
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39313528
71781
10.1038/s41598-024-71781-w
Article
Effect of silver nanoparticles and REP-PCR typing of Staphylococcus aureus isolated from various sources
http://orcid.org/0000-0002-7993-971X
Elghazaly Eman M. emanmoneer1@gmail.com

1
Torky Helmy A. 2
Tawfik Rasha Gomaa 2
1 Microbiology Department, Faculty of Veterinary Medicine, Matrouh University, Matrouh, Egypt
2 https://ror.org/00mzz1w90 grid.7155.6 0000 0001 2260 6941 Microbiology Department, Faculty of Veterinary Medicine, Alexandria University, Alexandria, Egypt
23 9 2024
23 9 2024
2024
14 2199725 4 2024
30 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
This is the primary study at Matrouh Governorate to unveil antibiotic resistance, biofilm formation, silver nanoparticles (Ag-NPs) effect using electron microscopy, and REP-PCR analysis of Staphylococcus aureus strains isolated from COVID-19 patients, contaminated food, and Morel’s diseased sheep and goats. A total of 15 S. aureus strains were isolated; five from each of the COVID-19 patients, Morel's diseased sheep and goats, and contaminated food. All strains were considered multidrug-resistant (MDR). All strains showed the presence of biofilm. Morphological changes in the cell surface of the bacterium were evidenced, and penetration with the rupture of some bacterial cells. Based on REP-PCR analysis, 4 clusters (C1-C4) with dissimilarity between clusters C1 and C2 8% and between C3 and C4 15%. Cluster I included 3 strains from contaminated food with a similarity of 97%, and Cluster II included 2 strains from contaminated food and 2 from COVID-19-infected patients with a similarity of 96% (confirming the zoonotic nature of this pathogen). Cluster III contained 4 strains isolated from Morel's diseased sheep & goats with a similarity ratio of 99% in comparison the 4th cluster contained 3 strains isolated from COVID-patients and one from Morel's diseased sheep & goats with a similarity ratio of 92%.

Keywords

Ag-NPs
REP-PCR
Electron microscopy
Biofilm
COVID-19
Morel's diseased
Subject terms

Microbiology
Molecular biology
Matrouh UniversityOpen access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

S. aureus is one of the most important opportunistic pathogens due to its high pathogenicity, high contamination rate for food, rapid transmission, and rapid distribution. This universal microorganism is carried asymptomatically in 20–30% of the human population1 and is a risk factor for subsequent infection2. The bacterium can cause minor skin lesions to invasive lesions such as pneumonia and endocarditis. The severity of the disease is linked to a battery of virulence factors—more than 70 genes related to its pathogenicity and invasiveness3.

Extracellular toxins including Staphylococcus enterotoxins (SEs) genes responsible for food poisoning outbreaks4. Some of its toxins are linked with an increased death rate among hosts suffering from other diseases. Alpha hemolysin is present in all S. aureus strains as the major virulence factor linked with mammary gland necrosis and a higher death rate among infected animals5. Contamination of food by methicillin-resistant S. aureus (MRSA) strains with a wide range of exotoxins, including enterotoxins confer life-threatening traits on MRSA, thereby making treatment complicated6.

The global pandemic illness COVID-19 caused by SARS-CoV-2, also known as COVID-19 by the World Health Organization (WHO)7, is characterized by severe acute respiratory syndrome. Today the management for the prevention and control of the disease allows the utilization of vaccines approved by the Food Drug Administration (FDA). Deaths accompanied by respiratory syndrome, endocarditis, and pneumonia draw attention that S. aureus may display as a relapse infection by strains responsible for the index case 2 virulent factors and enterotoxins and production of other toxins inhibit the immune response as alarming8.

The resistance of S. aureus is acquired soon after exposure to treatment with antibiotic9 through the acquisition of antibiotics resistance agents, mobile molecular elements such as integrons, and the existence of biofilm. antibiotic resistance poses a threat to food safety and leads to the death of animals10.

The mortality of S. aureus infections has dramatically increased as a result of the rise of MRSA strains, bringing attention to the requirement for the creation of novel therapeutic and preventive measures such as metallic nanoparticles, exclusively Ag-NPs to counteract multidrug-resistant S. aureus11. Even though12, are convinced that nanoparticles are essential in treatment besides systemic antibiotics to evade colonization of bacteria and possibly septicemia in the clinic; even though its mechanism is not fully known13.

Ag-NPs are seen as a good option among nanoparticles with marked antibacterial profiles, relatively inexpensive to produce14. Nanotechnology has potential use in human and veterinary medicine15. It is not surprising to see nanotechnology being employed to tackle the danger of antibiotic resistance because this technology is increasingly being used in medicine. Nanoparticles can be applied in several ways to cure illnesses16.

