
==== Front
ISME J
ISME J
ismej
The ISME Journal
1751-7362
1751-7370
Oxford University Press

39113594
10.1093/ismejo/wrae154
wrae154
Original Article
AcademicSubjects/SCI00010
AcademicSubjects/SCI00960
AcademicSubjects/SCI01150
AcademicSubjects/SCI02281
Large attachment organelle mediates interaction between Nanobdellota archaeon YN1 and its host
Johnson Matthew D Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Sakai Hiroyuki D Department of Science and Engineering for Sustainable Innovation, Faculty of Science and Engineering, Soka University, Hachioji, Tokyo 192-8577, Japan
Japan Collection of Microorganisms, RIKEN BioResource Research Center, Tsukuba, Ibaraki 305-0074, Japan

Paul Bindusmita Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Nunoura Takuro Research Center for Bioscience and Nanoscience (CeBN), Japan Agency for Marine-Earth Science & Technology (JAMSTEC), Yokosuka 237-0061, Japan

Dalvi Somavally Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Mudaliyar Manasi Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Shepherd Doulin C Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Shimizu Michiru Japan Collection of Microorganisms, RIKEN BioResource Research Center, Tsukuba, Ibaraki 305-0074, Japan

Udupa Shubha Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Ohkuma Moriya Japan Collection of Microorganisms, RIKEN BioResource Research Center, Tsukuba, Ibaraki 305-0074, Japan

Kurosawa Norio Department of Science and Engineering for Sustainable Innovation, Faculty of Science and Engineering, Soka University, Hachioji, Tokyo 192-8577, Japan

Ghosal Debnath Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia
ARC Centre for Cryo-electron Microscopy of Membrane Proteins, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia

Corresponding author: Debnath Ghosal, Department of Biochemistry and Pharmacology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Melbourne, VIC 3010, Australia. Email: debnath.ghosal@unimelb.edu.au
Matthew D. Johnson, Hiroyuki D. Sakai equally contributed this work as co-first authors.

Bindusmita Paul, Takuro Nunoura and Somavally Dalvi contributed this work as co-second authors.

1 2024
08 8 2024
08 8 2024
18 1 wrae15401 4 2024
25 6 2024
07 8 2024
06 9 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of the International Society for Microbial Ecology.
2024
https://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

DPANN archaea are an enigmatic superphylum that are difficult to isolate and culture in the laboratory due to their specific culture conditions and apparent ectosymbiotic lifestyle. Here, we successfully isolated and cultivated a coculture system of a novel Nanobdellota archaeon YN1 and its host Sulfurisphaera ohwakuensis YN1HA. We characterized the coculture system by complementary methods, including metagenomics and metabolic pathway analysis, fluorescence microscopy, and high-resolution electron cryo-tomography (cryoET). We show that YN1 is deficient in essential metabolic processes and requires host resources to proliferate. CryoET imaging revealed an enormous attachment organelle present in the YN1 envelope that forms a direct interaction with the host cytoplasm, bridging the two cells. Together, our results unravel the molecular and structural basis of ectosymbiotic relationship between YN1 and YN1HA. This research broadens our understanding of DPANN biology and the versatile nature of their ectosymbiotic relationships.

archaea
DPANN
intercellular communication
protein filament
microbial symbiosis
in situ structural biology
cryo-electron tomography
NHMRC 10.13039/501100000925 APP1196924 Japan Society for the Promotion of Science 10.13039/501100001691 21K15153 24K18201
==== Body
pmcIntroduction

The DPANN superphylum (an acronym of the names of first five lineages: “Ca. Diapherotrites”, “Ca. Parvarchaeota”, “Ca. Aenigmarchaeota”, “Ca. Nanohaloarchaeota,” and “Ca. Nanoarchaeota”) [1], is one of the most enigmatic groups in microbial ecosystems. Their metagenome-assembled genomes (MAGs) from diverse environments have been reported over the last few years, revealing that DPANN account for approximately half of all archaeal diversity [2, 3].

DPANN organisms are distinguished by their diminutive size, reduced genomes, and limited metabolic abilities. Therefore, the majority of the DPANN thrive in mutualistic, commensal, or parasitic associations with a variety of archaeal and bacterial hosts [2, 4–9]. Despite their widespread occurrence, and important role in microbial ecology and environment, very little is known about their cell biology, metabolic potential, and molecular/structural basis of their symbiosis. A considerable hurdle in the study of DPANN lies in the difficulty of isolating and establishing new DPANN coculture systems. Consequently, very few DPANN coculture systems have been established and investigated to date [4, 5, 10–13].

We have established a new coculture system composed of a novel Nanobdellota archaeon YN1 and its host Sulfurisphaera ohwakuensis YN1HA. We used microbiology, metagenomics and metabolic pathway analysis, fluorescence microscopy, and high-resolution electron cryo-tomography to characterize the YN1–YN1HA interaction. Our analyses revealed the growth characteristics and genomic features of YN1 and uncovered an attachment organelle in the YN1 envelope that bridges the host and DPANN cytoplasm, facilitating this ectosymbiotic relationship.

Materials and methods

Sampling

Approximately 50 ml of hot water samples containing a small quantity of mud were collected in polypropylene tubes at an acidic hot spring Yunoike in Kirishima geothermal area located in Kagoshima prefecture, Japan. Temperature and pH at the sampling site were 78°C and pH 2.7, respectively [14]. The sample in a plastic tube was transported to the laboratory under ambient temperature and used for enrichment culture.

Enrichment culture

Enrichment culture was conducted using modified Brock’s basal salt medium [15] supplemented with 0.1% (w/v) yeast extract (MBSY medium). The pH of the medium was adjusted to 2.9. One hundred microliters of each sample was inoculated into 10 ml MBSY medium in a 20 ml screw-capped test tube (16.5 × 105 mm, ST-16.5L, Nichiden-rika glass, Kobe, Japan) and incubated on static condition at 80°C. Microbial growth of the enrichment cultures was regularly monitored by measuring the optical density at 600 nm. When growth entered stationary phase, 2 ml of each enrichment culture was centrifuged (20 000 rcf, 25°C, 30 min) and the resulting pellet was used for DNA extraction for 16S ribosomal RNA (rRNA) gene amplicon sequencing. The rest of the enrichment culture was stored in a freezer at −80°C with 10% (v/v) glycerol as a cryoprotectant reagent. The cryostock was later used for the establishment of pure coculture composed of a Nanobdellota archaeon (strain YN1) and its host S. ohwakuensis (strain YN1HA).

16S rRNA gene amplicon sequencing

Microbial DNA from the enrichment culture was extracted using Extrap Soil DNA Plus Kit version 2 (Nippon Steel and Sumikin Eco-Tech). The extracted DNA was used for the 16S rRNA gene amplicon sequencing. The V3–V4 region of 16S rRNA was amplified using the DNA polymerase KOD Fx Neo (TOYOBO) with primers A340F [16] and 806rB [17] (with barcode for MiSeq System). The following thermal cycler protocol was used: an initial denaturation of 2 min at 94°C, 25 cycles of 10 s denaturation at 98°C, 30 s annealing at 50°C, followed by 68°C for 15 s, and a final extension of 68°C for 5 min. The PCR product was sent to a sequencing company (Fasmac, Kanagawa, Japan), and the 16S rRNA gene amplicon sequencing was carried out using a MiSeq sequencer (300 bp × 2; Illumina). The microbial community structure of the enrichment culture was investigated by the QIIME2 pipeline [18], followed by BLASTN search against nt database in NCBI.

Primer design

The specific primers targeting the 16S rRNA gene for a Nanobdellota archaeon (NanoF: GGCGAAATGCAGTAATCCCG, NanoR2: TAACGGCTTCCCTATCCCAC) detected in the enrichment culture were designed by using Primer BLAST [19], while those for other detected archaea (Sulfolobales species) were designed as previously described [20].

