
==== Front
Microbiology (Reading)
Microbiology (Reading)
micro
micro
Microbiology
1350-0872
1465-2080
Microbiology Society

39311857
001502
10.1099/mic.0.001502
Research Article
Regulation, Sensing and Signalling
A comparative genomic and phenotypic study of Vibrio cholerae model strains using hybrid sequencing
http://orcid.org/0009-0007-3386-0794
Lorentzen Øyvind M. 1*oyvind.m.lorentzen@uit.no

http://orcid.org/0009-0003-7348-8123
Bleis Christina 1christina.bleis@uit.no

http://orcid.org/0000-0002-4041-6989
Abel Sören 12*soren.abel@fhi.no

1 Department of Pharmacy, UiT The Arctic University of Norway, Tromsø, Norway
2 Division of Infection Control, Norwegian Institute of Public Health, Oslo, Norway
The authors declare that there are no conflicts of interest.

Øyvind M.Lorentzen, oyvind.m.lorentzen@uit.no
SörenAbel, soren.abel@fhi.no
Supplement: Two supplementary figures and five supplementary tables are available with the online version of this article.

2024
23 9 2024
170 9 00150224 5 2024
09 9 2024
Copyright © 2024 The Authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License. This article was made open access via a Publish and Read agreement between the Microbiology Society and the corresponding author’s institution.

Abstract

Next-generation sequencing methods have become essential for studying bacterial biology and pathogenesis, often depending on high-quality, closed genomes. In this study, we utilized a hybrid sequencing approach to assemble the genome of C6706, a widely used Vibrio cholerae model strain. We present a manually curated annotation of the genome, enhancing user accessibility by linking each coding sequence to its counterpart in N16961, the first sequenced V. cholerae isolate and a commonly used reference genome. Comparative genomic analysis between V. cholerae C6706 and N16961 uncovered multiple genetic differences in genes associated with key biological functions. To determine whether these genetic variations result in phenotypic differences, we compared several phenotypes relevant to V. cholerae pathogenicity like genetic stability, acid sensitivity, biofilm formation and motility. Notably, V. cholerae N16961 exhibited greater motility and reduced biofilm formation compared to V. cholerae C6706. These phenotypic differences appear to be mediated by variations in quorum sensing and cyclic di-GMP signalling pathways between the strains. This study provides valuable insights into the regulation of biofilm formation and motility in V. cholerae.

biofilm
c-di-GMP signalling
hybrid sequencing
motility
QS
V. cholerae
http://dx.doi.org/10.13039/501100005416 Norges Forskningsråd 249979 Abel Sören
==== Body
pmcImpact Statement

This study utilizes hybrid sequencing and manually curated annotation to provide a high-quality genome of V. cholerae C6706 that serves as a user-friendly tool to study this commonly used model strain. We uncover genotypic and phenotypic variance compared to V. cholerae N16961, which is widely used as a reference genome. Notably, distinct biofilm formation and motility patterns between the strains appear linked to differences in quorum sensing and c-di-GMP signalling pathways.

Introduction

Vibrio cholerae is the enteric pathogen that causes cholera, an acute diarrhoeal disease that can spread explosively and cause devastating outbreaks [1]. Annually, approximately 3 million people are infected, and 95 000 deaths are associated with the disease [2], making this pathogen a serious global health threat.

So far, the world has experienced seven cholera pandemics, spreading the pathogen globally [13]. The most commonly studied strains today all originate from the seventh pandemic and belong to the O1 serotype, biotype El Tor. The El Tor biotype is the currently dominating V. cholerae variant, responsible for the ongoing seventh pandemic [14]. Among them are V. cholerae N16961, C6706, E7946, A1552 and 2010EL-1786 [59]. Even though they belong to the seventh pandemic, they differ in origin and belong to different transmission waves within the seventh pandemic [4]. V. cholerae C6706 and A1552 were isolated from an outbreak in South America in the 1990s, while V. cholerae 2010EL-1786 stems from the 2010 Haiti cholera outbreak [59]. N16961 and E7946 were isolated in Asia in the 1970s. N16961 was the first sequenced V. cholerae isolate and has been used as a reference genome for the seventh pandemic V. cholerae El Tor strains [7]. While other V. cholerae variants have been sequenced more recently [912], including a V. cholerae C6706 strain [912], the original N16961 annotation is still widely used [1319].

V. cholerae survives in the aquatic environment year-round in endemic regions and infects humans through contaminated water and food [120]. Throughout its life cycle, the pathogen alternates between the aquatic environment and the human host. To successfully survive these transitions, V. cholerae depends on multiple cellular processes [120 21]. Biofilm formation plays an important role in the life cycle of V. cholerae. Growth in biofilms facilitates survival in the aquatic environment and increases the acid tolerance and infectivity of V. cholerae [2125]. Two of the key regulators of biofilm formation in V. cholerae are quorum sensing (QS) and the cyclic diguanylate (c-di-GMP) signalling system. QS is a key bacterial cell–cell communication system that governs collective behaviour in bacteria in response to cell population density and composition [1926]. Low cell density (LCD) induces biofilm formation through phosphorylation of the response regulator LuxO, which in turn simultaneously represses HapR and activates AphA, which are high-cell- and low-cell-density master QS regulators [19,2729]. HapR and AphA repress and stimulate the expression of biofilm genes, respectively. In contrast, high cell density leads to dephosphorylation of LuxO, which results in the repression of AphA and the expression of HapR, thereby inhibiting biofilm formation [19,2729]. QS states can differ between different seventh pandemic V. cholerae strains. For instance, the N16961 carries a frameshift mutation in HapR, which disrupts the QS signalling pathway and locks the strain into the state it assumes under LCD conditions [730 31]. One of the mechanisms through which QS represses biofilm formation in V. cholerae involves the regulation of c-di-GMP-metabolizing enzymes [28,3234]. C-di-GMP is a conserved nucleotide-based second messenger that regulates the biofilm formation and motility in bacteria [3537]. In short, c-di-GMP upregulates the biofilm formation and inhibits motility. C-di-GMP regulates the biofilm formation and motility through multiple regulatory mechanisms, which include flagellum synthesis and function, production of pilis and adhesins and secretion of extracellular polymeric substances [3537]. Strikingly, many Gram-negative pathogens with complex life cycles also boast complex c-di-GMP signalling systems [37]. In particular, V. cholerae possess more than 60 putative c-di-GMP-metabolizing proteins [3536].

One of the first barriers V. cholerae encounters in the human host is the acidic environment of the stomach [2038]. To overcome acidic conditions, V. cholerae employs a response called the ‘acid tolerance response’ (ATR) [39]. This is a cascade of physiological responses that enable the bacterium to counteract the damaging effects of acid stress. One extensively studied component of ATR is the Cad system (CadABC), which maintains the intracellular pH balance by converting H+ and lysine to cadaverine [20,3941]. After passage through the stomach, the pathogen enters and colonizes the small intestine to cause the characteristic symptoms of the disease [120]. To summarize, the pathogenicity of V. cholerae depends on multiple physiological processes including acid tolerance, motility, chemotaxis, biofilm formation and QS [1,1921].

In this study, we de novo assembled the genome of V. cholerae C6706 using short- and long-read next-generation sequencing (NGS) technologies. As an effort to improve upon the prior version of the C6706 genome, we also manually curated the genome annotation and linked all ORFs with the corresponding ORF in the N16961 genome. We thereby created an accessible genome with a link to the N16961 reference genome. Finally, we conducted a genetic and phenotypic comparison of V. cholerae C6706 and N16961 to reveal the differences between the two strains, thus contributing to the understanding of V. cholerae biology.