Repetitive element sequences spread throughout the chromosome of all bacteria and Van Der Zee et al.17 suggested REP-PCR genotyping technique based on the presence of homologous Mycoplasma pneumonia repeat-like elements in S. aureus for tracing the source of infection. Monitoring the prevalence of nosocomial Staphylococcus infections is simple and quick. MRSA isolates linked to outbreaks were discovered to share a cluster of identical REP-PCR profiles17,18. Manga and Vyletelova19 mentioned its higher discriminatory power and reproducibility than RAPD and PFGE.

The main objectives of this research are studying the antibiotics resistance pattern of S. aureus isolates, evaluating the effect of silver nanoparticles on pan-drug resistant S. aureus strains by electron microscopy and determining the genetic relatedness among S. aureus strains isolated from COVID-19 patients, contaminated food and Morel's diseased sheep and goat by REP-PCR at Matrouh Governorate.

Results

Out of 215 samples (120 contaminated food samples, 65 Morel's diseased sheep, and goats samples, and 30 samples from COVID-19 patients), 15 (7%) S. aureus strains were recovered, 5 (16.7%) from COVID-19 patients, 5 (7.7%) from Morel's diseased sheep and goats, and 5 (4.2%) from contaminated food as shown in Table 1. Staphylococcus enterotoxin a (sea) was found in four isolates from Morel's diseased sheep and goats, three isolates from the COVID-19 patients had the Staphylococcus enterotoxin b (seb) gene, and only one isolate from contaminated food had the seb gene. All strains displayed tolerance to at least three classes of antibiotics. Most strains showed MDR, and only 1(6.67%) of them was Pan-drug resistant (PDR) (showed resistance to six classes of antibiotics) as shown in Tables 2, 3 and all 15 (100%) strains were biofilm producers (6 weak, 4 moderate, and 5 strong) as shown in Table 2, the most pan-drug resistant strain that showed resistance to different six classes of antibiotics also, showed the presence of integron1 (this strain was used for evaluating the effect of silver nanoparticles by electron microscopy).Table 1 The incidence of Staphylococcus aureus among different sources of samples.

	Outcome	Total	
Negative	Positive	
Source of sample	COVID 19 human	Count	25	5	30	
% within samples types	83.3%	16.7%	100.0%	
Contaminated food samples	Count	115	5	120	
% within samples types	95.8%	4.2%	100.0%	
Morel’s diseased sheep and goats	Count	60	5	65	
% within samples types	92.3%	7.7%	100.0%	
Total	Count	200	15	215	
% within samples types	93.0%	7.0%	100.0%	

Table 2 Antibiotic resistance pattern and biofilm grade of Staphylococcus aureus isolates.

Number of examined isolates	Source	Resistance profile	Resistance of antimicrobial classes	Biofilm grade (OD)	
1	Morel's diseased sheep	CF, P, AMX, CL, TE	3 classes	Weak (+ or 1)	
2	Morel's diseased sheep	MUP, P, GEN and AMX, TE	3 classes	Weak (+ or 1)	
3	Morel's diseased goat	MUP, AMX, P, CF, K, V, TE	4 classes	Moderate (+ + or 2)	
4	Morel's diseased sheep	GEN, K, AMX, P, CL, CF, T IMI, T	5 classes	Strong (+ +  + or 3)	
5	Morel's diseased goat	AMX, CF, V	3 classes	Weak (+ or 1)	
6	Positive COVID-19 patient	K, AT, CF, GEN, P, V, AMX	5 classes	Strong (+ +  + or 3)	
7	Positive COVID-19 patient	AMX, CAZ, CF, MUP, TMP-SMZ	4 classes	Moderate (+ + or 2)	
8	Positive COVID-19 patient	AT, MUP, CMP	3 classes	Weak (+ or 1)	
9	Positive COVID-19 patient	CEZ, GEN, K, V, P, AMX	4 classes	Moderate (+ + or 2)	
10	Positive COVID-19 patient	K, GEN, P, AMX, CL	3 classes	Weak (+ or 1)	
11	Contaminated food	CAZ, AT, P, V, CIP, TMP-SMZ,GEN, TE	6 classes	Strong (+ +  + or 3)	
12	Contaminated food	MUP, CL, P, V, CAZ	5 classes	Strong (+ +  + or 3)	
13	Contaminated food	K, GEN, AMX, P, V	3 classes	Weak (+ or 1)	
14	Contaminated food	TMP-SMZ, AMX, P, V, CAZ	4 Classes	Moderate (+ + or 2)	
15	Contaminated food	CAZ, CEZ, CF, AMX, P, V, IMI, GEN, K	5 classes	Strong (+ +  + or 3)	

Table 3 Incidence of pan-drug resistant strain among 15 S. aureus isolates of different sources.

Sources of S. aureus isolates	Total NO. of S. aureus isolates	NO. of pan-drug resistant strains	% of pan-drug resistant strains	
COVID 19 human	15	0	0%	
Contaminated food samples	1	6.67%	
Morel’s diseased sheep and goats	0	0%	
% acc. to total NO. of S. aureus isolates.

