
==== Front
Nucleic Acids ResNucleic Acids ResearchNucleic Acids Research0305-10481362-4962Oxford University Press 10.1093/nar/gkl53116920740RNAAntisense-induced ribosomal frameshifting Henderson Clark M. Anderson Christine B. Howard Michael T. *Department of Human Genetics, University of Utah15 N 2030 E, Room 7410, Salt Lake City, UT 84112-5330, USA*To whom correspondence should be addressed. Tel: +1 801 585 1927; Fax: +1 801 585 3910; Email: mhoward@genetics.utah.edu9 2006 9 2006 18 8 2006 34 15 4302 4310 09 2 2006 07 6 2006 07 7 2006 © 2006 The Author(s)2006This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License () which permits unrestricted non-commerical use, distribution, and reproduction in any medium, provided the original work is properly cited.

Programmed ribosomal frameshifting provides a mechanism to decode information located in two overlapping reading frames by diverting a proportion of translating ribosomes into a second open reading frame (ORF). The result is the production of two proteins: the product of standard translation from ORF1 and an ORF1–ORF2 fusion protein. Such programmed frameshifting is commonly utilized as a gene expression mechanism in viruses that infect eukaryotic cells and in a subset of cellular genes. RNA secondary structures, consisting of pseudoknots or stem–loops, located downstream of the shift site often act as cis-stimulators of frameshifting. Here, we demonstrate for the first time that antisense oligonucleotides can functionally mimic these RNA structures to induce +1 ribosomal frameshifting when annealed downstream of the frameshift site, UCC UGA. Antisense-induced shifting of the ribosome into the +1 reading frame is highly efficient in both rabbit reticulocyte lysate translation reactions and in cultured mammalian cells. The efficiency of antisense-induced frameshifting at this site is responsive to the sequence context 5′ of the shift site and to polyamine levels.
==== Body
INTRODUCTION
The standard triplet readout of the genetic code can be reprogrammed by signals in the mRNA to induce ribosomal frameshifting [reviewed in (1–3)]. Generally, the resulting trans-frame protein product is functional and may in some cases be expressed in equal amounts to the product of standard translation. This elaboration of the genetic code (4,5) demonstrates versatility in decoding.

Requirements for eukaryotic ribosomal frameshifting include a shift-prone sequence at the decoding site and often a downstream secondary structure in mRNA. The majority of −1 programmed frameshift sites consist of a heptanucleotide sequence X XXY YYZ [where X can be A, G, C or U; Y can be A or U; and Z can be any nucleotide (6)]. In this configuration, the P- and A-site tRNAs can re-pair with at least 2 out of 3 nt when shifted 1 nt towards the 5′ end of the mRNA. Similarly, for +1 frameshift sites, the identity of the codons in the P- and A-sites of the ribosome is critical for efficient frameshifting. One factor affecting +1 frameshift efficiency is the initial stability of the P-site tRNA–mRNA interaction in the 0 frame (7). High-efficiency frameshifting occurs when the P-site tRNA does not form standard codon–anticodon interactions (8). In some studies, a correlation between +1 frameshift efficiency and the final stability of the P-site tRNA–mRNA interaction in the +1 frame has been shown previously (9,10). However, in other systems there appears to be little correlation (11). In addition, competition between decoding of the 0 frame and +1 frame codons in the A-site may affect frameshifting efficiency (7). Slow to decode 0 frame codons such as stop codons or those decoded by low abundance tRNAs favor frameshifting, as do +1 frame codons with high levels of corresponding cognate tRNAs (12–16).

High levels of frameshifting are often achieved by the stimulatory action of a cis-acting element located downstream of the shift site. A wide variety of structures, most commonly H-type pseudoknots (17), have been identified which stimulate −1 frameshifting in eukaryotes [for reviews see (18,19)]. Mutagenic and structural data for several of the frameshift stimulators have demonstrated that each pseudoknot has key structural features required for frameshift stimulation (20–28). However, unifying structural feature essential for frameshifting has not yet been identified. This observation combined with recent reports that simple antisense oligonucleotides can functionally mimic cis-acting 3′ stimulators of −1 frameshifting (29,30) demonstrates that many different structures can stimulate frameshifting. Although it should be noted that not all structures of equal thermodynamic stability can stimulate frameshifting (Discussion).

RNA pseudoknots have also been shown to stimulate programmed +1 frameshifting in many eukaryotic antizyme genes (31,32). Antizyme is a negative regulator of cellular polyamine levels through its ability to target ornithine decarboxylase (the rate-limiting enzyme in polyamine biosynthesis) for degradation (33–35), inhibits polyamine import (36,37) and stimulates export (38). Antizyme expression is induced by high-intracellular polyamine levels, and decreased with lowered levels. The polyamine sensor is a programmed +1 frameshift event that is required for antizyme synthesis. At low polyamine levels, termination at the end of open reading frame 1 (ORF1) is efficient, whereas at high levels of polyamines, a substantial proportion of ribosomes shift to the +1 reading frame and then resume standard decoding to synthesize the full-length and active antizyme protein. Frameshifting at the mammalian antizyme mRNA shift site, UCC UGA, is stimulated by two cis-acting signals (39,40). One of these, the 5′ element, encompasses ∼50 bases upstream of shift site and is important for the polyamine effect (39–41). The other cis-acting element is a pseudoknot located 3′ of the shift site. The mammalian antizyme pseudoknot and a structurally distinct counterpart in a subset of invertebrate antizyme mRNAs (31) are the only pseudoknots known to act as stimulators for +1 frameshifting in eukaryotes.

