
==== Front
MycoKeys
MycoKeys
11
urn:lsid:arphahub.com:pub:C004A564-9D6A-5F9F-B058-6A3815DFE9C3
urn:lsid:zoobank.org:pub:A4FD9303-3F01-45D9-B438-FCCFE465D2F7
MycoKeys
1314-4057
1314-4049
Pensoft Publishers

10.3897/mycokeys.108.126994
126994
Research Article
Lichenized Fungi
Phylogeny
Taxonomy
Asia
﻿Three new taxa of the lichen genus Lobothallia (Megasporaceae, Ascomycota) from China
Zhang Yanyun https://orcid.org/0000-0002-0902-5066
1Conceptualization Writing - original draft Funding acquisition Investigation Methodology
Wang Lun 1Writing - original draft Data curation Formal analysis Investigation Software
Yu Xinmeng 1Data curation Formal analysis Investigation
Cheng Su 1Data curation Formal analysis
Liu Junlan 1Data curation Formal analysis
Wang Xinyu wangxinyu@mail.kib.ac.cn
https://orcid.org/0000-0003-2166-6111
2Conceptualization Writing - review and editing Funding acquisition Supervision Validation
1 College of Life Sciences, Anhui Normal University, 241000, Wuhu, China
2 Yunnan Key Laboratory for Fungal Diversity and Green Development, Kunming Institute of Botany, CAS, 650201, Kunming, China
3 Key Laboratory of Phytochemistry and Natural Medicines, Kunming Institute of Botany, CAS, 650201, Kunming, China
Corresponding author: Xinyu Wang (wangxinyu@mail.kib.ac.cn)
Academic editor: Pradeep Divakar

2024
16 9 2024
108 351369
9B8BE6F8-070C-586A-97D4-E3D08873EF7807 5 2024
21 8 2024
Yanyun Zhang, Lun Wang, Xinmeng Yu, Su Cheng, Junlan Liu, Xinyu Wang
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
﻿Abstract

Two new species; Lobothalliacrenulata Lun Wang & Y. Y. Zhang, L.lobulata Lun Wang & Y. Y. Zhang and one new variety; L.subdiffractavar.rimosa Lun Wang & Y. Y. Zhang, are reported from China and described, based on morphological, chemical and molecular characters. Phylogenetic analyses showed that these new taxa form monophyletic groups. Lobothalliacrenulata and L.lobulata, together with L.hydrocharis, L.radiosa and L.recedens, form a well-supported clade, whereas L.subdiffractavar.rimosa is nested within the samples of L.subdiffracta. Lobothalliacrenulata is characterised by its placodioid thallus, thickly pruinose upper surface with a rimose appearance, aspicilioid to lecanorine apothecia with a crenate thalline margin and concave, black and pruinose discs. Lobothallialobulata is characterised by its placodioid thallus, pruinose upper surface with lobules, aspicilioid when immature, lecanorine to zeorine apothecia at maturity and concave to plane, dark brown, shiny and epruinose discs. Lobothalliasubdiffractavar.rimosa is characterised by its areolate thallus, rimose and pruinose upper surface, lecanorine apothecia and slightly concave to plane, black and pruinose discs. Secondary metabolites were not detected in the two new species nor the new variety. A key is provided for the species of Lobothallia in China.

Key words: New species
new variety
Qinghai-Tibetan Plateau
saxicolous lichen
taxonomy
This work was funded by the Anhui Provincial Education Department (no. 2022AH050207), the Second Tibetan Plateau Scientific Expedition and Research Program (STEP) (no. 2019QZKK0503), the National Training Program of Innovation and Entrepreneurship for Undergraduates from Anhui Normal University (S202310370581) and the Yunnan Fundamental Research Project (202401AT070196).Citation

Zhang Y, Wang L, Yu X, Cheng S, Liu J, Wang X (2024) Three new taxa of the lichen genus Lobothallia (Megasporaceae, Ascomycota) from China. MycoKeys 108: 351–369. https://doi.org/10.3897/mycokeys.108.126994
==== Body
pmc﻿Introduction

Lobothallia (Clauzade & Cl. Roux) Hafellner was originally established as a subgenus within Aspicilia A. Massal. (Clauzade and Roux 1984), then later treated as a distinct genus by Hafellner (1991). The genus Lobothallia is characterised by its immersed to adnate, or constrictively sessile apothecia, an epihymenium N– reaction to slightly greenish, an algal layer below the hypothecium, a non-amyloid ascus tholus (Aspicilia-type), with shorter ascospores (< 18 µm) and conidia (< 8 µm) compared to other genera of the family Megasporaceae (Nordin et al. 2010; Kou et al. 2013; Paukov et al. 2019).

Initially, Lobothallia was established to accommodate four marginally lobate species; including L.alphoplaca (Wahlenb.) Hafellner, L.melanaspis (Ach.) Hafellner, L.praeradiosa (Nyl.) Hafellner and L.radiosa (Hoffm.) Hafellner (Hafellner 1991). Subsequently, multiple species were transferred into Lobothallia, based on their phylogeny and taxonomy. These additions included lobate species: Aspiciliahydrocharis Poelt & Nimis, Lecanorahedinii H. Magn., L.platycarpa J. Steiner (Nimis 2016; Paukov et al. 2019; Zulfiqar et al. 2022) and non-lobate or vaguely lobate species, such as Aspiciliafarinosa (Flörke) Flagey, A.recedens (Taylor) Arnold and Lecanorasubdiffracta H. Magn. (Nordin et al. 2010; Paukov et al. 2019). To date, the genus includes 28 species worldwide (https://www.indexfungorum.org/).

Ten species of Lobothallia have been reported from China: L.alphoplaca, L.cheresina (Müll. Arg.) A. Nordin, Cl. Roux & Sohrabi, L.crassimarginata Kou & Q. Ren, L.hedinii (H. Magn.) Paukov, A. Nordin & Sohrabi, L.praeradiosa, L.pruinosa Kou & Q. Ren, L.radiosa, L.semisterilis (H. Magn.) Y. Y. Zhang, L.subdiffracta (H. Magn.) Paukov and L.zogtii Paukov & Davydov (Magnusson 1940, 1944; Reyim et al. 2012; Kou et al. 2013; Paukov et al. 2019; Wei 2020; Zhang et al. 2020). Secondary metabolites have been reported for all of these species except, L.subdiffracta. From 2014 to 2022, we conducted several field surveys of lichen across the Qinghai-Tibetan Plateau Region, during which, ca. 100 specimens were collected of the genus Lobothallia. Several of these specimens differed from the known species in their morphology, molecular phylogeny and absence of secondary metabolites. Here, we describe two new species and one new variety within the genus Lobothallia.