Methods

Strains, growth media and oligonucleotides

All bacterial strains used in this work are listed in Table 1. Unless otherwise noted, cultures were grown from single colonies in Lysogeny Broth (Miller) (LB) media (10 g l−1 of tryptone, 10 g l−1 of sodium chloride and 5 g l−1 of yeast extract) at 37 °C with shaking at 700 r.p.m. Media were supplemented with carbenicillin (50 µg ml−1) when V. cholerae strains carrying plasmids were grown to maintain the plasmid. For the acid killing assay, the pH of the medium was adjusted to pH 4.6 with a 0.1 M solution of HCl. All oligonucleotides were synthesized by Sigma-Aldrich and purified to remove salts.

Table 1. Strains and plasmids used in this study

Strain no.	Strain background	Vector	Insert	References	
3479	V. cholerae C6706 QS deficient	None	None	[6]	
1810	V. cholerae N16961	None	None	[7]	
3802	V. cholerae C6706 QS proficient	None	None	[30]	
2832	V. cholerae C6706 QS deficient	pANG01	None	This study	
3002	V. cholerae C6706 QS deficient	pOML27	VC1295-mRuby2	This study	
3867	V. cholerae N16961	pOML27	VC1295-mRuby2	This study	
3868	V. cholerae N16961	pANG01	None	This study	
2844	E. coli DH5αpir	None	None	[85]	
2988	E. coli DH5αpir	pOML27	VC1295-mRuby2	This study	
2831	E. coli DH5αpir	pANG01	None	This study	

Genomic DNA extraction

One millilitre of liquid culture of V. cholerae in the exponential phase was pelleted by centrifugation and resuspended in 50 µl of double-distilled sterile H2O. Afterwards, 600 µl of lysis buffer (SDS 2% and 0.1 M EDTA) was added, and the solution was incubated for 5 min at 80 °C to lyse the cells. After incubation, the solution was left to cool down to room temperature. Three microlitres of RNaseA were then added, and the solution was incubated for 60 min at 37 °C. Afterwards, the solution was cooled down to room temperature again before 200 µl protein precipitation solution (7.5 M ammonium acetate) was added. The solution was incubated on ice for 5 min followed by centrifugation to precipitate proteins. The DNA-containing supernatant was recovered, while the remaining pellet was discarded. Genomic DNA (gDNA) was then precipitated by adding 600 µl of isopropanol and gentle mixing. The precipitated gDNA was isolated from the tube with a glass pipette and washed in 600 µl of 70% EtOH. Lastly, the DNA was centrifuged one more time, and the supernatant was discarded. The remaining DNA pellet was carefully dried at room temperature for 30 min and dissolved overnight in Milli-Q filtered water.

Whole-genome data acquisition, assembly and annotation

The sequencing service was provided by the Norwegian Sequencing Centre (www.sequencing.uio.no), a Norwegian national technology platform hosted by the University of Oslo and supported by the ‘Functional Genomics’ and ‘Infrastructure’ programmes of the Research Council of Norway and the Southeastern Regional Health Authorities.

To create the paired-end fragment libraries for Illumina NGS, gDNA was sheared on a Covaris E220 instrument aiming for a 350 bp fragment size. After fragmentation, the sample was transferred to a 96 plate for a half-volume Kapa Hyper library preparation kit (Roche). Unique dual indexing (Illumina UD adaptor plate, Illumina) was used in the ligation reaction, followed by a clean-up and one round of PCR (four cycles) to boost the library amount. The final library was cleaned twice to get rid of any leftover adapters/dimers. The quality was checked on a Fragment Analyzer instrument using a standard NGS kit (AATI). The library was sequenced on an HiSeq 4000 instrument (150 bp paired end reads) and quantified using quantitative PCR (qPCR) (Kapa Library Quantification Kit, Kapa/Roche).

To conduct PacBio SMRT sequencing, gDNA was sheared to 12 kb fragments using g-tubes from Covaris. The library was prepared using Pacific Biosciences protocol for SMRTbell with PacBio Barcoded Adapters for Multiplex SMRT Sequencing. The sample was pooled together with ten other samples in roughly equimolar ratios. The final library was size selected using 0.45× AMPure PB beads. The library was sequenced on a Pacific Biosciences Sequel instrument using Sequel Polymerase v3.0, SMRT cells v3 LR and Sequencing chemistry v3.0. Loading was performed by diffusion. Sequencing was performed on one SMRT cell. Following sequencing, reads were demultiplexed using the barcoding pipeline on SMRT Link with 26 as the minimum barcode score. Finally, HGAP4 assembly was performed using the Assembly (HGAP4) pipeline on SMRT Link. Assembly was run using 4 Mb as the expected genome size.

The final genome was assembled with the hybrid assembler Unicycler with both short and long reads as input sequences [42]. The genome was automatically annotated with the Rapid Annotation and Subsystem Technology (RAST) web tool hosted on PATRIC [4344]. Gene annotations in strain C6706 were linked to the previously described V. cholerae strains by conducting a blast search with every identified coding sequence (CDS) in C6706 against known genomic features in a selection of V. cholerae strains [45]. To improve upon the automated annotation of the C6706 genome, all CDS annotated as hypothetical proteins by RAST were subjected to an additional protein blast search to identify the gene function through comparison of homologues with an E-value <0.05 in other bacterial strains.

Attachment assay

The attachment was used as a proxy for the biofilm formation and determined using a crystal violet (CV) attachment assay as described before but in 24-well plates instead of 96-well plates [46]. Briefly, 2 ml LB medium was inoculated 1 : 100 with an overnight culture of V. cholerae and grown statically for 24 h. After 24 h, the bacterial culture was removed, and the plate was gently submerged in filtered water thrice to remove non-adherent cells. Afterwards, plates were dried for 1 h at 55 °C. To quantify the biofilm formation, wells were stained with 2 ml of 0.1% CV for 10 min. After staining, the CV solution was removed, and the plates were again submerged in filtered water to remove non-adherent dye and left to dry at room temperature. The CV was dissolved from the stained biomass with 70% ethanol. Finally, the dissolved dye concentration was quantified by measuring the absorbance at 595 nm in a Spark multimode plate reader (Tecan).

Motility on semi-solid agar plates

Colony size on semi-solid agar plates was used as a proxy for motility and was assessed as previously described [47]. Briefly, semi-solid agar plates were made with 60 ml of LB media containing 0.3% agarose in 140-mm-diameter Petri dishes. One microlitre of cells grown to the exponential phase in LB medium was stabbed into the surface of the swarmer plates with a sterile inoculation loop. The plates were incubated at 37 °C for 12 h. Afterwards, plates were imaged. To quantify the motility, the images were imported into Fiji, and the diameter of each individual swarm was measured in Fiji with the line and measure function [48].

Variation analysis and genome comparison

The variation analysis was performed with the variation analysis tool hosted by PATRIC [44]. Mutations were called using standard settings with BWA-mem-strict and FreeBayes as aligner and SNP caller, respectively. Mutations called in homopolymeric regions were omitted. In addition, mutations called when comparing our short read sequences of V. cholerae C6706 against the our assembled C6706 genome (BioProject accession PRJNA1109855) (Table S1) were omitted. Genome comparison was conducted with progressiveMauve [49].

Fluctuation assays

Wild-type V. cholerae C6706 and N16961 were grown overnight. A dilution series of the overnight cultures were created and plated onto an LB plate with or without 50 µg ml−1 rifampicin. After overnight growth at 37 °C, the rifampicin-resistant and the total number (resistant and susceptible) of colonies were counted. The mutation rate was calculated with the FALCOR web application using the Ma–Sandri–Sarkar maximum likelihood estimator (MSS-MLE) method [50]. The Student’s t-test was used to determine the significance between the observed number of mutational events in C6706 and N16961 based on nine biological replicates [51].

Acid killing assay

Survival in acidic media was determined as previously described [39]. Briefly, two 100 ml LB cultures were inoculated 1 : 100 with a starter culture of V. cholerae C6706 and N16961, respectively. The two cultures were grown to the exponential phase and subsequently diluted to OD600 of 0.0125. These were used as inoculum into acidic media (LB adjusted to pH 4.6 with 0.1 M HCl). Samples were taken out at time points 0 min, 25 min, 40 min and 60 min, and c.f.u. values were enumerated by plating on LB agar. The experiment was performed in biological triplicates.