The disc diffusion of Ag-NPs revealed that 100 µg/ml is the minimum bactericidal concentration (MBC) required to inhibit cells of the S. aureus strain that exhibited resistance to six classes of antibiotics (pan-drug resistant). The minimum inhibitory concentration (MIC) was 50 µg/ml. The diffusion plate results revealed a strong positive correlation between the concentration of Ag-NPs and antibacterial efficacy, as measured by the zones of inhibition; increasing Ag-NPs concentrations increases the antibacterial efficacy as shown in Table 4 and Fig. 1. The silver nanoparticles (Ag-NPs) used were spherical (Fig. 2). As shown in Fig. 3, the images produced by the presence of Ag-NPs at concentrations of 100 µg/ml and various exposure times of 2.5, 10, and 25 min indicate changes in the integrity of the outer bacterial cell membrane and a strong positive correlation was found between the duration of exposure to silver nanoparticles and the morphological changes in bacterial cells that determined by SEM (Fig. 4) and Table 5, as the effect was more pronounced where the concentration was 100 µg/ml with a 25- min exposure time as shown in Fig. 3D.Table 4 Correlation between silver nanoparticles concentration and antibacterial efficacy.

Kendall's tau_b correlation	Antibacterial efficacy ( zones of inhibition)	
The concentration of silver nanoparticles	Correlation coefficient	0.887**	
Sig. (2-tailed)	0.003	
**Correlation is significant at the 0.01 level (2-tailed).

Fig. 1 Correlation between silver nanoparticles concentration and antibacterial efficacy.

Fig. 2 SEM micrograph of spherical Ag-NPs particles and with an 18.7 nm average size.

Fig. 3 Effect of silver nanoparticles on isolated S. aureus. (A) The surface of untreated S. aureus cells was smooth and retained their coccus/round morphology. (B) S. aureus cells treated with 100 µg/ml Ag-NPs for 2.5 min appeared to undergo slight lysis. (C) S. aureus treated with 100 µg/ml Ag-NPs for 10 min appeared to undergo moderate lysis (D) S. aureus treated with 100 µg/ml Ag-NPs for 25 min appeared to undergo severe lysis, so the contents of the cell were released into the cytoplasm.

Fig. 4 Correlation between duration of exposure to silver nanoparticles and morphological changes in bacterial cells that detected by SEM.

Table 5 Correlation between duration of exposure to silver nanoparticles and morphological changes in bacterial cells that detected by SEM.

Kendall's tau_b correlation	Morphological changes in bacterial cells determined by SEM	
Duration of exposure to silver nanoparticles	Correlation coefficient	0.932**	
Sig. (2-tailed)	0.000	
**Correlation is significant at the 0.01 level (2-tailed).

REP-PCR analysis revealed the presence of 4 clusters and 3 single strains (11, 8, and 5); cluster I included two strains (13 and 15) recovered from contaminated food and a single strain (11) which also, recovered from contaminated food with a similarity ratio about 97% between them, cluster II included 3 strains (12, 14, 10), two of them (12 and 14) recovered from contaminated food and one of them (10) recovered from COVID-19 patients and a single strain (8) that recovered from COVID-19 patients with a similarity ratio about 96%, cluster III which contained 4 strains (1, 2, 3, 4) recovered from Morel's diseased sheep and goats with a similarity ratio about 99% and cluster IV which contained 3 strains recovered from COVID-19 patients (6, 7, 9) and a single strain (5) which recovered from Morel's diseased sheep and goats with a similarity ratio about 92%, the dissimilarity between cluster I (CI) and C II about 8%, but the difference between C III and C IV about 15% as shown in Figs. 5, 6 and Table 6.Fig. 5 REP-PCR of S. aureus. REP-PCR assay of S. aureus strains from different sources in 1.5% agarose gel, L: 100 bp molecular marker, lanes (1–5): S. aureus isolates from Morel's diseased sheep and goat origin, lanes (6–10): S. aureus isolates from positive COVID -19 patient origin, Lanes (11–15): S. aureus isolates from contaminated food origin.

Fig. 6 Cropped figure of dendrogram showing the genetic relatedness among 15 S. aureus isolates using Ward linkage, (1, 2, 3, 4 and 5): S. aureus isolates from Morel's diseased sheep and goat origin, (6, 7, 8, 9 and 10): S. aureus isolates from positive COVID-19 patient origin, (11, 12, 13, 14 and 15): S. aureus isolates from contaminated food origin.

Table 6 The genetic relatedness among 15 S. aureus isolates.

Sources of S. aureus isolates	Clustering by ward method	Total	Monte Carlo Sig. (2-sided)	
Cluster 1	Cluster 2	Cluster 3	Cluster 4	
Morel's diseased sheep and goats	0	0	4	1	5	X2	P	
COVID-19 patients	0	2	0	3	5	14.243	0.001	
Contaminated food	3	2	0	0	5	
Total	3	4	4	4	15	

Discussion

S. aureus, a symptomatically colonizing normal flora of the skin and nasopharynx of animals and humans, characterized by its pathogenicity for both20 causes skin infection, pneumonia, and endocarditis in humans21.

