
==== Front
Ecol Evol
Ecol Evol
10.1002/(ISSN)2045-7758
ECE3
Ecology and Evolution
2045-7758
John Wiley and Sons Inc. Hoboken

10.1002/ece3.70071
ECE370071
ECE-2024-05-00901.R1
Agroecology
Research Article
Research Article
What's on the menu? A novel molecular gut content analysis to investigate the feeding behavior of phytophagous insects
Fluch et al.
Fluch Maja https://orcid.org/0009-0007-0162-3401
1
Chignola Marta https://orcid.org/0009-0004-6402-7998
1
Corretto Erika https://orcid.org/0000-0002-7767-5191
2
Wolf Manfred 3
Fischnaller Stefanie https://orcid.org/0000-0002-1098-0837
3
Borruso Luigimaria https://orcid.org/0000-0002-7445-3454
1
Schuler Hannes https://orcid.org/0000-0001-8307-9831
1 2 hannes.schuler@unibz.it

1 Faculty of Agricultural, Environmental and Food Sciences Free University of Bozen‐Bolzano Bolzano‐Bozen Italy
2 Competence Centre for Plant Health Free University of Bozen‐Bolzano Bolzano‐Bozen Italy
3 Research Centre Laimburg Vadena Italy
* Correspondence
Hannes Schuler, Faculty of Agricultural, Environmental and Food Sciences, Free University of Bozen‐Bolzano, Bolzano‐Bozen, Italy.
Email: hannes.schuler@unibz.it

24 9 2024
9 2024
14 9 10.1002/ece3.v14.9 e7007128 6 2024
07 5 2024
11 7 2024
© 2024 The Author(s). Ecology and Evolution published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Abstract

The relationship between phytophagous insects and plants is a central aspect of food webs and ecosystem functioning. The introduction of new species into an environment can have significant impacts on the food web of a native ecosystem. In many cases, there is a lack of knowledge on the biology and feeding behavior of invasive species prior their introduction and in the invaded regions. Gut content analyses of insects have provided valuable information on the host spectrum of insects. However, current approaches are time‐consuming and costly. Here, we describe a new molecular gut content analysis (GCA) approach using the Oxford Nanopore (ONT) Flongle sequencing platform to characterize the plant DNA present in the gut of the highly polyphagous insect species Halyomorpha halys. We demonstrate that this technique efficiently amplifies and correctly identifies plant DNA in a mock community. We performed a feeding experiment to determine the sensitivity of this approach and to assess how long the plant DNA can be detected. All plants used in the feeding experiment were correctly identified and detected after 56 days. Surprisingly, we also detected various plant genera that were not included in the feeding experiment and thus were likely ingested months before the experiment. Our study suggests that the GCA using the ONT Flongle sequencing platform represents a rapid and cost‐efficient diagnosis of the dietary preferences, host range, and the diversity of consumed plant species of pest insects with high precision.

Schematic overview of the feeding experimental set up to investigate the suitability of the Oxford Nanopore Flongle device for the molecular gut content analysis of Halyomorpha halys.

feeding behavior
food web
Halyomorpha halys
molecular gut content analysis
Nanopore Flongle
phytophagous insect
Free University of Bozen‐Bolzano 10.13039/501100008815 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:24.09.2024
Fluch, M. , Chignola, M. , Corretto, E. , Wolf, M. , Fischnaller, S. , Borruso, L. , & Schuler, H. (2024). What's on the menu? A novel molecular gut content analysis to investigate the feeding behavior of phytophagous insects. Ecology and Evolution, 14 , e70071. 10.1002/ece3.70071
==== Body
pmc1 INTRODUCTION

Ecological networks describe the interactions of different organisms within ecosystems, including predation, parasitism, and herbivory (Ings et al., 2009; Ollivier et al., 2020). Food webs are seen as one part of these networks and describe the feeding relationships within a community (Ings et al., 2009). Analyzing different food‐webs helps to elucidate several questions, for example, the complexity of all interactions and the processes in ecosystems, co‐evolution, or the impact of biological invasions (Ollivier et al., 2020).

The introduction of invasive species into an ecosystem can have profound effects on the existing food webs, as they can feed on native plants or prey on native species (Kenis et al., 2009; Ollivier et al., 2020). In most of the cases, observational studies are used to assess the ecology of invasive species (Kenis et al., 2009). However, studying the feeding behavior based only on field collections has some limitations: field collections may be biased and might include false absences (Delmas et al., 2019). Moreover, field observations can describe the occurrence of an insect on a specific plant but can describe only to a limited extent whether a certain plant actually serves as feeding plant (Hereward & Walter, 2012; Kitson et al., 2013). Therefore, it is almost impossible to accurately reconstruct the exact feeding behavior just by observation (García‐Robledo et al., 2013; Zhu et al., 2019). Recently, molecular gut content analysis (GCA) was used to reconstruct the trophic interactions of insects by studying the contents of their digestive system to identify the ingested host DNA (Avanesyan et al., 2021; Eitzinger et al., 2019; Hayashi et al., 2020; Hepler et al., 2021; Wallinger et al., 2013; Zhu et al., 2019).

GCA has already been performed on a wide variety of organisms, from mammals to fishes to arthropods (Cooper et al., 2019; Fourie et al., 2022; Khanam et al., 2016; Macías‐Hernández et al., 2018; van der Reis et al., 2022). Previous studies focused on different research aims, such as the investigation of the persistence of DNA in the gut (Hepler et al., 2021; Macías‐Hernández et al., 2018), the identification of all host plants of a species (Barthel et al., 2020; Cooper et al., 2022; Hepler et al., 2023; Hereward & Walter, 2012; Pitt et al., 2024; Serrano et al., 2023), or the characterization of the feeding behavior across different life stages (Hepler et al., 2023). To reach these objectives, different combinations of DNA barcodes and sequencing platforms have been used. Most commonly plant DNA was identified using either the chloroplast genes rbcL, trnF, and trnL, the intergenic region trnH‐psbA, or the internal transcribed spacers (ITS) of nuclear ribosomal DNA (Barthel et al., 2020; García‐Robledo et al., 2013; Hepler et al., 2021; Staudacher et al., 2011; Wang et al., 2017). These genes were mainly sequenced with the classical Sanger sequencing approach (García‐Robledo et al., 2013; Hereward & Walter, 2012; Wang et al., 2017) or with the Illumina next‐generation sequencing (Eitzinger et al., 2019; Van Dijck et al., 2023). More recently, third‐generation sequencing platforms such as Pacific Biosciences (PacBio) and Oxford Nanopore Technologies (ONT) have been used for GCA (Cooper et al., 2019; Hepler et al., 2021; van der Reis et al., 2022). Although the ONT Flongle sequencing platform offers an ultrafast and cost‐efficient sequencing method, especially for amplicon sequencing (Avershina et al., 2022; Cha et al., 2023; Cuber et al., 2023), it has never been used to perform GCA on a herbivorous insect.