﻿Materials and methods

﻿Morphological and chemical examination

In this study, 108 specimens were examined and deposited in the following Herbaria: Anhui Normal University (AHUB), Lichen Herbarium, Kunming Institute of Botany, Chinese Academy of Sciences (KUN-L) and Shandong Normal University (SDNU). The external morphological characters of air-dried material were studied under a stereomicroscope (OLYMPUS SZ61TR). Anatomical features were studied using a light microscope (OLYMPUS BX43) on transverse sections of apothecia and thalli, prepared manually with a razor blade and mounted in water or lactophenol cotton blue (LCB). Spore measurements were presented as: (minimum–) (x̄ - SD) – x̄ – (x̄ + SD) (–maximum), where x̄ is the arithmetic mean and SD is the standard deviation (values were rounded to the nearest 0.5 µm), followed by the number of measurements (n) (Li et al. 2023). Lugol’s solvent (I) was used to examine the apical structure of asci. Crystals in apothecia and thallus were observed in polarised light (POL) and their solubility was assessed in 10% potassium hydroxide (KOH) (K). Spot tests were conducted using K and a saturated aqueous solution of sodium hypochlorite (NaClO) (C). Secondary metabolites were analysed using thin layer chromatography (TLC) with the solvent C (Orange et al. 2001).

﻿DNA extraction, PCR and sequencing

Genomic DNA was extracted from dry or fresh specimens using the DNAsecure Plant Kit (Tiangen, China), according to the manufacturer’s instructions. The fungal internal transcribed spacer (ITS) region and mitochondrial small subunit (mtSSU) of rDNA were amplified using the primers, ITS1F (5′ CTTGGTCATTTAGAGGAAGTAA 3′) (Gardes and Bruns 1993), ITS4a (5′ CGCCGTTACTGGGGCAATCCCTG 3′) (Larena et al. 1999), mrSSU1 (5′ AGCAGTGAGGAATATTGGTC 3′) and mrSSU3r (5′ ATGTGGCACGTCTATAGCCC 3′) (Zoller et al. 1999). Amplifications were performed in a 25 μl volume containing 12.5 μl 2 × Trio Taq Master Mix (Monad Anhui), 1 μl of each primer, 9.5 μl ddH2O and 1 μl DNA. PCR-cycle conditions were: initial denaturation at 94 °C for 5 min, followed by 30 cycles of 94 °C for 15 s, 53 °C for 15 s and 72 °C for 1 min and a final extension at 72 °C for 10 min. The PCR products were visualised on 1% agarose gels. The PCR products were sequenced by GENERAL Biosystems (Chuzhou, China) using the amplification primers.

﻿Phylogenetic analyses

The raw sequences were initially checked with the BLAST tool on the NCBI online service (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the lichen affinity. Geneious v.8.0. was used to assemble and edit the raw sequences and generate a single matrix for nrITS and mtSSU. Each matrix was aligned using the MAFFT v.7 online server (https://mafft.cbrc.jp/alignment/server/). Before concatenating the single-gene matrices of nrITS and mtSSU, we tested for potential incongruity using IQ-TREE with 1000 ultrafast bootstrap replicates. No well supported conflict was detected. SequenceMatrix 1.7.8 (Vaidya et al. 2011) was used to concatenate the nrITS and mtSSU genes and produce a 2-locus dataset. PartitionFinder v.2.0 (Lanfear et al. 2017) was used to estimate the best schemes and nucleotide substitution models for Maximum Likelihood (ML) and Bayesian Inference (BI) analyses. The best-fit models for ITS1, 5.8S, ITS2 and mtSSU were GTR+G.

Phylogenetic relationships were inferred using Bayesian Inference and Maximum Likelihood. The Bayesian method was performed with MrBayes 3.2.7 (Ronquist et al. 2012), using four Markov chains running for 12 million generations. Trees were sampled every 100 generations and the first 25% were discarded as burn-in. Subset rates were modelled as fixed and equal. We used the default distributions for priors. The average standard deviation of split frequencies fell below 0.01 by the end of the analysis. Tracer v.1.7 (Rambaut et al. 2018) was used to assess chain convergence by checking the effective sampling size (ESS > 200). ML analyses were performed with RaxmlGUI (Silvestro and Michalak 2012) using the general time reversible model of nucleotide substitution with the gamma model of rate heterogeneity (GTRGAMMA). All trees were visualised using Mega v.7.0 (Kumar et al. 2016) and edited using PowerPoint. Bayesian posterior probabilities ≥ 0.95 and ML bootstrap values ≥ 70% were presented on the ML tree.

﻿Results and discussion

The nrITS-mtSSU data matrix encompassed a total of 91 sequences (61 nrITS, 30 mtSSU, including 49 downloaded from GenBank and 42 newly generated) from 61 samples of 22 taxa (Table 1). The length of the final aligned dataset was 1342 nucleotides. Three species, Aspiciliacinerea (L.) Körb., Circinariaesculenta (Pall.) Sohrabi and C.fruticulosa (Eversm.) Sohrabi were chosen as the outgroup, following previous phylogenetic studies (Nordin et al. 2010; Paukov et al. 2019).

Table 1. Sequences used in the phylogenetic analyses in this study, with specimen information and GenBank accession numbers. Newly-obtained sequences are in bold font. “na” indicates that there is no sequence available.