Establishment of pure coculture and isolation of pure host

To establish a pure coculture only composed of a Nanobdellota archaeon and its host, dilution to extinction method was carried out three times under the same condition as enrichment culture. The presence of a Nanobdellota archaeon was confirmed by quantitative PCR (qPCR) with specific primers, and the most diluted culture containing the Nanobdellota archaeon was always chosen for the next purification step (dilution to extinction). The same PCR cycling conditions as described previously [20] were used. A pure culture of host was isolated by single colony isolation from the pure coculture using an MBSY plate medium solidified with 0.7% (w/v) gellan gum (Wako), 10 mM MgSO4, and 2.5 mM CaCl2.

Genome sequencing and assembly

Microbial cells were collected by centrifugation (15 880 rcf, 10 min) from the pure coculture. Genomic DNA was extracted from the cells using Genomic-Tip 100/G (QIAGEN). To obtain long reads, a DNA library was prepared following the protocol as described by Oxford Nanopore Technologies (NBE_9065_v109_revZ_ 14Aug2019), followed by sequencing with MinION sequencer using R9 flow cell (Oxford Nanopore Technologies). To obtain short reads, the genomic DNA was sent to Novogene Bioinformatics Technology (China) to be sequenced on a NovaSeq 6000 platform (2 × 150 bp; Illumina). The short and long reads were quality-filtered with using the same protocol as described previously [21] and coassembled using Unicycler (ver. 0.4.8) [22]. To ensure the purity of the coculture, the quality-filtered short reads were mapped against genome assemblies using CoverM v.0.7.0 [23].

Genome analysis

Annotation of genome sequences was carried out using Prokka (ver. 1.14.6) [24], DFAST [25], RAST server [26], Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway tools [27], eggNOG-mapper (ver. 2.1.12) [28], COGclassifier (https://github.com/moshi4/COGclassifier), and hmmscan against MEROPS [29]. The annotated data obtained by these programs were manually curated. Subcellular localization of each protein encoded in the genome sequences was predicted using PSORTb 3.0.314. The 16S rRNA gene sequence similarity between YN1 and its most related species Nanobdella aerobiophila MJ1T was calculated by BLASTN, whereas their average amino acid identity (AAI) was calculated using the Kostas laboratory server (enve-omics.ce.gatech.edu/aai/).

Phylogenomic analysis

To conduct the phylogenomic analysis of strain YN1, amino acid sequences of 53 archaeal marker genes defined by the GTDB database (release 214) [30] were collected using GTDB-Tk (ver. 2.3.0) [31]. The collected sequences were realigned by MUSCLE [32], followed by trimming using TrimAL [33] with automated1 option. A maximum likelihood phylogenetic tree was reconstructed using IQ-TREE2 [34] with the LG + F + R6 model. Bootstrap support values were calculated with 1000 replicates.

Growth monitoring

The growth of a Nanobdellota archaeon YN1 and its host S. ohwakuensis YN1HA in pure coculture or pure culture was monitored by qPCR with specific primers for each species. The same protocols as described previously [20] was used. In brief, microbial DNAs regularly extracted from cultures were applied to qPCR with specific primers targeting 16S rRNA gene, which is a single copy gene for each strain. Cultivation was conducted in triplicate to compare YN1HA growth between coculture and pure culture and in duplicate to examine the growth temperature and pH ranges for YN1 and YN1HA.

Light microscopy and scanning electron microscopy

General cell morphology was assessed by phase contrast microscopy (Optiphot-2; Nikon) and differential interference contrast microscopy (BX51; Olympus) at room temperature. The cells stained with SYBR Green I by the same protocol as described previously [20] were observed by fluorescent microscopy (BX51; Olympus). Scanning electron microscopy (JSM-7500F; JEOL) was carried out using the same protocols as described previously [20]. Samples for these observations were collected on Day 3 or Day 4.

Fluorescent in situ hybridization

Fluorescent in situ hybridization (FISH) was conducted using the method as previously described [35] with some modifications. Samples for FISH analysis was collected on Day 3. The FISH probes used for YN1 (Nano-R4_TEX: GTATTCCCGTGGCGACTGC) and YN1HA (SFB-R_FAM: CGGTTACTAGGGATTCCTCG), both targeting the 16S rRNA gene were designed using Primer BLAST [19]. The probes were labelled with either Texas-red or 6-carboxyfluorescein at their 5′ end. Cells were fixed with 2% paraformaldehyde for overnight, washed in phosphate-buffered saline (PBS), and resuspended in PBS before spotting 15 μl onto a silane-coated glass slide (S8111; MATSUNAMI). The spotted sample was dried; incubated in 100 μl of 0.25 N HCl solution for 30 min at room temperature; rinsed in distilled water; and dehydrated by serial treatment with 50%, 80%, 90%, and 100% ethanol solutions (3 min each, two times). Hybridization was carried out with the probes (final concentration: 1 pmol/μl each) in buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.1% SDS, pH 7.5) at 48°C overnight. After hybridization, the slide was washed in buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.1% SDS, 5 mM EDTA, pH 7.5) at 48°C for 20 min, lightly rinsed in distilled water, and enclosed with mounting medium (SlowFade Gold Antifade reagent; Life Technologies). The fluorescence signals were detected with an epifluorescence microscope (BX63; Olympus) fitted with filter sets specific for Texas red and fluorescein.

Cocultivation experiments of YN1 with various thermoacidophilic species

To investigate the host specificity of YN1, the following thermoacidophilic strains were cocultivated with YN1: M. sedula DSM5348T, M. hakonensis DSM7519T, M. cuprina JCM15769T, Sulfodiicoccus acidiphilus HS-1T, Sulfuracidifex tepidarius JCM16833T, Saf. metallicus DSM6482T, Saccharolobus solfataricus JCM8930T, Scl. shibatae DSM5389T, Scl. caldissimus HS-3T, Sulfolobus acidocaldarius DSM639T, S. ohwakuensis TA-1T, S. ohwakuensis YN1HA (original host), and S. javensis KD-1T. These strains were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ) or Japan Collection of Microorganisms (JCM), except for Sfd. acidiphilus HS-1T, Scl. caldissimus HS-3T, S. ohwakuensis TA-1T, and S. javensis KD-1T, which were originally isolated and stored in our laboratory (Soka University). They were cultivated in MBSY medium (pH 3.0), with the exception of Saf. tepidarius JCM16833T and Saf. metallicus DSM6482T, which were cultivated in MBSY medium with 1 g/L elemental sulfur. Pure YN1 cells were collected from the original pure coculture (YN1 + YN1HA) by filtration using a sterilized syringe filter (pore size: 0.45 μm; material: polyethersulfone). Sixty microliters of each pure culture and 600 μl of the filtrate containing YN1 cells were inoculated into 6 ml of cultivation medium in a 20 ml screw-capped test tube (16.5 × 105 mm, ST-16.5 L, Nichiden-rika glass, Kobe, Japan). As a negative control, 1 ml of the filtrate was added to 5 ml of MBSY medium without the inoculation of any of the strains. All cultivations were conducted in duplicate. The incubation temperatures were set at 65°C for genera Metallosphaera, Sulfodiicoccus, and Sulfuracidifex; 75°C for Scl. solfastricus, Scl. shibatae, Slf. acidocacldarius; and 80°C for S. ohwakuensis YN1HA, S. ohwakuensis TA1T, and Scl. caldissimus HS-3T (under oxic conditions). Growth of YN1 was assessed by qPCR with specific primers at stationary growth phase.