In this study, we isolated and identified phenotypically and genotypically 15 S. aureus strains out of 215 different samples: five from each of the COVID-19 patients, Morel's diseased sheep and goats, and contaminated food samples.

Enterotoxin not only suppresses the immune system8 but also increases the risk of a chronic infection11 and is linked to the virulence and pathogenicity of strains22,23. Treatment becomes more difficult when any kind of SE acts as a superantigen on polymorphonuclear cells, causing the production of the IL-4 and IL-10 genes and then stimulating Th2 cells24. This makes it more difficult to eradicate invasive infections, which can cause serious lung damage in people with cystic fibrosis25 and lead to 94,000 invasive diseases and over 18,000 deaths each year in the United States26. Every year, 150,000 MRSA infections occur in Europe, and 7000 deaths are associated with these infections27.

Most isolated strains have one of the SEs. MRSA is the leading bacterium causing food poisoning outbreaks and is regarded as the most prevalent pathogen in human nosocomial infections28. 14 (41.2%) of the 34 S. aureus isolates were positive for Staphylococcus enterotoxin B (SEB)29.

In this study, all 15 S. aureus strains showed resistance to at least three different classes of antibiotics. Researchers determined that 24%, 47%, 91%, 82%, 59%, and 47% of S. aureus isolates were resistant to several antibiotics, indicating MDR29. All S. aureus strains showed different resistance standards to antibiotics30, while most of them were MDR that resist penicillins and their derivatives and methicillin, and many of the most frequently recommended beta-lactam antibiotics, comprising amoxicillin and oxacillin, match what is known as MRSA31.

All strains (100%) were biofilm producers. Neopane et al.32 found that 86.7% of biofilm-producing S. aureus exhibited MDR. Moreover, only one isolate showed the presence of integron 1 (the one that showed resistance to six classes of antibiotics). The class 1 integron gene cassette with variable amplicon and the integrase gene (intl1) were found to be present in 42% and 36% of the isolates, respectively33. The presence of integron contributes to the transfer of antibiotic-resistance genes among Staphylococci34.

The condition is exacerbated if contaminated food of animal origin (milk, meat) with S. aureus is submitted to patients in poor health35–37, which leads to subsequent dissemination of resistance to humans from the food chain, increasing the difficulty of treatment infection in humans and decreasing possible therapeutic uses20.

The emergence of resistance to antibiotics that are either not licensed for use in animals or that are listed for use in humans only complicates the issue of antimicrobial resistance in low-source countries like Egypt38. Most developed nations have antimicrobial drug resistance (AMR) surveillance and monitoring systems that are routinely updated7, as the Danish Integrated Antimicrobial Resistance, Monitoring, and Research Programme in Denmark and the National Antimicrobial Resistance Monitoring Systems (NARMS) in the United States. As a result, these nations have detailed maps of the AMR phenomenon39. Alternatively, due to a lack of surveillance networks, laboratory capacity, and proper diagnosis, and consequently, a lack of information, there is no regular surveillance or monitoring system for MDR in developing nations in Africa40.

The utilization of metallic nanoparticles that show antimicrobial activities is one of the recent techniques to overcome microbes and multi-drug resistant bacteria41. In our investigation, silver nanoparticles (Ag NPs) inhibited the growth of strong biofilm-forming and pan-drug-resistant S. aureus. In disc diffusion tests, the increase in the concentration of Ag-NPs increases the antibacterial efficacy; this relation was noticed by Armanullah et al.42 in Gram–negative bacteria. There is a direct relation between the duration of exposure to silver nanoparticles and its effect on the microorganisms, as found by Li et al.43 who reported that the exposure of S. aureus cells to 50 g/ml Ag-NPs for 6 h caused the DNA to become condensed and lose its capacity for replication, while its exposure to 50 g/ml Ag-NPs for 12 h caused the cell wall to break down, allowing the contents of the cells to leak out into the environment. Eventually, the cell wall disintegrated. The enzymatic activity of respiratory chain dehydrogenase may lso be decreased by Ag-NPs due to the low diffusibility of engineered nanoparticles (ENP). The efficacy of disc diffusion susceptibility assays for evaluating their antibacterial activity is in doubt, but Kourmouli et al.44 proved that their penetration through the cultured media and Ag-NPs' unique size-dependent properties are not responsible for their antibacterial diffusion behavior, which is instead ascribed to the ions they release.

The mechanisms of Ag NPs' action are blurred and unclear. The exact mechanisms are not completely understood. According to Duran et al.13 and Abdelrehiem et al.45, Ag-NPs may interact with the bacterial cell wall, produce reactive oxygen species (ROS), interact with DNA, and release Ag+ ions41. According to Qing et al.46, dissolving Ag+ ions produced during the oxidation and dilution of Ag-NPs in an aqueous solution and their subsequent reaction with cell membrane proteins are what cause the morphological changes seen in bacteria exposed to Ag-NPs47, reported that nanoparticles may be able to interact with the cell wall of bacteria by changing lipopolysaccharide and making pores that alter the cell membrane while Vazquez-Munoz et al.48 attributed its action to the direct influence of silver on membrane stability, an anchor to the bacterial cell wall, allow Ag-NPs to penetrate the intracellular environment that achieves to enter the cell cytoplasm and release Ag+ that can interact with various biomolecules ended by bacterial death.

