
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13814-5
10.1016/j.heliyon.2024.e37783
e37783
Research Article
Lemongrass extract enhances productive performance, blood biomarkers, immunity, and gut health of broilers
El-Sahn Amany A. a
Manaa Eman A. b
EL-Barbary Amal M. a
Khalifah Ayman M. c
Fayez Sahar d
Abdel-Daim Asmaa S.A. e
Albadrani Ghadeer M. f
Abdel-Daim Mohamed M. abdeldaim.m@vet.suez.edu.eg
gh⁎⁎
Abdel-Latif Mervat A. mervat.abdellatif@vetmed.dmu.edu.eg
i⁎
a Poultry Breeding Research Department, Animal Production Research Institute, Agriculture Research Center, Giza, Egypt
b Animal and Poultry Production, Department of Animal Wealth Development, Faculty of Veterinary Medicine, Benha University, Toukh, 13736, Egypt
c Livestock Research Department, Arid lands Cultivation Research Institute, City of Scientific Research and Technological Applications (SRTA – City), New Borg EL Arab, Egypt
d Department of Histology and Cytology, Faculty of Veterinary Medicine, Damanhour University, Damanhour, 22511, Egypt
e Department of Nutrition and Clinical Nutrition, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, 62511, Egypt
f Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia
g Department of Pharmaceutical Sciences, Pharmacy Program, Batterjee Medical College, Jeddah, Saudi Arabia
h Pharmacology Department, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt
i Department of Nutrition and Veterinary Clinical Nutrition, Faculty of Veterinary Medicine, Damanhour University, Damanhour, 22511, Egypt
⁎ Corresponding author. Department of Nutrition and Veterinary Clinical Nutrition, Faculty of Veterinary Medicine, Damanhour University, Damanhour, 22511, Egypt. mervat.abdellatif@vetmed.dmu.edu.eg
⁎⁎ Corresponding author. Department of Pharmaceutical Sciences, Pharmacy Program, Batterjee Medical College, Jeddah, Saudi Arabia. abdeldaim.m@vet.suez.edu.eg
11 9 2024
30 9 2024
11 9 2024
10 18 e3778313 2 2024
9 9 2024
10 9 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Background

Lemongrass (LG) had various phytochemical components such as saponins, phenols, resins, alkaloids, tannins, flavonoids, glycosides and terpenes, minerals as well as vitamin C which had various pharmacological actions (antioxidant, anti-inflammatory, antibacterial, antibiotic, and antifungal) and growth promoter. The use of LG in broiler nutrition can be optimized the bird performance and gut health. Based on the high nutrition value of LG and absence of sufficient studies on the effect of lemongrass aqueous extract (LGX) on broiler performance and gut health (antioxidant and immune biomarkers and intestinal morphology), the aim of the present study is to investigate the impact of using LGX on productive performance, blood biomarkers, immunity and gut health of broilers.

Methods

A total of two hundreds one-day- old male broiler chicks (Cobb 500) were fed on the starter basal diet for 6 days. From day 7 of age onwards, the birds were distributed, at random, into 4 groups. Each group included 5 replicates with 10 chicks per replicate. The birds in group 1 were not administered lemongrass extract (control, LGX0) while chicks in group 2 (LGX100), 3 (LGX200) and 4 (LGX300) were administered the aqueous extract of lemongrass in drinking water at levels of 100, 200 and 300 ml/l, respectively. The experimental period lasted for 35 day. Growth performance parameters, economic efficiency, hematological and biochemical biomarkers, expression of some antioxidant and immune related genes, cecal bacterial counts and intestinal morphological changes all were assessed.

Results

The results indicated that, administration of LGX in drinking water at levels of 200, 100 ml/l, respectively significantly improved (p ≤ 0.001) body weight (BW), body weight gain (BWG) and feed conversion ratio (FCR) than the control but without any effect on economic efficiency index (EEI) and feed intake (FI). On the other hand, the addition of LGX in drinking water at levels of 300 ml/l significantly decreased (p ≤ 0.001) FI, EEI and all growth performance parameters as compared to those other groups. LGX supplemented birds groups exhibited higher Hb, PCV, MCH, platelets, and lymphocytes than the control group. However, the ratio of H/L in LGX100 and LGX200 groups was lower (p ≤ 0.001) than other groups. LGX supplemented groups showed low (p ≤ 0.001) cholesterol, creatinine, MDA and high (p ≤ 0.01) TAC. Up regulation (p ≤ 0.001) of the expressions of catalase, GPX1, and SOD1 were in LGX200 group compared to other groups. While, the proinflammatory genes expression (IL1B, IL6, IFNᵧ, and TNF) were down regulated (p ≤ 0.001) in the LGX200 compared to others. Moreover, LGX200 and LGX300 reduced (p ≤ 0.001) the intestinal pathogens counts (E.coli and Salmonella). Administration of LGX at levels of 200 and 100 ml/l, respectively enhanced (p ≤ 0.001) villi height and crypts depth.

Conclusions

It was concluded that lemongrass aqueous extract can be included at level 100 and 200 ml/l in broilersˈ drinking water since it resulted in improved weight, feed conversion ratio, blood parameters, immunity and gut health without any deleterious effect on the health and performance of the birds. LGX at a 200 ml/l supplementation level achieved the best results followed by a 100 ml/l level. Also, the tested supplements can be used as natural growth promoter instead of antibiotic and help in solving the global problem of antimicrobial resistant bacterial strains responsible for human and animal diseases.

Keywords

Broiler
Gene expression
Growth
Histology
Lemongrass
==== Body
pmc1 Introduction

The growth of antimicrobial resistant bacterial strains responsible for human and animal diseases has led to global awareness of the need to use nature-derived antimicrobials for therapeutic and prophylactic purposes, as well as to enhance livestock performance [1]. The phytobiotics supplementation is an essential key to achieve this task [[2], [3], [4]]. Organic acids (formic, citric, acetic, butyric, etc.) are distinguished among others with its potency by adjusting the intestinal pH, improving digestion and nutrient absorption [5,6], and enhancing immune responses of broilers [7]. Many researches have focused on the application of citric acid that derived from different sources of fruits and herbs as poultry feed supplements. One of these herbs is Lemongrass (Cymbopogon citrates) which is an aromatic perennial grass (culinary herb). Many cultures have utilized it as a folk medicine, and it is grown in tropical and semi-tropical [8]. The most important constituent of LG is volatile oil which composed mainly of Citral (lemonal). Citral has various pharmacological actions (antioxidant, anti-inflammatory, antibacterial, antibiotic, and antifungal) and growth promoter [9,10]. In addition, lemongrass has other phytochemical components such as saponins, phenols, resins, alkaloids, tannins, flavonoids, glycosides and terpenes which protect the cells of the organism from oxidative stress by neutralizing and curbing harmful free radicals. These compounds are also distinguished by a biological efficacy that allows them to improve growth and health of bird's digestive system [11]. Lemongrass is rich in macro and trace elements [12], as well as vitamin C [13]. Citral, myrcene, and geraniol of LG can enhance the functioning of the immune system as it possesses antioxidant properties and thus improve the physiological characteristics and biochemical blood tests of broiler chickens [14]. The use of LG in broiler feeding led to a significant increase in total protein in broiler chicken serum, as well as a decrease in the activities of liver enzymes (AST) This may be due to bioactive compounds of LG that repair liver tissue or restore cellular permeability that can be caused by cytotoxic compounds [15]. It also indicated that LG can be significantly reduce the cholesterol level in the blood of birds due to its content of effective compounds that inhibit the activity of reductase (hydroxy-3- methylglutaryl-coenzyme A 3), which acts as an essential regulatory enzyme in the process of cholesterol synthesis [16]. Moreover, LG has been found to have an antibacterial effect against strains of E. coli, S. aureus, and S. enterica [11,17].