Sample vitrification and CryoET data acquisition

Samples for cryoET were collected on Day 3. Before vitrification, archaeal cocultures were mixed in a 2:1 ratio with 10 nm colloidal gold beads precoated with 1% BSA (Sigma-Aldrich, Australia). The mixture was added onto glow-discharged copper R2/2 Quantifoil holey carbon grids (Quantifoil Micro Tools GmbH, Jena, Germany). Grids were blotted for 6–8 s (under 100% humidity conditions) and plunged into liquid ethane using a Vitrobot Mark IV, FEI (Thermo Fisher Scientific). Micrographs of YN1 cocultures were acquired using an FEI Titan Krios G4, 300 keV FEG transmission electron microscope (Thermo Fisher Scientific), equipped with a BioQuantum K3 Imaging Filter (slit width 20 eV), and a K3 direct electron detector (Gatan). Tilt series were collected automatically using FEI Tomography 5.10 from −60° to +60° at 2° intervals with a defocus of −6 μm and a total electron fluence of 120 e−/Å2 and a pixel size of 3.39 Å.

Tomogram reconstruction

Before processing of tilt series, tilt images of poor quality were identified and removed through visual inspection. The cleaned tilt series were aligned using fiducial tracking in IMOD (Version 4.11.5) [36, 37] and subsequently binned four times (13.56 Å/pix). Tomo3D (version 2.2) [38] was used to generate Simultaneous Iterative Reconstruction Technique (SIRT)-reconstructed tomograms from aligned tilt series, which were then filtered to enhance contrast using the deconvolution filter in IsoNet [39].

Tomogram segmentation and visualization/3D segmentation

Visualization and segmentation of tomograms were conducted using the Dragonfly software (https://www.theobjects.com/dragonfly/index.html). Tomograms were preprocessed using built-in filters, including histogram equalization, gaussian, and unsharp filters. Neural network 5-class U-Net (with 2.5D input of 5 slices), were trained on tomogram slices to recognize YN1 cytoplasmic membrane, YN1 outer layer, YN1HA cytoplasmic membrane, YN1HA outer layer, cones = pink, cytoplasmic filaments, intercellular filaments, intercellular sheath filament, and ribosomes and further fine-tuned to achieve high-quality segmentation for automated 3D segmentation. The software’s built-in tools for exporting 2D images and creating 3D movies were utilized.

Results

Nanobdellota DPANN–host coculture system

From an initial enrichment culture, three archaeal taxa were detected: S. ohwakuensis [15], Scl. solfataricus [40], and a novel archaeon belonging to the Nanobdellota [41] (Fig. 1A). Using the enrichment culture as a starting material, we attempted to establish a pure coculture by dilution to extinction method [42]. During each purification attempt, we confirmed the presence of the Nanobdellota archaeon using qPCR with specific primers, and the most diluted culture containing the Nanobdellota archaeon was always chosen for the next purification step. After three rounds of purification attempts, a pure coculture composed of a Nanobdellota archaeon (strain YN1) and S. ohwakuensis (strain YN1HA) was successfully established (Fig. 1B). The purity was checked by shotgun genome sequencing of genomic DNA extracted from the coculture. As a result of hybrid assembly of HiSeq short and Nanopore long reads, two complete circular genomes having 773 326 bp (for YN1) and 2 761 125 bp (for YN1HA), respectively, were obtained. No other contigs encoding any prokaryotic marker gene and none of the other sequence fragments were obtained from the hybrid assembly. Besides, 99.7% of the short reads (6 737 386 out of 6 755 440 quality-filtered reads) were mapped to the two genomes, indicating that this coculture can be reliably considered a pure coculture.

Figure 1 YN1 and YN1HA coculture system, metagenomics, growth, and association. (A) Pie chart depicting the archaeal community structure of initial enrichment culture, based on the 16S rRNA amplicon analysis. (B) Growth curve analysis of pure YN1HA and in coculture with YN1 using 16S-rRNA quantification. The error bars indicate the standard deviation based on three culture replicates. (C) The maximum-likelihood tree was reconstructed using iqtree2 with the LG + F + R6 model. The tree was reconstructed based on 53 archaeal maker protein sequences obtained from GTDB-tk (release214). The scale bar represents 0.1 amino acid substitutions per sequence position. Bootstrap values are indicated at nodes. The numbers next to the nodes at the collapsed clades are the numbers of sequences used. (D) The maximum-likelihood tree was reconstructed using iqtree2 with the GTR + F + R3 model. The tree was reconstructed based on 16S rRNA gene sequences obtained from Genbank. The scale bar represents 0.1 nucleotide substitutions per sequence position. Bootstrap values are indicated at nodes. (E) FISH of YN1-YN1HA coculture. Red (small cells): Nanobdellota archaeon YN1, green (large cells): S. ohwakuensis YN1HA.

The genome of strain YN1 has 889 protein coding sequences (CDSs), 3 rRNAs, and 43 transfer RNA (tRNAs), with a guanine-cytosine (GC) content of 23.4%, whereas that of S. ohwakuensis YN1HA has 3130 CDSs, 2 rRNAs, and 47 tRNAs, with a GC content of 32.6% (Supplementary Tables 1 and 2). Phylogenomic analysis using amino acid sequences of 53 archaeal marker genes derived from the database [30] placed YN1 within the phylum Nanobdellota (Fig. 1C). The closest relative of YN1 was Nanobdella aerobiophila MJ1T, whose host was reported to be Metallosphaera sedula MJ1HA. This was in good agreement with the fact that YN1 and N. aerobiophila, but not other cultivated representatives in the phylum Nanobdellota, can grow under toxic conditions. The topology of phylogenetic tree based on the 16S rRNA gene sequence was almost the same as that of the based on 53 archaeal marker genes (Fig. 1C and D). The 16S rRNA gene sequence similarity between strain YN1 and N. aerobiophila MJ1T was only 86.5%, significantly below the highly reliable threshold value of 94.5% [43] for defining prokaryotic genera. The growth temperature of YN1 (55°C–95°C) is higher than that of N. aerobiophila (60°C–75°C). In addition, the host species of YN1 is different from that of N. aerobiophila (i.e. M. sedula). These differences indicate that strain YN1 represents a novel genus within the phylum Nanobdellota. Therefore, we propose a novel genus and species “Candidatus Nanofervidus parviconus” gen. nov. sp. nov. to accommodate strain YN1 (Na.no.fer’vi.dus. Gr. masc. n. nânos, a dwarf; L. masc. adj. fervidus, hot; N.L. masc. n. Nanofervidus, a thermophilic small-sized microorganism. Parviconus par’vi.co’nus. L. masc. adj. parvus, little; L. masc. n. conus, cone; N.L. fem. n. parviconus).

Growth conditions of the coculture system were investigated to establish an optimum. The growth temperature and pH ranges for YN1 were 55°C–95°C and pH 2.0–3.0, respectively, while those for S. ohwakuensis YN1HA were 55°C–95°C and pH 1.5–5.5, respectively (Supplementary Fig. 1A and B). The optimal conditions for both strains were established as 80°C and pH 3.0. Using these conditions, the growth of YN1 did not occur on the first day (Days 0–1) and the ratio of YN1/YN1HA was decreased from 90.5 to 7.3. After that, YN1 started to grow from Day 1 when its host YN1HA entered the early exponential phase (Fig. 1B). During the middle exponential phase of YN1HA (from Day 1 to Day 2), YN1 exhibited a growth rate almost identical to that of YN1HA, while the ratio of YN1/YN1HA was 3.9 to 7.3. From Day 2 to Day 3, while YN1HA was in the late exponential to early stationary phase, YN1 entered exponential phase and the ratio of YN1/YN1HA increased to 70. At this point, the growth of YN1HA was inhibited compared to pure culture. On Day 4, when YN1HA was in the late stationary phase, the YN1/YN1HA ratio became maximum of 233. After Day 5, YN1 entered the death phase, and the growth of YN1HA was slightly recovered reaching a maximum cell density at Day 7. At this point, the ratio of YN1/YN1HA decreased to 1.5, which was the lowest value observed during this growth experiment (Fig. 1B). FISH analysis confirmed that nanosized cells with ~300 nm in diameter were “Ca. Nanofervidus parviconus” YN1, while relatively larger cells with 1–2 μm in diameter were S. ohwakuensis YN1HA (Fig. 1E). While most YN1HA cells were surrounded by nanosized YN1 cells in the exponential phase (Days 3–4), many free YN1 cells away from the YN1HA cells (Supplementary Fig. 2A and B). Although some of the nanosized cells could be derived from cell debris or vesicles, we believe that most of the nanosized cells observed were YN1, since almost no small fluorescent objects were observed in the YN1HA pure culture (Supplementary Fig. 2C and D).