Although it is unknown if pseudoknots stimulate −1 frameshifting and +1 frameshifting by different mechanisms, one notable difference is found in positioning of the downstream structure relative to the shift site. Naturally occurring pseudoknots or stem–loop stimulators of −1 frameshifting typically begin ∼6–9 nt downstream of the A-site codon of the shift site (18), whereas +1 frameshift pseudoknots are located closer with only a 2–3 nt separation from the A-site codon (31). Mutagenic studies have revealed that altering the size of the spacer affects frameshifting and, in general, reduces efficiency (27,31,42–44).

Here we have tested the ability of antisense oligonucleotides, annealed downstream of the shift-prone site, UCC UGA, to induce shifting of the ribosome to the +1 reading frame. The directionality of frameshifting (either into the +1 or −1 reading frame) is shown to be dependent upon the position of the duplex region relative to the shift site, and the efficiency of frameshifting is responsive to polyamine levels and enhanced by the inclusion of stimulatory sequences found upstream of the human antizyme +1 programmed frameshift site.

MATERIALS AND METHODS
Frameshift reporter constructs and 2′-O-Methyl oligonucleotides
Complementary oligonucleotides, to construct the sequences described in this paper, were synthesized at the University of Utah DNA/Peptide Core Facility such that when annealed they would have appropriate ends to ligate into the SalI/BamHI sites of the dual luciferase vector, p2luc (45). Dual luciferase constructs were prepared and their sequence was verified as described previously (46).

Insert sequences with shift site in boldface is given as follows:

P2lucAZ1wt: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGATGCCCCTCACCCACCCCTGAAGA TCCCAGGTGGGCGAGGGAATAGTCAGAGGGATCACAACGGATC;

P2lucAZ10sp: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGACCCTCACCCACCCCTGAA GATCCCAGGTGGGCGAGGGAATAGTCAGAGGGATCACAACGGATC;

P2lucAZ1hp: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGATGCCCCTCACCCACCCCTGAAGA TCCCAGGTGGGCGAGGGAATGGATC;

P2lucAZ1PKdel: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGATGCCCCTGGATC;

P2lucAZ1PKm1: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGATGCCCCTCACCCACCGGGATCACA AGGATC;

P2lucAZ1sl: TCGACGGTCTCCCTCCACTGCTGTAGTAACCCGGGTCCGGGGCCTCGGTGGTGCTCCTGATGCCCCTCACCCACCCGGATC;

P2lucAZ1FS: TCGACGTGCTCCTGATGCCCCTGGATC;

P2lucAZ1FSUGG: TCGACGTGCTCCTGGTGCCCCTGGATC.

2′-O-Methyl antisense oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA).

AZ1A: AGUUGAAGGAUCCAGGGGCA; AZ1B: GGAAGUUGAAGGAUCCAGGG; AZ1C: CAGGGAAGUUGAAGGAUCCA; PKm1: GAUCCCGGUGGGUGAGGG; PKm2: GAUCCCAGGUGGGCGAGGG; SL1: GGUGGGUGAGGG; and SL2: GGAUCCGGGUGGGUGAGGG.

In vitro transcription and translation
The dual luciferase constructs (0.1 μg) described above were added directly to TNT coupled reticulocyte lysate reactions (Promega) with 35S-labeled methionine in a volume of 10 μl. Reactions were incubated at 30°C for 1 h. Radiolabeled proteins were separated by SDS–PAGE and the gels were fixed with 7.5% acetic acid and methanol for 20 min. After drying under vacuum, the gels were visualized using a Storm 860 PhosphorImager (Molecular Dynamics) and radioactive bands quantified using ImageQuant software. Percent frameshifting was calculated as the percentage of full-length (frameshift) product relative to the termination product and the full-length product combined. The value of each product was corrected for the number of methionine codons present in the coding sequence. The reported values are the average and standard deviations obtained from at least three independent measurements. Tables showing percent frameshifting and standard deviations can be found in Supplementary Data.

