
==== Front
Adv Biomed Res
Adv Biomed Res
ABR
Adv Biomed Res
Advanced Biomedical Research
2277-9175
Wolters Kluwer - Medknow India

ABR-13-2
10.4103/abr.abr_149_23
Original Article
CTNS Mutations Causing Autosomal Recessive Cystinosis in a Subset of Iranian Population: Report of Two New Variants
Mohammadi Chermahini Zahra 123
Salehi Mansoor 13
Gheissari Alaleh 4
Ahmadi Beni Faeze 1
Khosravian Farinaz 3
Kazemi Mohammad 12
1 Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2 Reproductive Sciences and Sexual Health Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
3 Cellular, Molecular and Genetics Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
4 Department of Pediatrics, School of Medicine, Kidney Diseases Research Center, Imam Hossein Children’s Hospital, Isfahan University of Medical Sciences, Isfahan, Iran
Address for correspondence: Dr. Mohammad Kazemi, Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran. E-mail: m_kazemi@med.mui.ac.ir
2024
30 1 2024
13 201 5 2023
25 7 2023
29 7 2023
Copyright: © 2024 Advanced Biomedical Research
2024
https://creativecommons.org/licenses/by-nc-sa/4.0/ This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.
Abstract

Background:

Nephropathic cystinosis (NC) is an uncommon autosomal recessive disease with abnormality in lysosomal storage that appearances in patients with mutations in the CTNS gene encoding a lysosomal transporter cystinosin. Disrupted function of this transporter is followed by accumulation of cysteine crystals in cells of many various organs. This study aimed to investigate the mutations of the CTNS gene in 20 Iranian patients suffering from NC.

Materials and Methods:

Twenty Iranian cystinosis patients referring to Imam Hossein Hospital of Isfahan were employed in this case-series study. After extraction of genomic DNA, the promoter and entire coding regions of CTNS were analysed using sanger sequencing in all patients. Gap–Polymerase Chain Reaction was used to detect 57 kb deletion in the CTNS gene. In silico study was performed to analyse variants.

Results:

The large deletion was not seen in any NC patients. Molecular analysis which conducted to screen the CTNS gene of patients, identified eight different mutations, including two new mutations, c.971_972insC and c.956_956delA, which have not been reported before, and c.681G>A mutation, which was identified as a frequently founded mutation in the Middle East and was observed in 35% of patients. In this study, five other mutations including c.1015G>A, c.922G>A, c.323_323delA, c.433C>T, and c.18_21delGACT were also observed, which have been reported in previous studies.

Conclusion:

The mutational spectrum in the Iranian patients is the same as previously reported mutations except that two new mutations were found. The present findings will present suggestions for regular molecular diagnosis of cystinosis in Iran.

Genetic variations
lysosomal storage disease
molecular diagnostic testing
nephropathic cystinosis
==== Body
pmcINTRODUCTION

Cystinosis is an infrequent illness, representing in individuals carrying mutations in both alleles of the CTNS gene which is embedded on the 17p13. The CTNS gene has 12 exons and exons 3-12 encodes cystinosin, a protein that transports the lysosomal-free cystin.[1] Imperfective cystinosin function make the accumulation of intralysosomal cystine crystals in the cells of various organs, especially the kidney, liver, cornea, lymph nodes, thyroid, bone marrow, and spleen.[2]

Considering the severity of disease and the age of imitation of expression of disease, three various clinical types of cystinosis have been reported. Nephropathic cystinosis (NC) is known as the most common and deleterious form of cystinosis that is represented in infancy and contributes in affecting 95% of all patients. Patients represent symptoms including failure to thrive, and symptom related to proximal tubular Fanconi syndrome (glucosuria, proteinuria, acidosis, salt craving, polydipsia, polyuria, electrolyte imbalance, and tetany) at 6-12 months after birth, and if they do not undergo temporary treatments and palliative care, they will suffer renal failure at the end first decade of life. The second type begins at the late phase of adolescence and is known as the intermediate form or nephropathic juvenile cystinosis. The second form typically is seen in adolescence rather than in infancy with more moderate renal symptoms. The third type is an ocular non-nephropathic form appearing with only corneal illness. All three kinds of the illness are generated by alterations in the CTNS gene.[234]