Bacterial fitness measurements

To start the growth curve experiments, overnight cultures were diluted 1 : 100 into 300 µl LB medium and pipetted into a 100-well honeycomb plates (Oy Growth Curves Ab Ltd., Finland). Growth curves were recorded by measuring OD at 600 nm (OD600) every 4 min for 24 h at 37 °C with continuous shaking in a Bioscreen C instrument (Oy Growth Curves Ab Ltd., Finland). Bacterial fitness was quantified as the area under the curve (AUC) in the growth curves with the flux package in R [52]. Each biological replicate is always based on three technical replicates.

Cloning of VC1295 for the expression and fluorescent microscopy

All primers used in this study are listed in Table 2. VC1295 was amplified by PCR with its native promotor from gDNA extracted from V. cholerae N16961 using primers #153 and #154. The PCR was conducted with Phusion polymerase (New England Biolabs). Afterwards, VC1295 with its native promotor was cloned onto the pENTRY vector pMaRo1 through a Gibson assembly reaction, which was conducted at 50 °C for 60 min [53]. The correct sequence was confirmed by Sanger sequencing by Macrogen Europe using primers #3 and #4.

Table 2. Primers used in this study

No.	Name	Sequence (5′ to 3′)	Ref.	
3	P0003_pEntry_F	gatctcgggccccaaataat	[54]	
4	P0004_pEntry_R	gcagctggatggcaaataat	[54]This study	
153	P0153_VC1295_F	TTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT gtatcttaacagtattccttgataca	This study	
154	P0154_VC1295_R	TCTTATAATGCCAACTTTGTACAAGAAAGCTGGGTtgcggcatctttaaagtgtgct	This study	
159	P0159_pANG_Ins_F	cagtgccaacatagtaagccag	This study	
160	P0160_pANG_Ins_R	gaagcatttatcagggttattgtctc	This study	

The final vector construct carrying VC1295-mRuby2 under the control of its native promotor was assembled by a Gateway cloning reaction between the pENTRY vector containing VC1295 and a pDESTINATION vector carrying mRuby2 [5455]. The correct assembly was confirmed by PCR using primers #159 and #160. This vector was then conjugated into V. cholerae via the intermediate strain Escherichia coli SM10(λpir) [56].

V. cholerae strain carrying a plasmid expressing VC1295-mRuby2 was grown to the exponential phase. Upon reaching the exponential phase, 2 µl of the suspension was spotted on a 1% agarose patched and imaged with a DeltaVision Elite (GE Healthcare) inverted microscope with a DeltaVision CMOS camera and a UPlanFLN 100× PH NA 1.30 phase-contrast objective (Olympus). The images were processed with softWoRx (GE Healthcare), Fiji and Photoshop CS6 (Adobe) to find a focused slide, crop the area of interest and adjust the levels [48].

Results

Building a circularized V. cholerae C6706 genome

We created a closed circularized genome for V. cholerae C6706 with a hybrid sequencing approach that combines both long- and short-read sequencing technology (Fig. 1) [42]. Long-read sequencing with PacBio sequencing yielded 504 131 subreads with a mean length of 6801 bps generating a total of 1.89×109 bases. The assembly yielded two contigs totalling 4 090 295 bp, with an average read depth of 444×. Short-read sequencing using Illumina technology generated a total of 15 841 698 reads, with an average length of 151 bps, resulting in an average read depth of 585×. The resulting genome consists of two closed, circular chromosomes of 3 019 923 and 1 070 364 bps, respectively. Genome quality evaluation hosted by PATRIC [44] confirmed the assembled genome’s completeness at 100%, with a minimal contamination of 0.6%. Additionally, the genome sequence is of high quality, with coarse and fine consistency values reaching 99.9 and 99.5%, respectively (Table 3) [57]. Automatic annotation with the RAST, hosted by PATRIC, yielded 3 788 CDS [4344]. To increase the usability, every CDS in the C6706 genome has also been linked to the corresponding CDS in V. cholerae N16961 by searching for homologues by blast (Table S2).

Fig. 1. Maps of chromosome 1 and 2 of V. cholerae C6706. Each grey bar represents a coding sequence (CDS), pink bar represents tRNAs, green bars represent rRNAs and orange bars represent repeat regions. Important mobile genetic elements (“regions”) are underlined in blue. Maps were created with CGView [8687].

Table 3. Sequencing and genome assembly metrics and genome quality control

PacBio sequencing		
 Subreads	504 131	
 Subread mean length (bp)	6801	
 Total reads (bp)	1.89×109	
Assembly		
 2 contigs total (bp)	4 090 295	
 Average read depth	444×	
Illumina sequencing		
 Reads total	15 841 698	
 Mean length (bp)	151	
 Average read depth	585×	
RAST		
 Completeness (%)	100	
 Coarse consistency (%)	99.9	
 Fine consistency (%)	99.5	
 Contamination (%)	0.6	

V. cholerae C6706 carries multiple genetic changes compared to N16961

The V. cholerae El Tor variant C6706 is a commonly used strain by researchers and represents the wild-type in many studies [1317 18 58 59]. For a long time, only the genome of V. cholerae N16961, another El Tor isolate, was available [7], and researchers have used and are still using it as the de facto reference genome [1318] despite the potential differences between the El Tor variants [49 10]. To identify the genetic differences between V. cholerae C6706 and N16961, we conducted a genome comparison and a variant analysis. The paired-read library of Illumina short-read sequences from our hybrid sequencing of V. cholerae C6706 was used as input. The updated closed genome of V. cholerae N16961 (GenBank accession numbers: LT906614 and LT906615; PATRIC Genome ID: 243277.254) was used as a reference genome. This identified 76 differences, which included 6 deletions, 3 insertions and 67 point mutations. Of the 67 point mutations, there were 44 nonsynonymous mutations and 23 synonymous mutations (Table S3). A genome comparison of V. cholerae C6706 and N16961 showcased that C6706 also contained the West African–South American (WASA)-1 prophage specific to the WASA clade of V. cholerae isolates, which are not present in N16961 [460]. Similar to what has been observed in other V. cholerae strains, chromosome 1 contained a large inversion (Fig. S1, available in the online version of this article) [6162]. A comparison of the previously sequenced V. cholerae C6706 showcased that the inversion varied between assemblies (Fig. S2). Finally, C6706 contained a different variant of the Vibrio seventh pandemic island II (VSP-2), which differs from N16961 in the region encompassing VC0511-VC0515 [463 64]. Overall, the genomes of C6706 and N16961 are very similar except for the two abovementioned mobile genetic elements and inversion in chromosome 1.

Several of the identified mutations in C6706 were located in genes previously linked to important biological functions, such as biofilm formation, motility, QS, genome stability and repair and acid tolerance (Table 4). Among the mutated genes was the previously published point mutation (Gly333Ser) in LuxO, which induces a deficiency in QS that locks V. cholerae into the same state; it assumes under LCD conditions [30]. We also found multiple mutations in c-di-GMP-metabolizing genes, potentially affecting the c-di-GMP turnover of V. cholerae C6706 relative to N16961. This included a frameshift mutation in VC1295, an HD-GYP-domain protein predicted to degrade c-di-GMP [65]. In addition, we identified mutations in genes coding for proteins important for flagellar function and chemotaxis. Lastly, we identified mutations in CadB, an enzyme crucial for acid adaptation in several enteric pathogens and RecA, which is essential for the global response to DNA damage (SOS response), DNA repair and mutagenicity in bacteria [39,41, 6668].