Analysis of antisense-induced frameshifting in mammalian cultured cells
Plasmid p2lucAZ1PKdel was co-transfected into CV-1 cells with varying concentrations of AZ1B 2′-O-Methyl antisense oligonucleotides under the following conditions. CV-1 cells (1.5 × 104) in 50 μl of DMEM + 5% fetal bovine serum were added to wells (1/2 area 96-well tissue culture treated plates) containing 25 ng of DNA, varying amounts of AZ1B antisense oligonucleotides and 0.4 μl Lipofectamine 2000 (Invitrogen) in 25 μl of Optimem. Cells were incubated at 37°C (5% CO2) for 20 h. Media were then removed from the cells and the transfected cells were lysed in 12.5 μl lysis buffer and luciferase activity determined by measuring light emission following injection of 25 μl of luminescence reagent (Promega). Percent frameshifting was calculated by comparing firefly/Renilla luciferase ratios of experimental constructs with those of control constructs: (firefly experimental RLUs/Renilla experimental RLUs)/(firefly control RLUs/Renilla control RLUs) × 100.

RESULTS
The ability of cis-acting RNA structures or trans-acting 2′-O-Methyl antisense oligonucleotides to induce ribosomal frameshifting was determined by in vitro transcription and translation of a dual luciferase reporter vector, p2Luc. p2Luc contains the Renilla and firefly luciferase genes on either side of a multiple cloning site, and can be transcribed using the T7 promoter located upstream of the Renilla luciferase gene (45). Sequences containing shift-prone sites were cloned between the two reporter genes such that the downstream firefly luciferase gene is in the +1 reading frame. The resulting constructs were then transcribed and translated in vitro with or without complementary 2′-O-Methyl oligonucleotides, using rabbit reticulocyte lysate in the presence of 35S-labeled methionine, and the products analyzed by electrophoresis on SDS–polyacrylamide gels as described in Materials and Methods.

cis-Acting stimulators of frameshifting at the antizyme shift site
Initially, three dual luciferase reporter vectors were generated containing the human antizyme 1 frameshift cassette (p2luc-AZ1wt) with the 5′ and 3′ stimulators of frameshifting, with the pseudoknot deleted (p2luc-AZ1PKdel), or replaced with a stem–loop (p2luc-AZ1hp) (Figure 1). Each constructs was then subjected to coupled transcription and translation reactions in the presence of increasing amounts of spermidine, and the 35S-labeled products separated by SDS–PAGE. Frameshifting efficiency was measured by comparing the amount of full-length frameshift product (+1 FS) to the product of termination (Term) at the shift site stop codon (Figure 2 and Supplementary Table 1). Maximum levels of frameshifting (AZ1wt 5.6%, AZ1PKdel 2.1% and AZ1hp 1.5%) were observed in the presence of 0.4 mM spermidine. Low-level frameshifting, 0.1% or less, was observed in the absence of exogenous spermidine.

Trans-acting stimulators of frameshifting at the antizyme shift site
2′-O-Methyl antisense oligonucleotides were designed to anneal downstream of the UCC UGA shift site of RNA produced from p2luc-AZ1PKdel (AZ1PKdel) such that the 3′ ends were located 0 (AZ1A), 3 (AZ1B) or 6 (AZ1C) nt downstream of the UGA codon of the shift site (Figure 1B). Frameshift efficiency was measured following transcription/translation reactions of p2luc-AZ1PKdel in the presence of 2 μM of each antisense oligonucleotide and increasing amounts of spermidine (Figure 3A–C and Supplementary Table 2). Maximal levels of frameshifting were found to occur when 2–4 μM of antisense oligonucleotide was added to the transcription/translation reactions (Supplementary Table 3). In the presence of 0.4 mM exogenous spermidine, highly efficient shifting of ribosomes into the +1 reading frame (higher than that observed in the wild-type antizyme frameshift cassette) was observed with the addition of AZ1A (26.1%), AZ1B (51.8%) and AZ1C (31.8%) (Supplementary Table 2). The most efficient frameshifting is observed with the antisense oligonucleotide AZ1B which anneals such that spacing between the shift site and the beginning of the duplex region is the same as that observed between the shift site and the beginning of stem 1 of the natural antizyme 3′ pseudoknot structure (i.e. each has a 3 nt spacer). To verify that the antisense oligonucleotide was activating ribosomal frameshifting and not transcription slippage, RNA was transcribed from p2luc-AZ1PKdel in the absence of oligonucleotide and added to reticulocyte lysate translations in the presence of increasing amounts of 2′-O-Methyl AZ1B oligonucleotide. Frameshifting levels were increased to the same level as that observed in coupled transcription and translation reactions demonstrating that the oligonucleotide acts to induce frameshifting during translation (Supplementary Figure).

Surprisingly, the addition of AZ1A (0 spacer) also induced high-level frameshifting into the −1 reading frame in a manner which was modestly inhibited by the addition of spermidine (19% in the absence and 10% in the presence of 0.4 mM exogenous spermidine) (Figure 3A and Supplementary Table 2). No −1 frameshift product was observed when the wild-type antizyme cassette was examined in the absence of antisense oligonucleotide addition (Figure 2; AZwt). As the AZ1A antisense oligonucleotide was designed to anneal directly adjacent to the UGA codon of the shift site, it was of interest to determine whether the wild-type antizyme pseudoknot could induce −1 frameshifting when located in the equivalent position. To address this, a new construct p2luc-AZ1-0sp (Figure 1A) was made by deleting the 3 nt spacer between the pseudoknot and the shift site of p2luc-AZ1wt. In this case, the wild-type pseudoknot is directly 3′ adjacent to the shift site. The products of in vitro transcription and translation were separated by SDS–PAGE. No −1 frameshift product was observed and levels of the +1 frameshift product were significantly reduced to ∼3% (Figure 3D and Supplementary Table 2).