Regular diagnostic methods for cystinosis are assessment of leukocyte cystine, using the slit lamp examination to look for corneal cystine crystals, and molecular screening of the CTNS gene.[5] From 1998 that the gene was uncovered until now, more than 148 various CTNS pathogenic and destructive alterations, instantiate short deletions or insertions, substitutions, aberrant stop codons, and splice site mutations, in the coding or noncoding region and also in the promoter have been reported.[2] A 57 kb deletion has been recorded as the most frequent alteration in northern parts of Europe and c.681 >4A; p.E227E is a frequent alteration that has been recorded in various Middle Eastern areas.[234] Although, the information related to the mutation profile of the CTNS gene in the Middle East, especially in Iran, is restricted.[6] The present investigation aimed to identify the mutations of the CTNS gene in some Iranian patients suffering NC.

MATERIALS AND METHODS

Patients

Twenty Iranian patients, from 18 unrelated families, nine males and 11 females, suffering from infantile NC, were analysed in the present study. All patients had been diagnosed according to clinical signs and symptoms considering lack of adequate growth, presentation of renal Fanconi syndrome-related signs detected by the pediatric nephrology group in the Imam Hossein hospital pediatric center (Isfahan, Iran), and the existence of corneal crystals founded by via slit lamp examination conducted by a practiced ophthalmologist. Genetic counselling was conducted. Afterwards, all the patients signed an informed consent before taking a blood sample. Approvement of assembling of samples and experimental protocols was made by the Isfahan University of Medical Science Ethical Committee (IR.MUI.MED.REC. 1398.669).

Molecular genetic analysis

At first, 1 mL blood sample was acquired from each patient and was kept in Ethylenediaminetetraacetic acid (EDTA) tubes. Extraction of DNA from whole blood carried out by Addprep Genomic DNA extraction kit (Addbio, Korea). Exon-specific primers were provided using Primer3 Plus software (http://www.primer3plus.com) and the promoter region of the CTNS gene and 57-kb deletion were amplified with previously reported primer pairs.[78] The sequences of primers are represented in Table 1.

Table 1 The employed primers sequence

Primer name	Sequence (5’ → 3’)	Amplicon size (bp)	
del57–kb	F: CCTGGCTGCTCTCCTCTTCTTGCCGTTC	387	
R: TCCCTGTGGCTTTCCGTCCTGTTTCCTC		
Promotor	F: CATGGAGGCTTCTCGTCTTC	405	
R: CGGCTAGACTTTGGGAGAGG		
Cys-Exon3	F: TTGTCTACAGGGAGCTGAGC	202	
R: TCCTCTAGCCACCATTTCCC		
Cys-Exon4	F: TTTGCAGTCCCATCACAGAA	316	
R: GCGCATCTGAAATCTGAACA		
Cys-Exon5	F: TGGAGCACCTAGCATTTCCT	362	
R: CATCCCCAAAAGACACCAAC		
Cys-Exon6-7	F: CAGCGTCTCTCCTTTTGCTT	633	
R: TTCTGGAAAGGGTAGGCAGA		
Cys-Exon8-9	F: CCCTGCCCTGTCTTGTCC	426	
R: GCTCTGCCGTGTCTTCTGTC		
Cys-Exon10	F: AGGTGTGATGCTTTCTGTGG	478	
R: TTTCCGTCCTGTTTCCTCAC		
Cys-Exon11	F: CATGCAGATGAGACGCCTAC	500	
R: CCCAGAAAACCACAAAGCCT		
Cys-Exon12	F: TTCGTAGCTGGAGGCTTTGT	490	
R: AAAGAGATGGCGGTGTCAAG		

