. palpale was unclear.

PCR detection using the improved primer set for DNA barcoding

We compared the full-length sequences of COI genes and found that the corresponding sequences to the original universal primers, LCO1490 (forward) and HCO2198 (reverse), differed among the strains (Fig. 3). Therefore, we designed degenerate primers, LCO1490_Ltromb (forward) and HCO2186_Ltromb (reverse), to obtain a suitable consensus sequence. HCO2186_Ltromb is located at the position 12 bp shifted from HCO2198 toward the 5′ sides. PCR with the new primer set led to an increase in identification rates of L. scutellare COI (approximately 17% increase), whereas the identification rates of COI of other mites remained almost the same (Table I).

Figure 3. Improvement of the primer set for deoxyribonucleic acid barcoding using mitochondrial cytochrome c oxidase subunit 1 sequences of Leptotrombidium. Original universal primers (forward: LCO1490, reverse: HCO2198) are shaded and improved primers (forward: LCO1490_Ltromb, reverse: HCO2186_Ltromb) are squared. Asterisks indicate fixed sites.

DNA barcoding with the improved primer set

We performed DNA barcoding by sequencing the 215 samples that showed intense bands by PCR. These include 137 L. scutellare, 42 L. pallidum, 8 L. fuji, 3 Leptotrombidium intermedium, 1 L. palpale, and 24 mites belonging to other genera such as Walchia (LC682866 to LC6803080) including the 5 sequences of full-length COI genes determined in this study. Phylogenetic analysis showed that all species of Leptotrombidium were clustered together and separated from similar mite species of other genera (Fig. 4). The genus Leptotrombidium was further divided into 4 clusters, Lpt-1, Lpt-2, Lpt-3, and Lpt-4. It should be noted that the phylogenetic relationship between the 4 clusters is unclear, and Lpt-3 does not represent a well-supported clade, which may be further separated into multiple clades by further sampling. Lpt-1 and Lpt-2 are expanded in Figure 5.

Figure 4. A phylogenetic tree based on deoxyribonucleic acid (DNA) barcoding of Leptotrombidium with the improved primer set. DNA sequences of 219 samples (141 Leptotrombidium scutellare, 37 Leptotrombidium pallidum, 9 Leptotrombidium fuji, 3 Leptotrombidium intermedium, 2 Leptotrombidium palpale, and 27 genus Walchia and other genus mites) were subjected to phylogenetic analysis with other known sequences from the National Center for Biotechnology Information database. The genus Leptotrombidium was separated into 4 smaller clusters.

Figure 5. Phylogenetic relationships of the respective clusters Lpt-1 and Lpt-2 among Leptotrombidium in Japan. Lpt-1 (Leptotrombidium scutellare) consists of 3 subclusters, Lsc-1, Lsc-2, and Lsc-3. For Lpt-2, the cluster of Leptotrombidium pallidum was divided into 2 distinct subclusters, Lpd-1 and Lpd-2. Geographic locations are represented by shading and by the numbers in parentheses. The 4 samples from which full-length sequences of the mitochondrial cytochrome c oxidase subunit 1 gene were determined in this study (L. scutellare, L. pallidum-1, L. pallidum-2, and Leptotrombidium fuji) are marked with stars. Color version available online.

The first cluster, Lpt-1 (L. scutellare), was divided into 3 subclusters, Lsc-1, Lsc-2, and Lsc-3. Included in the subcluster Lsc-1 was an L. scutellare individual for which full-length COI was determined in this study (LC681948, marked by a star in Fig. 5). Lsc-1 consists of samples derived from the 6 regions (Gumma, Saitama, Kanagawa, Ishikawa, Fukui, and Kagoshima) in Japan, whereas Lsc-2 and Lsc-3 are comprised of representatives from the limited areas (Lsc-2 from Kanagawa and Kagoshima; Lsc-3 from Kanagawa and Fukui; Figs. 5, 6). Circular structure in the haplotype network of Lsc-1 shows the presence of homoplasy in the COI sequence, which may imply natural selection acting on COI (Fig. 6). Uneven presence of samples derived from different regions may reflect a limited gene flow due to geographic distance, particularly between Kagoshima and other regions (Fig. 6).