AZ1A, AZ1B and AZ1C were designed to complement RNA sequences encoded by the originating vector. To determine if duplexes formed between the antisense oligonucleotide and 3′ adjacent antizyme sequences would result in more efficient frameshift stimulation, reporter vectors were designed to contain a portion of the antizyme 3′ stimulator. Construct p2luc-AZ1PKm1 contains sequences from the 5′ half of the axis formed by the stacking of stem 1 and stem 2 of the pseudoknot (Figure 1A). Two complementary 2′-O-Methyl antisense oligonucleotides were designed. First, PKm1 has perfect complimentarity to the region starting 3 nt and ending 21 nt downstream of the UGA shift site codon. Second, PKm2 is the same except that a mispaired C and bulged A were located at positions 9 and 16, respectively. These two alterations were included to more closely mimic the natural pseudoknot which also contains a mispaired C and bulged A at equivalent positions along the extended stem formed by the stacking of pseudoknot stems 1 and 2 (Figure 1; compare p2luc-AZ1wt with the duplex formed between p2luc-PKm1 and antisense oligonucleotide PKm2). PKm1 and PKm2 induced 30 and 22% frameshifting, respectively, when added to coupled transcription and translation reactions of p2luc-AZ1PKm1 in the presence spermidine (Figure 4A and B, and Supplementary Table 4). Neither PKm1 nor Pkm2 induced frameshifting to the same levels seen with AZ1B, suggesting that the sequence content of the duplex region can affect the efficiency of frameshift stimulation and that native antizyme sequences are not required.

A second construct, p2luc-AZ1sl, was designed to contain only the 5′ half of stem 1 of the antizyme pseudoknot downstream from the UCC UGA shift site (Figure 1A). 2′-O-Methyl antisense oligonucleotides were designed to anneal between 3 and 15 nt (SL1) or 3 and 22 nt (SL2) downstream from the UGA codon of the shift site. Frameshift efficiency induced by these two antisense oligonucleotides, 8 and 22% respectively, was somewhat lower than that observed with PKm1 and PKm2 (Figure 4C and D and Supplementary Table 4). In these cases frameshift efficiency was higher for the longer antisense oligonucleotide (SL2), suggesting that frameshift efficiency most probably correlates with stability of the duplex. As was seen with AZ1A, AZ1B and AZ1C, frameshifting efficiency stimulated by antisense oligonucleotides PKm1, PKm2, SL1 and SL2 was also strongly correlated with the concentration of exogenously added spermidine (Supplementary Table 5).

Trans-acting stimulators of frameshifting at a simple sequence, UCC UGA
The importance of the antizyme 5′ sequence context to antisense oligonucleotide induced ribosome frameshifting was examined by testing the frameshift site, UCC UGA, without the 5′ and 3′ stimulatory antizyme sequences. To this end, the 5′ antizyme stimulatory sequences were deleted from p2luc-AZ1PKdel to make p2luc-AZ1FS. Each of the antisense oligonucleotides AZ1A, AZ1B or AZ1C was added to coupled transcription and translation reactions with p2luc-AZ1FS in the presence or absence of spermidine. Frameshift efficiency was measured at 11, 8 and 4%, in the presence of spermidine and 3, 0.4 and 0.2% in its absence for AZ1A, AZ1B and AZ1C, respectively (Figure 5A and B).

To determine whether the stop codon of the shift site is essential for frameshifting, the UGA codon of p2luc-AZ1FS was altered to UGG such that the shift site was UCC UGG (p2luc-AZ1-UGG). Frameshift efficiency was significant, but reduced, compared to the shift site UCC UGA, and shows little stimulation by the addition of spermidine; AZ1A, AZ1B and AZ1C induced 3, 1 and 1.4% frameshifting in the presence of spermidine, and 1.9, 0.8 and 1.7% frameshifting in its absence, respectively (Figure 5C and D).

Trans-acting stimulators of frameshifting in cultured mammalian cells
The ability of antisense oligonucleotides to induce frameshifting in cultured mammalian cells was examined by co-transfection of CV-1 cells with p2lucAZ1PKdel and increasing amounts of 2′-O-Methyl antisense oligonucleotides AZ1B as described in Materials and Methods. In the absence of antisense oligonucleotide frameshifting levels were determined to be 1.1%, whereas a graded increase in frameshift levels was observed upon the addition of AZ1B (Figure 6). Maximal frameshifting levels were 13% in the presence of 2 μM AZ1B in the transfection media.