Polymerase Chain Reaction (PCR) was performed in a final volume of 25 μL containing 12.5 μL Addstar Taq master mix (2x) (Addbio, Korea), 500 pmol of each primer, and 100 ng of genomic DNA. The PCR program consisted of an initial denaturation at 95°C for 5 min; 30 cycles at 95°C for 20 s, annealing (60-67°C) for 30 s, and 72°C for 45 s; and a final elongation step at 72°C for 5 min. Sanger sequencing of PCR products was performed by ABI 3130XL capillary sequencer (Applied Biosystems, USA).

Validation of mutations

The founded mutations were checked in the 1,000 genomes database, NCBI dbSNP database, and the HapMap database to determine their frequencies and pathogenesis status. Also, the Human Gene Mutation Database (http://www.hgmd.org/) and the PubMed database (http://www.ncbi.nlm.nih.gov/pubmed/) were searched to check novelty of detected mutations. Furthermore, the functions of protein carrying the novel alterations were predicted using Mutation Taster, PolyPhen-2, SIFT, and Mutation Assessor.

RESULTS

Twenty patients (nine males and 11 females) from 18 families with infantile NC were evaluated. Assessed patients were aged 3 to 19 years. Indeed, 12 families had consanguineous marriage, and in two families, there were two affected cases. The age of onset of symptoms was 5 months to 2 years. The earliest appeared symptoms in all patients were severe failure to thrive, polyuria, and polydipsia [Table 2]. All patients were screened for the 57-kb deletion but 57 Kb deletion was observed in no cases in either homozygote or heterozygote state. Sequencing of the promoter region and 10 coding exons of CTNS discovered the existence of different nucleotide variations. Eight different variants were identified in the 16 patients [Figure 1a]. Six mutations have been reported in previous studies (c.1015G>A, c.922G>A, c.681G>A, c.323_323delA, c.433C>T, and c.18_21delGACT). Two new mutations were identified in three unrelated families, including one homozygous deletion in exon 11 (c.956_956delA) in two families, leading to a truncation of protein (Q319Rfs*10), and one insertion in exon 12 (c.971_972insC) in one family, leading to truncated protein (Q325Pfs*40) [Figures 2 and 1b]. No mutation was identified in the other cases.

Table 2 Clinical manifestations founded in patients suffering cystinosis

Patient/sex	Age in years	Consanguinity	Age of onset of symptoms	Fanconi syndrome	Corneal crystals	Renal transplantation	
P1/M	15	First cousin	8 months	+	+	+	
P2/M	6	Unrelated	6 months	+	+	−	
P3/F	19	Unrelated	9 months	−	+	+	
P4/M	14	First cousin	4 months	+	+	+	
P5/M	9	Unrelated	8 months	+	+	−	
P6/M	10	Second cousin	6 months	+	+	−	
P7/F	4	Second cousin	8 months	+	+	−	
P8/M	3	First cousin	8 months	+	−	−	
P9/M	12	First cousin	4 years	−	−	−	
P10/F	2	First cousin	6 months	+	+	−	
P11/F	5	First cousin	6 months	+	+	−	
P12/F	16	First cousin	2 months	+	+	+	
P13/M	12	First cousin	7 months	+	+	−	
P14/M	9	First cousin	2 years	+	+	−	
P15/F	13	First cousin	5 months	+	+	+	
P16/F	7	First cousin	16 months	+	+	−	
P17/F	8	First cousin	6 months	+	+	−	
P18/F	5	First cousin	12 months	+	+	−	
P19/M	13	First cousin	6 months	+	+	+	
P20/F	8	First cousin	6 months	+	+	−	

Figure 1 Localization of identified mutations in the study. (a) Four detected mutations are related to exons 3, 6, 7, and 9; while two mutations are occurred in exon 11, and two of them are in exon 12 (b) CTNS is a seven-passed transmembrane receptor and we have detected two new mutations affecting residues 319 and 325 in the protein