We observed cell division of YN1 on the surface of the host (Supplementary Fig. 3A–D) and away from the host (Supplementary Fig. 3A–D) in our scanning electron micrographs. During the exponential phase (Days 3–4), the majority of YN1HA cells were surrounded by 1–17 YN1 cells under the phase/fluorescence microscope, although many detached YN1 cells were also observed (Supplementary Figs 2 and 3E). When YN1 cells were physically separated from the YN1HA by filtration (pore size: 0.45 μm), YN1 growth was completely inhibited. A cocultivation screen showed that YN1 only grows on S. ohwakuensis strains as a host but not on other genera and species (i.e. Metallosphaera, Sulfuracidifex, Sulfodiicoccus, Saccharolobus, and Sulfurishaera javensis). Growth of coculture was confirmed by qPCR targeting the 16S rRNA gene of each species after 1–2 weeks of cultivation. Conversely, YN1 was able to grow on different strains of S. ohwakuensis (YN1HA and TA-1T). The motility of individual YN1 cells, on the surface of the host, was not clearly observed under the phase contrast microscope at room temperature. YN1 cells attaching to a host cell seemed to adhere firmly to the point of attachment (SI movie 1).

Figure 2 (A) 2D slice through a 3D tomogram of a representative YN1–YN1HA interaction showing YN1 and YN1HA cells. Pink arrows indicate example cone structures, and purple arrows indicate cytoplasmic filaments; zoomed-in YN1-YN1HA interaction is shown in the inset. (B) Segmentation analysis of the volume shown in (A), YN1 cytoplasmic membrane = light blue, YN1 outer layer = dark blue, YN1HA cytoplasmic membrane = light green, YN1HA outer layer = dark green, cones = pink, cytoplasmic filaments 1 and 2 are shown in purple and light yellow, respectively, intercellular filaments = red, and ribosomes = grey. (C) SEM analysis of an example coculture used in this work showing small YN1 cells attached to larger YN1HA cells. (D) SEM analysis showing example cell division events of YN1 cells separate from the host cell. (E) SEM analysis showing the presence of archaellum. Red, white, and green arrows indicate YN1HA cells, YN1 cells, and YN1 cell division sites, respectively. Yellow arrows indicate the location of example archaellum filaments.

CryoET uncovers an attachment organelle used by YN1 to interact with its host

Electron cryo-tomography (cryoET) is unparalleled in capturing a broad range of biological phenomena from microns to subnanometer scale in their near-native conditions [44–47]. CryoET does not require molecular biology and therefore can be used as an exploratory method to identify and characterize systems that are genetically intractable [48,49]. Here, we utilized cryoET to investigate the structural basis of ectosymbiosis between YN1 and YN1HA at molecular resolution. In our tomograms, the two cell types are clearly distinguishable by their size; YN1 cells measure between ~300 and 600 nm in diameter compared to the host cells, which measure ~1–2 microns in diameter (Fig. 2A–C, SI movie 2). Our data revealed that multiple YN1 cells interact with their host YN1HA; we observed as many as 5 YN1 per YN1HA (2.4 average YN1 per YN1HA, n = 29) (Fig. 2A, Supplementary Table 3). Our cryoET observations were further confirmed by scanning electron microscopy imaging (Fig. 2C–E). Intriguingly, at the interface between YN1 and YN1HA, we observed a cone-shaped large macromolecular structure imbedded in the envelope of YN1 cells (Fig. 2A, SI movie 2). Density for the YN1 inner membrane can be observed on the cytosolic side of the cone. However, the outer S-layer appears to be completely replaced by the cone-shaped assembly. Analysis of these structures in segmented volumes showed that they form open-ended cone-like structures with a wide opening at the base (cytosol facing) and narrow opening at the top (extracellular facing) (Fig. 2B, SI movie 3). We refer to these large structures as “cones” and the narrow opening at the interface of YN1 and YN1HA as “portals.” From our 15 tilt-series, we found a total of 31 YN1 cells and 29 cone structures. All but two YN1 cells contained a cone with a maximum of 1 cone per YN1 cell (Supplementary Table 3). Our measurements of these cone structures showed that they had an average lateral length of 165.9 nm (SD = 51.4 nm, n = 14), average base diameter of 288.4 nm (SD = 82.2 nm, n = 14), and average height of 97.6 nm (SD = 27.6 nm, n = 14) (Supplementary Table 3). We estimated the average lateral surface area of the cones at 8.5 × 104 nm2 (± 4.7 × 104 nm2), which demonstrates their enormous size and overall distribution within our dataset. We found that the cross-sectional thickness of the cones and the size of the portal were much more consistent between different cones; the average cross-sectional thickness and portal diameter was 20.8 nm (SD = 1.8 nm, n = 14) and 20.4 nm (SD = 2.6, n = 14), respectively. In 15 cone structures, we also observed an intercellular filament that passed from the cytoplasm of the YN1 cell to the cytoplasm of the host cell. The filaments passed through the portal of the cone and were attached to the cone via a cytoplasmic gate-like structure (Fig. 2A inset and B). Analysis of the segmented volume revealed that the cytoplasmic membrane of the host cell is contorted through its outer layer (S-layer) to the cone portal (Fig. 2A inset and B inset, SI movie 2). Finally, in 11 of the 31 YN1 cells, we observed filament bundles in the cytoplasm. Using automated segmentation, we trained a u-net to segment these filaments, revealing two different types of intercellular filament (Fig. 2B, SI movie 3, purple filaments and light-yellow filaments). It is unclear if these structures are related to the cones and involved in intercellular bridging, but their measured diameters (6.6 nm, n = 11) were close to those of the intercellular filaments present in the cones. Seemingly, the cone, portal, and intercellular filament together form an “attachment organelle” that facilitates the interaction between YN1 and YN1HA, and this interaction creates a cytoplasmic bridge for resource exchange.

CryoET reveals different stages of interaction between YN1 and YN1HA

Close inspection of our tomograms revealed different stages of interaction between YN1 and YN1HA. Based on the distance between the YN1 and YN1HA, we found three distinct relationships—(i) YN1 cells completely detached from their host, (ii) distally attached with their host, and (iii) forming a tight junction with their host. Interestingly, the detached YN1 cells still harboured the attachment organelle (cone, portal, and filament) (Fig. 3A and B, SI movie 4). This suggests that attachment organelle could exist prior to interaction with the host and/or could remain intact even after YN1 is detached from their host. The distally attached YN1 cells interacted with the host by the intercellular filament structure that protrudes out of the portal from a distance of ~40 nm (Fig. 3C and D, SI movies 5 and 6). Based on previously published cryoET data on sheathed filaments [50,51], we suggest that the intercellular filaments are likely coated in a proteinaceous sheath (Fig. 3C and D, SI movie 6), which was not observed in the fully developed interaction (proximal attachment) depicted in Fig. 2A and B. Finally, we observed YN1 cells proximally attached with the host, bridging the two cytoplasms (Fig. 2A and B, SI movie 3). In a few examples of proximal attachment, the attachment organelle seemingly did not form any cytoplasmic bridge between the two cells (Fig. 3E and F). The attachment organelle appeared in direct contact with the host outer layer, and the intercellular sheathed filament was visibly inside the host and extended more than 400 nm into the host (Fig. 3F, SI movie 6). The biogenesis of this enormous attachment organelle must require considerable resources from YN1, suggesting that this structure is critical for host–DPANN interaction and resource exchange.