DISCUSSION
Several models attempting to explain pseudoknot stimulation of programmed −1 frameshifting have been proposed [for reviews see (18,19)]. Most models invoke a pausing mechanism whereby the ribosome is paused over the shift site such that time is allowed for the tRNAs to reposition in the new reading frame. This explanation is clearly too simplistic as stem–loops and pseudoknots of similar thermodynamic stability that cause ribosome pausing are not necessarily effective frameshift stimulators (47–49). In addition, variations of the IBV pseudoknot have demonstrated a lack of correlation between the extent of pausing and the efficiency of frameshifting (47). A recent publication by Brierley and co-workers (50) presents structural data demonstrating that the IBV frameshift stimulating pseudoknot blocks the mRNA entrance tunnel and leads to a structural deformation of the P-site tRNA. The resulting movement of the tRNA displaces the anticodon loop towards the 3′ end of the mRNA. A model is presented in which this movement results in disruption of the codon–anticodon interactions, thus allowing for tRNA slippage relative to the mRNA. Similar tRNA movements were not observed with non-frameshift stimulating stem–loop structures. This model provides a feasible mechanistic explanation for the ability of some downstream structures to induce frameshifting.

The ability of antisense oligonucleotides to induce high-level −1 frameshifting (29,30) demonstrates that elaborate tertiary structures are not required, and that a duplex formed by complementary antisense oligonucleotides (with a variety of chemistries, including RNA, 2′-O-Methyl, morpholino) is sufficient to induce high-level frameshifting. Here we demonstrate for the first time that trans-acting antisense oligonucleotides may stimulate ribosome shifting to the +1 reading frame at surprisingly high levels, levels which are greater than those achieved by natural 3′ cis-acting mRNA pseudoknot structures in programmed +1 frameshifting.

Structural studies indicating that the mRNA begins to enter the ribosome 7–9 nt downstream from the A-site codon is of direct relevance to this study (50,51). Our results indicate that maximal frameshifting is induced when the antisense–mRNA duplex begins 3 nt downstream of the UGA of the shift site, in agreement with the distance found between the UGA of the shift site and the beginning of stem 1 of the pseudoknot stimulator found in antizyme genes. Given this distance, the implication is that the stimulatory secondary structure would be encountered by the ribosome when the UCC codon enters the A-site of the ribosome. Perhaps as suggested by the structural studies of the IBV-1 frameshift inducing pseudoknot, the codon–anticodon interactions between the UCC codon and Ser-tRNASer are disrupted during translocation to the P-site. Given the importance of the UGA codon during frameshifting at the UCC UGA shift site, subsequent events following translocation of the UCC codon to the P-site and UGA to the A-site must influence frameshifting efficiency. This latter event most probably involves competition between termination and +1 frame decoding when the UGA codon is in the A-site. Various discussions have been presented for the importance of A-site and P-site events during ribosomal frameshifting (7,52) and clearly, further investigations of this topic are warranted.

The observation presented here that the antisense oligonucleotide, AZ1A, which anneals directly adjacent to the UGA stop codon can induce ribosome frameshifts to either the +1 or −1 reading frame is surprising. In light of the above discussion of spacing for naturally occurring cis-acting frameshift stimulators, it is possible that frameshifting may occur at codons upstream of the known UCC UGA shift site. However, visual examination of upstream codons does not reveal an obvious −1 or +1 frameshift site.

The ability of spermidine to stimulate antisense oligonucleotide induced ribosome frameshifting to the +1 reading frame at the UCC UGA shift site in the absence of the natural 3′ stimulator demonstrates that this cis-acting element is not required for polyamine responsiveness. Similarly, spermidine stimulation was observed in the absence of the 5′ element but virtually eliminated by altering the UGA codon of the shift site to UGG. These observations are in agreement with previous studies examining the importance of cis-acting elements for polyamine induced frameshifting during expression of antizyme genes (39–41).

Finally, the ability to direct ribosomes to the +1 reading frame in living cells (Figure 6) suggests a potential therapeutic application for antisense oligonucleotides. Directed frameshifting to the +1 reading frame near a disease causing −1 frameshift mutation would cause some ribosomes to resume decoding in the wild-type ORF, thus restoring partial production of full-length protein from mutant alleles. The importance of the stop codon for efficient frameshifting suggests that the stop codon following the frameshift mutation presents a promising target for antisense induced phenotypic suppression, and that modulation of intracellular polyamine levels, although not essential, may increase the effectiveness of this approach. Further experiments are required to determine the therapeutic potential of this approach in vivo including the generality and efficiency of frameshift induction at non-programmed frameshift sites.

SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.

The authors would like to thank Drs Pasha Baranov, John Atkins and Lorin Petros for critical reading of the manuscript. This project was funded by an MDA Development grant and NIH R21NS051792 to M.T.H. Funding to pay the Open Access publication charges for this article was provided by NIH R21NS051792.

Conflict of interest statement. None declared.