Species	Country	Voucher specimens	GeneBank accession number	Reference	
nrITS	mtSSU	
Aspiciliacinerea	Sweden: Dalarna	Hermansson 13275 (UPS)	EU057899	HM060695	Nordin et al. (2010)	
Circinariafruticulosa	Russia: Chelyabinsk	Paukov 3074 (UFU)	MK347508	MK348227	Paukov et al. (2019)	
C.esculenta	Kazakhstan: Kyzylorda	UFU L-1743	MK347507	MK348226	Paukov et al. (2019)	
Lobothalliaalphoplaca	Norway	O-L-200411	MK812484	na	Marthinsen et al. (2019)	
L.alphoplaca	Ukraine: Donetzk	SK A20	KT456207	KT456211	Kondratyuk et al. (2015)	
L.alphoplaca	China: Inner Mongolia	Tong 20117616 (SDNU)	JX499233	na	Kou et al. (2013)	
L.brachyloba	Russia: Republic of Altai	Frolov 357 (UFU) Holotype	MK347506	MK348228	Paukov et al. (2019)	
L.crenulata	China: Xizang	ZYY22-331 (AHUB)	PP663141	PP663164	This paper	
L.crenulata	China: Xizang	ZYY22-301 (KUN-L) Holotype	PP663142	PP663165	This paper	
L.cheresina	Greece	Sipman & Raus 63224 (B)	MN172423	na	Unpublished	
L.crassimarginata	China: Inner Mongolia	Wang 20122565 (SDNU) Holotype	JX476026	na	Kou et al. (2013)	
L.crassimarginata	China: Inner Mongolia	Tong 20122583 (SDNU)	KC007439	na	Kou et al. (2013)	
L.densipruinosa	Pakistan	LAH 36790 Holotype	MZ871507	na	Ashraf et al. (2022)	
L.densipruinosa	Pakistan	LAH 36951	MZ871515	na	Ashraf et al. (2022)	
L.elobulata	Pakistan	LAH 37153 Holotype	ON384441	na	Zulfiqar et al. (2022)	
L.elobulata	Pakistan	LAH 37154	ON428667	na	Zulfiqar et al. (2022)	
L.epiadelpha	Russia: Orenburg	Paukov 1881 (UFU) Holotype	MK347505	MK348232	Paukov et al. (2019)	
“L.helanensis”	China: Inner Mongolia	Tong 20122517 (SDNU) Holotype	JX476030	na	Kou et al. (2013)	
“L.helanensis”	China: Inner Mongolia	Tong 20122791 (SDNU)	JX476031	na	Kou et al. (2013)	
L.hydrocharis	Italy: Sardinia	JN72085b (BOLO)	OQ073922	na	Nascimbene et al. (2023)	
L.hydrocharis	Italy: Sardinia	SMNS-STU-F-0002807 (STU)	OQ073923	na	Nascimbene et al. (2023)	
L.iqbalii	Pakistan	LAH 37149 Holotype	ON384444	na	Zulfiqar et al. (2022)	
L.iqbalii	Pakistan	LAH 37150	ON384445	na	Zulfiqar et al. (2022)	
L.lobulata	China: Sichuan	ZYY22-819 (KUN-L) Holotype	PP663143	PP663166	This paper	
L.lobulata	China: Sichuan	ZYY22-822 (AHUB)	PP663144	PP663167	This paper	
L.lobulata	China: Sichuan	Wang et al. 22-73395 (KUN-L)	PP663145	PP663168	This paper	
L.lobulata	China: Sichuan	Wang et al. 22-73396 (KUN-L)	PP663146	PP663169	This paper	
L.lobulata	China: Sichuan	ZYY22-829 (AHUB)	PP663147	PP663170	This paper	
L.lobulata	China: Sichuan	ZYY22-824 (AHUB)	PP663148	PP663171	This paper	
L.melanaspis	Sweden: Jämtland	Nordin 6622 (UPS)	HQ259272	HM060688	Nordin et al. (2011)	
L.melanaspis	Norway	Owe-Larsson 8943a (UPS)	JF825524	na	Valadbeigi et al. (2011)	
L.pakistanica	Pakistan	LAH 37137 Holotype	ON392718	na	Zulfiqar et al. (2022)	
L.pakistanica	Pakistan	LAH 37139	ON392720	na	Zulfiqar et al. (2022)	
L.praeradiosa	Russia: Orenburg	UFU L-1264	MK347501	MK348229	Paukov et al. (2019)	
L.praeradiosa	China: Xinjiang	Huang 20126355 (SDNU)	JX499230	na	Kou et al. (2013)	
L.praeradiosa	China: Xinjiang	Wang et al. 22-71753 (KUN-L)	PP663149	na	This paper	
L.praeradiosa	China: Xinjiang	ZYY22-596 (AHUB)	PP663150	PP663172	This paper	
L.praeradiosa	China: Xinjiang	ZYY22-570 (AHUB)	PP663151	PP663173	This paper	
L.pruinosa	China: Inner Mongolia	Wang 20123630 (SDNU)	JX476027	na	Kou et al. (2013)	
L.pruinosa	China: Inner Mongolia	Wang 20123278 (SDNU) Holotype	JX476028	na	Kou et al. (2013)	
L.pruinosa	China: Inner Mongolia	Wang 20123575 (SDNU)	PP663152	na	This paper	
L.pruinosa	China: Inner Mongolia	Wang 20122917 (SDNU)	PP663153	na	This paper	
L.pruinosa	China: Inner Mongolia	Dong 20123276 (SDNU)	PP663154	na	This paper	
L.radiosa	Czech Republic: South Moravia	Malicek 9968	ON707068	ON715664	Unpublished	
L.radiosa	Greece	Sipman & Raus 63229 (B)	MN172452	na	Unpublished	
L.radiosa	Sweden	Nordin 5889 (UPS)	JF703124	na	Roux et al. (2011)	
L.recedens	Sweden	Nordin 6035 (UPS)	HQ406807	na	Owe-Larsson et al. (2011)	
L.recedens	Portugal	Sipman 62857	MN586980	na	Sipman and Aptroot (2020)	
L.subdiffractavar.rimosa	China: Xinjiang	Wang et al. 22-72975 (KUN-L)	PP663155	PP663174	This paper	
L.subdiffractavar.rimosa	China: Xinjiang	ZYY22-647 (KUN-L) Holotype	PP663156	PP663175	This paper	
L.semisterilis	China: Qinghai	Wang et al. 18-59322 (KUN-L)	MK778039	na	Zhang et al. (2020)	
L.semisterilis	China: Qinghai	Wang et al. 18-59345 (KUN-L)	MK778042	na	Zhang et al. (2020)	
L.semisterilis	China: Gansu	Wang et al. 22-73123T (KUN-L)	PP663157	PP663176	This paper	
L.semisterilis	China: Gansu	Wang et al. 22-73079A (KUN-L)	PP663158	PP663177	This paper	
L.semisterilis	China: Gansu	ZYY22-715 (AHUB)	PP663159	PP663178	This paper	
L.semisterilis	China: Gansu	ZYY22-719 (AHUB)	PP663160	PP663179	This paper	
L.semisterilis	China: Gansu	ZYY22-704 (AHUB)	PP663161	PP663180	This paper	
L.subdiffracta	Russia: Republic of Altai	Frolov 178-1 (UFU)	MK347503	MK348233	Paukov et al. (2019)	
L.subdiffracta	Russia: Republic of Altai	Frolov 178-2 (UFU)	MK347504	MK348235	Paukov et al. (2019)	
L.subdiffracta	China: Xinjiang	ZYY22-628 (AHUB)	PP663162	PP663181	This paper	
L.subdiffracta	China: Xinjiang	Yin A. C. & Chen H. X. 22-72347 (KUN-L)	PP663163	PP663182	This paper	

The two-locus phylogenetic tree showed that species of the genus Lobothallia fell into three main clades (Fig. 1). Our two new species, Lobothalliacrenulata and L.lobulata, formed highly supported monophyletic clades, which belonged to Clade I. Lobothalliacheresina is the basal species of this clade, differing from other species of this clade by its non-lobate thallus with definite cracks up to the margins and aspicilioid apothecia without prominent margin (Müller 1880; Paukov et al. 2019; Zulfiqar et al. 2022). Lobothallialobulata and L.crenulata, together with the species of L.hydrocharis (Poelt & Nimis) Sohrabi & Nimis, L.radiosa and L.recedens (Taylor) A. Nordin, Savić & Tibell formed a monophyletic subclade. Species of this subclade had no secondary metabolites, with the exceptions of L.radiosa, which has three chemotypes: chemotype parasitica (stictic acid), chemotype subcircinata (norstictic acid) and chemotype radiosa (without norstictic or with trace amount of norstictic acid) (Nimis and Poelt 1987; Ryan 2004; Paukov et al. 2019; Zulfiqar et al. 2022). Lobothalliacrenulata is the basal species of this subclade and differs from the other species by its thickly pruinose thallus with rimose upper surface and its crenate thalline margin. Lobothallialobulata is sister to a subclade formed by L.hydrocharis and L.radiosa, but differs in the presence of lobules at the upper surface and its lecanorine to zeorine apothecia at maturity.