Figure 3 Structural basis of interaction between YN1 and YN1HA. (A) 2D slice through a 3D tomogram and (B) segmented volume of a YN1–YN1HA interaction showing separate YN1 and YN1HA cells. (C) 2D slice through a 3D tomogram and (D) segmented volume of a distant YN1–YN1HA interaction. (E) 2D slice through a 3D tomogram and (F) segmented volume of proximal/intimate YN1–YN1HA interaction. YN1 cytoplasmic membrane = light blue, YN1 outer layer = dark blue, YN1HA cytoplasmic membrane = light green, YN1HA outer layer = dark green, cones = pink, cytoplasmic filaments are shown in purple, intercellular filaments = red, intercellular sheath filament = yellow, and ribosomes = grey.

Metabolic pathway analysis of YN1 reveals key dependencies on the host cell

The metabolic pathways of YN1 were predicted on the basis of the genomic annotation (Fig. 4). As in the case of other Nanobdellota archaea, the YN1 genome lacks most of the genes in the central carbon metabolism pathways, including tricarboxylic acid (TCA) cycle; pentose phosphate pathway; respiration; adenosine triphosphate (ATP) synthesis’ carbon fixation; and in the biosynthesis of amino acids, nucleotides, cofactors, vitamins, and lipids. Several genes related to glycolysis and gluconeogenesis were encoded in the YN1 genome; however, in glycolysis, no genes from glucose to glucose-6-phosphate (G6P), from fructose-6-phosphate (F6P) to fructose 1,6-bisphosphate (FBP), and from phosphoenolpyruvate (PEP) to pyruvate were found (Fig. 4). Similarly, in gluconeogenesis, no genes from glycerate 3-phosphate (3PG) to glyceraldehyde-3-phosphate (GAP) were found. In contrast, most of the genes involved in genetic information processing (e.g. transcription, translation, and replication) were encoded in the YN1 genome. Kato et al. recently revealed the cell surface structure of N. aerobiophila MJ1HAT and suggested it has putative S-layer proteins (MJ1_0160 and MJ1_0707) [10]. The YN1 genome also encoded these proteins (YN1_5000 and YN1_2560) with high amino acid sequence similarity to MJ1_0160 (69.5%) and MJ1_0707 (61.7%), respectively. Genes involved in archaellum formation were encoded in the YN1 genome (FlaBDEHIJF). Consistent with the gene detection, the archaellum-like filaments were observed under the scanning electron microscopy (Fig. 2E). Genes involved in defence systems such as types I and IV of restriction and modification systems were identified. The YN1 genome did not contain the CRISPR-Cas system as there was no CRISPR repeats, and only the Cas4 gene was present.

Figure 4 Overview of the potential metabolic capability of YN-1. Metabolic pathways were constructed based on the annotation of predicted genes (Supplementary Table 1). Grey indicates the lack of a gene. Coloured boxes indicate different cellular pathways. A grey box with red cross indicates pathways that are not present in YN1. The total number of genes is indicated in parentheses near the gene name.

Discussion

The nature of DPANN biology and life cycle is enigmatic. Based on the information of their reduced genome, DPANN must require external resources to proliferate, but how they obtain resources and utilize them remains underexplored due to the limited number of coculture systems established to date [4, 8, 10, 20, 52, 53]. Previous work has shown that some DPANN may opt for a parasitic lifestyle, instead of an ectosymbiotic relationship [52]. Furthermore, it has often been suggested that proliferation of the DPANN would occur while attached to the host cell [2, 54]. Our results also show that the YN1 genome lacks most of the genes in the central carbon metabolism, suggesting that it ought to be an obligate symbiont of other microorganisms in its natural habitat. This was also confirmed by our cocultivation experiment, where YN1 did not grow without its host, indicating that YN1 is an obligate symbiont of S. ohwakuensis YN1HA. The growth of S. ohwakuensis YN1HA was significantly inhibited by the presence of YN1 (Fig. 1B), suggesting YN1HA–YN1 interaction might be parasitic. We have observed the narrow range of growth pH in YN1 (pH 2.0–3.0) compared with its host YN1HA (pH 2.0–5.5). A similar observation was reported for N. aerobiophila [41], suggesting that this characteristic is a common feature in Nanobdellota. The presence of most genes involved in genetic information processing and the observation of dividing YN1 cells while detached from their host (Fig. 2D) might imply that YN1 has the capability to undergo cell division away from the host cell, although we cannot exclude the possibility that dividing cells were detached from the host during sample processing. Since YN1 cells adhere firmly to the host (SI movie 1), YN1 cell division is likely to occur while they are attached onto the host.

Homologous genes for the recently suggested putative S-layer proteins of Nanobdellota [10] were found in the YN1 genome (YN1_5000 and YN1_2560), suggesting that these genes may be involved in S-layer formation. The presence of the putative S-layer proteins, having no sequence homology with that of YN1HA, could possibly explain why the cell wall structure of YN1 is different from that of YN1HA (Fig. 4). Additionally, the phenomenon of selective lipid component uptake from host species, as reported in three cultivated representatives of DPANN archaea [41, 55, 56], may also occur in YN1. This selective lipid acquisition could serve as an alternative explanation for the distinct cell wall structures observed between YN1 and its host YN1HA, potentially arising from differences in their respective lipid compositions.

The presence of genes involved in archaellum formation [57] (FlaBDEHIJF) and the observation of archaellum-like structures in our micrographs suggest the potential for motility in YN1 (Fig. 2E). Recently, using live cell imaging at the optimum growth temperature of 65°C, Kato et al. showed that sole N. aerobiophila cells (without host attachment) were not motile despite the presence of archaellum-like filaments [10]. On the contrary, Gaisin et al. reported that free cells of N. aerobiophila are motile [58]. Under our experimental conditions, however, we failed to observe motility of YN1 under light microscopy. It is possible that specific required conditions were not met for motility during our experiment. The diameter of the archaellum-like filaments observed under the SEM was ~18–21 nm (Fig. 2E), which is relatively larger than that of a typical archaellum of 10–14 nm [59]. The relatively larger size of the archaellum filaments was probably caused by a plasma osmium coating (5 s), which could result in a coating thickness of a few nanometres on the surface of the samples. Given the coating thickness, the actual diameter of the archaellum-like filaments should be slightly smaller, which would be consistent with the diameter for a typical archaellum of 10–14 nm. Upon attaching to a host cell, the YN1 cells appeared to adhere firmly to the point of attachment (SI movie 1), suggesting a robust connection between cells of YN1 and YN1HA. The intracellular filament visualized through cryoET may play a role in tethering YN1 firmly to the host cell’s surface, impeding its detachment while facilitating the acquisition of essential nutrients for its proliferation.

The presence of the solo Cas4 gene (with no CRISPR repeat) in the YN1 genome indicates that the CRISPR system does not work in YN1 as a defence system but may have a role for other purposes. It has been reported that most members of the DPANN superphylum encode solo-Cas4, and Cas4 could perform uncharacterized defence (possibly anti-defence) or repair functions in these microorganisms [60].