By using electron imQaging, we were able to demonstrate that Ag-NPs accumulated on the cell wall of S. aureus, penetrated the interior, and interacted with biomolecules, possibly causing the cell wall to rupture and/or bacterial death. In the twentieth century, people thought that silver was comparatively nanotoxic to mammalian cells, aside from the fact that it could lead to argyria. However, research has shown that silver-based compounds can be significantly toxic to human and animal cells at the nanoscale. These problems must be addressed before people hurry to indulge in the nanosilver boom49.

Finally, based on the results of REP-PCR as a recommended tool for partial fingerprinting analysis of 15 S. aureus strains, it revealed the presence of 4 clusters, gave detailed information to enable comparative analysis, confirmed the zoonotic nature of this important pathogen, and shared a common source, contamination, and/or infection. El-Gedawy et al.50 reported that the four Rep-PCR primers generated roughly 55 fragments, of which 29 (52.5%) are considered to be polymorphic bands among S. aureus isolates and 26 (47.5%) are considered to be monomorphic bands. Holmes and Zadoks34 provide evidence that humans are the primary natural carriers of S. aureus, which can contaminate food and put customers at risk for health problems. Shepheard et al.51 reported that animal S. aureus strains are distinct from those infecting humans, and Manga and Vyletelova19, concluded that REP-PCR is good compared to RAPD and PFGE, the pulsed-field gel electrophoresis screening of 42 S. aureus strains yielded six clusters. Abdelrahman52 subtyped 12 strains of S. aureus (10 from ruminants and 2 from poultry) at 75% genetic similarity into 6 ERIC-types (A1:A3, B1:B3). Holmes and Zadoks34 attributed the diversity to random nucleotide mutations and horizontal gene transfer.

Conclusion

In conclusion, the powerful biofilm-forming and antibiotic-resistant S. aureus strain development is inhibited by Ag-NPs. There is a direct relationship between the concentration and the antibacterial efficacy, as well as, between the duration of exposure to silver nanoparticles and their effect on the microorganisms. REP-PCR is one of the most effective methods to determine the genetic relatedness between different strains.

Material and methods

Sampling

Sample size

Two hundred and fifteen samples (120 contaminated food samples, 65 Morel's diseased sheep and goats samples, and 30 samples from COVID-19 patients) were collected from Matrouh Governorate for the isolation of S. aureus. By using the Epi Info sample size calculator, the odds ratio of contaminated food samples was 0.217 and the infection rate was 15%, so the minimum sample size was 106 contaminated food samples, the odds ratio of Morel's diseased sheep, and goats was 0.417 and the infection rate was 54%, so the minimum sample size was 56 Morel's diseased sheep and goats, the odds ratio of COVID-19 human was 0.200 and the infection rate was 22%, so the minimum sample size was 27 COVID-19 human cases53–55, so the minimum number required for doing our study was 189 samples. The odd ratios of different samples were illustrated in Table 7.Table 7 Exhibition of the Logistic regression to predict each sample type's risk factors (odds ratio).

	B	S.E	Wald	df	Sig	Exp (B) (odds ratio)	95.0% C.I. for EXP(B)	Classification Table	Hosmer and Lemeshow Test	Nagelkerke R Square	
Lower	Upper	
Contaminated food samples	− 1.526	0.670	5.190	1	0.023	0.217	0.058	0.808	93%	1.000	0.057	
Morel’s diseased sheep and goats	− 0.875	0.676	1.678	1	0.195	0.417	0.111	1.567	
Constant	− 1.609-	0.490	10.793	1	0.001	0.200			
References category COVID 19 human.

Isolation of S. aureus

For the isolation of S. aureus, nasopharyngeal swab samples were taken from COVID-19 patients, Morel's diseased sheep, and goats1. Briefly, from clinical cases, cotton-tipped swabs moistened with sterile saline, rolling over the lesion surface five times, focusing on the area where there was evidence of pus or an inflamed area, and contaminated food samples were processed as recorded by Artursson et al., Wang et al.56,57. Using Mannitol salt agar (Oxoid), Baired- parker agar (Hi- media, Mumbai), and oxacillin resistance screening agar base plate (ORSAB) (Oxoid, UK) (it gives characteristic dense blue colonies)58.

Identification of S. aureus

Identification of S. aureus was carried out by microscopic examination, colonial characteristics, and biochemical identification: catalase-positive, coagulase-positive, and oxidase-negative58, besides species-specific nuc gene PCR. Also, PCR investigation to its enterotoxin gene presence (Table 8). All molecular characterization was performed at the Animal Health Research Institute, Dokki, Giza, Egypt.Table 8 Target genes, Primer sequences, amplicon sizes, cycling conditions of S. aureus enterotoxin genes and integron 1.