Figure 6. Network analysis of 2 clusters of Leptotrombidium in Japan (Lpt-1 and Lpt-2; Fig. 5) on the basis of mitochondrial cytochrome c oxidase subunit 1 sequences. Haplotypes are represented by circles whose size is proportional to the number of individuals. The numbers represent geographic locations (Fig. 1). Missing haplotypes are represented by small open circles. Color version available online.

The second cluster, Lpt-2, can be separated into 4 small clusters: L. pallidum, L. intermedium, L. fuji, and a cluster that does not contain known species (Fig. 5). The cluster of L. pallidum was further separated into 2 clear subclusters, Lpd-1, and Lpd-2. The subcluster of Lpd-1 includes 2 L. pallidum individuals for which full-length COI were determined in this study (LC681946 and LC6819476, marked by a star in Fig. 5). Lpd-1 and Lpd-2 contained the samples from the same 2 regions (Saitama and Nagano; Figs. 5, 6).

Mean genetic distances between or within L. scutellare and L. pallidum were estimated. The mean genetic distance between L. scutellare and L. pallidum was 0.2147, whereas the mean distances within each species were 0.052 and 0.044. Within L. scutellare, the mean genetic distances between Lsc-1 and Lsc-2, Lsc-1 and Lsc-3, and Lsc-2 and Lsc-3 (the subclusters) were 0.1626, 0.1675, and 0.1732 respectively, whereas the distances within Lsc-1, Lsc-2, and Lsc-3 were 0.017, 0.003, and 0.017 respectively. Within L. pallidum, the mean genetic distance between Lpd-1 and Lpd-2 (the subclusters) was 0.1029, whereas the distances within Lpd-1 and Lpd-2 were 0.010 and 0.013 respectively.

The cluster L. fuji included an L. fuji individual for which full-length COI was determined in this study (LC681944, marked by a star in Fig. 5). The third cluster Lpt-3 consisted of L. deliense, L. akamushi, and miscellaneous species and the fourth cluster Lpt-4 consisted of L. palpale including an L. palpale individual for which full-length COI was determined in this study (LC681945, marked by a star in Fig. 5; Fig. 4).

Comparison between morphological and molecular classification

The molecular classification of the tested mites by DNA barcoding was compared with morphological classification (Table II). In each species, the accuracy of morphological classification is evaluated by the percentage of samples identified by molecular classification/number of samples classified by morphological inspection. The accuracy of morphological classification was 97.8% (133/136) for L. scutellare, 100% (35/35) for L. pallidum, and 66.7% (8/12) for L. fuji. Nine of Walchia masoni were classified into Walchia spp. since further classification was not done in this study. By molecular classification, 3 samples morphologically misclassified as L. scutellare were found to be L. pallidum, L. palpale, and other non-Leptorombidium mites. By molecular classification, 4 samples were morphologically misclassified as L. fuji and identified as L. intermidium and other non-Leptorombidium mites.

Table II Comparison of morphological and genetic classification. Underlined are samples that are consistent in morphological and genetic classification.

	Genetic classification	
L. scutellare	L. pallidum	L. fuji	L. intermidium	L. palpale	W. masoni	Others†	Total‡	
138	36	9	3	2	9	18	215	
Morphological classification*	
 Leptotrombidium scutellare	133	1			1		1	136	
 Leptotrombidium pallidum		35						35	
 Leptotrombidium fuji			8	3			1	12	
 Walchia masoni						9		9	
 Not done	5		1		1		16	23	
* Mites used for deoxyribonucleic acid barcoding were briefly identified by observing only some major morphological features.

† Other mites except for Leptotrombidium spp.

‡ Total numbers of obtained sequences.

DISCUSSION

In this study, we found that COI genes of Leptotrombidium mite were very different from some other similar mites and varied even among the species in Japan (Fig. 4). According to the consensus sequence of the full-length COI genes (Fig. 3), we redesigned the primer set for DNA barcoding of Leptotrombidium, which drastically increased the sensitivity (Table I), especially against L. scutellare, one of the significant mite species in Japan that transmits O. tsutsugamushi, the etiological agent of scrub typhus (Yamashita et al., 1994; Kawamura et al., 1995).