Our cocultivation experiments confirmed that YN1 grows on different strains of S. ohwakuensis (YN1HA and TA1T) but not on the other genera and species examined so far. (M. sedula DSM5348T, M. hakonensis DSM7519T, M. cuprina JCM15769T, Sulfodiicoccus acidiphilus HS-1T, Sulfuracidifex tepidarius JCM16833T, Saf. metallicus DSM6482T, Scl. solfataricus JCM8930T, Scl. shibatae DSM5389T, Scl. caldissimus HS-3T, S. acidocaldarius DSM639T) [40, 61–66]. This is consistent with the published literature, which has shown that all cultivated Nanobdellota archaea can only use a specific host [7, 41, 67–69]. For instance, a recently described N. aerobiophila MJ1T showed that it only grows with the original host, M. sedula MJ1HA, but not with the type strain of M. sedula TH2T as well as other several different genera and species [41]. A similar observation was also reported for Nanoarchaeum equitans [69], the first cultivated species in the phylum Nanobdellota [7]. In contrast, YN1 was able to grow with different strains of S. ohwakuensis, a unique observation in phylum Nanobdellota. This suggests that this taxon could have a narrow range of host specificity. The fact that the YN1 cells passed through the membrane filter grew with different strains of S. ohwakuensis possibly indicates that the free YN1 cells observed under microscope are living cells and capable of proliferation (Fig. 2D). The archaellum, typically known for its functions in chemotaxis and surface attachment [57], could in principle support free YN1 cells in locating and reattaching to host cells.

DPANN archaea are dependent on other organisms to provide resources for proliferation, previous work has shown that cell–cell connections can form between DPANN archaea and their host; including connecting filaments and cytoplasmic bridges [10, 11, 70]. More recently, cryoET and sub-tomogram averaging were used to determine the in situ structure of proteinaceous tubes that bridge host and DPANN cells [71]. We identified an attachment organelle in the YN1 cell envelope that is used to attach to the YN1HA host cell to form a cytoplasmic bridge. This organelle was comprised of a cone structure with a portal opening, and a filament extension that passes through the portal. When YN1 made intimate contact with the host (proximal attachment), the intercellular filament traversed inside the host and appeared to have a sheath. Similar cone-shaped protein complexes have been previously observed in other microorganisms, e.g. virus-associated pyramids (VAPs) were described in Sulfolobus islandicus [72]. The VAP structure did not have a portal and, although the inner layer of the VAP formed a continuous density with the inner membrane, the VAP was not embedded within the cell envelope as reported in this study. Archaeal cones have also been described in Thermococcus kadokaraensis [49] and Pyrococcus furiosus [73] and were described as an organization center for archaellum assembly. However, these cone structures were cytoplasmic and without a portal. The attachment organelle of YN1 is embedded within the envelope, has filaments passing through the cone’s portal, and is therefore structurally unique. Although it is possible that these previously described structures are evolutionarily linked to the cone structures observed here, the structures are considerably different and likely have completely different functions. In one instance, attachment organelles from different YN1 cells appear to be facing and possibly interacting with each other (Supplementary Fig. 4A and B, SI movie 7). However, the portals of the attachment organelles are not in plane and there is no density connecting them. Recently, the same attachment organelles were observed in an unrelated DPANN–host coculture system comprised of Nanobdella aerobiophila and its host M. sedula [58], which suggests that these structures may be ubiquitous across the Nanobdellota phylum and may interact with a range of hosts.

Our results show that YN1 Nanobdellota assembles an attachment organelle to form direct cytoplasmic bridge with the host cell. We have also described attachment organelles in YN1 cells that are detached from the host, either primed to form an interaction or a relic from a previous interaction. Finally, we described two further attachment stages where the filament, and filament sheath, of the attachment organelle appear to be inserted into the host cytoplasm, while the cone structure remained distally connected. We predict that YN1 has a biphasic lifestyle, an obligate ectosymbiont that uses its host to acquire the essential nutrients for growth, but once fuelled up, YN1 can detach and proliferate in isolation. We propose that the attachment organelle is used to latch onto the host cells and form an intimate interaction that results in the formation of a cytoplasmic bridge between the host cell and YN1, allowing for resource exchange. Many steps in this process remain unanswered, the protein(s) that comprise the attachment organelle are unknown, as is the mechanism by which they assemble this massive macromolecular complex. We identified different types of filaments (and filament bundles) present in the DPANN cytoplasm, but further investigation is required to confirm their identity and functions (Supplementary Fig. 4A–E).

Our work here established a new Nanobdellota coculture system and characterized the structural basis of host-DPANN interaction through a complex attachment organelle. The proteins that comprise this complex remain unknown and are the subject of future research, as is the method by which this enormous organelle assembles into the YN1 membrane, permeates the host’s outer layer, and fuses with the cytoplasm. This research broadens our understanding of DPANN biology and reveals the versatile nature of their ectosymbiotic relationships.

Supplementary Material

SI_26072024_CleanVersion_wrae154

SI_Movie_1_wrae154

SI_Movie_2_wrae154

SI_Movie_3_wrae154

SI_Movie_4_wrae154

SI_Movie_5_wrae154

SI_Movie_6_wrae154

SI_Movie_7_wrae154

Acknowledgements

We thank the Ian Holmes Imaging Centre at the University of Melbourne for access to microscopes.

Conflicts of interest

None declared.

Funding

This project was funded by an NHMRC grant (APP1196924 to D.G.), an HFSP grant (RGEC33/2023) to D.G. and H.D.S., and the Japan Society for the Promotion of Science through Grants-in-Aid for Scientific Research (21K15153 and 24K18201 to H.D.S.).

Data availability

Raw read data of genome sequencing have been deposited in DDBJ/ENA/GenBank under the accession numbers DRR287339 and DRR287338. Genomic sequences of YN1 and S. ohwakuensis YN1HA were deposited under the accession numbers AP031373 and AP031374, respectively.
==== Refs
References