10.3897/mycokeys.108.126994.figure1 3A37E9F3-5B9B-51D5-9443-89F483A98755 Figure 1. Phylogenetic tree generated from Maximum Likelihood (ML) analysis, based on the concatenated nrITS and mtSSU dataset. ML bootstrap values ≥ 70% (left) and Bayesian posterior probabilities ≥ 0.95 (right) are displayed along the branches of the tree. Newly-generated sequences are indicated in bold. The three new taxa are marked by triangles.

https://binary.pensoft.net/fig/1134730

Clade II comprises a single species, Lobothalliaelobulata Zulfiqar, Khalid & Paukov, which is easily recognised by its black prothallus, non-lobate thallus with a smooth and epruinose upper surface, lecanorine apothecia with thinly pruinose disc and the absence of secondary metabolites (Zulfiqar et al. 2022). Further research is required regarding the phylogenetic position of this clade.

Clade III consisted of several subclades and species lineages. Species of this clade were mainly distributed in Asia. Our new variety; Lobothalliasubdiffractavar.rimosa, together with samples of “L.helanensis” formed a sister group to L.subdiffracta, which was nested within Clade III. These taxa differ from other species of this clade by their non-lobate, thick and areolate thallus, rimose upper surface and absence of secondary metabolites (Magnusson 1944; Kou et al. 2013; Paukov et al. 2019). The species “Lobothalliahelanensis” was synonymised to L.subdiffracta by Paukov et al. (2019). Lobothalliasubdiffractavar.rimosa differs from L.subdiffracta by its lecanorine apothecia with permanent thalline margin and pruinose discs.

Nine out of the 28 species within the genus Lobothallia have no available gene sequences. Amongst these, secondary metabolites are only absent for Lobothalliachadefaudiana (Cl. Roux) A. Nordin, Cl. Roux & Sohrabi. Lobothalliachadefaudiana can be distinguished from our new taxa by the non-lobate thallus, with rough yellowish granules on the upper surface and immersed apothecia (Roux 1977; Paukov et al. 2019). Lobothalliacernohorskyana (Clauzade & Vězda) A. Nordin, Cl. Roux & Sohrabi, L.controversa Cl. Roux & A. Nordin, L.gangwondoana S.Y. Kondr., J.J. Woo & Hur and L.lacteola (Oxner) Şenkard., Paukov, Davydov & Sohrabi differ from the two new species by their non-lobate thallus, aspicilioid apothecia and the presence of norstictic acid (Clauzade and Vězda 1970; Roux et al. 2016; Paukov et al. 2019; Kondratyuk et al. 2020). Lobothalliazogtii is characterised by the brown thallus, white bordered squamules and the presence of stictic acid complex (Paukov et al. 2019). Lobothalliaplatycarpa shares whitish-grey and lobate thallus with the new species of L.crenulata, but differs in its immersed apothecia and the presence of norstictic acid (Zulfiqar et al. 2022). Lobothalliahedinii could potentially be confused with L.lobulata, but differs by its brown thallus, straight and parallel lobes and presence of norstictic acid (Magnusson 1940; Paukov et al. 2019).

﻿Taxonomy

Taxon classification Fungi
Pertusariales
Megasporaceae
﻿ Lobothallia crenulata

Lun Wang & Y. Y. Zhang sp. nov.

928B1684-6853-5D78-A5D6-143BA5CB36C3

Fungal Names: FN 571927

Fig. 2A–J

Type.

China • Xizang Autonomous Region: Shigatse Ci., Sa′gya Co.; 29°12′01.28″N; 88°23′09.65″E; 3924 m elev.; on schist rock in a desert environment; 14 June 2022; ZYY22-301 (Holotype: KUN-L0081882!, Isotype: AHUB-00157!).

Diagnosis.

Lobothalliacrenulata is characterised by its placodioid, thickly pruinose thallus, rimose upper surface, aspicilioid to lecanorine apothecia with a crenate thalline margin, concave, black and pruinose disc and the absence of secondary metabolites.

Etymology.

The epithet refers to the crenate thalline margin of the apothecia.

Description.

Thallus placodioid, circular to irregular in outline, up to 2 cm in diameter; central areoles contiguous, angular to rounded, flat to slightly convex, 0.5–2 mm wide; marginal lobes closely attached, 0.5–2 mm long, 0.2–1 mm wide, with an irregularly arranged and divided apex. Upper surface white to light grey, covered with white, thick and discontinuous pruina (see Fig. 2D). Upper cortex paraplectenchymatous, hyaline, 20–50 μm thick; epinecral layer 20–70 μm thick, consisting of dark granules (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming separated groups, 50–150 μm high, diffuse dark granules (soluble in K), algae ca. 10–20 μm in diam.; medulla with dark brown granules (POL+, insoluble in K). Lower cortex absent.

10.3897/mycokeys.108.126994.figure2 473C07C5-4220-5123-BE77-180A838A4A76 Figure 2. LobothalliacrenulataA thallus and apothecia B apothecia C marginal lobes D cross-section of thallus (LCB) E cross-section of thallus under polarised light (LCB) F vertical section of apothecia G, H ascus I ascospores J conidia. All sections were mounted in water, except where otherwise stated. Scale bars: 1 mm (A, C); 0.4 mm (B); 100 µm (D, E); 20 µm (F); 5 µm (G, H, I, J).

https://binary.pensoft.net/fig/1134731

Apothecia aspicilioid to lecanorine, numerous, 1–2 per areole, dispersed to crowded, rounded to flexuous, 0.1–1.25 mm in diam.; disc concave, black and thinly pruinose; thalline margin crenate, concolorous with the thallus, 0.05–0.125 mm wide; proper exciple inconspicuous. Hymenium hyaline, 75–120 µm high, I + blue; epihymenium 10–20 µm high, with inspersed pale brown (insoluble in K) and brown (soluble in K) granules and coarse hyaline plate-like crystals (insoluble in K); paraphyses simple, submoniliform at upper part, with 2–4 apical cells, apex thickened, 3–5 µm wide; hypothecium 30–60 μm high, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 70–80 × 20–30 µm; ascospores hyaline, simple, broadly ellipsoid to ellipsoid, (8.0–)11.0–13.0–14.5(–17.0) × (7.0–)8.5–9.0–10.0(–11.0) µm (n = 56), wall ca. 1.0 µm. Pycnidia uncommon; conidia bacilliform, 5–6 × 1–1.5 µm.