The DNA barcoding performed for 291 mites using the new primer set revealed that they were classified into 5 species of the genus Leptotrombidium: L. scutellare, L. pallidum, L. fuji, L. intermedium, and L. palpale; the genus Walchia; and other genera (Fig. 5). Specifically, the sequences of both L. scutellare and L. pallidum, the notable species carrying O. tsutsugamushi, were further divided into some subclusters (Fig. 5). However, the morphological inspection did not allow further classification beyond individual species level (Table I). Both major subclusters, Lsc-1 of L. scutellare and Lpd-1 of L. pallidum, included the sequences of full-length COI genes of each species determined in this study using the mite sample morphologically classified with detailed features. This suggests that Lsc-1 and Lpd-1 constitute a significant group of each mite species, and the other subclusters Lsc-2, Lsc-3, and Lpd-2 are subgenotypes of each mite species. Detailed morphological classification should be done for the mites classified into subclusters (Lsc-2, Lsc-3, and Lpd-2), even though these mite samples had the same major morphological features. Furthermore, nuclear gene sequences of the mites would be required to confirm the existence of subgenotypes.

Microscopical classification is difficult owing to the minuscule size of the larval mites (approximately 0.2 mm); morphological identification requires considerable skills and taxonomic expertise. The accuracy of morphological classification was high for L. scutellare and L. pallidum, whereas not very high for L. fuji (Table II). Most of the misclassified samples of L. fuji were genetically classified into L. intermedium; however, the cluster of L. intermedium was not well divided from that of L. fuji. These results suggest that L. fuji and L. intermedium should be classified into a single species. These results indicate the advantage of DNA barcoding, which showed a more precise classification of Leptotrombidium even within the species (Figs. 4, 5).

Recent studies from our laboratory showed that certain species of Leptotrombidium were carriers of several novel symbiotic bacteria including Wolbachia spp., Rickettsiella spp., and Rickettsia spp. other than O. tsutsugamushi (Ogawa et al., 2020). Symbiotic bacteria, including O. tsutsugamushi, are transmitted through a mite life cycle by transstadial transmission and to their eggs and progeny by transovarial transmission (Takahashi et al., 1988; Urakami et al., 1994). This suggests that both the host mites and their symbiotic bacteria can coevolve. Only a few percent of mites carry O. tsutsugamushi (Kawamura et al., 1995) in some areas. However, Wolbachia, a nonpathogenic symbiotic genus of bacteria, was distributed in a wide area of Japan. DNA barcoding in this study may make it possible to clarify the relationship between DNA haplotypes of mites and their bacterial symbionts, such as O. tsutsugamushi. The host DNA haplotypes may allow distinction between harmful mites and nonharmful ones to humans.

This study showed that the improved DNA barcoding with the redesigned primers had higher detection sensitivity than universal primers; we also obtained a higher classification accuracy than morphological classification methods. Finally, the DNA barcoding uncovered the broad genetic diversity in Leptotrombidium mites, especially in L. scutellare and L. pallidum, the primary species that carry O. tsutsugamushi.

ACKNOWLEDGMENTS

This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan [grant number: 60K21321, R2-Chousenteki houga kenkyu].
==== Refs
LITERATURE CITED