Table 4. Selected genes with changes from N16961 to C6706

Gene accession no. N16961	Gene accession no. C6706	Nucleotide change	aa change	Gene name	Function	Cellular process	
VC0280	VCC2568	C686T	Thr229Ile	cadB	Lysine/cadaverine antiporter membrane protein CadB	Acid adaptation	
VC0543	VCC2308	A914G	Tyr305Cys	recA	RecA protein	Stress response	
VC0543	VCC2271	217_218insT*	Val74fs†	hapR	QS regulator of virulence	QS	
VC0653	VCC2204	T1664C	Val555Ala	rocS	Diguanylate cyclase/phosphodiesterase	c-di-GMP signalling	
VC1021	VCC1859	G997A	Gly333Ser	luxO	LuxO global QS regulator	QS	
VC1295	VCC1597/1598	1153delT‡	Phe385fs	n/a	c-di-GMP phosphodiesterase (HD-GYP domain)	c-di-GMP signalling	
VC1399	VCC1499	837_838insA	Gly279_ Lys280fs	cheR	Chemotaxis protein methyltransferase CheR	Motility/chemotaxis	
VC1653	VCC1185	C1675T	His559Tyr	vieS	Response regulator VieS	c-di-GMP signalling	
VC1967	VCC0880	A277G	Thr93Ala	n/a	Methyl-accepting chemotaxis sensor/transducer protein	Motility/chemotaxis	
VC2191	VCC0672	C863T	Pro288Leu	flgK	Flagellar hook-associated protein FlgK	Motility/chemotaxis	
VC2208	VCC0655	G283A	Ala95Thr	flgT	Flagellar protein FlgT	Motility/chemotaxis	
VC2338	VCC0536	C1237T	Leu413Phe	lacZ	Beta-galactosidase	Metabolism	
VCA0557	VCCA0844	A926G	Asp309Gly	n/a	Diguanylate cyclase	c-di-GMP signalling	
VCA0931	VCCA0133	G1207A	Ala403Thr	n/a	c-di-GMP phosphodiesterase (HD-GYP domain)	c-di-GMP signalling	
VCA1084	VCCA0275	G339A	Met113Ile	lapB	Type I secretion system ATPase, LssB family LapB	Type II secretion systems	
* “* *‘ins’ indicates an insertion between the two given positions within a gene.

# †‘fs’ indicates a frame shift after the first amino acidaa that is affected by the change.

$ ‡‘del’ indicates a deletion of the indicated base at the indicated position.

Our genetic comparison of V. cholerae C6706 and N16961 identified a selection of mutations likely affecting the physiology and adaptability of these strains. To understand the role of these mutations, we employed phenotypic assays to accurately quantify differences in key bacterial phenotypes between V. cholerae C6706 and N16961.

Mutation rate is increased in V. cholerae C6706

The recA gene codes for a protein essential for DNA repair and has been shown to affect the mutagenicity of bacteria [6667 69]. The A914G substitution identified in C6706 is a missense mutation that results in a tyrosine-to-cysteine change at position 305 in the C-terminal domain of RecA [70]. To assess whether this mutation affects the mutation rate in V. cholerae C6706, we quantified the mutation rate and number of mutations per culture (m) with a rifampicin fluctuation assay [71]. The mutation rate and m were calculated using the FALCOR web application, employing the MSS-MLE method [49]. The mutation rate was higher in V. cholerae C6706 (7.85×10−9) compared to N16961 (5.65×10−9) (Fig. 2a), and we observed a significant increase in mutations per culture (m) in V. cholerae C6706 (39.3) compared to N16961 (18.2) (P=0.0236 in two-tailed t-test comparing the natural logarithm of m of C6706 and N1691) (Fig. 2b). We did not identify any additional mutations in genes predicted to be involved in genome stability and repair. This suggests that the observed difference in mutation rates could stem from functional differences in the RecA variants.

Fig. 2. Comparison of mutation rate and the natural logarithm of number of mutations per culture [ln(m)] of V. cholerae C6706 and N16961 measured with a rifampicin fluctuation assay [50]. (a) Mutation rate of V. cholerae C6706 and N16961. (b) Ln(m) of V. cholerae C6706 and N16961. Bars depict the means based on nine biological replicates. Error bars represent the 95% confidence intervals. Statistical significance was tested using an unpaired two-tailed T-test, *, p<0.05.

V. cholerae C6706 and N16961 have similar tolerance to acidic conditions

To understand the impact of the point mutation in cadB (Thr229Ile), we compared the acid tolerance of V. cholerae C6706 and N16961. Both strains were exposed to a pH of 4.6 in LB medium, and c.f.u. values were enumerated over time (Fig. 3). The two strains did not grow in pH 4.6. Instead, c.f.u. values declined over time, indicating cell death. There was no significant survival difference between V. cholerae C6706 and N16961 in acid at any time point (P=0.4–0.9, two-tailed t-test), indicating that the observed mutation in cadB does not significantly affect the acid tolerance of V. cholerae C6706.

Fig. 3. Both V. cholerae strains, C6706 and N16961, are equally sensitive to acid. C.f.u. ml−1 measurements over time of V. cholerae C6706 and N16961 exposed to pH 4.6 in LB medium. The dots represent the mean of three biologically independent replicates and error bars indicate the standard deviation. Statistical significance was tested using a two-tailed T-test for each individual time point; non-significant (ns), p>0.05.

Biofilm formation and motility differ between V. cholerae C6706 and N16961

V. cholerae C6706 harboured multiple genetic changes in genes predicted to regulate biofilm formation and motility, including several c-di-GMP-associated genes, luxO, and multiple proteins involved in flagellar function and chemotaxis (Table 4). In bacteria, biofilm formation and motility are often inversely regulated, where increasing the biofilm formation leads to decreased motility and vice versa [3536 72 73]. To investigate if the sum of these genetic changes affected biofilm formation and motility in V. cholerae C6706 and N16961, we quantified these phenotypes. As already stated, N16961 contains a non-functional hapR due to a frameshift mutation that locks it in an LCD QS state, independent of the actual cell density [730 31]. This defective QS is known to affect biofilm formation and motility [2228]. The strain of V. cholerae C6706 sequenced in this study is locked in the same QS state, but due to a different mutation in luxO [30]. To compare N16961 to the naïve, QS-proficient C6706, we also included a variant with harbouring wild-type luxO [22]. We conducted a variant analysis to identify the genetic differences between QS-proficient C6706 (GenBank accession numbers: CP064350, CP064351; PATRIC Genome ID: 948564.8) sequenced by Weng et al. [11] and QS-deficient C6706 (BioProject accession PRJNA1109855) strains, which did not reveal any additional mutations other than the expected G997A in luxO (Table S4).

The QS-deficient variant of V. cholerae C6706 formed 85 and 53% more biofilm compared to QS-proficient variant of V. cholerae C6706 and QS-deficient N16961, respectively (Fig. 4a, one-way ANOVA, P<0.0001). In addition, N16961 formed 20% more biofilm compared to the QS-proficient variant of C6706 (Fig. 4a, one-way ANOVA, P<0.01). The QS-deficient V. cholerae C6706 exhibited 14% lower motility compared to V. cholerae N16961 (Fig. 4b, one-way ANOVA, P<0.0001). In contrast, QS-deficient C6706 exhibited a 12% increase in motility compared to QS-proficient C6706 (Fig. 4b, one-way ANOVA, P<0.0001). To ensure that the differences in biofilm formation and motility were not due to large variations in bacterial fitness, we recorded growth curves. Comparisons of these curves revealed small differences in the AUC. Although these differences were statistically significant, the resulting minor changes in relative fitness (QS-deficient C6706 : 1.00, N16961 : 0.96, QS-proficient C6706 : 1.03) are unlikely to account for the substantial differences observed in biofilm formation and motility (Fig. 4c, Table S5).