The high cost of poultry feeds motivates the researchers to use unconventional natural growth promoters such as LG herbal plant which is safe, cheap and maintain the optimum growth of birds by enhancement of feed utilization and gut health condition [18]. Lemon grass can be used as a promising alternative to antibiotics [6,19]. Several researchers have studied the substantial improvement in broiler performance and carcass characteristics of dietary herbal inclusion such essential citrus oils [20]. Moreover, citrus oils may increase thyroid hormone [21]. Also, lemongrass has antihypertensive effect in animals due to stimulation of parasympathetic activity [22]. However, their effects on the gut health regarding antioxidants and immune biomarkers, intestinal bacterial count and intestinal morphology weren't sufficiently studied. Therefore, this experiment was carried out to evaluate the impact of aqueous lemongrass extract inclusion in broiler drinking water and its effect on growth performance, economic efficiency, blood biomarkers (haematological and biochemical), antioxidants (serum TAC and MDA and expression of catalase, GPX1, and SOD1), immunity (expression of IL1B, IL6, IFNᵧ, and TNF) and gut health (intestinal bacterial count and intestinal morphology).

2 Materials and methods

2.1 Dietary treatments and management

A total of two hundreds 1-day old male broiler chicks (Cobb 500) were purchased from a commercial hatchery. The birds fed on the starter basal diet for 6 days. From day 7 of age onwards, the birds were distributed, at random, into 4 groups. Each group included 5 replicates with 10 chicks per replicate. The birds in group 1 were not administered lemongrass extract (control, LGX0) while chicks in group 2 (LGX100), 3 (LGX200) and 4 (LGX300) were administered the aqueous extract of lemongrass in drinking water at levels of 100, 200 and 300 ml/l, respectively. The experimental period lasted for 35 day. The chicks were housed in a floor pen, and wheat straw was used as a litter. An artificial lightning period of 23 h per day was provided throughout the experiment. The initial brooding temperature was 33 °C in the first week of age and reduced gradually 2 °C per week until reaching approximately 20 °C at the end of the experiment. Birds had a free access to water and feed along the experimental period. The diets were formulated to surpass the nutrient requirements of broilers according to the nutritional specifications guide of the breed (Table 1). The feeding period was divided into three phases, in which starter (0–14 day), grower (15–28 day) and finisher (28–35 day) diets were fed. All chicks were kept under similar managerial conditions. The vaccination program for all groups was also as follows: bivalent live infectious bronchitis and Newcastle vaccine, MA5+Clone 30 (Nobilis® Ma5-Clone30, MSD, Intetrvet Int., The Netherlands) at 5 days of age via eye drop (ED), bivalent inactivated avian influenza subtype H5 plus Newcastle vaccine (MEFLUVAC® H5+ND7, MEVAC, Egypt) at 10 days of age through subcutaneous route with a dose of 0.5 mL/bird, Gumboro intermediate plus, Bursine plus® (Zoetis, USA) at 12 days of age via ED and live Newcastle, laSota® (MSD, Intertvet Int., The Netherlands), at 18 days of age via ED.Table 1 Nutritional composition (%) of the experimental broilersˈ diets (as fed).

Table 1
Composition	Diet	
Starter (0–14 d)	Grower (15–28 d)	Finisher (29–35 d)	
Yellow corn	54.93	60.88	70.17	
Soybean meal, (48 % CP)	38.40	33.30	25.46	
Soy oil	2.60	2.90	1.50	
Limestone	2.20	1.75	1.75	
Di- calcium phosphate	0.85	0.20	0.20	
Common salt	0.45	0.45	0.45	
Vitamin premixa	0.10	0.10	0.10	
Mineral premixb	0.20	0.20	0.20	
DL-methionine, (98 %)	0.20	0.15	0.10	
Mixed enzymesc	0.030	0.030	0.030	
Phytased	0.005	0.005	0.005	
Coccidiostate	0.020	0.020	0.020	
Anti-mycotoxinf	0.016	0.016	0.016	
Total	100	100	100	
Calculated analysis	
ME, (kcal/kg)	3000	3100	3100	
Crude protein	23	21	18	
Fat	2.60	2.75	3.02	
Fiber	2.49	2.45	2.41	
Calcium	1.10	0.77	0.75	
Available phosphorus	0.50	0.38	0.43	
Total lysine	1.30	1.05	1.08	
Methionine	0.57	0.45	0.47	
Cysteine	0.33	0.28	0.28	
Met + Cys	0.90	0.73	0.75	
Arginine	1.33	1.07	1.00	
a Vitamin premix provides per diet: Vit. A; 12000000 IU, Vit. E: 400000 mg, Vit. Bl: 2000 mg. Vit. B2: 160000 mg, Vit.B6: 5000 mg, Vit, B12: 12 mg, Niacin: 45000 mg, Pantothenic acid: 12000 mg, Vit. K: 3000 mg, Vit. D3; 3000000 IU, Biotin: 70 mg and Folic acid: 2000 mg.

b Trace mineral premix provides per diet: Choline: 3600000 mg, Copper: 10000 mg, Iodine: 1000 mg, Iron: 30000 mg, Manganese: 100000 mg, Zinc: 600000 mg, and selenium: 400 mg, cobalt: 100 mg.

c Combo® Enzyme Blend consists of: Cellulase 75,000 CU units/kg, Fungal amylase 30,000 SKB units/kg, Fungal protease 1,000,000 HUT units/kg, Neutral protease 100,000 PC units/kg, Alkaline protease 1.2 Anson units/kg, Xylanase 20,000 XU units/kg, Beta-glucanase 20,000 BG units/kg, Hemicellulase 20,000 HCU units/kg and Lipase 75,000 FIP units/kg.

d Axtra® PHY 10000 TPT, 6-phytase 10000 FTU/g.

e Diclazuril 500 mg, Atozuril® (ATco pharma).

f Mycofix® Select 3, feed additives that protect broiler health by deactivation of mycotoxin.

2.2 Growth performance and economic efficiency

Weight change and diet consumption were recorded weekly for 4 weeks. BWG and FCR, and EEI were calculated [23].