Figures and Tables
Figure 1 (A) Reporter construct design: cis- and trans-acting stimulators of frameshifting. Sequence of the shift site and downstream sequences for dual luciferase constructs containing cis-acting structures used in this paper. P2luc-AZ1wt contains the wild-type antizyme frameshift cassette, p2luc-AZ1-0sp has a 3 bp deletion of the spacer sequences separating the shift site from the pseudoknot and p2luc-AZ1hp contains a hairpin replacement of the pseudoknot structure. S1 and S2 refer to stem 1 and stem 2 of the RNA pseudoknot. L1 and L2 refer to loops 1 and 2 of the pseudoknot. Fluc and Rluc represent Firefly and Renilla luciferase genes, respectively. (B) Sequence of the shift site and downstream sequences for dual luciferase constructs and their complementary antisense oligonucleotide partners. Fluc and Rluc represent Firefly and Renilla luciferase genes, respectively.

Figure 2 Cis-acting 3′ stimulators of frameshifting. Plasmids p2Luc-AZ1wt (AZ1wt), p2luc-AZ1PKdel (AZ1PKdel) and p2luc-AZ1hp (AZ1hp) were transcribed and translated in rabbit reticulocyte lysate in the absence or presence of increasing amounts of spermidine (final concentration indicated in mM). SDS–PAGE of 35S-methionine-labeled protein products from transcription and translation reactions is shown. The location of the full-length frameshift product (+1 FS) and non-frameshift termination product (Term) are indicated. The efficiency of frameshifting (% FS) is indicated.

Figure 3 Antisense oligonucleotide stimulators of frameshifting. Plasmids p2Luc-AZ1PKdel (AZ1PKdel) or p2luc-AZ1-0sp (AZ1-0sp) were transcribed and translated in rabbit reticulocyte lysate in the absence or presence of increasing amounts of spermidine (final concentration indicated in mM). Either 2′-O-Methyl antisense oligonucleotide AZ1A (A), AZ1B (B) or AZ1C (C) was added to the transcription and translation reactions at 2 μM final concentration. No antisense oligonucleotide was added to reactions with AZ1-0sp (D). SDS–PAGE of 35S-methionine-labeled protein products from transcription and translation reactions is shown. The efficiency of frameshifting (% FS) is indicated.

Figure 4 Sequence effect 3′ of the shift site on 2′-O-Methyl induced frameshifting. Plasmids p2Luc-AZ1PKm1 (AZ1PKm1) (A and B) or p2luc-AZ1sl (AZ1SL) (C and D) were transcribed and translated in rabbit reticulocyte lysate in the presence of 0.4 mM spermidine. Either 2′-O-Methyl antisense oligonucleotide PKm1 (A), PKm2 (B), SL1 (C) or SL2 (D) was added to the transcription and translation reactions at increasing concentrations. Final concentration of the antisense oligonucleotide (AO) is indicated in μM. SDS–PAGE of 35S-methionine-labeled protein products from transcription and translation reactions is shown. The efficiency of frameshifting (% FS) is indicated.

Figure 5 Sequence effect 5′ of the shift site on 2′-O-Methyl induced frameshifting. Plasmids p2Luc-AZ1FS (AZ1 FS) (A and B) or p2luc-AZ1FS-UGG (AZ1FS-UGG) (C and D) were transcribed and translated in rabbit reticulocyte lysate in the presence or absence of 0.4 mM spermidine. Either 2′-O-Methyl antisense oligonucleotide AZ1A, AZ1B or AZ1C were present. SDS–PAGE of 35S-methionine-labeled protein products from transcription and translation reactions is shown for AZ1FS (A) and AZ1FS-UGG (C). The efficiency of frameshifting (% FS) is indicated.