Here, we developed a novel GCA approach for phytophagous insects using the brown marmorated stink bug (BMSB) Halyomorpha halys (Stål) as study system. H. halys is an invasive insect in Europe and North America, originating from Northeast Asia (Cianferoni et al., 2018; Haye et al., 2014; Hoebeke & Carter, 2003; Leskey & Nielsen, 2018). It is considered highly polyphagous, with more than 300 described host plants (Kriticos et al., 2017). However, in most of the studies, the host plants are investigated by observational studies (Bergmann et al., 2016; Haye et al., 2014; Lee et al., 2013) which define the occurrence and/or the reproduction of H. halys on a specific plant, but do not give any information if they actually feed on the plant (Haye et al., 2014, 2015). For the validation of the GCA based on ONT Flongle sequencing, we (1) tested a mock community of plant DNA to assess the accuracy and efficiency of this platform and (2) set up a feeding experiment with alternating feeding plants to assess how long the DNA of the ingested plants is detectable.

2 METHODS

2.1 Collection and rearing of Halyomorpha halys

Individuals of H. halys were collected in October and November 2022 in Adige Valley, South Tyrol, Italy. Approximately 250 insects were kept at 9°C with a photoperiod of L8:D16 and 60% humidity to overwinter. After approximately 3 months, the temperature of the incubation chamber was increased to 18°C for 10 days with a photoperiod of L14:D10 and 60% humidity. The individuals were transferred to five 30 cm x 30 cm x 30 cm cages (BugDorm, MegaView Science Co., Ltd., Taiwan) with approximately 50 individuals per cage. The temperature was then increased to 25°C with a photoperiod of L16:D8 and 60% humidity. Four cages were used for the feeding experiment (feeding group) and one served as a control (control group), where only water and no food was provided.

Each cage of the feeding group contained: paper towels serving as shelter for the bugs, cotton wool soaked with tap water, one plant of the genus Peperomia, sunflower seeds (Helianthus annuus), four to five cherry tomatoes (Solanum lycopersicum, variety: Axtar and Paskualeto), and one pear (Pyrus communis, variety: Abate Fetel). For 3 weeks, the bugs were provided with this diet ad libitum. To see how long the DNA of the first feeding plants can be detected, the diet was replaced with one carrot (Daucus carota) broken into three to four pieces, one kiwi (Actinidia chinensis), and around 25 green beans (Phaseolus vulgaris) while water, sunflower seeds, and peperomia were available in the cages for the duration of the experiment (Figure 1). The chosen feeding plants showed the best results in the rearing facility (Dingha & Jackai, 2017; Funayama, 2006; Medal et al., 2012; Taylor et al., 2017). Two times a week, the cages were cleaned by wiping all surfaces with 70% ethanol, paper towels, the cotton wool and, if needed, the feed was substituted. The bugs were collected at 12 time points during a period of 11 weeks (Table 1, Figure 1). The first collection (T0) was done 3 weeks after starting the experiment, before changing the diet (Figure 1). At each time point, two individuals were collected from each cage and directly stored in 100% ethanol at −20°C (Table 1). The control group was collected at five different time points (Table S1).

FIGURE 1 Schematic overview of the experimental setup. The feeding experiment and the collection of individuals was performed for 11 weeks. The insects were dissected, and the plant DNA was extracted. The ITS2 region was amplified via PCR and sequenced on the ONT Flongle flow cell. Sequences were quality‐filtered and taxonomic identification of the ingested plants was determined via BLAST. The figure was created with BioRender.com.

TABLE 1 Time points of H. halys individuals collected during the feeding experiment.

Time point	Days after changing the diet	Number of sequenced bugs (n = 99)	Average number of plant DNA reads per individual a	Average number of plant DNA reads after rarefaction b	Number of bugs with >1000 reads (n = 60)	
T0	0	8	227 ± 230	0	0	
T1	2	7	119 ± 96	0	0	
T2	5	8	3933 ± 3957	5127 ± 3883	6	
T3	7	8	3980 ± 2243	3980 ± 2243	7	
T4	9	8	3238 ± 2490	4179 ± 2097	6	
T5	12	5	4380 ± 5539	7133 ± 5739	3	
T6	15	7	3653 ± 2294	4115 ± 2128	6	
T7	20	7	2822 ± 1600	3174 ± 1426	6	
T8	26	8	2181 ± 1580	2181 ± 1580	8	
T9	34	8	2160 ± 2458	4282 ± 335	2	
T10	44	6	0 ± 0	0	0	
T11	56	7	3934 ± 2780	4435 ± 2676	6	
Control	2–12	12	1737 ± 971	1964 ± 897	10	
Note: The time points refer to the number of days after changing the diet after the 3 weeks post hibernation (Figure 1).

a Average number of plant DNA reads per individual after filtering ± standard deviation. Individuals without reads assigned to plants were omitted.

b Average number of plant DNA reads after rarefaction.

2.2 Dissection of the gut and DNA extraction

The gut of single individuals of H. halys was dissected using sterilized tweezers, scissors, and a needle. Despite careful dissection, some surrounding tissues might have been included in the material for DNA extraction. DNA was extracted using the Qiagen DNeasy Blood and Tissue Kit (QIAGEN GmbH, 40724 Hilden, Germany), following the manufacturer's instructions (Figure 1). The overview of individuals analyzed from the different time points is reported in Table 1.

2.3 Mock community composition

To validate if all the provided plants were correctly amplified, a mock community was prepared, consisting of the DNA extracted from peperomia leaves, sunflower seeds, and the flesh of pear, kiwi, bean, carrot, and tomato. DNA from individual plants was extracted using the Qiagen DNeasy Blood and Tissue Kit (QIAGEN GmbH, 40724 Hilden, Germany) following the manufacturer's instructions. The DNA concentration was measured with the Qubit 4 Fluorometer using the Qubit™ 1X dsDNA HS Assay Kit (ThermoFisher Scientific, Waltham, Massachusetts, USA). The DNA of all plants was pooled in equal amounts (10 ng each) and used for library preparation as described in the next paragraph. The mock community was sequenced in duplicates.