2.3 Hematological and biochemical biomarkers

At the end of the experiment ten blood samples were collected from each group in tubes without anticoagulant. The samples were allowed to clot for 1 h, at the room temperature and then centrifuged at 3000 r.p.m. for 20 min for serum separation. Collected sera were stored in a deep freezer at −20 °C until the chemical analyses. At the time of analysis, the samples were thawed and total protein, albumin, aspartate transferase (AST), alanine transferase (ALT), cholesterol, creatinine, urea, total antioxidant capacity (TAC), and MDA were detected using a spectrophotometer (SELECTA®UV-2005) and commercial kits (Bio-diagnostic, Egypt) following the manufacturer's instructions. Triiodothyronine (T3), thyroxine (T4) and corticosterone hormones (ng/ml) were tested using the radioimmunoassay technique by chemical kits. Moreover, Aliquot of blood was obtained to count the white blood cells (WBCs), red blood cells (RBCs), measure hemoglobin (Hb), packed cell volume (PCV), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), lymphocytes (L), heterophils (H), ratio of H/L, mean corpuscular hemoglobin concentration (MCHC) and platelets.

2.4 Gene expression

At the end of the experimental period, 20 birds (five per group) were sacrificed. The jejunum was rapidly separated, then opened, and the digesta was washed with physiological saline and then stored at −80 °C for further detection of mRNA gene expression. RNA extraction was done by TRIzol reagent (Invitrogen/Life Technologies, Carlsbad, CA, USA) and NanoDrop for quantification. The cDNA was synthesized from RNA (cDNA Reverse Transcription kits; Applied Bio systems), and then samples of cDNA were stored at −20 °C. Real-time polymerase chain reaction was applied to quantify expression of antioxidant biomarkers (Catalase, GPX1 and SOD1), and immune biomarkers (IL1, IL6, INF-ᵧ and TNF). One pair of primers for each gene was used based on the gene sequences found at GenBank (http://www.ncbi.nlm.nih.gov), and tow reference housekeeping gene, β actin and GAPDH, as found in (Table 2).Table 2 Primers sequences used in relative gene expression quantification.

Table 2Target Genes	Primer sequence (5′–3′)	Amplicon (bp)	Accession number	References	
Reference genes	
β-actin	Forward
Reverse	AGCGAACGCCCCCAAAGTTCT
AGCTGGGCTGTTGCCTTCACA	139	NM_205518.1	[24]	
GAPDH	Forward
Reverse	GCTGGCATTGCACTGAATGAC
CACTCCTTGGATGCCATGT	113	NM_204305.1	[25]	
Antioxidant related genes	
Catalase	Forward
Reverse	ACTGGTGCTGGCAACCC
ACGTGGCCCAACTGTCAT	57	NM_001031215.2	[26]	
GPX-1	Forward
Reverse	GCGACTTCCTGCAGCTCAACGA
CGTTCTCCTGGTGCCCGAAT	99	NM_001277853.3	[27]	
SOD-1	Forward
Reverse	CGGGCCAGTAAAGGTTACTGGAA TGTTGTCTCCAAATTCATGCACATG	83	NM_205064.2	[26]	
Immunity related genes	
IL-1ᵦ	Forward
Reverse	TGCTTCGTGCTGGAGTCACCC
GGCCGGTACAGCGCAATGTT	98	XM_015297469.1	[25]	
IL6	Forward
Reverse	AGCGAAAAGCAGAACGTCGAGTC
GCCGAGTCTGGGATGACCACTTC	107	XM_015281283.2	[25]	
IFN-ᵧ	Forward
Reverse	AACAACCTTCCTGATGGCGTGA
GCTTTGCGCTGGATTCTCAAGT	89	NM_205149.1	[25]	
TNF	Forward
Reverse	CCCCTACCCTGTCCCACAA
TGAGTACTGCGGAGGGTTCAT	67	NM204267	[28]	

Each reaction composed of 1.5 μl of 1 μg/μl cDNA, ten μl SYBR Green PCR Master Mix (Quanti Tect SYBR Green PCR Kit, Qiagen), one μM of each forward and reverse primer for each gene and nuclease-free water to a final volume of 20 μl. The reactions were then quantified on an Applied Biosystem Real-time PCR 7500 Fast detection system under the following conditions: 95 °C for 10 min (first denaturation and 40 cycles of 95 °C for 15 s (second denaturation stage) followed by 60 °C for 1 min (annealing and extension stage). Comparing the Ct method (2−ΔΔCt) of target genes to the house keeping genes was used to calculate the changes in gene expression comparative [29].

2.5 Cecal bacterial counts

At the end of the experimental period, ten birds per group were randomly selected and euthanized, and the ceca were sealed [30], and stored at −80 °C until counting the total number of both aerobic and anaerobic bacteria using the protocols which stated by Abdel-Latif et al. [31].

2.6 Histology

Morphological examination was done for intestine (about 3 cm jejunal samples; 1 cm before the midpoint). Five birds/group tissue samples were taken and were fixed in neutral buffered formalin (10 %) for 2–5 days. Samples were dehydrated in ascending grades of ethanol starting from 70 % to absolute one. Then using xylene (three changes) for clearance of the samples and the samples after that was put in melted paraffin in oven at 56 °C for (three changes). Finally cut using rotatory microtome the blocks of the processed samples. Thin paraffin sections (5-7 μm-thick) were cut from the samples’ blocks and mounted on coated glass slides and dried in an incubator for 30–60 min at 45 °C then stained with hematoxylin and eosin (H and E) for general inspection of the organ based on Bancroft and Layton [32]. Jejunum length, depth and crypt were measured by Image J software (NIH). The VH (villi height) and CD (crypt depth), measured by Image J software (NIH) and then divided the VH/CD to obtained ratio.

2.7 Experimental statistics

SPSS 20 was applied using Variance Analysis (ANOVA). Significant differences with Tukey's post hoc test were calculated at p < 0.05. RT-PCR data were analyzed using Graphpad prism 5.

3 Results

3.1 Performance and economic efficiency

The results of the growth performance and economic efficiency index of broiler chickens administered varying levels of aqueous lemon grass extract at drinking water is shown in Table 3 at 35 days of age. Lemongrass had a substantial impact on BW and BWG values (p ≤ 0.001). LGX200 had the highest BW by 9.51 %, followed by LGX100 which increased by 4.73 %. However, they were dropped in LGX300 by 9.27 %. In general, bird's treated with water enriched with 300 ml LGX/liter consumed less feed, besides recording a highest FCR and low EEI compared to other groups. In contrast, FI and EEI were similar in LGX200, LGX100 and control group.Table 3 Growth performance and economic efficiency index of broilers chicks administered varying levels of aqueous lemongrass extract.

Table 3Items	Lemongrass extract supplementation groups	SEM1	p-value	
LGX0	LGX100	LGX200	LGX300	
IBW, g	142	142	143	143	0.42	0.815	
FBW, g	1749b	1832ab	1916a	1587c	30.5	0.001	
BWG, g/day	57.4b	60.4ab	63.3a	51.6c	1.09	0.001	
FI, g/day	90.8a	89.1a	88.1a	83.9b	0.64	0.001	
FCR	1.58a	1.48b	1.39b	1.63a	0.03	0.001	
EEI (%)	98.7a	99.6a	100a	81b	0.69	0.01	
Means with different superscripts within the same row are significantly different (p ≤ 0.05). IBW, initial body weight; FBW, final body weight; BWG, body weight gain; FI, feed intake; FCR, feed conversion ratio; EEI, Economic efficiency index = lowest feed cost per kilogram of weight gain among treatment/cost of treatment.