Figure 6 Antisense induced frameshifting in cultured mammalian cells. Plasmid p2lucAZPKdel was transfected into cultured CV-1 cells along with increasing amounts of 2′-O-Methyl antisense oligonucleotide AZ1B. The cells were incubated for 20 h and the percent frameshifting was determined by assaying firefly and Renilla luciferase activity in cell lysates as described in Materials and Methods.
==== Refs
REFERENCES
1 Farabaugh P.J.  Programmed translational frameshifting Microbiol. Rev. 1996 60 103 134 8852897 
2 Baranov P.V. Gesteland R.F. Atkins J.F.  Recoding: translational bifurcations in gene expression Gene 2002 286 187 201 11943474 
3 Namy O. Rousset J.P. Napthine S. Brierley I.  Reprogrammed genetic decoding in cellular gene expression Mol. Cell 2004 13 157 168 14759362 
4 Gesteland R.F. Weiss R.B. Atkins J.F.  Recoding: reprogrammed genetic decoding Science 1992 257 1640 1641 1529352 
5 Gesteland R.F. Atkins J.F.  Recoding: dynamic reprogramming of translation Annu. Rev. Biochem. 1996 65 741 768 8811194 
6 Brierley I. Jenner A.J. Inglis S.C.  Mutational analysis of the ‘slippery-sequence’ component of a coronavirus ribosomal frameshifting signal J. Mol. Biol. 1992 227 463 479 1404364 
7 Baranov P.V. Gesteland R.G. Atkins J.F.  P-site tRNA as a crucial initiator of ribosomal frameshifting RNA 2004 10 221 230 14730021 
8 Sundararajan A. Michaud W.A. Qian Q. Stahl G. Farabaugh P.J.  Near-cognate peptidyl-tRNAs promote +1 programmed translational frameshifting in yeast Mol. Cell 1999 4 1005 1015 10635325 
9 Curran J.F.  Analysis of effects of tRNA:message stability on frameshift frequency at the Escherichia coli RF2 programmed frameshift site Nucleic Acids Res. 1993 21 1837 1843 8493101 
10 Weiss R.B. Dunn D.M. Atkins J.F. Gesteland R.F.  Ribosomal frameshifting from −2 to +50 nucleotides Prog. Nucleic Acid Res. Mol. Biol. 1990 39 159 183 2247607 
11 Vimaladithan A. Farabaugh P.J.  Special peptidyl-tRNA molecules can promote translational frameshifting without slippage Mol. Cell. Biol. 1994 14 8107 8116 7969148 
12 Belcourt M.F. Farabaugh P.J.  Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site Cell 1990 62 339 352 2164889 
13 Farabaugh P.J. Zhao H. Vimaladithan A.  A novel programed frameshift expresses the POL3 gene of retrotransposon Ty3 of yeast: frameshifting without tRNA slippage Cell 1993 74 93 103 8267715 
14 Atkins J.F. Gesteland R.F. Reid B.R. Anderson C.W.  Normal tRNAs promote ribosomal frameshifting Cell 1979 18 1119 1131 391405 
15 Weiss R. Gallant J.  Mechanism of ribosome frameshifting during translation of the genetic code Nature 1983 302 389 393 6339944 
16 Pande S. Vimaladithan A. Zhao H. Farabaugh P.J.  Pulling the ribosome out of frame by +1 at a programmed frameshift site by cognate binding of aminoacyl-tRNA Mol. Cell. Biol. 1995 15 298 304 7799937 
17 Pleij C.W. Rietveld K. Bosch L.  A new principle of RNA folding based on pseudoknotting Nucleic Acids Res. 1985 13 1717 1731 4000943 
18 Brierley I. Pennell S.  Cold Spring Harbor Symposia on Quantitative Biology 2001 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 233 248 
19 Giedroc D.P. Theimer C.A. Nixon P.L.  Structure, stability and function of RNA pseudoknots involved in stimulating ribosomal frameshifting J. Mol. Biol. 2000 298 167 185 10764589 
20 Shen L.X. Tinoco I. Jr The structure of an RNA pseudoknot that causes efficient frameshifting in mouse mammary tumor virus J. Mol. Biol. 1995 247 963 978 7723043 
21 Wang Y. Wills N.M. Du Z. Rangan A. Atkins J.F. Gesteland R.F. Hoffman D.W.  Comparative studies of frameshifting and nonframeshifting RNA pseudoknots: a mutational and NMR investigation of pseudoknots derived from the bacteriophage T2 gene 32 mRNA and the retroviral gag-pro frameshift site RNA 2002 8 981 996 12212853 
22 Michiels P.J. Versleijen A.A. Verlaan P.W. Pleij C.W. Hilbers C.W. Heus H.A.  Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frameshifting J. Mol. Biol. 2001 310 1109 1123 11501999 
23 Egli M. Minasov G. Su L. Rich A.  Metal ions and flexibility in a viral RNA pseudoknot at atomic resolution Proc. Natl Acad. Sci. USA 2002 99 4302 4307 11904368 
24 Su L. Chen L. Egli M. Berger J.M. Rich A.  Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot Nature Struct. Biol. 1999 6 285 292 10074948 
25 Kim Y.G. Su L. Maas S. O'Neill A. Rich A.  Specific mutations in a viral RNA pseudoknot drastically change ribosomal frameshifting efficiency Proc. Natl Acad. Sci. USA 1999 96 14234 14239 10588689 
26 Liphardt J. Napthine S. Kontos H. Brierley I.  Evidence for an RNA pseudoknot loop–helix interaction essential for efficient −1 ribosomal frameshifting J. Mol. Biol. 1999 288 321 335 10329145 
27 Napthine S. Liphardt J. Bloys A. Routledge S. Brierley I.  The role of RNA pseudoknot stem 1 length in the promotion of efficient −1 ribosomal frameshifting J. Mol. Biol. 1999 288 305 320 10329144 