Chemistry.

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology.

This new species grows on calcareous schist rocks at elevations of 3924–4304 m in Xizang Autonomous Region, China.

Notes.

The new species is similar to Lobothalliaiqbalii Zulfiqar, Khalid & Paukov and L.pakistanica Razzaq, Fayyaz, Khalid & Afshan in its placodioid thallus, white to light grey upper surface and the absence of secondary metabolites. Lobothalliaiqbalii differs in its lecanorine apothecia with plane to convex disc and an entire and thick thalline margin (Zulfiqar et al. 2022). Lobothalliapakistanica differs in its rarely cracked central areoles, thinner epinecral layer (8–16 µm), slightly concave to flat, rarely pruinose disc and the absence of thalline margin (Zulfiqar et al. 2022). Lobothalliasubdiffracta shares some features with L.crenulata: rimose and pruinose thallus. However, L.subdiffracta differs in its grey thallus with thinner and uneven pruina and its non-lobate thallus (Magnusson 1944; Kou et al. 2013; Paukov et al. 2019). Another taxon, Lobothalliapruinosa, also has a placodioid and pruinose thallus and pruinose discs, but differs from L.crenulata in its entire thalline margin and the presence of norstictic and constictic acids (Kou et al. 2013).

Additional specimens examined.

China • Xizang Autonomous Region: Shigatse Ci., Dingri Co., along road G219; 28°35′10.03″N, 87°3′42.56″E; 4304 m elev.; on weathered schist rock; 16 June 2022; ZYY22-331 (KUN-L0081892, AHUB-00187).

Taxon classification Fungi
Pertusariales
Megasporaceae
﻿ Lobothallia lobulata

Lun Wang & Y. Y. Zhang sp. nov.

8D407007-CB9E-5302-959F-83D804258847

Fungal Names: FN 571928

Fig. 3A–K

Type.

China • Sichuan Prov.: Ganzi Tibetan Autonomous Prefecture, Xinlong County, along road G227; 31°25′52.77″N, 100°8′52.04″E; 3296 m elev.; on rock; 11 July 2022; ZYY22-819 (Holotype: KUN-L0082392!; Isotype: AHUB-00673!).

Diagnosis.

The species Lobothallialobulata is characterised by its conspicuously radiate marginal lobes, pruinose upper surface with lobules, the aspicilioid apothecia when immature, lecanorine to zeorine at maturity with epruinose, shiny discs and the absence of secondary metabolites.

Etymology.

The epithet refers to its lobules along the upper surface.

Description.

Thallus placodioid, circular in outline, up to 3 cm in diameter, tightly adnate to the substratum; central areoles contiguous, angular to irregular, plane to slightly convex, 0.3–1 mm across; marginal lobes radiate, plane, 1–5 mm long, 0.5–1 mm wide, ca. 0.3 mm thick, apex rounded, irregularly divided, usually with a black rim. Upper surface light grey to greyish-olive, lightly and discontinuously pruinose, pruina on the apex of lobes thicker than the centre. Lobules common, 0.1–0.3 mm, divided, heavily pruinose. Upper cortex paraplectenchymatous, even, ca. 30 μm thick, filled with pale brown (insoluble in K) and dark brown (partly soluble in K) granules; epinecral layer 10–20 μm thick, containing dark granules when pruina is present (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming separated groups, 50–150 μm high, containing black substance (soluble in K), algae cells ca. 5–10 μm in diam.; medulla filled with black substance (POL+, insoluble in K). Lower cortex absent.

Apothecia aspicilioid when immature, lecanorine to zeorine at maturity, common, initially 1–2 per areole, usually one per areole, scattered to slightly grouped, adnate, rounded, 0.5–1 mm in diam.; disc brown to brownish-black, shiny, epruinose, concave at first, plane at maturity; thalline margin entire, ca. 0.1 mm wide, slightly pruinose or epruinose, cortex identical with upper cortex (POL–), 30–50 μm thick; proper exciple conspicuous in mature apothecia, 20–150 μm thick. Hymenium hyaline, I+ blue, 100–120 μm high; epihymenium 5–10 μm thick, with pale brown (insoluble in K) and brown (soluble in K) granules; paraphyses simple, moniliform at upper part, with 3–6 cells, apex thickened, 4–6 µm wide; hypothecium 25–50 μm thick, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 70–80 × 15–20 µm; ascospores hyaline, simple, broadly ellipsoid, (9.0–)10.5–11.5–12.5(–13.0) × (7.0–)8.0–8.5–9.5(–10.0) µm (n = 64), wall ca. 1.0 µm. Pycnidia common, convex, ostioles dark brown, shiny; conidia hyaline, bacilliform, 5–6 × ca. 1 μm.

10.3897/mycokeys.108.126994.figure3 15D40AED-7C1A-5BEC-837B-75CE373DFE8D Figure 3. LobothallialobulataA thallus and apothecia B apothecia C lobules D cross-section of thallus E cross-section of thallus under polarised light F vertical section of apothecia G vertical section of apothecia under polarised light H, I ascus J ascospores K conidia. All sections were mounted in water, except where otherwise stated. Scale bars: 2 mm (A); 0.4 mm (B); 1 mm (C); 20 µm (D, E); 50 µm (F, G); 5 µm (H, I, J, K).

https://binary.pensoft.net/fig/1134732

Chemistry.

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology.

This new species grows on exposed calcareous rocks at elevations of 3262–3296 m elev. in Sichuan Province, China.

Notes.

This species shares morphological features with the closely-related Lobothalliaradiosa: both have placodioid thallus, areolate in central parts and conspicuously radiate marginal lobes. Lobothalliaradiosa has three chemotypes: parasitica with stictic acid, subcircinata with norstictic acid and radiosa with or without a trace amount of norstictic acid (Ryan 2004; Reyim et al. 2012; Paukov et al. 2019). The new species shares the chemotype of some specimens of radiosa, but differs in the presence of lobules, the aspicilioid apothecia when immature, lecanorine to zeorine at maturity and in its phylogenetic position. Lobothalliahydrocharis also has a placodioid thallus with secondary metabolites absent, but differs by its aspicilioid apothecia with black and matt discs and its distribution, which is restricted to Sardinia, Italy (Nimis and Poelt 1987; Nimis 2016; Nascimbene et al. 2023).

Additional specimens examined.

China • Sichuan Prov.: Xinlong Co., along road G227; 31°25′53″N, 100°8′53″E; 3282–3296 m elev.; on rock; 11 July 2022; ZYY22-822 (KUN-L0082395, AHUB-00676), ZYY22-824 (KUN-L0082397, AHUB-00678), ZYY22-829 (KUN-L0082402, AHUB-00683) • Shadui Vi.; 31°25′52″N, 100°8′54″E; 3262–3263 m elev.; on limestone rock; 11 July 2022; Li S. Wang et al.; 22-73395 (KUN-L0087873), 22-73396 (KUN-L0087874).