3.2 Hematological and biochemical biomarkers

Impact of lemongrass extract on hematological and biochemical biomarkers is presented in Table 4, Table 5. Significant differences of RBCs, Hb and PCV were existed for broilers treated with 200 and 300 ml LGX/L compared with those for control and 100 ml LGX/L. Also, it appears from data of Table 4 that all bird groups represented an increase (p ≤ 0.001) of Hb, PCV, MCH, and lymphocytes due to experimental LGX supplementation compared to control. No significant differences were observed between WBCs. Whereas, 100 and 200 ml LGX/L had the lowest (p ≤ 0.001) ratio of H/L.Table 4 Blood biomarkers of broilers chicks administered varying levels of aqueous lemongrass extract.

Table 4Items	Lemongrass extract supplementation groups	S E M	p-value	
LGX0	LGX100	LGX200	LGX300	
RBC, 106/mm3	2.35b	2.43b	2.63a	2.62a	0.03	0.001	
Hb, g/dl	8.77c	9.67b	0.90a	10.93a	0.08	0.001	
PCV, %	26.1c	29.5b	31.4a	31.9a	0.16	0.001	
MCV	111b	121a	119a	122a	1.71	0.017	
MCH, pg	37.4c	39.8b	41.5ab	41.7a	0.43	0.001	
MCHC, g/dl	33.6ab	32.8b	34.7a	34.2a	0.37	0.042	
WBC, 103/mm3	13.1	13.4	14.2	13.8	0.35	0.304	
Lymphocyte, %	60.4c	65.5a	65.9a	63.4b	0.50	0.001	
Heterophils, %	31.7	29.2	28.8	30.9	0.80	0.074	
H/L ratio	0.52a	0.44c	0.43c	0.48b	0.01	0.001	
Platelets, 103/ml	117c	131bc	144b	180a	6.20	0.001	
Means with different superscripts within the same row are significantly different (p ≤ 0.05). Hb: hemoglobin concentration, RBC: red blood cell count, PCV: packed cell volume, MCV: mean corpuscular volume, MCH: mean corpuscle hemoglobin, MCHC: mean corpuscle hemoglobin concentration, WBC: white blood cell count, L lymphocytes cell, H: heterophile cells. Means with different superscripts within the same row are significantly different (p ≤ 0.05).

Table 5 Biochemical biomarkers of broilers chicks administered varying levels of aqueous lemongrass extract.

Table 5
Items	Lemongrass extract supplementation groups	S E M	p-value	
LGX0	LGX100	LGX200	LGX300	
Total protein, g/dl	5.17b	5.33a	5.40a	5.10b	0.04	0.001	
Albumin, g/dl	2.43b	2.63b	3.23a	2.46b	0.102	0.01	
Globulin, g/dl	2.73	2.69	2.16	2.63	0.154	0.15	
AST, u/l	164a	156ab	144c	151bc	3.21	0.01	
ALT, u/l	7.15	6.85	6.90	5.85	0.45	0.29	
Cholesterol, mg/dl	145a	130b	129b	128b	3.51	0.001	
Creatinine, mg/dl	0.29a	0.23b	0.22b	0.21b	0.009	0.001	
Urea, mg/dl	10.90	10.63	11.06	11.10	0.192	0.46	
TAC, mM/L	2.05b	2.49a	2.62a	2.56a	0.109	0.01	
MDA, nm/L	17.9a	11.9b	13.2b	12.9b	0.856	0.01	
Cortecosterone, nm/L	9.63b	10.50b	7.43c	12.72a	0.523	0.001	
T3, ng/Ml	2.08b	2.74a	2.82a	2.10b	0.044	0.001	
T4, ng/mL	4.61	4.49	4.47	4.45	0.088	0.63	
T3/T4 ratio	0.450b	0.611a	0.631a	0.470b	0.084	0.001	
AST: aspartate aminotransferase, ALT: alanine aminotransferase, ALP: alkaline phosphatase, TAC: total antioxidants capacity, MDA: malondialdehyde, T3: thyroid hormone, T4: thyroxine hormone. Means with different superscripts within the same row are significantly different (p ≤ 0.05).

Birds of LGX100 and LGX200 had increased (p ≤ 0.01) total protein and albumin compared to control and LGX300, however, the globulin was similar among the experimental groups. LGX groups decreased (p ≤ 0.001) serum cholesterol level by 10.12 %, 11.03 % and 11.45 % with different doses, respectively, compared with control. Serum AST level was decreased (p ≤ 0.01) for broilers treated with LGX200 and LGX300 compared with control group. LGX groups had low creatinine (p ≤ 0.001) compared control without any statistical differences for urea concentration. Total antioxidant capacity (TAC) was high (p ≤ 0.01) in all supplemented groups. The reverse was found for serum malondialdehyde (MDA). Broilers of LGX200 had a lowest (p ≤ 0.001) level of corticosterone hormone. T3 hormone was higher (p ≤ 0.001) in LGX100 and LGX200 than the others.

3.3 Gene expression

Antioxidant genes expression in jejunum is shown in Fig. 1 (A–C). Up regulation (p < 0.001) of the expressions of superoxide dismutase 1 (SOD1), glutathione peroxidase 1 (GPX1), and catalase were in LGX200 group compared to other groups. While, the proinflammatory genes expression (tumor necrosis factor (TNF), interferon gamma (IFNᵧ) interleukin 6 (IL6), and interleukin 1 beta (IL1B)) showed down regulation (p < 0.001) in the LGX200 compared to others as shown in Fig. 2 (A–D).Fig. 1 RT-PCR validation of the antioxidant genes SOD1; superoxide dismutase (A), GPX1; glutathione peroxidase (B), and Catalase (C) of birds with aqueous lemongrass extract. Columns (control (LGX0), 100 ml lemongrass/1 L drinking water (LGX100), 200 ml lemongrass/1 L drinking water (LGX200) and 300 ml lemongrass/1 L drinking water (LGX300) carrying different letters (a, b, c and d) using Tukey's post hoc test are significantly different at p < 0.05.

Fig. 1

Fig. 2 RT-PCR validation of the immune related genes; tumor necrotic factor (TNF) (A), interferon gamma (IFN-ᵧ) (B), interleukin 6 (IL-6) (C), and interleukin 1 beta (IL-1ᵦ) (D) of birds with aqueous lemongrass extract. Columns (control (LGX0), 100 ml lemongrass/1 L drinking water (LGX100), 200 ml lemongrass/1 L drinking water (LGX200) and 300 ml lemongrass/1 L drinking water (LGX300) carrying different letters (a, b, c and d) using Tukey's post hoc test are significantly different at p < 0.05.