Figure 2 Data of two new mutations. (a) NCBI blast (b) Chromatogram (Chromas software version 2.6.6) for the region containing two novel mutations. The substituted nucleotides are shown by red arrow shows. (a) illustrates a single base pair deletion in nucleic acid position 956 (c.956_956delA) in exon 11, resulting in formation of truncated protein (Q319Rfs*10) which was detected in two patients in homozygous condition. (b) shows an insertion in exon 12 (c.971_972insC) in one family, leading to truncated protein (Q325Pfs*40). (c) Family pedigree of patients

DISCUSSION

An incidence of 1 in 100,000 and 1 in 200,000 is estimated for CTNS in the general population, nevertheless, it is expected that the diseases frequency be higher in the areas which have a higher rate of consanguinity, instantiate the Middle East, Turkey,[9] and Iran.[1] The CTNS gene is embedded on chromosome 17p13.3 and contains 12 exons, and the first two exons are noncoding. Cystinosin is an integral lysosomal cystine transporter having seven membrane domains [Figure 1b] and dysfunction of it makes cystine accumulate in all organs and results in cystinosis disease. However, cystinosin has other roles, such as modulation and regulation of mTOR signaling pathway, autophagy, mTOR signaling pathway, lysosomal formation, and vesicle transferring in proximal tubular epithelial cells.[10] Considering the issue that cystinosis is the main cause of renal Fanconi syndrome, its diagnosis is basically using the known criteria are employed to recognize renal Fanconi syndrome, inclusive of growth retardation, dehydration, polydipsia, polyuria, rickets, glucosuria, and electrolyte imbalance.[11] Measuring increased cystine content in the white blood cell is the gold standard for the diagnosis. The validation of the diagnosis made by the presence of corneal cystine crystals and especially molecular analysis of the cystinosin gene. Importantly, diagnosis must be performed as soon as possible not to loss time for initiation of treatment. Until now, the only treatment is the use of oral cysteamine.[5]

This study investigated 20 patients from 18 unrelated families in Iran. At first, we searched for the 57 kb deletion, the most frequently detected pathogenic alteration in North America and Northern Europe and which affects the promoter region and the initiator 10 exons of the CTNS gene, in addition to two upstream genes (TRPV1 and CARKL),[12] and have been reported in 65% of patients of northern European descent.[1314] According to previous reports, this mutation has not been detected in the Middle East, Asia, and Africa,[15] while this mutation was identified in a patient in a recent study in Iran.[2] Hence, initially, we examined patients for this large deletion. None of the investigated patients had the mentioned deletion. Then, screening the coding regions and also exon–intron boundaries of the CTNS gene and its promoter revealed eight different mutations, two of which had not been previously identified. The first undiscovered previously mutation founded in this study is the deletion (c.956_956delA; Q319Rfs*10) in exon 11 that was detected in two unrelated families (P2 and P6) [Figure 1a]. The second novel mutation is the insertion (c.971_972insC; Q325Pfs*40) that was detected in patient 15. Both of them make a truncated protein in homozygous states.

However, the previously discovered splice site mutation, c.681G>A, that has been identified in 35% of all patients in our investigation, is a frequent alteration in the Middle East and also the most founded mutation in Iran based on this study and other studies of cystinosis in Iran.[1616] All the patients carried the same homozygous mutation. This mutation is frequently reported in other Middle Eastern countries, such as Saudi Arabia,[16] Iran,[6] Egypt,[12] and Turkey.[9] It can be considered a “founder mutation” in the Middle East, especially since it has a higher frequency in Iran. Therefore, checking exon 9 should be given priority when trying to identify the responsible mutation in affected patients.