2.4 Library preparation and metabarcoding of the gut content

A PCR was performed using primers targeting the plant ITS2 region with Nanopore‐specific overhangs that were added at the 5′ end: ITS2_S2F (5′‐TTTCTGTTGGTGCTGATATTGC‐ATGCGATACTTGGTGTGAAT‐3′), modified from Chen et al. (2010) and ITS4 (R) (5′‐ACTTGCCTGTCGCTCTATCTTC‐TCCTCCGCTTATTGATATGC‐3′), modified from White et al. (1990), resulting in amplicons of approximately 400 bp. Each PCR reaction was set up in a laminar flow hood (GuardOne® Workstation‐Laminar Flow, Starlab (UK) LTD, Milton Keynes, United Kingdom) that was decontaminated using UV light for at least 30 min. Each reaction had a volume of 25 μL containing 2 μL of DNA, 1.25 μL of each primer (10 μM), 12.5 μL of Q5® Hot Start High‐Fidelity 2X Master Mix (New England Biolabs, Ipswich, Massachusetts, USA), and 8 μL of sterile water. The PCR was performed with the TurboCycler 2 Thermal Cycler (Blue‐Ray Biotech, Taipei City, Taiwan) under the following conditions: 98°C for 30 s, followed by 35 cycles of 98°C for 10 s, 51°C for 20 s, and 72°C for 25 s, with the final extension step at 72°C for 2 min. Each sample was run in duplicates and a negative control was added, where sterilized water instead of DNA was used. Amplification success was checked via electrophoresis on a 1% agarose gel. The positive duplicates were pooled, purified using the AMPure XP beads (Beckman Coulter Life Sciences, Indianapolis, USA), and used for the library preparation.

All samples were sequenced on the ONT Flongle flow cell (R9.4.1) using the PCR Barcoding Expansion 1–12 kit EXP‐PBC001 (Oxford Nanopore Technologies, Oxford, United Kingdom), which allowed the pooling of 12 individuals on a single flow cell. The barcoded samples were pooled in the same quantity of DNA (1.5 μg in total, 125 ng per sample) and the library was prepared with the Ligation Sequencing Kit SQK‐LSK110 (Oxford Nanopore Technologies, Oxford, United Kingdom) and the Flongle Sequencing Expansion kit EXP‐FSE001 (Oxford Nanopore Technologies, Oxford, United Kingdom) according to the manufacturer's instructions. Each sequencing was run for 18–48 h, until the number of passed reads (Phred Score ≥ 9) reached a plateau and a maximum of two pores were active.

2.5 Bioinformatic analysis

Demultiplexing and basecalling with a minimum Phred Score of 9 were performed during the run using the Guppy Basecaller (Guppy Basecalling Software, Oxford Nanopore Technologies plc. Version 6.5.7). The Guppy Barcoder was used to crop the barcodes. Sequences shorter than 250 bp and longer 600 bp were excluded from the analysis.

The sequences were then taxonomically assigned using MegaBLAST (Chen et al., 2015) and the NCBI database. To optimize and validate the method, different filtering settings were tested in R (R version 4.2.0) (R Core Team, 2022) on the sequences of the mock communities The percentage of nucleotide identity (pident) was tested in a range from 90% to 95% and the number of matching nucleotides (nident) was tested at 100, 150, and 200 bp, in combination with all the different pident (90, 91, 92, 93, 94, and 95%). The optimal filtering settings consisted of a pident ≥95% and a nident ≥200 bp. All sequences that did not match these requirements were excluded from the analysis. Only the BLAST hit with the highest pident was included in the analysis. The taxonomic assignment of the plants was performed at the genus level. The number of sequences for each genus was counted and all genera having less than 20 sequences were removed, together with all reads assigned to bacteria or fungi. To analyze the number of host plants per individual and the detection rates of the feeding plants across the different time points, we performed a rarefaction analysis using the vegan package in R to evaluate the amount of reads necessary to assess the whole plant diversity. All rarefaction curves showed a similar pattern reaching a plateau at 1000 reads (Figure S1). We therefore set a threshold of 1000 reads per individual where individuals with less than 1000 reads were excluded from the subsequent analysis (Table S2). Statistical analyses were performed in R using the packages car (Fox & Weisberg, 2019) and agricolae (de Mendiburu & Yaseen, 2020). Graphs were generated in R using the packages ggplot2 (Wickham, 2016) and cowplot (Wilke, 2023).

3 RESULTS

The sequencing of the two mock communities generated a total of 20,444 and 20,725 reads. After filtering, 7680 and 7897 reads were classified as plants. All seven plant genera provided in the feeding experiment were detected in both samples, but the number of reads assigned to each plant varied widely. Most reads were assigned to tomato (Solanum, 44.7% in sample A and 40.6% in sample B), green bean (Phaseolus, 32.4% and 32.7%), and sunflower (Helianthus, 16.4% and 16.7%), which accounts for a total of 93.5% and 90%. The remaining reads were assigned to carrot (Daucus, 2.9% and 4.7%), kiwi (Actinidia, 1.9% and 2.3%), pear (Pyrus, 0.3% and 1.5%), and Peperomia (0.6% and 0.7%) (Figure S2). The genus Theobroma was detected, although not added in the mock community (0.8% of reads in both samples). This might be the result of a contamination during the sample preparation. Two of the three negative controls included had zero reads assigned to plant DNA, while one sample had a low number of reads (87) assigned to Daucus and Actinidia.

By analyzing the gut content of 99 individuals across 12 different time points, we obtained in total from 2009 to 127,252 reads for each individual (mean number of reads: 42,907 ± 28,711). Overall, 4.26% ± 3.04% of these reads were assigned to bacteria, fungi, or were unclassified and were removed. Eleven individuals did not have any reads assigned to plants. To compare the number of host plants and the relative abundance of feeding hosts across time, we set a threshold of 1000 reads per individual based on the rarefaction curve, which reached a plateau at 1000 (Figure S1). In total, 39 individuals did not reach the threshold and were excluded from this analysis. All individuals from the time points T0, T1, and T10 were excluded from these analyses due to the low number of reads. Two to eight individuals (mean: 5.56 ± 1.88) remained for each of the other sampling time points (Table 1). The remaining 60 individuals from this dataset had between 1007 and 13,332 reads per individual (mean number of reads: 3709 ± 2559) (Table S2).

In the 76 individuals belonging to the feeding group, kiwi was found in most individuals (49 individuals), followed by pear (46), green beans (41), sunflower (37), tomato (26), carrot (10), and peperomia (7 individuals) (Figure 2a). Sunflower seeds, that were always present in the experimental cages, were found at each time point with a high prevalence, especially highly abundant after day 9 (Figure 3a). In contrast, Peperomia, which was also always provided, was not detected frequently, and was not detected in any individuals at days 12, 20, and 56 (Figure 3a). Pear and tomato that were fed only during the first 3 weeks after hibernation were both detected at each time point and pear was present in more individuals than tomato (Figure 3b). From the feeding plants that were provided in the second part of the experiment, only green beans and kiwi were found in high frequencies across the different collection times, both with a prevalence between 43% and 100%. In contrast, carrot was not present at three different times (day 7, 9, and 12) (Figure 3c).