Fig. 2

3.4 Cecal bacterial count

All birds groups represented a decrease (p < 0.001) of caecum E.coli counts due to the experimental LGX supplementation compared to control group (Table 6). Inverse was true for Lactobacillus counts. The statistical analysis showed that LGX100 and LGX200 groups had the lower (p < 0.001) Salmonella counts than others. LGX200 was the best to decline intestinal pathogens.Table 6 Cecal bacteriology of broilers chicks administered varying levels of aqueous lemongrass extract.

Table 6
Items	Lemongrass extract supplementation		
LGX0	LGX100	LGX200	LGX300	S E M1	p-value	
Escherichia coli	5.77a	5.48b	5.43b	5.17c	0.05	0.001	
Salmonella spp.	2.24a	2.25a	2.10b	1.97c	0.03	0.001	
Lactobacillus spp.	6.48c	6.58bc	6.69b	7.08a	0.06	0.001	
Means with different superscripts within the same row are significantly different (p ≤ 0.05).

3.5 Histology

Jejunal histomorphology of birds with aqueous lemongrass extract is shown in (Table 7 and Fig. 3). Villus height and crypt depth were enhanced (p ≤ 0.001) in LGX200 and LGX100 compared to other groups. The normal finger-like projections of jejunal villi which extend into the intestinal lumen with few goblet cells located in between. Below the epithelium, lamina propria is a loose and had irregular cells of connective tissue. Most of the cells within the propria meshes of the collagen fibrils are plasma cells, although many other cell types can be found. The intestinal crypts located between the villi and extended deep in tunica mucosa. The tunica muscularis layers formed from smooth muscle and contain two layers the inner circular and outer longitudinal layer (Fig. 3A and B).Table 7 Intestinal histology of broilers chicks administered varying levels of aqueous lemongrass extract.

Table 7Items	Lemongrass extract supplementation	p-value	
LGX0	LGX100	LGX200	LGX300	
Villus height (VH), μm	847.14 ± 40.39d	1467.05 ± 44.72b	1730.38 ± 15.56a	1035.45 ± 17.83c	0.001	
Crypt depth (CD), μm	369.92 ± 24.78b	623.67 ± 21.49a	681.25 ± 21.11a	404.15 ± 21.25b	0.001	
VH/CD	2.33 ± 0.20	2.35 ± 0.11	2.54 ± 0.34	2.59 ± 0.13	0.12	
Means with different superscripts within the same row are significantly (p ≤ 0.05) different. VH, CD and VH/CD analysis were done for 5 replicates (n = 10).

Fig. 3 Photomicrograph of broiler jejunum treated by different doses of lemongrass and stained by hematoxylin and eosin. A, control group showing normal intestinal villi with lining epithelium (arrowhead) and intestinal crypt (arrow), scale bar = 200 μm. B, showing control group with normal lining epithelium (arrowhead), lamina propria (thin arrow) and intestinal crypts (thick arrow), scale bar = 100 μm. C, group treated by 100 ml/L (LGX100), lemongrass showing improved, protrude lining epithelium (arrowhead), lamina propria with lymphocytes infiltration (thin arrow) and intestinal crypts (thick arrow), scale bar = 100 μm. D, group treated by 100 ml/L (LGX100), lemongrass showing increase the villi length with proliferation of lining epithelium (arrowheads) and lamina propria with lymphocytes infiltration (thin arrow), scale bar = 50 μm. E, group treated by 200 ml/L (LGX200), lemongrass showing increase the length of villi with lining epithelium (arrowhead), lamina propria (thin arrow) and intestinal crypts (thick arrow), scale bar = 200 μm. F, higher magnification of villi of group treated by 200 ml/L (LGX200), lemongrass showing increased, higher proliferation of lining epithelium (arrowhead) and lamina propria with more lymphocytes infiltration (thin arrow), scale bar = 50 μm. G, group treated by 300 ml/L (LGX300), lemongrass showing improved villi length (arrowhead), lamina propria (thin arrow) and intestinal crypts (thick arrow), scale bar = 100 μm. H, higher magnification of villi epithelium of group treated by 300 ml/L (LGX300), lemongrass showing increased, limited bending of villi epithelium (arrowhead) and lamina propria width with higher lymphocytes infiltration (thin arrow), scale bar = 50 μm.

Fig. 3

Lemongrass was shown to increase the length of villi gradually by using different level of dose. In group supplied by 100 ml/L (LGX100), of lemongrass on drinking water showing improved, little protrude of lining epithelium, increased villi length, lamina propria with lymphocytes infiltration and intestinal crypts development (Fig. 3C and D). With increasing the dose of lemongrass 200 ml/L (LGX200), supplied group showing more, higher villi length, proliferation of lining epithelium for increasing absorption content and the width of villi was increase by more proliferation of connective cells and blood cells, crypts are improved with proliferated lining epithelium (Fig. 3E and F). When the dose of lemongrass increased 300 ml/L (LGX300) of treated group, showing moderate increase of villi length and the bending of lining epithelium decrease with little improvement in lamina propria with proliferation of cells and blood, intestinal crypts showing similar to previous group (Fig. 3G and H).

4 Discussion

Lemongrass had various phytochemical components such as saponins, phenols, resins, alkaloids, tannins, flavonoids, glycosides and terpenes, minerals as well as vitamin C which had various pharmacological actions. The poly phenolic, alkaloids, terpenoids, carotenoids, and some vitamins compounds which have antioxidant activity, as they work to protect the cells of the bird from oxidative stress by neutralizing and curbing harmful free radicals. These compounds have also a biological efficacy that allows them to act as antibiotics against bacteria and fungi [33]. Furthermore, many studies have illustrated that other compounds found in lemongrass, such as flavonoids and tannins which improve the performance and the health of the bird's digestive system [11]. Addition of LGX at level 200 ml/l and 100 ml/l in broiler drinking water had a beneficial influence on growth indices due to presence of flavonoids and tannins in LGX which improve the bird's appetite and health of digestive system [11,34]. Moreover, LGX can stimulate the production of digestive juice for efficient nutrients utilization and an increase in the rate at which digesta passes through the intestines [35]. Also, LGX contains poly phenolic, alkaloids, terpenoids, carotenoids, and some vitamins compounds which have a beneficial effect on bird health and performance due to its antioxidant and antimicrobial activity [13]. On the other hand, the improvements in gut health can enhance the digestion and absorption of nutrients [36] and boost feed conversion ratio [9,13].

The improvement of hematological parameters of broilers treated with LGX100 and LGX200 compared with control could be related to the fact that lemongrass is rich in iron and copper which enter into the process of forming erythrocytes and thus reduced anemia in broilers [37]. The antioxidant activity of flavonoids in herbs improved the hematological biomarkers which protect against any stress (PCV and heterophile/lymphocyte ratio), and fight against infections (WBCs count) [38,39]. Similarly, lemongrass extracts are efficacious in enhancing serum protein and albumin levels without any effect on globulin and this probably due to high phenolics and flavonoids contents [21,40]. On the other hand, the reduction of serum protein concentration for LGX300 may due to the reverse effect of ascorbic acid overdose (physiological stress) which lower the biological value of protein [41].