Other previously identified mutations were also found in this study, including the c.1015 G4A; G339R[17] in TM7 (exon 12) in patient 10 in both the alleles. The nonsense mutation, c.433C4T, Q145X in exon 7 resulting in generation of an incomplete protein was identified in Russia.[18] This mutation was identified in a homozygous condition in patient 19. One patient represented heterozygous mutation of c.18-21delGACT[19] due to the heredity of this disease; this patient requires further investigation. This mutation results in a T7F substitution and truncation at amino acid 13 which most likely is found in the European population.[20] Two patients had single base pair deletion (c.323delA) in exon 6, in both alleles, followed by generation of short protein (p.Q108RfsX10).[21] Shotelersuk et al. have found a missense mutation (922G>A) in a number of patients, which replaces an arginine for the severely conserved glycine residue and leads to disruption of TM6.[17] A summary of all identified mutations during this or previous studies is depicted in Table 3.

Table 3 The identified mutations in Cystinosis patients

Patient ID	Mutation	Position	AA change	Protein effect	Reference	
P1	c.922G>A	Exon 11	G308R	Protein features	[18]	
P2	c.956_956delA	Exon 11	Q319Rfs*10	Truncated protein	This study	
P3	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P4	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P5	c.18_21delGACT	Exon 3	T7Ffs*7	Frameshift at 7→Stop 6 amino acids downstream	[20]	
P6	c.956_956delA	Exon 11	Q319Rfs*10	Truncated protein	This study	
P7	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P8	ND	________	___________	___________	________	
P9	ND	________	___________	___________	________	
P10	c.1015G>A	Exon 12	G339R	AA change at TM7	[18]	
P11	ND	________	___________	___________	________	
P12	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P13	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P14	c.323_323delA	Exon 6	Q108Rfs*10	Premature truncation of the protein	[21]	
P15	c.971_972insC	Exon 12	Q325Pfs*40	Truncated protein	This study	
P16	c.323_323delA	Exon 6	Q108Rfs*10	Premature truncation of the protein	[21]	
P17	ND	________	___________	___________	________	
P18	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	
P19	c.433C>T	Exon 7	Q145*	Truncated protein	[19]	
P20	c.681G>A	Exon 9	E227E	Alternative splicing	[16]	

CONCLUSION

However, our new findings make progress to know more about the mutations of the CTNS gene in patients suffering NC and could be beneficial for the prenatal or preimplantation genetic diagnosis. In Iran, there is a relatively higher frequency of consanguineous marriages, which can lead to an increased risk of rare autosomal recessive disorders such as cystinosis in offspring. Therefore, to prevent or reduce the rate of these genetic conditions, genetic counselling before marriage and prenatal diagnosis in carriers and high-risk families are highly recommended. To rapidly identify heterozygous carriers, and other patients with similar disease symptoms and genetic diagnosis, primary searching for c.681G>A in high-risk Iranian persons may be useful. However, patients investigated in the present study were collected from patients referring the Imam Hossein hospital pediatric center of Isfahan; hence, further studies needed to screen CTNS gene in a larger population of patients from all over the Iran. Additionally, performing functional experiment of novel mutations is our next step study.

Financial support and sponsorship

This study was supported by the research fund of Isfahan University of Medical Sciences. Compliance with ethical standards.