FIGURE 2 Prevalence of plants in the individuals of the feeding group (a) and in the control group (b). Data were not rarefied for this analysis. Yellow colored bars represent the seven plants provided during the feeding experiment: Actinidia, Pyrus, Phaseolus, Helianthus, Solanum, Daucus, and Peperomia; Green bars represent field plants which were detected but not included in the feeding experiment.

FIGURE 3 Prevalence of the different plant genera provided during the feeding experiment over the course of the 12 time points. (a) Plants that were fed across the whole experiment. (b) Plants that were fed in the first 3 weeks. (c) Plants that were fed from week three to the end of the experiment.

Surprisingly, besides the seven feeding plants, additional 32 plant genera that were not included in the experiment were detected (Figure 2). The most frequent plant genera, Salix, Malus, and Robinia were found in a total of 62 (82%), 53 (70%), and 52 (68%) individuals of the feeding group and are and thus more prevalent than the most common feeding plants (Figure 2a). In the individuals of the control group, which were kept without food for around 4 months, a total of 14 different plant genera were detected in the gut of the 12 analyzed individuals. Actinidia and Triticum were found in all individuals and Malus was detected in 10 individuals, Salix in nine, Ostrya, Prunus, and Robinia were found in eight individuals (Figure 2b). Individuals from both the feeding and control group shared the following genera which were not provided in the feeding experiment: Aegilops, Carpinus, Citrullus, Malus, Ostrya, Prunus, Robinia, Salix, Secale, Triticum, and Vigna. Moreover, Arabidopsis, Betula, Clematis, Cucumis, Erigeron, Fraxinus, Humulus, Juglans, Lactuca, Musa, Platanus, Poa, Populus, Pourthiaea, Raphanus, Rosa, Tilia, Torminalis, Viburnum, and Vitis were found only in the feeding group (family and common names found in Table S3). The only genus that was detected in the control group but not the feeding group was Hordeum.

After excluding the 39 individuals which did not reach the threshold of 1000 reads, a mean of 11.02 ± 4.37 different plant genera have been detected in the feeding group. The lowest number of plant genera found in one individual was three, whereas one individual harbored DNA from 22 different plant genera. The control group had a significantly lower number of plant genera (mean 8.10 ± 1.45), with a minimum of five plants in one individual and a maximum of 10 plants in two individuals (Welch test, p < .05). No significant differences in the number of plants were detected between the different collection days (field plants: Kruskal–Wallis test, χ2 = 13.914, p > .05; feeding plants: Kruskal–Wallis test, χ2 = 25.927, p > .05; Figure 4). This indicates that the number of plant genera per individual remained constant throughout the feeding experiment.

FIGURE 4 Number of plant genera found in the gut of H. halys at different time points. Blue – field plants: All plants that were not fed during the experiment. Yellow – feeding plants: The seven plants that were fed during the experiment. The numbers indicate the days after changing the diet after the 3 weeks post hibernation whereas C represent the number of plant genera found in the individuals belonging to the control group.

4 DISCUSSION

Understanding the feeding behavior of animals is crucial to comprehend their biology and ecology. Especially polyphagous insect species can have a variety of food sources and disentangling the exact feeding hosts is tricky. Therefore, molecular gut content analysis is a powerful tool to assess the complete diet of an organism. A common limitation of this approach is that the sensitivity is often unknown and recent studies have shown that the ingested DNA can be traced back only by a limited time, that is, a few hours or days (Briem et al., 2018; Hepler et al., 2021; Pumariño et al., 2011). Here, we present a novel method for DNA metabarcoding using the ONT Flongle device. The approach has the advantage to provide fast results, as sequencing can be performed instantly in the laboratory. Moreover, the method is cheap, as multiple samples can be barcoded and sequenced in parallel on one Flongle flow cell. To test its sensitiveness, we set up a feeding experiment to assess the time frame within which the DNA of the ingested plants can be detected.

Previous studies showed that the post‐feeding detection of plant DNA ranges according to the feeding behavior of the insect (Briem et al., 2018). In case of chewing insects, the DNA of the ingested plant was found after more than 24 h in lepidopteran larvae (Pumariño et al., 2011) and easily up to 72 h in the larvae of click beetles (Staudacher et al., 2011), while the post‐feeding DNA detection decreased significantly after 16–20 h in mirid bugs (Wang et al., 2017). Briem et al. (2018) speculated, that the plant DNA from liquids ingested by piercing‐sucking bugs compared to DNA in tissues absorbed by chewing insects might be more easily degraded and therefore have a shorter post‐feeding detection rate (Briem et al., 2018). This was challenged by Cooper et al. (2019), who investigated the feeding hosts of the phloem‐feeding psyllids and detected plant DNA weeks or months after feeding (Cooper et al., 2019).

To our knowledge, only two studies performed a GCA of Pentatomidae. Fourie et al. (2022) showed a variety of host plants of the two‐spotted stink bug Bathycoelia distincta in the wild, whereas Hepler et al. (2021) investigated the plant DNA of laboratory‐fed individuals of H. halys and detected plant DNA 3–14 days after ingestion, depending on the used marker. To our surprise, in our study, we did not only find the plants initially fed even after 56 days, but we also found an unexpectedly high diversity of plant genera which were not included in the feeding experiment. They have likely been ingested before our collection and thus before the winter diapause, months before the start of the feeding experiment. An explanation for the long persistence of DNA in the gut of H. halys can be found in the anatomy and physiology of plant‐sucking heteropterans. If the diet of plant‐sucking heteropteran's does not or only in small amounts include solid waste material, there is a closure between the different parts of the midgut (Chapman, 1998). The midgut is divided into the regions M1, M2, M3 (in some species M4B), and M4. The latter is the main region where symbionts are found and in between M3 and M4 a narrow region (called “constricted region”) was described in several stink bug species. This narrow part hinders the food fluid to proceed to the M4 region, which is then excreted via the Malpighian tubes and in the feces (Ohbayashi et al., 2015). The midgut of the southern green stink bug Nezara viridula (Hemiptera: Pentatomidae) blocks the ingested material between M3 and M4 (Lomate & Bonning, 2016). This is causing an accumulation of the food in the M3 region (Cantón & Bonning, 2019). Additionally, the activity of nucleases in the midgut of H. halys and N. viridula is very low compared to the saliva and salivary glands (Cantón & Bonning, 2019; Lomate & Bonning, 2016, 2018). We therefore speculate that the ingested food is accumulated in the gut of H. halys, where there are no or only very few nucleases present to degrade the plant DNA.