Fig. 4. Comparison of the capacity to form biofilms, motility on semi-solid agar plates, and growth of the naturally QS-deficient N16961, a laboratory acquired QS deficient C6706 (QS- C6706), and a naturally QS proficient C6706 (QS+ C6706). (a) Relative biofilm formation normalized to QS- C6706 after static growth at 37 °C for 24 hours in 24-well plates. The bars represent the mean of eight (QS- C6706 and N16961) or seven (QS+ C6706) biological replicates and the error bars indicate the 95% confidence interval. Statistical significance was tested using a one-way ANOVA followed by Tukey’s multiple comparisons tests. **, p<0.01; ****, p<0.0001. (b) Relative motility normalized to QS- C6706 after growth on semi-solid agar for 12 hours. The bars represent the mean of four biological replicates and the error bars indicate the 95% confidence interval. Statistical significance was tested using a one-way ANOVA followed by Tukey’s multiple comparisons tests. ****, p<0.0001. (c) Growth curves of N16961, QS-deficient V. cholerae C6706, and QS-proficient C6706 measured as OD600 over time.

QS-deficient C6706 and N16961 had inverse behaviour when comparing biofilm formation and motility, where the strain with the highest level of biofilm formation had the lowest motility. In contrast, QS-proficient V. cholerae C6706 did not exhibit this pattern and had both the lowest biofilm formation and the lowest motility out of the three strains. The observed differences in biofilm formation and motility between the QS-proficient and QS-deficient variants of V. cholerae C6706 are likely due to the differences in QS state, as QS is known to impact biofilm formation and motility [2228]. The same explanation could explain the differences between QS proficient and N16961. However, the QS-deficient variant of V. cholerae C6706 and N16961 are locked in the same LCD state. Therefore, the difference in biofilm formation and motility between these two strains is likely not mediated by differences in QS state, but caused by additional mutations (e.g. mutations in the c-di-GMP signalling system or flagellar protein).

Altered c-di-GMP signalling and QS shape biofilm and motility in V. cholerae strains C6706 vs. N16961

A comparison of N16961, QS-deficient V. cholerae C6706 and QS-proficient C6706 indicated that QS was not the sole cause of the observed differences in biofilm formation and motility. We, therefore, wanted to investigate whether variations in the c-di-GMP signalling system, particularly the frameshift mutation in the putative c-di-GMP-degrading protein VC1295, contributed to the observed phenotypic differences. First, we investigated the expression of VC1295 under the control of its native promotor. In agreement with Koestler and Waters [74] and McKee et al. [65], fluorescence microscopy demonstrated that VC1295 was expressed and translated in V. cholerae C6706 (Fig. 5a). Furthermore, the protein was correctly translocated to its expected subcellular compartment in the cell membrane.

Fig. 5. VC1295 is expressed in V. cholerae C6706, inhibits biofilm formation and increases motility. (a) Fluorescent images of V. cholerae C6706 expressing VC1295 fused to a C-terminal mRuby2 on a medium-copy number plasmid under the control of its native promoters in the exponential growth phase (QS− C6706 pVC1295). A phase contrast (PC), a corresponding fluorescence (mRuby2) image and an overlay of both images (merged) are shown. (b) Biofilm formation of QS− C6706 pCTRL, N16961 pCTRL and QS− C6706 pVC1295 normalized to QS− C6706 pCTRL after static growth at 37 °C for 24 h in 24-well plates (n=12). (c) Motility of the same strains test in (b) after growth on semi-solid agar at 37 °C for 12 h (n ≥ 6). The bars represent the mean and the error bars represent the 95% CI. Statistical significance was tested using a one-way ANOVA followed by the Dunnet multiple comparison correction. *P<0.05; ****P<0.0001.

V. cholerae N16961 contains a functional copy of VC1295 and is naturally QS deficient. Therefore, we next investigated the biofilm formation and motility in N16961 harbouring an empty control vector (N16961 pCTRL) and QS-deficient V. cholerae C6706 expressing either a plasmid-born VC1295 (QS− C6706 pVC1295) or an empty control vector (QS− C6706 pCTRL). Comparing QS-deficient V. cholerae C6706 harbouring pVC1295 with N16961 harbouring pCTRL, the two strains displayed identical biofilm formation (Fig. 5b), while QS− C6706 pVC1295 demonstrated a 12% increase in motility compared to N16961 pCTRL (Fig. 5c). This indicates that the plasmid-borne VC1295 can complement the frameshifted genomic VC1295. Therefore, VC1295 seemed to be expressed and enzymatically active under the tested biofilm and motility assay conditions, and the frameshift mutation in VC1295 in V. cholerae C6706 seems to contribute to the differences in the biofilm formation and motility between C6706 and N16961.

Discussion

In this study, we have assembled a high-quality, carefully annotated genome of V. cholerae C6706 and employed it to conduct a genetic and phenotypic comparison of V. cholerae C6706 and N16961. The assessment of genome quality in our assembled genome aligned well with the criteria suggested by Parello et al. [57] for defining a high-quality genome with a low contamination score (0.6%), a fine consistency score of 99.5% and a completeness score of 100%. A genetic comparison demonstrates how these strains, isolated from different outbreaks in the seventh pandemic, carry mutations that alter their physiology. Indeed, when comparing our assembled C6706 genome with the genome of N16961, we identified multiple mutations in genes with the potential to affect V. cholerae biology (Table 4). One set of striking differences was the multiple mutations in enzymes metabolizing c-di-GMP, a well-known regulator of biofilm and motility in bacteria [3537]. In addition, we observed mutations in genes involved in acid stress, stress response and genome stability, flagellum biosynthesis and chemotaxis. The comparison of our genome to the previously assembled genomes of V. cholerae C6706 only identified the known laboratory-acquired mutation in luxO [1130]. However, a large inversion in chromosome 1 had occurred (Fig. S1 and S2), which seems to occur intermittently in V. cholerae seventh pandemic strains, as this has occurred in multiple V. cholerae model strains [1061 62]. Importantly, a previous study did not find any fitness costs associated with large inversions in chromosome 1 [61].

To better understand if these mutations really affect the biology of V. cholerae C6706, we quantified the selected phenotypes. Firstly, this revealed a difference in mutation rate between the two strains (Fig. 2), which could potentially be attributed to a point mutation (C305Y) in RecA. This is a ubiquitous recombinase conserved throughout the bacterial kingdom, which evolves at a slow speed [7075 76]. The protein is involved in multiple important cellular processes including the SOS response, genome stability and repair and homologous recombination [6669]. An increased mutation rate can be beneficial in some circumstances as it has been shown to accelerate evolution and increase the rate of adaptation [7779].

The most striking phenotypic differences between the strains were differences in the biofilm formation and motility (Fig. 4a, b). QS-deficient V. cholerae C6706 formed increased biofilms and larger colonies on semi-solid agar plates compared to the QS-proficient C6706. These findings are in line with the current literature that QS inhibits both motility and biofilm formation [2228]. Prior studies have demonstrated that QS regulates the biofilm formation through control of multiple c-di-GMP-metabolizing genes [27,28, 3234, 80]. Typically, c-di-GMP regulates motility and biofilm formation inversely, i.e. high c-di-GMP concentrations increase biofilms and decrease motility, while low c-di-GMP concentrations do the opposite [3537]. How QS inhibits both biofilm formation and motility at the same time in V. cholerae remains unclear. In certain cases, specific c-di-GMP-metabolizing enzymes asymmetrically regulate both biofilm formation and motility [3581]. Consequently, QS might influence c-di-GMP-degrading enzymes that primarily inhibit biofilm formation without necessarily promoting increased motility. Alternatively, additional signalling pathways could also be involved, thereby modulating biofilm formation or motility independently of c-di-GMP.

V. cholerae N16961 exhibited higher motility than both variants of C6706 (Fig. 4b). This is in agreement with a previous study that showed that V. cholerae N16961 had increased motility compared to South American V. cholerae isolates closely related to C6706 [82]. In addition to increased motility due to QS deficiency, this could come from an altered c-di-GMP metabolism with decreased levels of c-di-GMP in V. cholerae N16961, e.g. due to the presence of a functional copy of the putative c-di-GMP-degrading enzyme VC1295. Alternatively, the genetic differences in multiple flagellar and chemotaxis-related proteins could also contribute to the observed difference in motility.