Conflicts of interest

There are no conflicts of interest.
==== Refs
REFERENCES

1 Sadeghipour F Basiratnia M Derakhshan A Fardaei M Mutation analysis of the CTNS gene in Iranian patients with infantile nephropathic cystinosis:Identification of two novel mutations Hum Genome Var 2017 4 17038 28983406
2 Najafi M Tamandani DMK Azarfar A Bakey Z Behjati F Antony D A 57 kB genomic deletion causing CTNS loss of function contributes to the CTNS mutational spectrum in the middle east Front Pediatr 2019 7 89 30949462
3 Topaloglu R Vilboux T Coskun T Ozaltin F Tinloy B Gunay-Aygun M Genetic basis of cystinosis in Turkish patients:A single-center experience Pediatr Nephrol 2012 27 115 21 21786142
4 Gholami Yarahmadi S Sarlaki F Morovvati S Cystinosis and two rare mutations in CTNS gene:Two case reports J Med Case Rep 2022 16 181 35513889
5 Wilmer MJ Schoeber JP van den Heuvel LP Levtchenko EN Cystinosis:Practical tools for diagnosis and treatment Pediatr Nephrol 2011 26 205 15 20734088
6 Shahkarami S Galehdari H Ahmadzadeh A Babaahmadi M Pedram M The first molecular genetics analysis of individuals suffering from nephropatic cystinosis in the Southwestern Iran Nefrologia 2013 33 308 15 23640116
7 Mason S Pepe G Dall'Amico R Tartaglia S Casciani S Greco M Mutational spectrum of the CTNS gene in Italy Eur J Hum Genet 2003 11 503 8 12825071
8 Chkioua L Khedhiri S Grissa O Aloui C Turkia HB Ferchichi S Genetic basis of cystinosis in Tunisian patients:Identification of novel mutation in CTNS gene Meta Gene 2015 5 144 9 26266097
9 Topaloglu R Gulhan B İnözü M Canpolat N Yilmaz A Noyan A The Clinical and mutational spectrum of Turkish patients with cystinosis Clin J Am Soc Nephrol 2017 12 1634 41 28793998
10 Topaloglu R Nephropathic cystinosis:An update on genetic conditioning Pediatr Nephrol 2021 36 1347 52 32564281
11 David D Princiero Berlingerio S Elmonem MA Oliveira Arcolino F Soliman N van den Heuvel B Molecular basis of cystinosis:Geographic distribution, functional consequences of mutations in the CTNS gene, and potential for repair Nephron 2019 141 133 46 30554218
12 Soliman NA Elmonem MA van den Heuvel L Abdel Hamid RH Gamal M Bongaers I Mutational spectrum of the CTNS gene in Egyptian patients with nephropathic cystinosis JIMD Rep 2014 14 87 97 24464559
13 Anikster Y Lucero C Touchman JW Huizing M McDowell G Shotelersuk V Identification and detection of the common 65-kb deletion breakpoint in the nephropathic cystinosis gene (CTNS) Mol Genet Metab 1999 66 111 6 10068513
14 Cherqui S Courtoy PJ The renal Fanconi syndrome in cystinosis:Pathogenic insights and therapeutic perspectives Nat Rev Nephrol 2017 13 115 31 27990015
15 Elmonem MA Veys KR Soliman NA van Dyck M van den Heuvel LP Levtchenko E Cystinosis:A review Orphanet J Rare Dis 2016 11 47 27102039
16 Aldahmesh MA Humeidan A Almojalli HA Khan AO Rajab M AL-Abbad AA Characterization of CTNS mutations in Arab patients with cystinosis Ophthalmic Genet 2009 30 185 9 19852576
17 Shotelersuk V Larson D Anikster Y McDowell G Lemons R Bernardini I CTNS mutations in an American-based population of cystinosis patients Am J Hum Genet 1998 63 1352 62 9792862
18 Savostyanov KV Pushkov AA Shchagina OA Maltseva VV Suleymanov EA Zhanin IS Genetic landscape of nephropathic cystinosis in Russian children Front Genet 2022 13 863157 35571017
19 Town M Jean G Cherqui S Attard M Forestier L Whitmore SA A novel gene encoding an integral membrane protein is mutated in nephropathic cystinosis Nat Genet 1998 18 319 24 9537412
20 Kiehntopf M Schickel J Gönne Bv Koch HG Superti-Furga A Steinmann B Analysis of the CTNS gene in patients of German and Swiss origin with nephropathic cystinosis Hum Mutat 2002 20 237 12204010
21 Ghazi F Hosseini R Akouchekian M Teimourian S Ataei Kachoei Z Otukesh H CTNS molecular genetics profile in a Persian nephropathic cystinosis population Nefrologia 2017 37 301 10 28238446