1. Rinke  C, Schwientek  P, Sczyrba  A  et al.  Insights into the phylogeny and coding potential of microbial dark matter. Nature  2013;499 :431–7. 10.1038/nature12352 23851394
2. Dombrowski  N, Lee  J-H, Williams  TA  et al.  Genomic diversity, lifestyles and evolutionary origins of DPANN archaea. FEMS Microbiol Lett  2019;366 :fnz008. 10.1093/femsle/fnz008
3. Vigneron  A, Cruaud  P, Lovejoy  C  et al.  Genomic evidence of functional diversity in DPANN archaea, from oxic species to anoxic vampiristic consortia. ISME COMMUN  2022;2 :1–10. 10.1038/s43705-022-00088-6 37938656
4. Hamm  JN, Erdmann  S, Eloe-Fadrosh  EA  et al.  Unexpected host dependency of Antarctic Nanohaloarchaeota. Proc Natl Acad Sci USA  2019;116 :14661–70. 10.1073/pnas.1905179116 31253704
5. La Cono  V, Messina  E, Rohde  M  et al.  Symbiosis between nanohaloarchaeon and haloarchaeon is based on utilization of different polysaccharides. Proc Natl Acad Sci USA  2020;117 :20223–34. 10.1073/pnas.2007232117 32759215
6. Krause  S, Bremges  A, Münch  PC  et al.  Characterisation of a stable laboratory co-culture of acidophilic nanoorganisms. Sci Rep  2017;7 :3289. 10.1038/s41598-017-03315-6 28607432
7. Huber  H, Hohn  MJ, Rachel  R  et al.  A new phylum of archaea represented by a nanosized hyperthermophilic symbiont. Nature  2002;417 :63–7. 10.1038/417063a 11986665
8. Golyshina  OV, Toshchakov  SV, Makarova  KS  et al.  ‘ARMAN’ archaea depend on association with euryarchaeal host in culture and in situ. Nat Commun  2017;8 :60. 10.1038/s41467-017-00104-7 28680072
9. He  C, Keren  R, Whittaker  ML  et al.  Genome-resolved metagenomics reveals site-specific diversity of episymbiotic CPR bacteria and DPANN archaea in groundwater ecosystems. Nat Microbiol  2021;6 :354–65. 10.1038/s41564-020-00840-5 33495623
10. Kato  S, Tahara  YO, Nishimura  Y  et al.  Cell surface architecture of the cultivated DPANN archaeon Nanobdella aerobiophila. J Bacteriol  2024;206 :e0035123. 10.1128/jb.00351-23 38289045
11. Baker  BJ, Comolli  LR, Dick  GJ  et al.  Enigmatic, ultrasmall, uncultivated archaea. Proc Natl Acad Sci USA  2010;107 :8806–11. 10.1073/pnas.0914470107 20421484
12. Gfrerer  S, Winkler  D, Novion Ducassou  J  et al.  A Micrarchaeon isolate is covered by a proteinaceous S-layer. Appl Environ Microbiol  2022;88 :e0155321. 10.1128/aem.01553-21 35020453
13. Heimerl  T, Flechsler  J, Pickl  C  et al.  A complex endomembrane system in the archaeon Ignicoccus hospitalis tapped by Nanoarchaeum equitans. Front Microbiol  2017;8 :1072. 10.3389/fmicb.2017.01072 28659892
14. Urayama  S, Fukudome  A, Hirai  M  et al.  Double-stranded RNA sequencing reveals distinct riboviruses associated with thermoacidophilic bacteria from hot springs in Japan. Nat Microbiol  2024;9 :514–23. 10.1038/s41564-023-01579-5 38233646
15. Kurosawa  N, Itoh  YH, Iwai  T, Sugai  A, Uda  I, Kimura  N, Horiuchi  T, Itoh  T  Sulfurisphaera ohwakuensis gen. Nov., sp. nov., a novel extremely thermophilic acidophile of the order Sulfolobales. Int J Syst Bacteriol  1998; 48  Pt 2 : 451–6, 10.1099/00207713-48-2-451.9731283
16. Gantner  S, Andersson  AF, Alonso-Sáez  L  et al.  Novel primers for 16S rRNA-based archaeal community analyses in environmental samples. J Microbiol Methods  2011;84 :12–8. 10.1016/j.mimet.2010.10.001 20940022
17. Apprill  A, McNally  S, Parsons  R  et al.  Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat Microb Ecol  2015;75 :129–37. 10.3354/ame01753
18. Bolyen  E, Rideout  JR, Dillon  MR  et al.  Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol  2019;37 :852–7. 10.1038/s41587-019-0209-9 31341288
19. Ye  J, Coulouris  G, Zaretskaya  I  et al.  Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics  2012;13 :134. 10.1186/1471-2105-13-134 22708584
20. Sakai  HD, Nur  N, Kato  S  et al.  Insight into the symbiotic lifestyle of DPANN archaea revealed by cultivation and genome analyses. Proc Natl Acad Sci USA  2022;119 :e2115449119. 10.1073/pnas.2115449119 35022241
21. Omokawa  H, Kurosawa  N, Kato  S  et al.  Complete genome sequence of a novel Sulfolobales archaeon strain, HS-7, isolated from the Unzen hot spring in Japan. Microbiol Resour Announc  2021;10 :e0058221. 10.1128/MRA.00582-21 34553995
22. Wick  RR, Judd  LM, Gorrie  CL  et al.  Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol  2017;13 :e1005595. 10.1371/journal.pcbi.1005595 28594827
23. Cover  M . Read coverage calculator for metagenomics. Available at: https://github.com/wwood/CoverM
24. Seemann  T . Prokka: rapid prokaryotic genome annotation. Bioinformatics  2014;30 :2068–9. 10.1093/bioinformatics/btu153 24642063
25. Tanizawa  Y, Fujisawa  T, Nakamura  Y. DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication. Bioinformatics  2018;34 :1037–9. 10.1093/bioinformatics/btx713 29106469
26. The RAST Server . The RAST server: rapid annotations using subsystems technology. BMC Genomics  2008;9 :75. 10.1186/1471-2164-9-75 18261238
27. Ogata  H, Goto  S, Sato  K  et al.  KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res  1999;27 :29–34. 10.1093/nar/27.1.29 9847135
28. Huerta-Cepas  J, Szklarczyk  D, Forslund  K  et al.  eggNOG 4.5: a hierarchical orthology framework with improved functional annotations for eukaryotic, prokaryotic and viral sequences. Nucleic Acids Res  2016;44 :D286–93. 10.1093/nar/gkv1248 26582926
29. Rawlings  ND, Barrett  AJ, Thomas  PD  et al.  The MEROPS database of proteolytic enzymes, their substrates and inhibitors in 2017 and a comparison with peptidases in the PANTHER database. Nucleic Acids Res  2018;46 :D624–32. 10.1093/nar/gkx1134 29145643
30. Parks  DH, Chuvochina  M, Rinke  C  et al.  GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic Acids Res  2022;50 :D785–94. 10.1093/nar/gkab776 34520557
31. Chaumeil  P-A, Mussig  AJ, Hugenholtz  P  et al.  GTDB-Tk: a toolkit to classify genomes with the genome taxonomy database. Bioinformatics  2020;36 :1925–7. 10.1093/bioinformatics/btz848
32. Edgar  RC . MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res  2004;32 :1792–7. 10.1093/nar/gkh340 15034147
33. Capella-Gutiérrez  S, Silla-Martínez  JM, Gabaldón  T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics  2009;25 :1972–3. 10.1093/bioinformatics/btp348 19505945
34. Minh  BQ, Schmidt  HA, Chernomor  O  et al.  IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol  2020;37 :1530–4. 10.1093/molbev/msaa015 32011700
35. Bond  PL, Banfield  JF. Design and performance of rRNA targeted oligonucleotide probes for in situ detection and phylogenetic identification of microorganisms inhabiting acid mine drainage environments. Microb Ecol  2001;41 :149–61. 10.1007/s002480000063 12032620
36. Kremer  JR, Mastronarde  DN, McIntosh  JR. Computer visualization of three-dimensional image data using IMOD. J Struct Biol  1996;116 :71–6. 10.1006/jsbi.1996.0013 8742726
37. Mastronarde  DN . Correction for non-perpendicularity of beam and tilt axis in tomographic reconstructions with the IMOD package. J Microsc  2008;230 :212–7. 10.1111/j.1365-2818.2008.01977.x 18445149
38. Agulleiro  J-I, Fernandez  J-J. Tomo3D 2.0 – exploitation of advanced vector eXtensions (AVX) for 3D reconstruction. J Struct Biol  2015;189 :147–52. 10.1016/j.jsb.2014.11.009 25528570