Taxon classification Fungi
Pertusariales
Megasporaceae
﻿ Lobothallia subdiffracta var. rimosa

Lun Wang & Y. Y. Zhang var. nov.

17100411-9150-5AB3-9DB8-994660D3F1F2

Fungal Names: FN 571929

Fig. 4 A–J

Type.

China • Xinjiang Uygur Autonomous Region: Hami Ci., Balikun Co.; 43°41′39″N, 92°17′48″E; 2031 m elev.; on rock; 04 July 2022; ZYY22-647 (Holotype: KUN-L0082221!, isotype: AHUB00501!).

Diagnosis.

Lobothalliasubdiffractavar.rimosa is characterised by its areolate thallus with slightly radiated marginal areoles, rimose and white pruinose upper surface, lecanorine apothecia with black and pruinose discs, its crenate thalline margin when immature and entire at maturity and the absence of secondary metabolites.

Etymology.

The epithet refers to the rimose upper surface.

Description.

Thallus areolate, usually circular in outline, up to 4 cm in diam., 2–5 mm thick, central areoles continuous, angular and slightly convex, 0.5–2.5 mm across, marginal areoles slightly radiate with a rounded apex. Upper surface greyish to clay coloured, rimose and pruinose. Upper cortex paraplectenchymatous, uneven, (25.0–)36.5–53.5–70.5(–85.0) μm (n = 20) thick, upper part brownish, insoluble in K; epinecral layer uneven, (10.0–)21.5–45.5–69.0(–95.0) μm (n = 30) thick, containing dark brown granules (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming algal stacks, 100–200 μm high, with dark granules (partly soluble in K), algae 8–15 μm in diam.; medulla containing black substance (POL+, insoluble in K). Lower cortex absent.

10.3897/mycokeys.108.126994.figure4 F85E6C42-2829-5E7B-B4F4-3A97FB4D50E2 Figure 4. Lobothalliasubdiffractavar.rimosaA thallus and apothecia B thalline margin crenate when immature and entire at maturity C slightly radiate arrangement of marginal areoles D cross-section of thallus E cross-section of thallus under polarised light F vertical section of apothecia G ascus H ascus (Lugol’s solution) I ascospores J conidia. All sections were mounted in water except where otherwise stated. Scale bars: 2 mm (A); 1 mm (B, C); 100 µm (D, E); 20 µm (F); 5 µm (G, H, I, J).

https://binary.pensoft.net/fig/1134733

Apothecia lecanorine, numerous, initially 1–2 per areole, then one per areole, dispersed to grouped, rounded, (0.2–)0.7–1.5(–2) mm in diam.; disc slightly concave to plane, matt, black, pruinose; thalline margin 0.1–0.15 mm wide, crenate when young, entire with age, pruinose, concolorous with upper surface, cortex identical with upper cortex (POL+), 40–75 μm thick; proper exciple inconspicuous. Hymenium hyaline, I+ blue, 100–125 μm high; epihymenium 5–15 μm thick, with pale brown (insoluble in K), brown (soluble in K) granules and hyaline plate-like crystals (insoluble in K); paraphyses simple to rarely anastomosed, submoniliform to moniliform at the upper part, with 3–5 cells, apex thickened, 4–6 µm wide; hypothecium 50–60 μm thick, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 60–80 × 20–30 µm; ascospores hyaline, simple, broadly ellipsoid, (8.0–)10.0–11.0–12.5(–13.0) × (7.0–)7.0–8.0–9.0(–10.0) µm (n = 50), wall ca. 1.0 µm. Pycnidia common, with punctiform ostiole, dark brown; conidia hyaline, bacilliform, 5–7(–8) × ca. 1 μm.

Chemistry.

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology.

This species grows on exposed calcareous rocks at elevations of approximately 2000 m in Xinjiang Uygur Autonomous Region, China.

Notes.

Lobothalliasubdiffractavar.rimosa, L.subdiffractavar.subdiffracta and “L.helanensis” were sympatric in north-western China and neighbouring regions and also phylogenetically closely interrelated (Kou et al. 2013; Paukov et al. 2019). “Lobothalliahelanensis” was previously synonymised with L.subdiffracta, because both shared the morphological characters of non-lobate thallus and apothecia with incised margins, with similar sequences in the ITS and mtSSU regions (Paukov et al. 2019). Our materials differ from both var. subdiffracta and “L.helanensis” by their characters of lecanorine apothecia, permanent thalline margin, pruinose discs and the slightly radiate marginal areoles. Therefore, we treat these specimens as a new variety within Lobothalliasubdiffracta. Table 2 presents a brief comparison of these taxa. Another taxon Lobothalliarecedens may be confused with L.subdiffractavar.rimosa due to its thick, areolate, non-lobate thallus and the absence of secondary metabolites. However, the former differs in its densely clustered apothecia (3–6 per areole) and its shorter conidia 3–5 × ca. 1 μm (Paukov et al. 2019; Cannon et al. 2023; Martellos et al. 2023).

Table 2. Comparison between Lobothalliavar.subdiffracta, “L.helanensis” and L.var.rimosa.

Character	L.var.subdiffracta	“L.helanensis”	L.var.rimosa	
Thallus form	areolate	areolate	areolate, marginal areoles slightly elongate	
Apothecia form and size (mm)	aspicilioid, disc 0.2–0.4(–1.5 in our newly collected materials) in diam.	aspicilioid, 0.5–1.3(–2) in diam.	lecanorine, (0.2–)0.7–1.5(–2) in diam.	
Disc	epruinose	epruinose	pruinose	
Habit (substratum)	siliceous rock	calcareous rock	calcareous rock	
References	Magnusson (1944); Paukov et al. (2019)	Kou et al. (2013)	This paper	

Additional specimens examined.

Lobothalliasubdiffractavar.rimosa. China • Xinjiang Uygur Autonomous Region: Hami Ci., Balikun Co., along road G335, 43°41′35.55″N, 92°17′46.81″E, 2036 m elev., on limestone rock, 04 July 2022, Li S. Wang et al. 22-72975 (KUN-L0087453).

Lobothalliasubdiffractavar.subdiffracta. China • Xinjiang Uygur Autonomous Region: Fukang Ci., Chengguan Vi.; 44°09′36.52″N, 87°58′42.00″E; 500–600 m elev.; on sandstone; 04 July 2022; Yin A. C. & Chen H. X.; 22-72347 (KUN-L0086973) • Turpan Ci., Tuokexun Co.; 43°06′15.85″N, 87°34′52.51″E; 2473 m elev.; on rock; 02 July 2022; ZYY22-628 (KUN-L0082202, AHUB-00482).

“Lobothalliahelanensis”. China • Inner Mongolia: Bayan Hot Vi., Helan Mountain; 1500–2000 m elev.; on rock; 19 Aug 2011; Wang H. Y. 20122708; Kou X. R. 20123833, Wang P. M. 20123198, Dong D. B. 20123040 (SDUN).