Target gene	Primers sequences	Amplified segment (bp)	Primary denaturation	Amplification (35 cycles)	Final extension	Reference	
Secondary denaturation	Annealing	Extension	
nuc	GTGCTGGCATATGTATGGCAATTG	660 bp	94˚C

2 min

	98˚C

10 s

	58˚C

30 s

	68˚C

1 min

	68˚C

7 min

	59	
CTGAATCAGCGTTGTCTTCGCTCCAA	
Sea	GGTTATCAATGTGCGGGTGG	102	94˚C

5 min

	94˚C

30 s

	57˚C

30 s

	72˚C

30 s

	72˚C

7 min

	60	
CGGCACTTTTTTCTCTTCGG	
Seb	GTATGGTGGTGTAACTGAGC	164	57˚C

30 s

	72˚C

30 s

	72˚C

7 min

	
CCAAATAGTGACGAGTTAGG	
Sec	AGATGAAGTAGTTGATGTGTATGG	451	57˚C

40 s

	72˚C

45 s

	72˚C

10 min

	
CACACTTTTAGAATCAACCG	
Sed	CCAATAATAGGAGAAAATAAAAG	278	57˚C

30 s

	72˚C

30 s

	72˚C

7 min

	
ATTGGTATTTTTTTTCGTTC	
See	AGGTTTTTTCACAGGTCATCC	209	57˚C

30 s

	72˚C

30 s

	72˚C

7 min

	
CTTTTTTTTCTTCGGTCAATC	
Integron (hep 35 and hep 36 primers)	TGCGGGTYAARGATBTKGATTT	491	55˚C

40 s

	72˚C

45 s

	72˚C

10 min

	61	
CARCACATGCGTRTARAT	
Class 1 Integron cassettes	GGCATCCAAGCAGCAAG	Variable			55˚C

40 s

	72˚C

45 s

	72˚C

10 min

	62	
AAGCAGACTTGACCTGA	

Antimicrobial susceptibility testing

The disc diffusion technique63 using a bacterial suspension with turbidity standards of 0.5 McFarland and Muller Hinton agar plates (OXOID) using 16 antibiotics of different classes: CEZ (cefazolin), CF (Cefoxitin), CAZ (Ceftazidime), AMX (Amoxicillin), AT (Azithromycin), TMP-SMZ (Sulpha/Trimethoprim),CMP (Chlorampheniol), IMI (Imipenem), CIP (Ciprofloxacin), GEN (Gentamycin), CL (Clindamycin), K (Kanamycin), MUP (Mupirocin), P (Penicillin), V (Vancomycin) and TE (Tetracycline), and the diameter of inhibition zone was estimated as described by Christensen et al.64.

Biofilm formation

The Micro titer plate method for recognizing biofilm formation was performed following the scheme mentioned by Christensen et al.64. By using a micro-ELISA auto- reader at a wavelength of 570 nm, the optical density of the adherent stained biofilm was measured, and the results are determined according to the following equations, as shown in Table 9.Table 9 The equations used to determine the biofilm grade of isolates.

NO	Results	Equation	
1	Non biofilm producer (0)	OD≤ODc	
2	Weak biofilm producer(+ or 1)	ODc > OD ≤ 2 × ODc	
3	Moderate biofilm producer(+ + or 2)	2×ODc<OD≤4×ODc	
4	Strong biofilm producer (+ +  + or 3)	3×ODc<OD≤4×ODc	

Detection of integron

The selected pan-drug-resistant strain was selected for detection of integron using hep 35 and hep 36 genes, which encoded a conserved region of the integrase gene61 and then for detection of integron 1 cassette62 using PCR-specific primers as shown in Table 8. It was carried out at the Animal Health Research Institute, Dokki, Giza, Egypt.

Preparation and characterization of silver nanoparticles65

Preparation of silver nanoparticles

Using starch as a means of decreasing and stabilizing the obtained Ag-NPs, high throughput production was used to prepare the Ag-NPs solution66. In summary, 2 g of raw rice starch (WINLAB laboratory chemicals Co., U.K.) was progressively dissolved with stirring in an alkaline solution pH 11 (0.3 g sodium hydroxide; Sigma-Aldrich, Germany). The mixture was continuously stirred until the starch was completely dissolved. Concurrently, 100 ml of deionized water were used to dissolve 0.5 g of silver nitrate [99.99%; Sigma-Aldrich, Germany]. At 60 °C, the silver nitrate solution was gradually added to the starch solution while being stirred. The color progressively changed from a murky white to a transparent yellow hue, which is indicative of Ag-NP production. The final concentration of Ag-NPs solution was 400 µg/ml.