The long persistence of DNA in the gut of H. halys also explains, why we cannot see any significant differences in the number of detected plants found on the different collection days and after switching the feeding plants during the feeding experiment. In total, we detected 32 plant genera that were not fed in the experiment. All plants detected in this work are present in the study region (South Tyrol, Italy). Some of them (Carpinus, Malus, Prunus, Salix, Triticum, Fraxinus, Humulus, Juglans, Platanus, Rosa, Viburnum, Vitis, Robinia, Populus, Tilia, Secale, Betula, and Vigna) were already described as hosts or associated plants of H. halys (Bakken et al., 2015; Bergmann et al., 2016; Bosco et al., 2020; Dingha et al., 2021; Haye et al., 2014, 2015; Hess et al., 2022; Holthouse et al., 2021; Lee et al., 2013; Maistrello et al., 2016; Rice et al., 2014; Wermelinger et al., 2008). Remarkably, a total of 13 associated plants were, to the best of our knowledge, not described in literature yet: Aegilops, Citrullus, Ostrya, Arabidopsis, Clematis, Erigeron, Lactuca, Musa, Poa, Photinia, Raphanus, Torminalis, and Hordeum. Thus, by assessing only a small number of individuals (n = 88), we were able to identify 13 new host genera. Whether these genera represent an additional reproductive host or only an occasional host plant, needs to be confirmed in future studies.

While our results highlight the potential of our newly developed approach, this method still has some limitations. Although the ONT technology allows a rapid, cost‐efficient, high‐throughput sequencing approach, it generally generates sequences at lower quality with relatively high error rates (Loit et al., 2019; Srivathsan et al., 2018; Tedersoo et al., 2019). The recently released R10.4.1 flow cell is expected to provide a higher quality of the produced reads due to the improved accuracy (Szoboszlay et al., 2023). By using the R9.4 Flongle flow cells, the low quality of our reads constrained us to a stringent filtering and a taxonomic determination to the genus level. We expect the new technology to allow a higher sequencing output and a quality that should allow to detect plants up to the species level. The results of the mock communities, where the amplification of some plants is up to 140‐fold higher than for others, even if present at the same concentration, indicates that the sequencing output cannot be interpreted quantitatively. Therefore, our approach cannot provide any quantitative information about the amount of plant DNA of each genus. The most plausible explanation for this might be due to a difference in the amplification efficiency of the primers for the different plant taxa (Hepler et al., 2021; Zhu et al., 2019). Additionally, the plant ITS region is generally present in multiple copies in the plant genome (Cheng et al., 2016), thus explaining the varying amplification efficiencies of different plant species having variable numbers of copies. Hence, employing additional plant‐specific markers should provide also quantitative results. Nevertheless, our study demonstrated that the ONT Flongle device is a suitable instrument for conducting GCA quickly and cost‐efficiently. It enables us to evaluate the feeding habits of phytophagous insects and can potentially be applied to other food webs.

AUTHOR CONTRIBUTIONS

Maja Fluch: Conceptualization (equal); data curation (lead); formal analysis (lead); investigation (lead); methodology (lead); validation (lead); visualization (lead); writing – original draft (lead). Marta Chignola: Formal analysis (supporting); investigation (equal). Erika Corretto: Conceptualization (supporting); investigation (supporting); methodology (supporting); supervision (supporting); writing – review and editing (supporting). Manfred Wolf: Conceptualization (supporting); methodology (supporting). Stefanie Fischnaller: Conceptualization (supporting); investigation (supporting); methodology (supporting). Luigimaria Borruso: Formal analysis (supporting); methodology (supporting); software (supporting). Hannes Schuler: Conceptualization (lead); funding acquisition (lead); methodology (equal); project administration (lead); resources (lead); supervision (lead); validation (supporting); writing – original draft (supporting).

CONFLICT OF INTEREST STATEMENT

There are no conflicts of interests.

Supporting information

Appendix S1.

ACKNOWLEDGEMENTS

We thank Angelika Gruber and Antonio Pignalosa for collecting the individuals in the field and for taking care of the overwintering in the lab. The work was funded by internal funds of the Free University of Bozen‐Bolzano to Hannes Schuler. Open access publishing facilitated by Libera Universita di Bolzano, as part of the Wiley ‐ CRUI‐CARE agreement.

DATA AVAILABILITY STATEMENT

All raw data and metadata are available at the NCBI GenBank under the accession number PRJNA1126037.
==== Refs
REFERENCES