Interestingly, QS-deficient V. cholerae C6706 formed more biofilm and had lower motility compared to N16961 even though they should both be locked in the same QS state (Fig. 4a, b) [30]. This indicates that additional signalling pathways other than QS are mediating the observed phenotypic differences. The inverse effect on biofilm formation and motility resembles the effect of increased levels of c-di-GMP [3537]. While some c-di-GMP-metabolizing enzymes in V. cholerae are known to be regulated by QS, many of them are seemingly regulated independently of QS [3280 83]. Therefore, we hypothesized that the differences between QS-deficient C6706 and N16961 could be due to the differences in the strains’ QS-independent c-di-GMP signalling systems. Indeed, V. cholerae C6706 contains multiple mutations in putative c-di-GMP-metabolizing enzymes (Table 4). This includes a frameshift mutation in VC1295, a functional c-di-GMP-degrading enzyme [65]. Indeed, the expression of a functional copy of VC1295 in QS-deficient C6706 reversed the observed differences in biofilm formation and motility (Fig. 5b, c), indicating that the observed differences were at least partly due to the differences in c-di-GMP metabolism between the strains, although the difference could also be due to additional QS-related signalling pathways as V. cholerae C6706 and N16961 contain different mutations, LuxO and HapR, respectively, in the QS signalling pathway. Even though the mutations lead to the same QS state, we cannot exclude that they have additional confounding downstream effects. Altogether, the results of this work are consistent with a model where the observed differences in biofilm formation and motility are due to a combination of effects from QS and c-di-GMP signalling.

V. cholerae N16961 and QS-proficient V. cholerae C6706 exhibited differences in the biofilm formation and motility, and the difference in motility exceeded the biofilm formation (Fig. 4a, b). In QS-proficient V. cholerae C6706, this might be attributed to QS-mediated repression of biofilm formation [2832 34 80]. In addition, it harbours a frameshift mutation in the active c-di-GMP-degrading enzyme VC1295 (Table 4) [65]. This leads to putatively increased c-di-GMP levels and increased biofilm formation, which could partially balance out the QS-mediated biofilm repression (Fig. 4a). N16961 lacks QS-mediated biofilm repression but also lacks the frameshift mutation in VC1295. For motility, the QS state and c-di-GMP levels of QS-proficient V. cholerae C6706 would both act to repress motility (Fig. 4b) [2236 84]. In contrast, the QS state and putatively lower c-di-GMP levels of V. cholerae N16961 would both promote motility (Fig. 4b) [2236 84]. Therefore, the observed differences in biofilm formation and motility are consistent with the identified genetic changes between V. cholerae C6706 and N16961 (Table 4).

In conclusion, our study offers a genomic analysis of V. cholerae C6706, utilizing a hybrid sequencing approach. This yielded a high-quality genome of V. cholerae C6706, which we carefully annotated and cross referenced to N16961. We believe that this will be a valuable resource for the scientific community and represents an improvement of the previous version of the V. cholerae C6706 genome [11]. By characterizing genotypic and phenotypic differences between V. cholerae C6706 and N16961, we have uncovered the potential targets of adaptive evolution in the seventh cholera pandemic. Furthermore, the comparison of the biofilm formation and motility between V. cholerae C6706 and N16961 sheds further light on the complex interplay of factors regulating biofilm formation and motility in V. cholerae seventh pandemic strains.

supplementary material

10.1099/mic.0.001502 Uncited Supplementary Material 1.

10.1099/mic.0.001502 Uncited Supplementary Material 2.

Acknowledgements

We thank the Norwegian Sequencing Centre hosted at the University of Oslo for sequencing our laboratory’s strain of Vibrio cholerae. In addition, we thank Erik Hjerde for the assistance with the de novo assembly of the closed genome of Vibrio cholerae C6706. We thank Prof. Melanie Blokesch for providing us with the QS-proficient variant of V. cholerae C6706. We thank João Alves Gama for assisting in the analysis of bacterial fitness.

Abbreviations

ATR acid tolerance response

AUC area under the curve

CDS coding sequence

CV crystal violet

gDNA genomic DNA

LB Lysogeny broth (Miller)

LCD low cell density

MSS-MLE Ma–Sandri–Sarkar maximum likelihood estimator

NGS next-generation sequencing

QS quorum sensing

RAST Rapid Annotation and Subsystem Technology

WASA West African–South American

Funding: This work was funded by the Research Council of Norway (NFR) 249979 (to S.A.). The funders had no role in study design, data collection and interpretation or the decision to submit the work for publication.

Author contributions: The project was conceptualized by O.M.L. and S.A. Funding was acquired by S.A. The experiments were carried out and the data analysed by O.M.L. and C.B. under the supervision of S.A. The manuscript was drafted by O.M.L. and C.B. and edited and revised by all authors.

Accession No: BioProject accession: PRJNA1109855. Accession numbers: CP157384, CP157385.
==== Refs
References