Characterization of silver nanoparticles

Initially, ultraviolet visible spectroscopy (UV–Vis; TG 80; Germany) was used to measure the absorbance of Ag-NPs. The findings indicate that Ag-NPs have a robust absorption peak at 408 nm, but starch molecules do not exhibit any discernible band that could be linked to surface plasmon excitation. Transmission electron microscopy (TEM; JEOLJEM-1230; Japan) was used to examine the particle form and distribution of starch-mediated Ag-NPs. The resulting particles verified the high capacity of starch to reduce silver ions and stabilize the generated Ag-NPs, with a small spherical size of approximately 40 nm and a well-distributed size. After centrifuging the high throughput Ag-NPs solution for 60 min at 4480 × g, Ag-NPs was obtained as powder. An ambient Siemens D500 X-ray diffractometer (30 mA and 40 kV) with a copper tube was used to examine the elemental analysis of the powdered Ag-NPs using X-ray diffraction (XRD). Ag-NPs demonstrated a highly crystalline face-centered cubic architecture, as corroborated by the strong peaks seen in the XRD at 2θ = 37.88°, 44.27°, 64.43°, and 77.35°. The Ag-NPs (220), (200), (311), and (111) planes are the indexes for the diffraction peaks.

Determination of S. aureus susceptibility/resistance to Ag-NPs

After preparing 0.5 McFarland’s standard from S. aureus in Brain heart infusion broth (BHI), A Muller Hinton agar (MH) plate was swabbed with the bacteria suspension, and the plate was then incubated for 30 min. Different concentrations of Ag-NPs diluted in de-ionized water were added to wells in the agar with adequate spacing between wells, and then plates were incubated for 20 h at 37 °C. According to CLSI, the lowest concentration of Ag-NPs that kills 100% of the initial bacterial population (showing no colony on MH agar after 20 h of incubation at 37 °C) is known as the minimum bactericidal concentration (MBC). After detecting the minimum bactericidal concentration of Ag-NPs, the tested bacteria, separately, were inoculated onto brain heart infusion broth and then centrifuged to collect a higher number of pellets. The collected pellets were adjusted to be incubated with Ag-NPs colloidal solution concentration to match the minimum bactericidal concentration of Ag-NPs for 2.5, 10, and 25 min, respectively, to be examined by SEM for morphological changes determination67,68.

Bacterial growth inhibition test:69,70

One colony from the pan drug-resistant strain was inoculated in brain heart infusion broth (BHI) (Sigma Aldrich) and kept for 24–48 h in a shaking incubator (144 rpm). BHI broth was used to dilute the bacterial culture to adjust the count to 106 CFU/ ml. An equal volume of each concentration of nanoparticles diluted solution (400, 200, 100, 50, 25, 12.5, 6.25, 3.12 µg/ml) was added to the same volume of a bacterial strain to obtain a 5 × 105 CFU/ ml total volume. Following overnight incubation in a shaking incubator under the same conditions described above, 100 µl of each sample was streaked in a static incubator to track the bacterial growth curve. The experiment was carried out in triplicate.

Determination of the minimum inhibitory concentration (MIC)71

Double-fold serial dilution of silver nanoparticles was added to a culture holding 106 CFU/ ml and incubated as before. On Muller Hinton agar plates, 100 µl of each was then smeared. The smallest double-fold serial solution with little to no bacterial growth is the minimal inhibitory concentration (MIC).

Scanning electron microscope

All the electron microscopy investigation was carried out at the Faculty of Science, Alexandria University. The morphological measurement of nanoparticles was conducted using SEM (Vega Tescan, USA) that measures the size of nanoparticles72.

Ultrastructure observations

By using SEM (scanning electron microscope) at the Faculty of Science, Alexandria University, the particle size, shape of silver nanoparticles and the morphological changes in treated bacterial cells with nanoparticles were determined.

REP- PCR

Table 10 showed the primer pairs for REP-PCR amplification and conditions. After electrophoresis in a submerged agarose gel (1.5%), the size of the amplified fragments was recognized73. Computer software was used to analyze the data. The REP-PCR and the analysis of the data was carried out at the Animal Health Research Institute, Dokki, Giza, Egypt.Table 10 Target genes, primer sequences, amplicon sizes, and cycling conditions of REP-PCR.

Target gene	Primers sequences	Amplified segment (bp)	Primary denaturation	Amplification (35 cycles)	Final extension	Reference	
Staph REP	Secondary denaturation	Annealing	Extension	
REP2-I-ICGICTTATCIGGCCTAC	Variable	94˚C

5 min

	94˚C

1 min

	46 ˚C

1 min

	72˚C

2 min

	72˚C

12 min

	74	

Statistical analysis

Data were collected in a spreadsheet Excel, SPSS version 22 was used. Monte Carlo Sig. (2-sided) and Kendall's tau_b correlation were applied to predict the association between independent variables and outcomes, between qualitative variables. Logistic regression was applied to predict the risk factors (odds ratio) of independent variables and outcomes. Dendrogram Ward linkage was used to rescale distance cluster combine.

Author contributions

R.G. and E.M. wrote the main manuscript, prepared the figures and tables, and H.T. put the design and the plan of the work, all authors reviewed the manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

Data is provided within the manuscript.