Lemongrass phenolic components which have antioxidant [42], cytoprotective properties and antihypertensive components has significant hypocholesterolemic [43], low levels of AST and ALT which stimulate the integrity of the liver and muscles [9]. Also, improvement of renal function biomarkers (urea and creatinine) and inhibited lipid peroxidation (low MDA and high TAC) as stated by Ojo et al. [44] were reported. One of the surprising results is that LGX200 could reduce serum corticosterone hormone concentration and thereby could ameliorate the anti oxidative stress or protect against stressors in birds, further research is needed. As a result, it has antihypertensive effect in animals due to stimulation of parasympathetic activity (Silva and Barbara, 2022). High corticosterone concentration of LGX300 could be related to overdose of citric acid in lemongrass which may increase the acidity of water as stated by Oviedo [45]. Thyroid hormones are involved in the regulation of metabolic pathways of all nutrients [46]. Increased T3 hormone was reported and metabolic cycle [21].

The antioxidant activity of lemongrass enhanced antioxidant gene expression [47]. The findings were in line with Li et al. [48] who recorded that an enhance in the activity of antioxidant enzymes (SOD and GPX) due to the supplementation of herbs in chicken. Similar results recorded by Alagawany et al. [13] who recorded that, total antioxidant capacity, GSH, and catalase were significantly increased by lemongrass inclusion compared with the control. The supplementation lemongrass enhanced the immunity and resistance against diseases [49]. Under normal settings, pro-inflammatory cytokines (IL1B, IL6 and TNF) are not released but are secreted in response to immune system stimulation [50], so, downregulation of pro-inflammatory cytokines expression means that the birds are under normal condition.

Lemongrass enhanced the gut health by modifying the microbial counts and intestinal morphology, stimulating immunity and antioxidants, improving the production of the broilers [51] and quails [9,13]. The antioxidant activity was improved by LGX may be due to superoxide, and LGX scavenges hydroxyl radicals; metal ions chelation and the formation of inactive complexes; upregulation the expression of the antioxidant genes as the results shown (SOD1, GPX1 and catalase), and stimulation of endogenous antioxidant enzyme production in cells [52]. Lemongrass modulatory effect on indigenous intestinal flora is thought to be advantageous in developing the gut's immune system [53]. The antibacterial activity of natural extracts is intimately linked to the presence of phenolic and polyphenolic chemicals, which operate as potent active molecules with significant antioxidant and antimicrobial properties [17,54]. Animal health is directly related to the balance of intestinal microbiota; both good and detrimental microorganisms naturally inhabit the gastrointestinal tract of poultry [9]. Vitamin synthesis, gas emission, digestion, and nutrient absorption are all aided by beneficial microbes, restricting the growth of dangerous bacteria [55]. Lemongrass contains two main components citral and pinene which possesses a broad spectrum of antibacterial activities [56].

Histomorphological examination which was unprecedented before shows normal small intestine (jejunum) of broiler involved in the absorption of the bulk of nutrients. Lemongrass increased the length of villi gradually by increasing the dose; improved and little protrusion of lining epithelium and increased villi length (LGX100), while higher villi length and proliferation of lining epithelium for increasing absorption content (LGX200). However, moderate increase in villi length and the bending of lining epithelium decreased (LGX300). These findings are in accordance of Lan et al. [57] who noted that organic acids and essential oils as types of prebiotics may not only benefit for the intestinal microbiome but also progress the intestinal epithelial cells integrity, which further increases the nutrients absorption and promote the growth performance of animals. The improved gut morphology of LGX200 group confirmed the enhanced nutrient absorption, thus improving and preserving the microstructure of the intestine, thus improving growth performance. Positive changes in the gut structure of chickens funded with symbiotic and probiotics in terms of more villus width and higher villus surface area in the ileum and jejunum parts and deeper crypts [58], thus confirming the beneficial impacts on intestinal morphometric characteristics.

5 Conclusion

The results indicate that using of lemongrass aqueous extract at levels 100 and 200 ml/l in broilersˈ drinking water can enhance the growth performance, blood parameters and gut health status. LGX at a 200 ml/l supplementation level achieved the best results followed by a 100 ml/l level. So, it can be recommended to use LGX200 ml/l in broiler drinking water. Moreover, LGX increased the height and width of intestinal villi, resulting in high absorption of dietary nutrients. Supplementation of LGX to broiler drinking water stimulated the immunity of poultry through increasing the level of immunological blood indicators as well as the local intestinal immunity.

Ethics statement

All animal procedures were conducted in accordance with the standards set forth in the guidelines for the care and use of experimental animals. The study protocol was approved by the Animal Ethics Committee at Faculty of Veterinary Medicine, Damanhour University (DMU/VetMed-2023/011).

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article. Then, the manuscript is available to the readers after acceptance according to the policy of the journal without any objection.

CRediT authorship contribution statement

Amany A. El-Sahn: Writing – review & editing, Validation, Methodology, Data curation. Eman A. Manaa: Writing – review & editing, Methodology, Formal analysis, Data curation. Amal M. EL-Barbary: Writing – original draft, Validation, Software, Methodology. Ayman M. Khalifah: Writing – original draft, Software, Methodology, Investigation, Data curation. Sahar Fayez: Writing – original draft, Methodology, Formal analysis. Asmaa S.A. Abdel-Daim: Writing – original draft, Software, Methodology, Investigation. Ghadeer M. Albadrani: Writing – review & editing, Resources, Funding acquisition. Mohamed M. Abdel-Daim: Writing – review & editing, Supervision, Conceptualization. Mervat A. Abdel-Latif: Writing – review & editing, Supervision, Project administration, Conceptualization.

Declaration of competing interest

All authors have no competing financial or non financial interests that could influence the work in this manuscript.

Acknowledgements

The authors acknowledge Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R30), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. They also acknowledge their institutes and universities.
==== Refs
References