39. Liu  Y-T, Zhang  H, Wang  H  et al.  Isotropic reconstruction for electron tomography with deep learning. Nat Commun  2022;13 :6482. 10.1038/s41467-022-33957-8 36309499
40. Sakai  HD, Kurosawa  N. Saccharolobus caldissimus gen. Nov., sp. nov., a facultatively anaerobic iron-reducing hyperthermophilic archaeon isolated from an acidic terrestrial hot spring, and reclassification of Sulfolobus solfataricus as Saccharolobus solfataricus comb. nov. and Sulfolobus shibatae as Saccharolobus shibatae comb. nov. Int J Syst Evol Microbiol  2018;68 :1271–8. 10.1099/ijsem.0.002665 29485400
41. Kato  S, Ogasawara  A, Itoh  T  et al.  Nanobdella aerobiophila gen. Nov., sp. nov., a thermoacidophilic, obligate ectosymbiotic archaeon, and proposal of Nanobdellaceae fam. Nov., Nanobdellales Ord. Nov. and Nanobdellia class. Nov. Int J Syst Evol Microbiol  2022;72 :005489. 10.1099/ijsem.0.005489
42. Aakra  A, Utåker  JB, Nes  IF  et al.  An evaluated improvement of the extinction dilution method for isolation of ammonia-oxidizing bacteria. J Microbiol Methods  1999;39 :23–31. 10.1016/S0167-7012(99)00094-9 10579504
43. Yarza  P, Yilmaz  P, Pruesse  E  et al.  Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences. Nat Rev Microbiol  2014;12 :635–45. 10.1038/nrmicro3330 25118885
44. Turk  M, Baumeister  W. The promise and the challenges of cryo-electron tomography. FEBS Lett  2020;594 :3243–61. 10.1002/1873-3468.13948 33020915
45. Ghosal  D, Kim  KW, Zheng  H  et al.  In vivo structure of the legionella type II secretion system by electron cryotomography. Nat Microbiol  2019;4 :2101–8. 10.1038/s41564-019-0603-6 31754273
46. Ghosal  D, Jeong  KC, Chang  Y-W  et al.  Molecular architecture, polar targeting and biogenesis of the legionella dot/Icm T4SS. Nat Microbiol  2019;4 :1173–82. 10.1038/s41564-019-0427-4 31011165
47. Kaplan  M, Nicolas  WJ, Zhao  W  et al.  In situ imaging and structure determination of biomolecular complexes using electron cryo-tomography. Methods Mol Biol  2021;2215 :83–111.33368000
48. Rodrigues-Oliveira  T, Wollweber  F, Ponce-Toledo  RI  et al.  Actin cytoskeleton and complex cell architecture in an Asgard archaeon. Nature  2023;613 :332–9. 10.1038/s41586-022-05550-y 36544020
49. Briegel  A, Oikonomou  CM, Chang  Y-W  et al.  Morphology of the archaellar motor and associated cytoplasmic cone in Thermococcus kodakaraensis. EMBO Rep  2017;18 :1660–70. 10.15252/embr.201744070 28729461
50. Zhu  S, Nishikino  T, Hu  B  et al.  Molecular architecture of the sheathed polar flagellum in vibrio alginolyticus. Proc Natl Acad Sci USA  2017;114 :10966–71. 10.1073/pnas.1712489114 28973904
51. Qin  Z, Lin  W-T, Zhu  S  et al.  Imaging the motility and chemotaxis machineries in helicobacter pylori by cryo-electron tomography. J Bacteriol  2017;199 :e00695–16. 10.1128/JB.00695-16 27849173
52. Hamm  JN, Liao  Y, Kügelgen  AV  et al.  The parasitic lifestyle of an archaeal symbiont. Preprint at bioRxiv. 2023. 10.1101/2023.02.24.529834
53. Schwank  K, Bornemann  TLV, Dombrowski  N  et al.  An archaeal symbiont-host association from the deep terrestrial subsurface. ISME J  2019;13 :2135–9. 10.1038/s41396-019-0421-0 31048756
54. Castelle  CJ, Banfield  JF. Major new microbial groups expand diversity and alter our understanding of the tree of life. Cell  2018;172 :1181–97. 10.1016/j.cell.2018.02.016 29522741
55. Jahn  U, Summons  R, Sturt  H  et al.  Composition of the lipids of Nanoarchaeum equitans and their origin from its host Ignicoccus sp. strain KIN4/I. Arch Microbiol  2004;182 :404–13. 10.1007/s00203-004-0725-x 15492905
56. Ding  S, Hamm  JN, Bale  NJ  et al.  Selective lipid recruitment by an archaeal DPANN symbiont from its host. Nat Commun  2024;15 :3405. 10.1038/s41467-024-47750-2 38649682
57. Albers  S-V, Jarrell  KF. The Archaellum: an update on the unique archaeal motility structure. Trends Microbiol  2018;26 :351–62. 10.1016/j.tim.2018.01.004 29452953
58. Gaisin  VA, van Wolferen  M, Albers  S-V  et al.  Distinct life cycle stages of an ectosymbiotic DPANN archaeon. ISME J  2024;18 :wrae076. 10.1093/ismejo/wrae076 38691426
59. Thomas  NA, Bardy  SL, Jarrell  KF. The archaeal flagellum: a different kind of prokaryotic motility structure. FEMS Microbiol Rev  2001;25 :147–74. 10.1111/j.1574-6976.2001.tb00575.x 11250034
60. Hudaiberdiev  S, Shmakov  S, Wolf  YI  et al.  Phylogenomics of Cas4 family nucleases. BMC Evol Biol  2017;17 :232. 10.1186/s12862-017-1081-1 29179671
61. Huber  G, Spinnler  C, Gambacorta  A  et al.  Metallosphaera sedula gen, and sp. nov. represents a new genus of aerobic, metal-mobilizing, thermoacidophilic archaebacteria. Syst and Appl Microbiol  1989;12 :38–47. 10.1016/S0723-2020(89)80038-4
62. Takayanagi  S, Kawasaki  H, Sugimori  K  et al.  Sulfolobus hakonensis sp. nov., a novel species of acidothermophilic archaeon. Int J Syst Bacteriol  1996;46 :377–82. 10.1099/00207713-46-2-377 8934897
63. Liu  L-J, You  X-Y, Guo  X  et al.  Metallosphaera cuprina sp. nov., an acidothermophilic, metal-mobilizing archaeon. Int J Syst Evol Microbiol  2011;61 :2395–400. 10.1099/ijs.0.026591-0 21057050
64. Sakai  HD, Kurosawa  N. Sulfodiicoccus acidiphilus gen. Nov., sp. nov., a sulfur-inhibited thermoacidophilic archaeon belonging to the order Sulfolobales isolated from a terrestrial acidic hot spring. Int J Syst Evol Microbiol  2017;67 :1880–6. 10.1099/ijsem.0.001881 28629504
65. Itoh  T, Miura  T, Sakai  HD  et al.  Sulfuracidifex tepidarius gen. Nov., sp. nov. and transfer of Sulfolobus metallicus Huber and Stetter 1992 to the genus Sulfuracidifex as Sulfuracidifex metallicus comb. nov. Int J Syst Evol Microbiol  2020;70 :1837–42. 10.1099/ijsem.0.003981 31958046
66. Brock  TD, Brock  KM, Belly  RT  et al.  Sulfolobus: a new genus of sulfur-oxidizing bacteria living at low pH and high temperature. Archiv Mikrobiol  1972;84 :54–68. 10.1007/BF00408082
67. St John  E, Liu  Y, Podar  M  et al.  A new symbiotic nanoarchaeote (Candidatus Nanoclepta minutus) and its host (Zestosphaera tikiterensis gen. Nov., sp. nov.) from a New Zealand hot spring. Syst Appl Microbiol  2019;42 :94–106. 10.1016/j.syapm.2018.08.005 30195930
68. Wurch  L, Giannone  RJ, Belisle  BS  et al.  Genomics-informed isolation and characterization of a symbiotic Nanoarchaeota system from a terrestrial geothermal environment. Nat Commun  2016;7 :12115. 10.1038/ncomms12115 27378076
69. Jahn  U, Gallenberger  M, Paper  W  et al.  Nanoarchaeum equitans and Ignicoccus hospitalis: new insights into a unique, intimate association of two archaea. J Bacteriol  2008;190 :1743–50. 10.1128/JB.01731-07 18165302
70. Comolli  LR, Banfield  JF. Inter-species interconnections in acid mine drainage microbial communities. Front Microbiol  2014;5 :367.25120533
71. Johnson  MD, Shepherd  DC, Sakai  HD  et al.  Novel cell-to-cell interactions revealed by cryotomography of a DPANN coculture system. Preprint at bioRxiv. 2024. 10.1101/2024.05.20.594898
72. Quax  TEF, Daum  B. Structure and assembly mechanism of virus-associated pyramids. Biophys Rev  2017;10 :551–7.29204884
73. Daum  B, Vonck  J, Bellack  A  et al.  Structure and in situ organisation of the Pyrococcus furiosus archaellum machinery. elife  2017;6 :e27470. 10.7554/eLife.27470 28653905