1. Kanungo S Azman AS Ramamurthy T Deen J Cholera DS Lancet 2022 399 1429 1440 35397865
2. Ali M Nelson AR Lopez AL Sack DA Updated global burden of cholera in endemic countries PLoS Negl Trop Dis 2015 9 e0003832 10.1371/journal.pntd.0003832 26043000
3. Barua D History of cholera Barua D Greenough WB Cholera Boston, MA Springer US 1 36 10.1007/978-1-4757-9688-9_1
4. Mutreja A Kim DW Thomson NR Connor TR Lee JH et al Evidence for several waves of global transmission in the seventh cholera pandemic Nature 2011 477 462 465 10.1038/nature10392 21866102
5. Yildiz FH Schoolnik GK Role of rpoS in stress survival and virulence of Vibrio cholerae J Bacteriol 1998 180 773 784 10.1128/JB.180.4.773-784.1998 9473029
6. Thelin KH Taylor RK Toxin-coregulated pilus, but not mannose-sensitive hemagglutinin, is required for colonization by Vibrio cholerae O1 El Tor biotype and O139 strains Infect Immun 1996 64 2853 2856 10.1128/iai.64.7.2853-2856.1996 8698524
7. Heidelberg JF Eisen JA Nelson WC Clayton RA Gwinn ML et al DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae . Nature 2000 406 477 483 10.1038/35020000 10952301
8. Miller VL DiRita VJ Mekalanos JJ Identification of toxS, a regulatory gene whose product enhances toxR-mediated activation of the cholera toxin promoter J Bacteriol 1989 171 1288 1293 10.1128/jb.171.3.1288-1293.1989 2646275
9. Reimer A Domselaar G Stroika S Walker M Kent H et al Comparative genomics of Vibrio cholerae from Haiti, Asia, and Africa Emerg Infect Dis 2011 17 2113 10.3201/eid1711.110794 22099115
10. Matthey N Drebes Dörr NC Blokesch M Long-read-based genome sequences of pandemic and environmental Vibrio cholerae strains Microbiol Resour Announc 2018 7 e01574-18 10.1128/MRA.01574-18 30574591
11. Weng Y Bina XR Bina JE Complete genome sequence of Vibrio cholerae O1 El Tor strain C6706 Microbiol Resour Announc 2021 10 10.1128/MRA.01301-20
12. Creasy-Marrazzo A Saber MM Kamat M Bailey LS Brinkley L et al Genome-wide association studies reveal distinct genetic correlates and increased heritability of antimicrobial resistance in Vibrio cholerae under anaerobic conditions Microb Genom 2022 8 mgen000905 10.1099/mgen.0.000905 36748512
13. Rivera-Chávez F Mekalanos JJ Cholera toxin promotes pathogen acquisition of host-derived nutrients Nature 2019 572 244 248 10.1038/s41586-019-1453-3 31367037
14. Sit B Srisuknimit V Bueno E Zingl FG Hullahalli K et al Undecaprenyl phosphate translocases confer conditional microbial fitness Nature 2023 613 721 728 10.1038/s41586-022-05569-1 36450355
15. Dalia AB McDonough E Camilli A Multiplex genome editing by natural transformation Proc Natl Acad Sci USA 2014 111 8937 8942 10.1073/pnas.1406478111 24889608
16. Jaskólska M Adams DW Blokesch M Two defence systems eliminate plasmids from seventh pandemic Vibrio cholerae Nature 2022 604 323 329 10.1038/s41586-022-04546-y 35388218
17. Vidakovic L Mikhaleva S Jeckel H Nisnevich V Strenger K et al Biofilm formation on human immune cells is a multicellular predation strategy of Vibrio cholerae Cell 2023 186 2690 2704 10.1016/j.cell.2023.05.008 37295405
18. Prentice JA van de Weerd R Bridges AA Cell-lysis sensing drives biofilm formation in Vibrio cholerae Nat Commun 2024 15 2018 10.1038/s41467-024-46399-1 38443393
19. Bridges AA Prentice JA Wingreen NS Bassler BL Signal transduction network principles underlying bacterial collective behaviors Annu Rev Microbiol 2022 76 235 257 10.1146/annurev-micro-042922-122020 35609948
20. Conner JG Teschler JK Jones CJ Yildiz FH Staying alive: Vibrio cholerae’s cycle of environmental survival, transmission, and dissemination Microbiol Spectr 2016 4 10.1128/microbiolspec.VMBF-0015-2015
21. Silva AJ Benitez JA Vibrio cholerae biofilms and cholera pathogenesis PLoS Negl Trop Dis 2016 10 e0004330 10.1371/journal.pntd.0004330 26845681
22. Zhu J Mekalanos JJ Quorum sensing-dependent biofilms enhance colonization in Vibrio cholerae . Dev Cell 2003 5 647 656 10.1016/s1534-5807(03)00295-8 14536065
23. Gallego-Hernandez AL DePas WH Park JH Teschler JK Hartmann R et al Upregulation of virulence genes promotes Vibrio cholerae biofilm hyperinfectivity Proc Natl Acad Sci U S A 2020 117 11010 11017 10.1073/pnas.1916571117 32355001
24. Rita T Bharathi P Andrew C Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae Infect Immun 2010 78 3560 3569 10.1128/IAI.00048-10 20515927
25. Faruque SM Biswas K Udden SMN Ahmad QS Sack DA et al Transmissibility of cholera: In vivo -formed biofilms and their relationship to infectivity and persistence in the environment Proc Natl Acad Sci USA 2006 103 6350 6355 10.1073/pnas.0601277103 16601099
26. Waters CM Bassler BL QUORUM SENSING: cell-to-cell communication in bacteria Annu Rev Cell Dev Biol 2005 21 319 346 10.1146/annurev.cellbio.21.012704.131001 16212498
27. Bridges AA Bassler BL The intragenus and interspecies quorum-sensing autoinducers exert distinct control over Vibrio cholerae biofilm formation and dispersal PLoS Biol 2019 17 e3000429 10.1371/journal.pbio.3000429 31710602
28. Hammer BK Bassler BL Quorum sensing controls biofilm formation in Vibrio cholerae Mol Microbiol 2003 50 101 104 10.1046/j.1365-2958.2003.03688.x 14507367
29. Rutherford ST van Kessel JC Shao Y Bassler BL AphA and LuxR/HapR reciprocally control quorum sensing in vibrios Genes Dev 2011 25 397 408 10.1101/gad.2015011 21325136
30. Stutzmann S Blokesch M Circulation of a quorum-sensing-impaired variant of Vibrio cholerae strain C6706 masks important phenotypes mSphere 2016 1 e00098-16 10.1128/mSphere.00098-16 27303743
31. Meibom KL Blokesch M Dolganov NA Wu C-Y Schoolnik GK Chitin induces natural competence in Vibrio cholerae Science 2005 310 1824 1827 10.1126/science.1120096 16357262
32. Waters CM Lu W Rabinowitz JD Bassler BL Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT J Bacteriol 2008 190 2527 2536 10.1128/JB.01756-07 18223081
33. Hammer BK Bassler BL Distinct sensory pathways in Vibrio cholerae El Tor and classical biotypes modulate cyclic dimeric GMP levels to control biofilm formation J Bacteriol 2009 191 169 177 10.1128/JB.01307-08 18952786
34. Zhao X Koestler BJ Waters CM Hammer BK Post-transcriptional activation of a diguanylate cyclase by quorum sensing small RNAs promotes biofilm formation in Vibrio cholerae Mol Microbiol 2013 89 989 1002 10.1111/mmi.12325 23841714
35. Hengge R Principles of c-di-GMP signalling in bacteria Nat Rev Microbiol 2009 7 263 273 10.1038/nrmicro2109 19287449
36. Conner JG Zamorano-Sánchez D Park JH Sondermann H Yildiz FH The ins and outs of cyclic di-GMP signaling in Vibrio cholerae Curr Opin Microbiol 2017 36 20 29 10.1016/j.mib.2017.01.002 28171809
37. Römling U Galperin MY Gomelsky M Cyclic di-GMP: the first 25 years of a universal bacterial second messenger Microbiol Mol Biol Rev 2013 77 1 52 10.1128/MMBR.00043-12 23471616
38. Hornick RB Music SI Wenzel R Cash R Libonati JP et al The broad street pump revisited: response of volunteers to ingested cholera vibrios Bull NY Acad Med 1971 47 1181 1191
39. Merrell DS Camilli A The cadA gene of Vibrio cholerae is induced during infection and plays a role in acid tolerance Mol Microbiol 1999 34 836 849 10.1046/j.1365-2958.1999.01650.x 10564522
40. Singh A Barnard TG Surviving the acid barrier: responses of pathogenic Vibrio cholerae to simulated gastric fluid Appl Microbiol Biotechnol 2015 100 815 824 10.1007/s00253-015-7067-2 26496916
41. Meng SY Bennett GN Nucleotide sequence of the Escherichia coli cad operon: a system for neutralization of low extracellular pH J Bacteriol 1992 174 2659 2669 10.1128/jb.174.8.2659-2669.1992 1556085
42. Wick RR Judd LM Gorrie CL Holt KE Unicycler: resolving bacterial genome assemblies from short and long sequencing reads PLoS Comput Biol 2017 13 e1005595–e1005595. 10.1371/journal.pcbi.1005595 28594827
43. Aziz RK Bartels D Best AA DeJongh M Disz T et al The RAST Server: rapid annotations using subsystems technology BMC Genomics 2008 9 75 10.1186/1471-2164-9-75 18261238
44. Wattam AR Abraham D Dalay O Disz TL Driscoll T et al PATRIC, the bacterial bioinformatics database and analysis resource Nucleic Acids Res 2014 42 D581 D591 10.1093/nar/gkt1099 24225323