﻿Key to the species of Lobothallia in China

1	Thallus areolate, margins not lobate	2	
–	Thallus placodioid, margins distinctly lobate	4	
2	Thallus whitish with grey tinge, upper surface not farinose, with definite cracks up to the margin. Orbicular specimens with marginally radially elongated cracks, given the thallus a placodioid-like appearance. Apothecia without prominent thalline margin. Secondary metabolites absent or stictic/norstictic acid present	Lobothalliacheresina	
–	Thallus pruinose and rimose, not cracked. Apothecia with prominent thalline margin. Secondary metabolites absent	3	
3	Thallus light to dark grey to olive grey. Apothecia aspicilioid to lecanorine, with an epruinose disc	Lobothalliasubdiffractavar.subdiffracta	
–	Thallus greyish to clay coloured. Apothecia lecanorine, with a pruinose disc	Lobothalliasubdiffractavar.rimosa	
4	Terricolous, pycnidia prominent, sometimes protruding apothecia-like	Lobothalliasemisterilis	
–	Saxicolous, pycnidia immersed to slightly convex with depressed or punctiform ostiole	5	
5	Secondary metabolites absent	6	
–	Secondary metabolites present	7	
6	Lobules present at the upper surface, discs shiny and epruinose, thalline margin entire	Lobothallialobulata	
–	Lobules absent, discs matt and pruinose, thalline margin crenate	Lobothalliacrenulata	
7	Norstictic acid present	8	
–	Norstictic acid absent, but stictic acid present. Thallus brown, lobes with definite deep cracks forming a reticulate pattern in exposed habitat	Lobothalliazogtii	
8	Thallus epruinose	9	
–	Thallus pruinose	11	
9	Thallus loosely attached to the substratum (sometimes removable intact). Central areoles strongly swollen, bullate. Lobes often strongly convex to almost cylindrical	Lobothalliaalphoplaca	
–	Thallus closely attached to the substratum. Central areoles plane to convex or uneven, not bullate. Lobes plane to moderately convex	10	
10	Lobes 1–2 mm long, closely attached, not overlapping. Upper surface grey, sometimes tinted ochraceous or rosy. Apothecia with thick thalline margin, 0.2–0.5 mm wide. On calcareous rocks	Lobothalliacrassimarginata	
–	Lobes 3–6 mm long, loosely attached, overlapping. Upper surface green grey to orange brown. Apothecia with narrower thalline margin (less than 0.3 mm wide). On siliceous rocks	Lobothalliapraeradiosa	
11	Thallus brown, lobes strongly convex, simple to dichotomous, with straight and parallel margins	Lobothalliahedinii	
–	Thallus whitish-grey to brownish-grey or grey, lobes flat or moderately convex	12	
12	Lobes flat, 1–3 mm long. Constictic acid present	Lobothalliapruinosa	
–	Lobes moderately convex, 3–5 mm long, with darkened tips. Constictic acid absent	Lobothalliaradiosa	

Supplementary Material

XML Treatment for Lobothallia crenulata

XML Treatment for Lobothallia lobulata

XML Treatment for Lobothallia subdiffracta var. rimosa

﻿Acknowledgements

The authors thank Dr. Lulu Zhang from Shandong Normal University and the curator Dr. Xinyu Wang of KUN-L for loaning specimens and permitting DNA extraction. We thank Dr. Fiona Ruth Worthy from Kunming Institute of Botany, CAS, for English-language revision.

﻿Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was funded by the Anhui Provincial Education Department (no. 2022AH050207), the Second Tibetan Plateau Scientific Expedition and Research Program (STEP) (no. 2019QZKK0503), the National Training Program of Innovation and Entrepreneurship for Undergraduates from Anhui Normal University (S202310370581) and the Yunnan Fundamental Research Project (202401AT070196).

Author contributions

Yanyun Zhang performed specimen collection, data analysis, draft writing and provided funding; Lun Wang performed experimental work, data analysis and draft writing; Xinmeng Yu, Su Cheng and Junlan Liu conducted part of the molecular and chemical experiments. Xinyu Wang designed the project and supervised this research, revised the manuscript and provided funding.

Author ORCIDs

Yanyun Zhang https://orcid.org/0000-0002-0902-5066

Xinyu Wang https://orcid.org/0000-0003-2166-6111

Data availability

All of the data that support the findings of this study are available in the main text.

Yanyun Zhang and Lun Wang contributed equally to this work.
==== Refs
﻿References