Ahmed, S. Ibrahim, M. Nantasenamat, C. Nisar, M. F. Malik, A. A. Waheed, R. Ahmed, M. Z. Ojha, S. C. and Alam. M. K. 2022 Pragmatic applications and universality of DNA barcoding for substantial organisms at species level: A review to explore a way forward. BioMed Research International 2022: Article 1846485, 19 p 10.1155/2022/1846485
Beebe, N. W. 2018 DNA barcoding mosquitoes: Advice for potential prospectors Parasitology 145 622 633 29564995
Clement, M. Posada, D. and Crandall. K. A. 2000 TCS: A computer program to estimate gene genealogies Molecular Ecology 9 1657 1659 11050560
Folmer, O. Black, M. Hoeh, W. Lutz, R. and Vrijenhoek. R. 1994 DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates Molecular Marine Biology and Biotechnology 3 294 299 7881515
Hillis, D. M. and Bull. J. J. 1993 An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis Systematic Biology 42 182 192
Kawamura, A. Tanaka, H. and Tamura. A. 1995 Tsutsugamushi Disease University of Tokyo Press Tokyo, Japan 362 p
Leigh, J. W. and Bryant. D. 2015 POPART: Full-feature software for haplotype network construction Methods in Ecology and Evolution 6 1110 1116
Nagano, I. Kasuya, S. Noda, N. and Yamashita. T. 1996 Virulence in mice of Orientia tsutsugamushi isolated from patients in a new endemic area in Japan Microbiology and Immunology 40 743 747 8981347
Ogawa, M. Takahashi, M. Matsutani, M. Takada, N. Noda, S. and Saijo. M. 2020 Obligate intracellular bacteria diversity in unfed Leptotrombidium scutellare larvae highlights novel bacterial endosymbionts of mites Microbiology and Immunology 64 1 9 31549736
Perlman, S. J. Hodson, C. N. Hamilton, P. T. Opit, G. P. and Gowen. B. E. 2015 Maternal transmission, sex ratio distortion, and mitochondria Proceedings of the National Academy of Sciences of the United States of America 112 10162 10168 25870270
Seto, J. Suzuki, Y. Otani, K. Qiu, Y. Nakao, R. Sugimoto, C. and Abiko. C. 2013 Proposed vector candidate: Leptotrombidium palpale for Shimokoshi type Orientia tsutsugamushi Microbiology and Immunology 57 111 117 23253042
Sharma, P. and Kobayashi. T. 2014 Are “universal” DNA primers really universal? Journal of Applied Genetics 55 485 496 24839163
Takada, N. Fujita, H. Yano, Y. Ishiguro, F. Iwasaki, H. and Masuzawa. T. 2001 First records of tick-borne pathogens, Borrelia, and spotted fever group Rickettsiae in Okinawajima Island, Japan Microbiology and Immunology 45 163 165 11293483
Takahashi, M. Misumi, H. Urakami, H. Nakajima, S. Furui, S. Yamamoto, S. Furuya, Y. Misumi, M. and Matsumoto. I. 2004 a Mite vectors (Acari: Trombiculidae) of scrub typhus in a new endemic area in northern Kyoto, Japan Journal of Medical Entomology 41 107 114 14989353
Takahashi, M. Misumi, H. Urakami, H. Saito, T. Misumi, M. Matsumoto, I. and Suzuki. H. 2004 b A new member of the trombiculid mite family Neotrombicula nagayoi (Acari: Trombiculidae) induces human dermatitis Southeast Asian Journal of Tropical Medicine and Public Health 35 113 118 15272753
Takahashi, M. Murata, M. Machida, K. Hori, E. Kawamura A. Jr., and Tanaka. H. 1990 Aggregated distribution of infective spots composed of Leptotrombidium pallidum, highly prevalent with Rickettsia tsutsugamushi, demonstrated by sentinel voles, Microtus montebelli, on the ground Japanese Journal of Experimental Medicine 60 325 335 2128945
Takahashi, M. Murata, M. Nogami, S. Hori, E. Kawamura A. Jr., and Tanaka. H. 1988 Transovarial transmission of Rickettsia tsutsugamushi in Leptotrombidium pallidum successively reared in the laboratory Japanese Journal of Experimental Medicine 58 213 218 3149693
Tamura, A. Ohashi, N. Urakami, H. and Miyamura. S. 1995 Classification of Rickettsia tsutsugamushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov International Journal of Systematic Bacteriology 45 589 591 8590688
Uchikawa, K. Kawamori, F. Kanda, T. and Kumada. N. 1994 Trombiculid fauna and seasonal abundance of Leptotrombidium scutellare (Acari: Trombiculidae) in an endemic area of scrub typhus (Tsutsugamushi disease) in Yamakita Town, Kanagawa Prefecture, Japan Journal of Medical Entomology 31 844 849 7815396
Urakami, H. Takahashi, M. Hori, E. and Tamura. A. 1994 An ultrastructural study of vertical transmission of Rickettsia tsutsugamushi during oogenesis and spermatogenesis in Leptotrombidium pallidum American Journal of Tropical Medicine and Hygiene 50 219 228 8116816
Yamashita, T. Kasuya, S. Noda, N. Nagano, I. and Kang. J. S. 1994 Transmission of Rickettsia tsutsugamushi strains among humans, wild rodents, and trombiculid mites in an area of Japan in which Tsutsugamushi disease is newly endemic Journal of Clinical Microbiology 32 2780 2785 7852572