1 Gonzalez J.M. Portillo M.C. Belda-Ferre P. Mira A. Amplification by PCR artificially reduces the proportion of the rare biosphere in microbial communities PLoS One 7 1 2012 e29973
2 Ayoub M.M. Ahmed H.A. Sadek K.M. Alagawany M. Abd El-Hack M.E. Othman S.I. Allam A.A. Abdel-Latif M.A. Effects of liquid yucca supplementation on nitrogen excretion, intestinal bacteria, biochemical and performance parameters in broilers Animals 9 12 2019 1097 31818028
3 Abdel-Latif M.A. Elbestawy A.R. El-Far A.H. Noreldin A.E. Emam M. Baty R.S. Albadrani G.M. Abdel-Daim M.M. Abd El-Hamid H.S. Quercetin dietary supplementation advances growth performance, gut microbiota, and intestinal mrna expression genes in broiler chickens Animals 11 8 2021 2302 34438756
4 Manaa E.A. Abdel-Latif M.A. Ibraheim S.E. Sakr A. Dawood M. Albadrani G.M. El-Kott A.F. Abdel-Daim M.M. Shafik B.M. Impacts of macleaya cordata on productive performance, expression of growth-related genes, hematological, and biochemical parameters in Turkey Front. Vet. Sci. 9 2022
5 Hajati H. Application of organic acids in poultry nutrition Int. J. Avian Wildl. Biol 3 4 2018 324 329
6 Khan R.U. Naz S. Raziq F. Qudratullah Q. Khan N.A. Laudadio V. Tufarelli V. Ragni M. Prospects of organic acids as safe alternative to antibiotics in broiler chickens diet Environ. Sci. Pollut. Control Ser. 29 22 2022 32594 32604
7 Safwat A.M. Hassan O.A. El-Hady A.M.A. Kholif A.E. Sallam S.M. El-Zaiat H.M. Dietary supplementation of growing rabbits with lemongrass (Cymbopogon citrates) extract: effects on performance, nutrient digestibility, anti-oxidative status, immune response and carcase characteristics Ital. J. Anim. Sci. 20 1 2021 1977 1986
8 Shah G. Shri R. Panchal V. Sharma N. Singh B. Mann A. Scientific basis for the therapeutic use of Cymbopogon citratus, stapf (Lemon grass) \"J. Adv. Pharm. Technol. Research\"\" (JAPTR)\" 2 1 2011 3
9 Khalifah A.M. Abdalla S.A. Dosoky W.M. Shehata M.G. Khalifah M.M. Utilization of lemongrass essential oil supplementation on growth performance, meat quality, blood traits and caecum microflora of growing quails Ann. Agric. Sci. (Cairo) 66 2 2021 169 175
10 Otu B.O. Banjo A.A. Kolo P.S. Egena S.S. Dikko A. Audu F. Growth and body morphometric parameters of broiler chickens orally administered varying levels of lemongrass extract At Finisher Phase 2022
11 Hasan-Al-Sharif M. Hossain M.M. Asha A.S. Al-Mamun M. Lemongrass (cymbopogon citratus) essential oil improves gut health and production performance in broiler: a review Int. J. Curr. Sci. 13 2023 788 801
12 Ekpenyong C.E. Daniel N.E. Antai A.B. Bioactive natural constituents from lemongrass tea and erythropoiesis boosting effects: potential use in prevention and treatment of anemia J. Med. Food 18 1 2015 118 127 25162916
13 Alagawany M. El-Saadony M. Elnesr S. Farahat M. Attia G. Madkour M. Reda F. Use of lemongrass essential oil as a feed additive in quail's nutrition: its effect on growth, carcass, blood biochemistry, antioxidant and immunological indices, digestive enzymes and intestinal microbiota Poultry Sci. 100 6 2021 101172
14 Al-Rawi F. Abdul-Rahaman Y. Noaman A.I. Mohammed Th T. Abdulateef S. Jebril N. Mahmud K. Role of ascorbic acid and appetite stimulants on a few blood serum biochemical characteristics in pregnant Iraqi ewes under heat stress Revis Bionatura 7 4 2022 6
15 Gibson C. Akinsoyinu Akintunde O. Tayo Grace O. Akinboye Olufunso E. Afodu Osagie J. Ndubuisi-Ogbonna Lois C. Ogbonnaya Faith C. Serum biochemistry and sensory evaluation of broiler chicken fed cymbopogon citratus leaf meal World 5 6 2017 305 309
16 Krishan G. Narang A. Use of essential oils in poultry nutrition: a new approach Journal of Advanced Veterinary and Animal Research 1 4 2014 156 162
17 Belali M. Seidavi A. Bouyeh M. Gorlov I.F. Slozhenkina M.I. Mosolov A.A. Ramírez L.S. Tirado-González D.N. Cuevas-Barragán C.E. Cipriano-Salazar M. Substantiable bioconversion of the aromatic plant extracts biomass as feed additives in broiler performance: effects and prefeasibility comparison of thyme (Thymus vulgaris) Biomass Conversion and Biorefinery 14 5 2024 6097 6109
18 Erhan M. Bölükbaşı Ş. Citrus peel oils supplementation in broiler diet: effects on performance, jejunum microflora and jejunum morphology Brazilian Journal of Poultry Science 19 2017 15 22
19 Abd El-Ghany W.A. Abdel-Latif M.A. Hosny F. Alatfeehy N.M. Noreldin A.E. Quesnell R.R. Chapman R. Sakai L. Elbestawy A.R. Comparative efficacy of postbiotic, probiotic, and antibiotic against necrotic enteritis in broiler chickens Poultry Sci. 101 8 2022 101988
20 Alcicek A. Bozkurt M. Cabuk M. The effect of a mixture of herbal essential oils, an organic acid or a probiotic on broiler performance S. Afr. J. Anim. Sci. 34 4 2004 217 222
21 Abd El-Hady A. El Ashry G.M. El-Ghalid O. Effect of natural phytogenic extract herbs on physiological status and carcass traits of broiler chickens Open J. Anim. Sci. 10 1 2019 134 151
22 Silva H. Bárbara R. Exploring the anti-hypertensive potential of lemongrass—a comprehensive review Biology 11 10 2022 1382 36290288
23 Fialho E.T. Barbosa H.P. Ferreira A.S. Gomes P.C. Girotto A.F. Utilizacao da Cevada em Dietas Suplementadas com Oleo de Soja para Suinos em Crescimento e Terminacao 1992
24 Ahmadipour B. Hassanpour H. Khajali F. Evaluation of hepatic lipogenesis and antioxidant status of broiler chickens fed mountain celery BMC Vet. Res. 14 1 2018 1 7 29291752
25 Csernus B. Biró S. Babinszky L. Komlósi I. Jávor A. Stündl L. Remenyik J. Bai P. Oláh J. Pesti-Asbóth G. Effect of carotenoids, oligosaccharides and anthocyanins on growth performance, immunological parameters and intestinal morphology in broiler chickens challenged with Escherichia coli lipopolysaccharide Animals 10 2 2020 347 32098265
26 El-Kassas S. El-Naggar K. Abdo S.E. Abdo W. Kirrella A.A. El-Mehaseeb I. El-Magd M.A. Dietary supplementation with copper oxide nanoparticles ameliorates chronic heat stress in broiler chickens Anim. Prod. Sci. 60 2 2019 254 268
27 Li J.-L. Sunde R.A. Selenoprotein transcript level and enzyme activity as biomarkers for selenium status and selenium requirements of chickens (Gallus gallus) PLoS One 11 4 2016 e0152392
28 Han H. Zhang J. Chen Y. Shen M. Yan E. Wei C. Yu C. Zhang L. Wang T. Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age J. Anim. Sci. 98 10 2020 skaa311