Avanesyan, A. , Sutton, H. , & Lamp, W. O. (2021). Choosing an effective PCR‐based approach for diet analysis of insect herbivores: A systematic review. Journal of Economic Entomology, 114 , 1035–1046. 10.1093/jee/toab057 33822094
Avershina, E. , Frye, S. A. , Ali, J. , Taxt, A. M. , & Ahmad, R. (2022). Ultrafast and cost‐effective pathogen identification and resistance gene detection in a clinical setting using nanopore Flongle sequencing. Frontiers in Microbiology, 13 , 822402. 10.3389/fmicb.2022.822402 35369431
Bakken, A. J. , Schoof, S. C. , Bickerton, M. , Kamminga, K. L. , Jenrette, J. C. , Malone, S. , Abney, M. A. , Herbert, D. A. , Reisig, D. , Kuhar, T. P. , & Walgenbach, J. F. (2015). Occurrence of Brown marmorated stink bug (Hemiptera: Pentatomidae) on wild hosts in nonmanaged woodlands and soybean fields in North Carolina and Virginia. Environmental Entomology, 44 , 1011–1021. 10.1093/ee/nvv092 26314046
Barthel, D. , Schuler, H. , Galli, J. , Borruso, L. , Geier, J. , Heer, K. , Burckhardt, D. , & Janik, K. (2020). Identification of plant DNA in adults of the phytoplasma vector Cacopsylla picta helps understanding its feeding behavior. Insects, 11 , 835. 10.3390/insects11120835 33255992
Bergmann, E. J. , Venugopal, P. D. , Martinson, H. M. , Raupp, M. J. , & Shrewsbury, P. M. (2016). Host plant use by the invasive Halyomorpha halys (Stål) on Woody ornamental trees and shrubs. PLoS One, 11 , e0149975. 10.1371/journal.pone.0149975 26906399
Bosco, L. , Nardelli, M. , & Tavella, L. (2020). First insights on early host plants and dispersal behavior of Halyomorpha halys (Hemiptera: Pentatomidae) from overwintering to crop colonization. Insects, 11 , 866. 10.3390/insects11120866 33291265
Briem, F. , Zeisler, C. , Guenay, Y. , Staudacher, K. , Vogt, H. , & Traugott, M. (2018). Identifying plant DNA in the sponging–feeding insect pest Drosophila suzukii . Journal of Pest Science, 91 , 985–994. 10.1007/s10340-018-0963-3
Cantón, P. E. , & Bonning, B. C. (2019). Proteases and nucleases across midgut tissues of Nezara viridula (Hemiptera:Pentatomidae) display distinct activity profiles that are conserved through life stages. Journal of Insect Physiology, 119 , 103965. 10.1016/j.jinsphys.2019.103965 31610185
Cha, T. , Kim, H. H. , Keum, J. , Kwak, M.‐J. , Park, J. Y. , Hoh, J. K. , Kim, C.‐R. , Jeon, B.‐H. , & Park, H.‐K. (2023). Gut microbiome profiling of neonates using nanopore MinION and Illumina MiSeq sequencing. Frontiers in Microbiology, 14 , 1148466. 10.3389/fmicb.2023.1148466 37256051
Chapman, R. F. (1998). The insects: Structure and function (4th ed.). Cambridge University Press.
Chen, S. , Yao, H. , Han, J. , Liu, C. , Song, J. , Shi, L. , Zhu, Y. , Ma, X. , Gao, T. , Pang, X. , Luo, K. , Li, Y. , Li, X. , Jia, X. , Lin, Y. , & Leon, C. (2010). Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE, 5 , 1–8. 10.1371/journal.pone.0008613
Chen, Y. , Ye, W. , Zhang, Y. , & Xu, Y. (2015). High speed BLASTN: An accelerated MegaBLAST search tool. Nucleic Acids Research, 43 , 7762–7768. 10.1093/nar/gkv784 26250111
Cheng, T. , Xu, C. , Lei, L. , Li, C. , Zhang, Y. , & Zhou, S. (2016). Barcoding the kingdom plantae: New pcr primers for its regions of plants with improved universality and specificity. Molecular Ecology Resources, 16 , 138–149. 10.1111/1755-0998.12438 26084789
Cianferoni, F. , Graziani, F. , Dioli, P. , & Ceccolini, F. (2018). Review of the occurrence of Halyomorpha halys (Hemiptera: Heteroptera: Pentatomidae) in Italy, with an update of its European and world distribution. Biologia (Bratisl.), 73 , 599–607. 10.2478/s11756-018-0067-9
Cooper, W. R. , Horton, D. R. , Wildung, M. R. , Jensen, A. S. , Thinakaran, J. , Rendon, D. , Nottingham, L. B. , Beers, E. H. , Wohleb, C. H. , Hall, D. G. , & Stelinski, L. L. (2019). Host and non‐host ‘whistle stops’ for psyllids: Molecular gut content analysis by high‐throughput sequencing reveals landscape‐level movements of Psylloidea (Hemiptera). Environmental Entomology, 48 , 554–566. 10.1093/ee/nvz038
Cooper, W. R. , Marshall, A. T. , Foutz, J. , Wildung, M. R. , Northfield, T. D. , Crowder, D. W. , Leach, H. , Leskey, T. C. , Halbert, S. E. , & Snyder, J. B. (2022). Directed sequencing of plant specific DNA identifies the dietary history of four species of Auchenorrhyncha (Hemiptera). Annals of the Entomological Society of America, 115 , 275–284. 10.1093/aesa/saab053
Cuber, P. , Chooneea, D. , Geeves, C. , Salatino, S. , Creedy, T. J. , Griffin, C. , Sivess, L. , Barnes, I. , Price, B. , & Misra, R. (2023). Comparing the accuracy and efficiency of third generation sequencing technologies, Oxford nanopore technologies, and Pacific biosciences, for DNA barcode sequencing applications. Ecological Genetics and Genomics, 28 , 100181. 10.1016/j.egg.2023.100181
de Mendiburu, F. , & Yaseen, M. (2020). Agricolae: Statistical procedures for agricultural research . R Package Version 1.4.0. https://myaseen208.github.io/agricolae/https://cran.r‐project.org/package=agricolae
Delmas, E. , Besson, M. , Brice, M.‐H. , Burkle, L. A. , Dalla Riva, G. V. , Fortin, M.‐J. , Gravel, D. , Guimaraes, P. R., Jr. , Hembry, D. H. , Newman, E. A. , Olesen, J. M. , Pires, M. M. , Yeakel, J. D. , & Poisot, T. (2019). Analysing ecological networks of species interactions. Biological Reviews, 94 , 16–36. 10.1111/brv.12433 29923657
Dingha, B. N. , & Jackai, L. E. N. (2017). Laboratory rearing of the brown marmorated stink bug (Hemiptera: Pentatomidae) and the impact of single and combination of food substrates on development and survival. Canadian Entomologist, 149 , 104–117. 10.4039/tce.2016.39
Dingha, B. N. , Omaliko, P. C. , Amoah, B. A. , Jackai, L. E. , & Shrestha, D. (2021). Evaluation of cowpea (Vigna unguiculata) in an intercropping system as pollinator enhancer for increased crop yield. Sustainability, 13 , 9612. 10.3390/su13179612
Eitzinger, B. , Abrego, N. , Gravel, D. , Huotari, T. , Vesterinen, E. J. , & Roslin, T. (2019). Assessing changes in arthropod predator–prey interactions through dna ‐based gut content analysis—Variable environment, stable diet. Molecular Ecology, 28 , 266–280. 10.1111/mec.14872 30230073