Ashraf A Habib K Khalid AN (2022) A new pruinose lichen species in genus Lobothallia (Megasporaceae, lichen forming Ascomycota) from Pakistan. Acta Botanica Brasilica 36: e2021abb0225.
Cannon P Nordin A Coppins B Aptroot A Sanderson N Simkin J (2023) Pertusariales: Megasporaceae, including the genera Aspicilia, Aspiciliella, Circinaria, Lobothallia, Megaspora and Sagedia. Revisions of British and Irish Lichens 34 : 1–15.
Clauzade G Roux C (1984) Les genres Aspicilia Massal. et Bellemerea Hafellner et Roux. Bulletin de la Société Botanique de Centre-Ouest, Nouvelle Série 15 : 127–141.
Clauzade G Vězda A (1970) Lecanoracernohorskyana Clauzade et Vězda sp. n. Preslia 42 : 215–219.
Gardes M Bruns TD (1993) ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Molecular Ecology 2 (2 ): 113–118. 10.1111/j.1365-294X.1993.tb00005.x 8180733
Hafellner J (1991) Die Gattung Aspicilia, ihre Ableitungen nebst Bemerkungen über cryptolecanorine Ascocarporganisation bei anderen Genera der Lecanorales (Ascomycetes lichenisati). Acta Botanica Malacitana 16 : 133–140. 10.24310/abm.v16i.9153
Kondratyuk SY Gromakova AB Khodosovtsev AY Kim JA Kondratiuk AS Hur J-S (2015) Agrestiazerovii (Megasporaceae, Lichen-forming ascomycetes), a new species from South Eastern Europe proved by alternative phylogenetic analysis. Studia Botanica Hungarica 46 (2 ): 69–94. 10.17110/StudBot.2015.46.2.69
Kondratyuk SY Upreti DK Mishra GK Nayaka S Ingle KK Orlov OO Kondratiuk AS Lőkös L Farkas E Woo JJ Hur JS (2020) New and noteworthy lichen-forming and lichenicolous fungi 10. Acta Botanica Hungarica 62 (1–2 ): 81–84. 10.1556/034.62.2020.1-2.6
Kou XR Li SX Ren Q (2013) Three new species and one new record of Lobothallia from China. Mycotaxon 123 (1 ): 241–249. 10.5248/123.241
Kumar S Stecher G Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33 (7 ): 1870–1874. 10.1093/molbev/msw054 27004904
Lanfear R Frandsen PB Wright AM Senfeld T Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34 : 772–773. 10.1093/molbev/msw260 28013191
Larena I Salazar O González V Julián MC Rubio V (1999) Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for Ascomycetes. Journal of Biotechnology 75 (2–3 ): 187–194. 10.1016/S0168-1656(99)00154-6 10553657
Li L Zhang Y Printzen C (2023) Phylogeny, morphology and chemistry reveal two new multispored species in the Lecanorasubfusca group (Lecanoraceae, Ascomycota). MycoKeys 99 : 27–28. 10.3897/mycokeys.99.108462
Magnusson AH (1940) Lichens from central Asia I. In reports from the scientific expedition to the NorthWestern Provinces of China under the leadership of Dr. Sven Hedin (the Sino-Swedish expedition). Publication 13, XI. Botany: 98–99. [Stockholm: Aktiebolaget Thule.]
Magnusson AH (1944) Lichens from central Asia II. In reports from the scientific expedition to the NorthWestern Provinces of China under the leadership of Dr. Sven Hedin (the Sino-Swedish expedition). Publication 22, XI. Botany: 40–41. [Stockholm: Aktiebolaget Thule.]
Martellos S Conti M Nimis PL (2023) Aggregation of Italian lichen data in ITALIC 7.0. Journal of Fungi (Basel, Switzerland) 9 (5 ): 556. 10.3390/jof9050556 37233266
Marthinsen G Rui S Timdal E (2019) OLICH: A reference library of DNA barcodes for Nordic lichens. Biodiversity Data Journal 7: e36252. 10.3897/BDJ.7.e36252
Müller J (1880) Enumeration lichenum Aegyptiacum. Revue mycologique, Toulouse 2 (2 ): 75.
Nascimbene J Nimis PL Klüßendorf J Thüs H (2023) Freshwater lichens, including new species in the genera Verrucaria, Placopyrenium and Circinaria, associated with Lobothalliahydrocharis (Poelt & Nimis) Sohrabi & Nimis from Watercourses of Sardinia. Journal of Fungi (Basel, Switzerland) 9 (3 ): 380. 10.3390/jof9030380 36983548
Nimis PL (2016) The lichens of Italy, A second annotated catalogue. EUT-Edizioni Università di Trieste, Trieste, 288–290.
Nimis PL Poelt J (1987) The lichens and lichenicolous fungi of Sardinia (Italy). Studia Geobotanica 7 : 44–45.
Nordin A Savić S Tibell L (2010) Phylogeny and taxonomy of Aspicilia and Megasporaceae. Mycologia 102 (6 ): 1339–1349. 10.3852/09-266 20943564
Nordin A Owe-Larsson B Tibell L (2011) Two new Aspicilia species from Fennoscandia and Russia. Lichenologist (London, England) 43 (1 ): 27–37. 10.1017/S0024282910000629
Orange A James PW White FJ (2001) Microchemical methods for the identification of lichens. British Lichen Society, London.
Owe-Larsson B Nordin A Tibell L Sohrabi M (2011) Circinariaarida sp. nova and the ‘Aspiciliadesertorum’ complex. Bibliotheca Lichenologica 106 : 235–246.
Paukov AG Davydov EA Nordin A Roux C Şenkardeşler A Sohrabi M Vondrák J Frolov IV Teptina AY Shiryaeva AS (2019) Three new species, new combinations and a key to known species of Lobothallia (Megasporaceae). Lichenologist (London, England) 51 (4 ): 301–322. 10.1017/S0024282919000264
Rambaut A Drummond AJ Xie D Baele G Suchard MA (2018) Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67 (5 ): 901–904. 10.1093/sysbio/syy032 29718447
Reyim M Suo FY Abbas A (2012) Lobothalliaradiosa: A new record of lichen genus Lobothallia from China. Zhiwu Kexue Xuebao 30 (3 ): 305–308. 10.3724/SP.J.1142.2012.30305
Ronquist F Teslenko M van der Mark P Ayres DL Darling A Höhna S Larget B Liu L Suchard MA Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Systematic Biology 61 (3 ): 539–542. 10.1093/sysbio/sys029 22357727
Roux C (1977) Aspiciliachadefaudiana Cl. Roux, sp. nov. et remarques sur le genre Aspicilia. Revue Bryologique et Lichénologique 43(2): 159–172(57–70).
Roux C Nordin A Tibell L Sohrabi M (2011) Some poorly known or new Aspicilia species from Pyrenees-Orientales (France). Bulletin de la Société Linnéenne de Provence 14 : 177–227.
Roux C Nordin A Bertrand M (2016) Lobothalliacontroversa Cl. Roux & A. Nordin sp. nov., correspondant au Lecanorafarinosa sensu Nyl. non (Flörke) Nyl. Herzogia 29 (2 ): 586–595. 10.13158/heia.29.2.2016.586
Ryan BD (2004) Lobothallia. In: Nash III TH Ryan BD Diederich P Gries C Bungartz F (Eds ) Lichen Flora of the Greater Sonoran Desert Region, Vol. II. Lichens Unlimited, Arizona State University, Tempe, Arizona, 352–357.
Silvestro D Michalak I (2012) raxmlGUI: A graphical front-end for RAxML. Organisms, Diversity & Evolution 12 (4 ): 335–337. 10.1007/s13127-011-0056-0
Sipman HJ Aptroot A (2020) Ikaeriaserusiauxii, a new Caloplaca-like lichen from Macaronesia and mainland Portugal, with a lichen checklist for Porto Santo. Plant and Fungal Systematics 65 (1 ): 126. 10.35535/pfsyst-2020-0006
Vaidya G Lohman DJ Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27 (2 ): 171–180. 10.1111/j.1096-0031.2010.00329.x 34875773
Valadbeigi T Nordin A Tibell L (2011) Megasporarimisorediata (Pertusariales, Megasporaceae), a new sorediate species from Iran and its affinities with Aspicilia sensu lato. Lichenologist (London, England) 43 (4 ): 285–291. 10.1017/S0024282911000211
Wei JC (2020) The Enumeration of Lichenized Fungi in China. China Forestry Publishing House, Beijing, 134–135.
Zhang YY Wang XY Li LJ Printzen C Timdal E Niu DL Yin AC Wang SQ Wang LS (2020) Squamarina (lichenised fungi) species described from China belong to at least three unrelated genera. MycoKeys 66 : 135–157. 10.3897/mycokeys.66.39057 32377155
Zoller S Scheidegger C Sperisen C (1999) PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist (London, England) 31 (5 ): 511–516. 10.1006/lich.1999.0220
Zulfiqar R Razzaq F Afshan NUS Fayyaz I Habib K Khalid AN Paukov AG (2022) Three new species of Lobothallia (Megasporaceae, Pertusariales, Ascomycota) from Pakistan and a new combination in the genus. Mycological Progress 21 (9 ): 80. 10.1007/s11557-022-01830-z