45. Madden T The BLAST Sequence Analysis Tool. 2002 Oct 9. The NCBI Handbook. Bethesda (MD): National Center for Biotechnology Information (US) 2002
46. O’Toole GA Microtiter dish biofilm formation assay JoVE 2011 e2437 10.3791/2437-v
47. Zhu J Miller MB Vance RE Dziejman M Bassler BL et al Quorum-sensing regulators control virulence gene expression in Vibrio cholerae Proc Natl Acad Sci USA 2002 99 3129 3134 10.1073/pnas.052694299 11854465
48. Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M et al Fiji: an open-source platform for biological-image analysis Nat Methods 2012 9 676 682 10.1038/nmeth.2019 22743772
49. Darling AE Mau B Perna NT progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement PLoS One 2010 5 1 17 10.1371/journal.pone.0011147
50. Hall BM Ma C-X Liang P Singh KK Fluctuation analysis CalculatOR: a web tool for the determination of mutation rate using Luria-Delbruck fluctuation analysis Bioinformatics 2009 25 1564 1565 10.1093/bioinformatics/btp253 19369502
51. Rosche WA Foster PL Determining mutation rates in bacterial populations Methods 2000 20 4 17 10.1006/meth.1999.0901 10610800
52. Jurasinski G Koebsch F Guenther A Beetz S Flux rate calculation from dynamic closed chamber. R package version 03-01 2022 https://cran.r-project.org/package=flux
53. Gibson DG Young L Chuang R-Y Venter JC Hutchison CA III et al Enzymatic assembly of DNA molecules up to several hundred kilobases Nat Methods 2009 6 343 345 10.1038/nmeth.1318 19363495
54. House BL Mortimer MW Kahn ML New recombination methods for Sinorhizobium meliloti genetics Appl Environ Microbiol 2004 70 2806 2815 10.1128/AEM.70.5.2806-2815.2004 15128536
55. Hartley JL Temple GF Brasch MA DNA cloning using in vitro site-specific recombination Genome Res 2000 10 1788 1795 10.1101/gr.143000 11076863
56. Simon R Priefer U Pühler A A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria Nat Biotechnol 1983 1 784 791 10.1038/nbt1183-784
57. Parrello B Butler R Chlenski P Olson R Overbeek J et al A machine learning-based service for estimating quality of genomes using PATRIC BMC Bioinformatics 2019 20 486 10.1186/s12859-019-3068-y 31581946
58. Abel S Abel zur Wiesch P Chang H-H Davis BM Lipsitch M et al Sequence tag–based analysis of microbial population dynamics Nat Methods 2015 12 223 226 10.1038/nmeth.3253 25599549
59. Cameron DE Urbach JM Mekalanos JJ A defined transposon mutant library and its use in identifying motility genes in Vibrio cholerae Proc Natl Acad Sci USA 2008 105 8736 8741 10.1073/pnas.0803281105 18574146
60. Morais LLC de S Garza DR Loureiro ECB Vale ER Santos DSA de S et al Population and genetic study of Vibrio cholerae from the amazon environment confirms that the WASA-1 prophage is the main marker of the epidemic strain that circulated in the region PLoS One 2013 8 e81372 10.1371/journal.pone.0081372 24303045
61. Val M-E Marbouty M de Lemos Martins F Kennedy SP Kemble H et al A checkpoint control orchestrates the replication of the two chromosomes of Vibrio cholerae Sci Adv 2016 2 e1501914 10.1126/sciadv.1501914 27152358
62. Matthey N Stutzmann S Stoudmann C Guex N Iseli C et al Neighbor predation linked to natural competence fosters the transfer of large genomic regions in Vibrio cholerae elife 2019 8 e48212 10.7554/eLife.48212 31478834
63. Nusrin S Gil AI Bhuiyan NA Safa A Asakura M et al Peruvian Vibrio cholerae O1 El Tor strains possess a distinct region in the Vibrio seventh pandemic island-II that differentiates them from the prototype seventh pandemic El Tor strains J Med Microbiol 2009 58 342 354 10.1099/jmm.0.005397-0 19208885
64. Taviani E Grim CJ Choi J Chun J Haley B et al Discovery of novel Vibrio cholerae VSP-II genomic islands using comparative genomic analysis FEMS Microbiol Lett 2010 308 130 137 10.1111/j.1574-6968.2010.02008.x 20528940
65. McKee RW Kariisa A Mudrak B Whitaker C Tamayo R A systematic analysis of the in vitro and in vivo functions of the HD-GYP domain proteins of Vibrio cholerae BMC Microbiol 2014 14 272 10.1186/s12866-014-0272-9 25343965
66. Thi TD Lopez E Rodriguez-Rojas A Rodriguez-Beltran J Couce A et al Effect of recA inactivation on mutagenesis of Escherichia coli exposed to sublethal concentrations of antimicrobials J Antimicrob Chemother 2011 66 531 538 10.1093/jac/dkq496 21212055
67. Cirz RT Chin JK Andes DR de Crécy-Lagard V Craig WA et al Inhibition of mutation and combating the evolution of antibiotic resistance PLoS Biol 2005 3 e176 10.1371/journal.pbio.0030176 15869329
68. Friedberg EC Walker GC Siede W DNA Repair and Mutagenesis ASM Press 2005
69. Kanie S Horibata K Kawano M Isogawa A Sakai A et al Roles of RecA protein in spontaneous mutagenesis in Escherichia coli Genes Genet Syst 2007 82 99 108 10.1266/ggs.82.99 17507776
70. Bell JC Kowalczykowski SC RecA: regulation and mechanism of a molecular search engine Trends Biochem Sci 2016 41 491 507 10.1016/j.tibs.2016.04.002 27156117
71. Krašovec R Richards H Gomez G Gifford DR Mazoyer A et al Measuring microbial mutation rates with the fluctuation assay J Vis Exp 2019 10.3791/60406
72. Teschler JK Nadell CD Drescher K Yildiz FH Mechanisms underlying Vibrio cholerae biofilm formation and dispersion Annu Rev Microbiol 2022 76 503 532 10.1146/annurev-micro-111021-053553 35671532
73. Flemming H-C Wingender J Szewzyk U Steinberg P Rice SA et al Biofilms: an emergent form of bacterial life Nat Rev Microbiol 2016 14 563 575 10.1038/nrmicro.2016.94 27510863
74. Koestler BJ Waters CM Bile acids and bicarbonate inversely regulate intracellular cyclic di-GMP in Vibrio cholerae . Infect Immun 2014 82 3002 3014 10.1128/IAI.01664-14 24799624
75. Rocha EPC Cornet E Michel B Comparative and evolutionary analysis of the bacterial homologous recombination systems PLoS Genet 2005 1 e15 10.1371/journal.pgen.0010015 16132081
76. Karlin S Brocchieri L Evolutionary conservation of RecA genes in relation to protein structure and function J Bacteriol 1996 178 1881 1894 10.1128/jb.178.7.1881-1894.1996 8606161
77. Ram Y Hadany L The evolution of stress-induced hypermutation in asexual populations Evolution 2012 66 2315 2328 10.1111/j.1558-5646.2012.01576.x 22759304
78. Swings T Van den Bergh B Wuyts S Oeyen E Voordeckers K et al Adaptive tuning of mutation rates allows fast response to lethal stress in Escherichia coli elife 2017 6 e22939 10.7554/eLife.22939 28460660
79. Taddei F Radman M Maynard-Smith J Toupance B Gouyon PH et al Role of mutator alleles in adaptive evolution Nature 1997 387 700 702 10.1038/42696 9192893
80. Srivastava D Harris RC Waters CM Integration of cyclic di-GMP and quorum sensing in the control of vpsT and aphA in Vibrio cholerae J Bacteriol 2011 193 6331 6341 10.1128/JB.05167-11 21926235
81. Hengge R High-specificity local and global c-di-GMP signaling Trends Microbiol 2021 29 993 1003 10.1016/j.tim.2021.02.003 33640237
82. Satchell KJF Jones CJ Wong J Queen J Agarwal S et al Phenotypic analysis reveals that the 2010 Haiti cholera epidemic is linked to a hypervirulent strain Infect Immun 2016 84 2473 2481 10.1128/IAI.00189-16 27297393
83. Walker LM Haycocks JRJ Van Kessel JC Dalia TN Dalia AB et al A simple mechanism for integration of quorum sensing and cAMP signalling in Vibrio cholerae elife 2023 12 RP86699 10.7554/eLife.86699 37410076
84. Srivastava D Hsieh M-L Khataokar A Neiditch MB Waters CM Cyclic di-GMP inhibits Vibrio cholerae motility by repressing induction of transcription and inducing extracellular polysaccharide production Mol Microbiol 2013 90 1262 1276 10.1111/mmi.12432 24134710
85. Platt R Drescher C Park SK Phillips GJ Genetic system for reversible integration of DNA constructs and lacZ gene fusions into the Escherichia coli chromosome Plasmid 2000 43 12 23 10.1006/plas.1999.1433 10610816
86. Stothard P Wishart DS Circular genome visualization and exploration using CGView Bioinformatics 2005 21 537 539 10.1093/bioinformatics/bti054 15479716
87. Grant JR Stothard P The CGView Server: a comparative genomics tool for circular genomes Nucleic Acid Res 2008 36 W181 W184 10.1093/nar/gkn179 18411202