28 Pallan P.S. Marshall W.S. Harp J. Jewett F.C. IIIWawrzak Z. Brown B.A. IIRich A. Egli M.  Crystal structure of a luteoviral RNA pseudoknot and model for a minimal ribosomal frameshifting motif Biochemistry 2005 44 11315 11322 16114868 
29 Howard M.T. Gesteland R.F. Atkins J.F.  Efficient stimulation of site-specific ribosome frameshifting by antisense oligonucleotides RNA 2004 10 1653 1661 15383681 
30 Olsthoorn R.C. Laurs M. Sohet F. Hilbers C.W. Heus H.A. Pleij C.W.  Novel application of sRNA: stimulation of ribosomal frameshifting RNA 2004 10 1702 1703 15496520 
31 Ivanov I.P. Anderson C.B. Gesteland R.F. Atkins J.F.  Identification of a new antizyme mRNA +1 frameshifting stimulatory pseudoknot in a subset of diverse invertebrates and its apparent absence in intermediate species J. Mol. Biol. 2004 339 495 504 15147837 
32 Matsufuji S. Matsufuji T. Wills N.M. Gesteland R.F. Atkins J.F.  Reading two bases twice: mammalian antizyme frameshifting in yeast EMBO J. 1996 15 1360 1370 8635469 
33 Li X. Coffino P.  Degradation of ornithine decarboxylase: exposure of the C-terminal target by a polyamine-inducible inhibitory protein Mol. Cell. Biol. 1993 13 2377 2383 8455617 
34 Murakami Y. Matsufuji S. Kameji T. Hayashi S. Igarashi K. Tamura T. Tanaka K. Ichihara A.  Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination Nature 1992 360 597 599 1334232 
35 Zhang M. Pickart C.M. Coffino P.  Determinants of proteasome recognition of ornithine decarboxylase, a ubiquitin-independent substrate EMBO J. 2003 22 1488 1496 12660156 
36 Mitchell J.L. Judd G.G. Bareyal-Leyser A. Ling S.Y.  Feedback repression of polyamine transport is mediated by antizyme in mammalian tissue-culture cells Biochem. J. 1994 299 19 22 8166639 
37 Suzuki T. He Y. Kashiwagi K. Murakami Y. Hayashi S. Igarashi K.  Antizyme protects against abnormal accumulation and toxicity of polyamines in ornithine decarboxylase-overproducing cells Proc. Natl Acad. Sci. USA 1994 91 8930 8934 8090747 
38 Sakata K. Kashiwagi K. Igarashi K.  Properties of a polyamine transporter regulated by antizyme Biochem. J. 2000 347 297 303 10727431 
39 Howard M.T. Shirts B.H. Zhou J. Carlson C.L. Matsufuji S. Gesteland R.F. Weeks R.S. Atkins J.F.  Cell culture analysis of the regulatory frameshift event required for the expression of mammalian antizymes Genes Cells 2001 6 931 941 11733031 
40 Matsufuji S. Matsufuji T. Miyazaki Y. Murakami Y. Atkins J.F. Gesteland R.F. Hayashi S.  Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme Cell 1995 80 51 60 7813017 
41 Petros L.M. Howard M.T. Gesteland R. Atkins J.F.  Polyamine sensing during antizyme mRNA programmed frameshifting Biochem. Biophys. Res. Commun. 2005 338 1478 1489 16269132 
42 Brierley I. Digard P. Inglis S.C.  Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot Cell 1989 57 537 547 2720781 
43 Kollmus H. Honigman A. Panet A. Hauser H.  The sequences of and distance between two cis-acting signals determine the efficiency of ribosomal frameshifting in human immunodeficiency virus type 1 and human T-cell leukemia virus type II in vivo J. Virol. 1994 68 6087 6091 8057488 
44 ten Dam E. Brierley I. Inglis S. Pleij C.  Identification and analysis of the pseudoknot-containing gag-pro ribosomal frameshift signal of simian retrovirus-1 Nucleic Acids Res. 1994 22 2304 2310 8036158 
45 Grentzmann G. Ingram J.A. Kelly P.J. Gesteland R.F. Atkins J.F.  A dual-luciferase reporter system for studying recoding signals RNA 1998 4 479 486 9630253 
46 Howard M.T. Shirts B.H. Petros L.M. Flanigan K.M. Gesteland R.F. Atkins J.F.  Sequence specificity of aminoglycoside-induced stop codon readthrough: potential implications for treatment of Duchenne muscular dystrophy Ann. Neurol. 2000 48 164 169 10939566 
47 Kontos H. Napthine S. Brierley I.  Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency Mol. Cell. Biol. 2001 21 8657 8670 11713298 
48 Tu C. Tzeng T.H. Bruenn J.A.  Ribosomal movement impeded at a pseudoknot required for frameshifting Proc. Natl Acad. Sci. USA 1992 89 8636 8640 1528874 
49 Somogyi P. Jenner A.J. Brierley I. Inglis S.C.  Ribosomal pausing during translation of an RNA pseudoknot Mol. Cell. Biol. 1993 13 6931 6940 8413285 
50 Namy O. Moran S.J. Stuart D.I. Gilbert R.J. Brierley I.  A mechanical explanation of RNA pseudoknot function in programmed ribosomal frameshifting Nature 2006 441 244 247 16688178 
51 Yusupova G.Z. Yusupov M.M. Cate J.H. Noller H.F.  The path of messenger RNA through the ribosome Cell 2001 106 233 241 11511350 
52 Stahl G. Ben Salem S. Li Z. McCarty G. Raman A. Shah M. Farabaugh P.J.  Programmed +1 translational frameshifting in the yeast Saccharomyces cerevisiae results from disruption of translational error correction Cold Spring Harb. Symp. Quant. Biol. 2001 66 249 258 12762026