29 Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method methods 25 4 2001 402 408 11846609
30 Ballongue J. Schumann C. Quignon P. Effects of lactulose and lactitol on colonic microflora and enzymatic activity Scand. J. Gastroenterol. 32 sup222 1997 41 44
31 Abdel-Latif M.A. El-Far A.H. Elbestawy A.R. Ghanem R. Mousa S.A. Abd El-Hamid H.S. Exogenous dietary lysozyme improves the growth performance and gut microbiota in broiler chickens targeting the antioxidant and non-specific immunity mRNA expression PLoS One 12 10 2017 e0185153
32 Bancroft J.D. Layton C. The Hematoxylins and Eosin, Bancroft's Theory and Practice of Histological Techniques vol. 7 2012 173 186
33 Efenberger-Szmechtyk M. Nowak A. Czyzowska A. Plant extracts rich in polyphenols: antibacterial agents and natural preservatives for meat and meat products Crit. Rev. Food Sci. Nutr. 61 1 2021 149 178 32043360
34 Salako A. Atteh J. Akande T. Opowoye I. Aderibigbe T. Mitigating potential of three phytogenic feed additives in broilers exposed to dietary aflatoxin Iran. J. Appl. Anim. Sci. 12 3 2022 571 581
35 Bento M. Ouwehand A. Tiihonen K. Lahtinen S. Nurminen P. Saarinen M. Schulze H. Mygind T. Fischer J. Essential oils and their use in animal feeds for monogastric animals--Effects on feed quality, gut microbiota, growth performance and food safety: a review Vet. Med. 58 9 2013
36 Khattak F. Ronchi A. Castelli P. Sparks N. Effects of natural blend of essential oil on growth performance, blood biochemistry, cecal morphology, and carcass quality of broiler chickens Poultry Sci. 93 1 2014 132 137 24570432
37 Al-Awadi D.H.Y. Al-Nadawi N.A.-L.A. Effect of adding different levels of lemon grass leaves (Cymbopogon citratus) to the diet or its extract into drinking water on some blood parameters for broiler chickens (Ross 308) Journal of Physics: Conference Series 2020 IOP Publishing 012114
38 Puvadolpirod S. Thaxton J. Model of physiological stress in chickens 3. Temporal patterns of response Poultry Sci. 79 3 2000 377 382 10735205
39 Soetan K. Akinrinde A. Ajibade T. Preliminary studies on the haematological parameters of cockerels fed raw and processed Guinea corn (Sorghum bicolor) Proceedings of 38th Annual Conference of Nigerian Society for Animal Production 2013 49 52
40 Opoola E. Atte P. Makinde O. Aganbi B. Effect of vitamin C supplementation on haematological and serum biochemical indices of laying hens diagnosed with fowl typhoid under tropical environment Trop. J. Anim. Sci. 20 3 2018 117 123
41 Puvadolpirod S. Thaxton J. Model of physiological stress in chickens 4. Digestion and metabolism Poultry Sci. 79 3 2000 383 390 10735206
42 Guimarães L.G.L. dasGraças Cardoso M. Souza P.E. de Andrade J. Vieira S.S. Antioxidant and fungitoxic activities of the lemongrass essential oil and citral Rev. Cienc. Agron. 42 2 2011 464
43 Olorunnisola S. Hammed A. Simsek S. Biological properties of lemongrass: an overview Int. Food Res. J. 21 2 2014
44 Ojo O. Kabutu F. Bello M. Babayo U. Inhibition of paracetamol-induced oxidative stress in rats by extracts of lemongrass (Cymbropogon citratus) and green tea (Camellia sinensis) in rats Afr. J. Biotechnol. 5 12 2006
45 Oviedo E. Important factors in water quality to improve broiler performance North Carolina Poultry Industry Joint Area Newsletter 4 1 2006 7 8
46 Lachowicz K. Koszela-Piotrowska I. Rosołowska-Huszcz D. Dietary fat type and level affect thyroid hormone plasma concentrations in rats J. Anim. Feed Sci. 18 3 2009 541 550
47 Nambiar V.S. Matela H. Potential functions of lemon grass (Cymbopogon citratus) in health and disease International Journal of Pharmaceutical and Biological Archives 3 5 2012 1035 1043
48 Li W. Wei F. Xu B. Sun Q. Deng W. Ma H. Bai J. Li S. Effect of stocking density and alpha-lipoic acid on the growth performance, physiological and oxidative stress and immune response of broilers Asian-Australas. J. Anim. Sci. 32 12 2019 1914 31010966
49 Al‐Sagheer A. Mahmoud H. Reda F. Mahgoub S. Ayyat M. Supplementation of diets for Oreochromis niloticus with essential oil extracts from lemongrass (Cymbopogon citratus) and geranium (Pelargonium graveolens) and effects on growth, intestinal microbiota, antioxidant and immune activities Aquacult. Nutr. 24 3 2018 1006 1014
50 Slawinska A. Dunislawska A. Plowiec A. Gonçalves J. Siwek M. TLR-mediated cytokine gene expression in chicken peripheral blood mononuclear cells as a measure to characterize immunobiotics Genes 12 2 2021 195 33572768
51 Gan L. Fan H. Mahmood T. Guo Y. Dietary supplementation with vitamin C ameliorates the adverse effects of Salmonella Enteritidis-challenge in broilers by shaping intestinal microbiota Poultry Sci. 99 7 2020 3663 3674 32616263
52 Kara K. Kocaoğlu Güçlü B. Şentürk M. Konca Y. Influence of catechin (flavan-3-ol) addition to breeder quail (Coturnix coturnix japonica) diets on productivity, reproductive performance, egg quality and yolk oxidative stability J. Appl. Anim. Res. 44 1 2016 436 441
53 Harikrishnan R. Balasundaram C. Heo M.-S. Impact of plant products on innate and adaptive immune system of cultured finfish and shellfish Aquaculture 317 1–4 2011 1 15
54 Luther M. Parry J. Moore J. Meng J. Zhang Y. Cheng Z. Yu L.L. Inhibitory effect of Chardonnay and black raspberry seed extracts on lipid oxidation in fish oil and their radical scavenging and antimicrobial properties Food Chem. 104 3 2007 1065 1073
55 Cho J. Kim H. Kim I. Effects of phytogenic feed additive on growth performance, digestibility, blood metabolites, intestinal microbiota, meat color and relative organ weight after oral challenge with Clostridium perfringens in broilers Livest. Sci. 160 2014 82 88
56 Leite A.M. Lima E.d.O. Souza E.L.d. Diniz M.d.F.F.M. Trajano V.N. Medeiros I.A.d. Inhibitory effect of beta-pinene, alpha-pinene and eugenol on the growth of potential infectious endocarditis causing Gram-positive bacteria Rev. Bras. Ciencias Farm. 43 2007 121 126
57 Lan Y. Verstegen M. Tamminga S. Williams B. The role of the commensal gut microbial community in broiler chickens World Poultry Sci. J. 61 1 2005 95 104
58 Bogucka J. Ribeiro D.M. Bogusławska‐Tryk M. Dankowiakowska A. da Costa R.P.R. Bednarczyk M. Microstructure of the small intestine in broiler chickens fed a diet with probiotic or synbiotic supplementation J. Anim. Physiol. Anim. Nutr. 103 6 2019 1785 1791