Fourie, A. , Venter, S. N. , Slippers, B. , & Fourie, G. (2022). A detection assay to identify alternative food sources of the two‐spotted stink bug, Bathycoelia distincta (Hemiptera: Pentatomidae). Journal of Economic Entomology, 115 , 519–525. 10.1093/jee/toab256 35028665
Fox, J. , & Weisberg, S. (2019). An R companion to applied regression (3rd ed.). Sage. https://socialsciences.mcmaster.ca/jfox/Books/Companion/
Funayama, K. (2006). A new rearing method using carrots as food for the brown‐marmorated stink bug, Halyomorpha halys (Stål) (Heteroptera: Pentatomidae). Applied Entomology and Zoology, 41 , 415–418. 10.1303/aez.2006.415
García‐Robledo, C. , Erickson, D. L. , Staines, C. L. , Erwin, T. L. , & Kress, W. J. (2013). Tropical plant‐herbivore networks: Reconstructing species interactions using DNA barcodes. PLoS One, 8 , e52967. 10.1371/journal.pone.0052967 23308128
Hayashi, M. , Abe, J. , Owashi, Y. , & Miura, K. (2020). Estimation of movement from insectary plants to crop plants in Orius bugs (Heteroptera: Anthocoridae) by molecular gut content analysis. Applied Entomology and Zoology, 55 , 361–365. 10.1007/s13355-020-00692-9
Haye, T. , Gariepy, T. , Hoelmer, K. , Rossi, J.‐P. , Streito, J.‐C. , Tassus, X. , & Desneux, N. (2015). Range expansion of the invasive brown marmorated stinkbug, Halyomorpha halys: An increasing threat to field, fruit and vegetable crops worldwide. Journal of Pest Science, 88 , 665–673. 10.1007/s10340-015-0670-2
Haye, T. , Wyniger, D. , & Gariepy, T. (2014). Recent range expansion of Brown marmorated stink bug in Europe . Presented at the proceedings of the eighth international conference on urban pests, Zurich (pp. 309–314). 10.1007/s10340-013-0529-3
Hepler, J. , Cooper, R. , & Beers, E. (2021). Host plant signal persistence in the gut of the Brown marmorated stink bug (Hemiptera: Pentatomidae). Environmental Entomology, 50 , 202–207. 10.1093/ee/nvaa152 33595659
Hepler, J. R. , Cooper, W. R. , Cullum, J. P. , Dardick, C. , Dardick, L. , Nixon, L. J. , Pouchnik, D. J. , Raupp, M. J. , Shrewsbury, P. , & Leskey, T. C. (2023). Do adult Magicicada (Hemiptera: Cicadidae) feed? Historical perspectives and evidence from molecular gut content analysis. Journal of Insect Science, 23 , 13. 10.1093/jisesa/iead082
Hereward, J. P. , & Walter, G. H. (2012). Molecular interrogation of the feeding behaviour of field captured individual insects for interpretation of multiple host plant use. PLoS One, 7 , e44435. 10.1371/journal.pone.0044435 23028538
Hess, B. , Zimmermann, O. , Baufeld, P. , Reißig, A. , Lutsch, B. , & Schrader, G. (2022). Current distribution and spatial spread patterns of Halyomorpha halys in Germany. EPPO Bulletin, 52 , 164–174. 10.1111/epp.12828
Hoebeke, R. E. , & Carter, M. E. (2003). Halyomorpha halys (Stål) (Heteroptera: Pentatomidae): A polyphagous plant pest from Asia newly detected in North America. Proceedings of the Entomological Society of Washington, 105 , 225–237.
Holthouse, M. C. , Spears, L. R. , & Alston, D. G. (2021). Urban host plant utilisation by the invasive Halyomorpha halys (Stål) (Hemiptera, Pentatomidae) in northern Utah. NeoBiota, 64 , 87–101. 10.3897/neobiota.64.60050
Ings, T. C. , Montoya, J. M. , Bascompte, J. , Blüthgen, N. , Brown, L. , Dormann, C. F. , Edwards, F. , Figueroa, D. , Jacob, U. , Jones, J. I. , Lauridsen, R. B. , Ledger, M. E. , Lewis, H. M. , Olesen, J. M. , Van Veen, F. J. F. , Warren, P. H. , & Woodward, G. (2009). Review: Ecological networks – Beyond food webs. The Journal of Animal Ecology, 78 , 253–269. 10.1111/j.1365-2656.2008.01460.x 19120606
Kenis, M. , Auger‐Rozenberg, M.‐A. , Roques, A. , Timms, L. , Péré, C. , Cock, M. J. W. , Settele, J. , Augustin, S. , & Lopez‐Vaamonde, C. (2009). Ecological effects of invasive alien insects. Biological Invasions, 11 , 21–45. 10.1007/s10530-008-9318-y
Khanam, S. , Howitt, R. , Mushtaq, M. , & Russell, J. C. (2016). Diet analysis of small mammal pests: A comparison of molecular and microhistological methods. Integrative Zoology, 11 , 98–110. 10.1111/1749-4877.12172 27001489
Kitson, J. J. N. , Warren, B. H. , Vincent Florens, F. B. , Baider, C. , Strasberg, D. , & Emerson, B. C. (2013). Molecular characterization of trophic ecology within an Island radiation of insect herbivores (Curculionidae: Entiminae: Cratopus). Molecular Ecology, 22 , 5441–5455. 10.1111/mec.12477 24112379
Kriticos, D. J. , Kean, J. M. , Phillips, C. B. , Senay, S. D. , Acosta, H. , & Haye, T. (2017). The potential global distribution of the brown marmorated stink bug, Halyomorpha halys, a critical threat to plant biosecurity. Journal of Pest Science, 90 , 1033–1043. 10.1007/s10340-017-0869-5
Lee, D.‐H. , Short, B. D. , Joseph, S. V. , Bergh, J. C. , & Leskey, T. C. (2013). Review of the biology, ecology, and management of Halyomorpha halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea. Environmental Entomology, 42 , 627–641. 10.1603/EN13006 23905725
Leskey, T. C. , & Nielsen, A. L. (2018). Impact of the invasive Brown marmorated stink bug in North America and Europe: History, biology, ecology, and management. Annual Review of Entomology, 63 , 599–618. 10.1146/annurev-ento-020117-043226
Loit, K. , Adamson, K. , Bahram, M. , Puusepp, R. , Anslan, S. , Kiiker, R. , Drenkhan, R. , & Tedersoo, L. (2019). Relative performance of MinION (Oxford nanopore technologies) versus sequel (Pacific biosciences) third‐generation sequencing instruments in identification of agricultural and Forest fungal pathogens. Applied and Environmental Microbiology, 85 , e01368‐19. 10.1128/AEM.01368-19 31444199
Lomate, P. R. , & Bonning, B. C. (2016). Distinct properties of proteases and nucleases in the gut, salivary gland and saliva of southern green stink bug, Nezara viridula . Scientific Reports, 6 , 27587. 10.1038/srep27587 27282882
Lomate, P. R. , & Bonning, B. C. (2018). Proteases and nucleases involved in the biphasic digestion process of the brown marmorated stink bug, Halyomorpha halys (Hemiptera: Pentatomidae). Archives of Insect Biochemistry and Physiology, 98 , e21459. 10.1002/arch.21459 29527721
Macías‐Hernández, N. , Athey, K. , Tonzo, V. , Wangensteen, O. S. , Arnedo, M. , & Harwood, J. D. (2018). Molecular gut content analysis of different spider body parts. PLoS One, 13 , e0196589. 10.1371/journal.pone.0196589 29847544
Maistrello, L. , Dioli, P. , Bariselli, M. , Mazzoli, G. L. , & Giacalone‐Forini, I. (2016). Citizen science and early detection of invasive species: Phenology of first occurrences of Halyomorpha halys in southern Europe. Biological Invasions, 18 , 3109–3116. 10.1007/s10530-016-1217-z
Medal, J. , Smith, T. , Fox, A. , Cruz, A. S. , Poplin, A. , & Hodges, A. (2012). Rearing the Brown marmorated stink bug Halyomorpha halys (Heteroptera: Pentatomidae). Florida Entomologist, 95 , 800–802. 10.1653/024.095.0339
Ohbayashi, T. , Takeshita, K. , Kitagawa, W. , Nikoh, N. , Koga, R. , Meng, X.‐Y. , Tago, K. , Hori, T. , Hayatsu, M. , Asano, K. , Kamagata, Y. , Lee, B. L. , Fukatsu, T. , & Kikuchi, Y. (2015). Insect's intestinal organ for symbiont sorting. Proceedings of the National Academy of Sciences of the United States of America, 112 , E5179–E5188. 10.1073/pnas.1511454112 26324935
Ollivier, M. , Lesieur, V. , Raghu, S. , & Martin, J.‐F. (2020). Characterizing ecological interaction networks to support risk assessment in classical biological control of weeds. Current Opinion in Insect Science, 38 , 40–47. 10.1016/j.cois.2019.12.002 32088650
Pitt, W. J. , Cooper, W. R. , Pouchnik, D. , Headrick, H. , & Nachappa, P. (2024). High‐throughput molecular gut content analysis of aphids identifies plants relevant for potato virus Y epidemiology. Insect Science. 10.1111/1744-7917.13327 [Epub ahead of print].
Pumariño, L. , Alomar, O. , & Agustí, N. (2011). Development of specific ITS markers for plant DNA identification within herbivorous insects. Bulletin of Entomological Research, 101 , 271–276. 10.1017/S0007485310000465 21092379
R Core Team . (2022). R: A language and environment for statistical computing. R Foundation for Statistical Computing.
Rice, K. B. , Bergh, C. J. , Bergmann, E. J. , Biddinger, D. J. , Dieckhoff, C. , Dively, G. , Fraser, H. , Gariepy, T. , Hamilton, G. , Haye, T. , Herbert, A. , Hoelmer, K. , Hooks, C. R. , Jones, A. , Krawczyk, G. , Kuhar, T. , Martinson, H. , Mitchell, W. , Nielsen, A. L. , … Tooker, J. F. (2014). Biology, ecology, and Management of Brown Marmorated Stink bug (Hemiptera: Pentatomidae). Journal of Integrated Pest Management, 5 , 1–13. 10.1603/IPM14002
Serrano, J. M. , Cook, R. , Headrick, H. , & Cooper, W. R. (2023). Dietary history of click beetles and wireworms in the genus Limonius (Coleoptera: Elateridae) revealed by molecular gut content analysis. Environmental Entomology, 53 , 173–179. 10.1093/ee/nvad114
Srivathsan, A. , Baloğlu, B. , Wang, W. , Tan, W. X. , Bertrand, D. , Ng, A. H. Q. , Boey, E. J. H. , Koh, J. J. Y. , Nagarajan, N. , & Meier, R. (2018). A MinION™‐based pipeline for fast and cost‐effective DNA barcoding. Molecular Ecology Resources, 18 , 1035–1049. 10.1111/1755-0998.12890
Staudacher, K. , Wallinger, C. , Schallhart, N. , & Traugott, M. (2011). Detecting ingested plant DNA in soil‐living insect larvae. Soil Biology and Biochemistry, 43 , 346–350. 10.1016/j.soilbio.2010.10.022 21317975
Szoboszlay, M. , Schramm, L. , Pinzauti, D. , Scerri, J. , Sandionigi, A. , & Biazzo, M. (2023). Nanopore is preferable over Illumina for 16S amplicon sequencing of the gut microbiota when species‐level taxonomic classification, accurate estimation of richness, or focus on rare taxa is required. Microorganisms, 11 , 804. 10.3390/microorganisms11030804 36985377
Taylor, C. M. , Coffey, P. L. , Hamby, K. A. , & Dively, G. P. (2017). Laboratory rearing of Halyomorpha halys: Methods to optimize survival and fitness of adults during and after diapause. Journal of Pest Science, 90 , 1069–1077. 10.1007/s10340-017-0881-9
Tedersoo, L. , Drenkhan, R. , Anslan, S. , Morales‐Rodriguez, C. , & Cleary, M. (2019). High‐throughput identification and diagnostics of pathogens and pests: Overview and practical recommendations. Molecular Ecology Resources, 19 , 47–76. 10.1111/1755-0998.12959 30358140
van der Reis, A. L. , Beckley, L. E. , Olivar, M. P. , & Jeffs, A. G. (2022). Nanopore short‐read sequencing: A quick, cost‐effective and accurate method for dna metabarcoding. Environmental DNA, 5 , 282–296. 10.1002/edn3.374
Van Dijck, T. , Klerkx, H. , Thijs, S. , Rineau, F. , Van Mechelen, C. , & Artois, T. (2023). Sedum as host plants for caterpillars? Introducing gut content metabarcoding to green roof research. Urban Ecosystem, 26 , 955–965. 10.1007/s11252-023-01357-5
Wallinger, C. , Staudacher, K. , Schallhart, N. , Peter, E. , & Juen, A. (2013). The effect of plant identity and the level of plant decay on molecular gut content analysis in a herbivorous soil insect. Molecular Ecology Resources, 13 , 75–83.23167731
Wang, Q. , Bao, W.‐F. , Yang, F. , Xu, B. , & Yang, Y.‐Z. (2017). The specific host plant DNA detection suggests a potential migration of Apolygus lucorum from cotton to mungbean fields. PLoS One, 12 , e0177789. 10.1371/journal.pone.0177789 28586352
Wermelinger, B. , Wyniger, D. , & Forster, B. (2008). First records of an invasive bug in Europe: Halyomorpha halys Stål (Heteroptera: Pentatomidae), a new pest on woody ornamentals and fruit trees? Mitteilungen der Schweizerischen Entomologischen Gesellschaft, 81 , 1–8.
White, T. J. , Bruns, T. , Lee, S. , & Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR ‐ Protocols and Applications ‐ A Laboratory Manual (pp. 315–322). Academic Press.
Wickham, H. (2016). ggplot2: Elegant graphics for data analysis. Springer‐Verlag. https://ggplot2.tidyverse.org
Wilke, C. O. (2023). Cowplot: Streamlined plot theme and plot annotations for “ggplot2” . R package version 1.1.2. https://wilkelab.org/cowplot/
Zhu, C. , Gravel, D. , & He, F. (2019). Seeing is believing? Comparing plant‐herbivore networks constructed by field co‐occurrence and DNA barcoding methods for gaining insights into network structures. Ecology and Evolution, 9 , 1764–1776. 10.1002/ece3.4860 30847071