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

All experiments were carried out in accordance with relevant guidelines and regulations. Informed consent was obtained from all subjects and/or their legal guardian(s). This study protocol was approved by the Ethics Committee at the Faculty of Medicine, Alexandria University, Egypt (5/2023/245).

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Singh, A., Sao, S., & Aswani, J. Isolation of Staphylococcus aureus from wound/swab and its antibiogram study ‏(2014).
2. Sakr A Brégeon F Mège JL Rolain JM Blin O Staphylococcus aureus nasal colonization: An update on mechanisms, epidemiology, risk factors, and subsequent infections Front. Microbiol. 2018 9 415974 10.3389/fmicb.2018.02419
Sakr, A., Brégeon, F., Mège, J. L., Rolain, J. M. & Blin, O. Staphylococcus aureus nasal colonization: An update on mechanisms, epidemiology, risk factors, and subsequent infections. Front. Microbiol. 9, 415974 (2018).
3. Thompson TA Brown PD Association between the agr locus and the presence of virulence genes and pathogenesis in Staphylococcus aureus using a Caenorhabditis elegans model Int. J. Infect. Dis. 2017 54 72 76 10.1016/j.ijid.2016.11.411 27915107
Thompson, T. A. & Brown, P. D. Association between the agr locus and the presence of virulence genes and pathogenesis in Staphylococcus aureus using a Caenorhabditis elegans model. Int. J. Infect. Dis. 54, 72–76 (2017).27915107
4. Tarekgne EK Skjerdal T Skeie S Rudi K Porcellato D Felix B Narvhus JA Enterotoxin gene profile and molecular characterization of Staphylococcus aureus isolates from bovine bulk milk and milk products of Tigray region, northern Ethiopia J. Food Prot. 2016 79 8 1387 1395 10.4315/0362-028X.JFP-16-003 27497126
Tarekgne, E. K. et al. Enterotoxin gene profile and molecular characterization of Staphylococcus aureus isolates from bovine bulk milk and milk products of Tigray region, northern Ethiopia. J. Food Prot. 79(8), 1387–1395 (2016).27497126
5. Tam K Torres VJ Staphylococcus aureus secreted toxins and extracellular enzymes Microbiol. Spectr. 2019 7 2 10 1128 10.1128/microbiolspec.GPP3-0039-2018
Tam, K. & Torres, V. J. Staphylococcus aureus secreted toxins and extracellular enzymes. Microbiol. Spectr. 7(2), 10–1128 (2019).
6. Santy-Tomlinson J Antimicrobial resistance stewardship: It’s up to us all Int. J. Orthopaed. Trauma Nurs. 2018 28 1 3 10.1016/j.ijotn.2017.11.004
Santy-Tomlinson, J. Antimicrobial resistance stewardship: It’s up to us all. Int. J. Orthopaed. Trauma Nurs. 28, 1–3 (2018).
7. World Health Organization Food and Agriculture Organization of the United; Nations World Organisation for Animal Health; Anthrax in Humans and Animals 2021 World Health Organization
World Health Organization. Food and Agriculture Organization of the United; Nations World Organisation for Animal Health; Anthrax in Humans and Animals (World Health Organization, 2021).
8. Holmes A Ganner M McGuane S Pitt TL Cookson BD Kearns AM Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: Frequency, characterization, and association with clinical disease J. Clin. Microbiol. 2005 43 5 2384 2390 10.1128/JCM.43.5.2384-2390.2005 15872271
Holmes, A. et al. Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: Frequency, characterization, and association with clinical disease. J. Clin. Microbiol. 43(5), 2384–2390 (2005).15872271
9. Enright MC The evolution of a resistant pathogen–the case of MRSA Curr. Opin. Pharmacol. 2003 3 5 474 479 10.1016/S1471-4892(03)00109-7 14559091
Enright, M. C. The evolution of a resistant pathogen–the case of MRSA. Curr. Opin. Pharmacol. 3(5), 474–479 (2003).14559091
10. Jiang Y Geng M Bai L Targeting biofilms therapy: Current research strategies and development hurdles Microorganisms 2020 8 8 1222 10.3390/microorganisms8081222 32796745
Jiang, Y., Geng, M. & Bai, L. Targeting biofilms therapy: Current research strategies and development hurdles. Microorganisms 8(8), 1222 (2020).32796745
11. Kim HK Falugi F Missiakas DM Schneewind O Peptidoglycan-linked protein A promotes T cell-dependent antibody expansion during Staphylococcus aureus infection Proc. Natl. Acad. Sci. 2016 113 20 5718 5723 10.1073/pnas.1524267113 27140614
Kim, H. K., Falugi, F., Missiakas, D. M. & Schneewind, O. Peptidoglycan-linked protein A promotes T cell-dependent antibody expansion during Staphylococcus aureus infection. Proc. Natl. Acad. Sci. 113(20), 5718–5723 (2016).27140614
12. Koo HJ Comparative genomic analysis reveals genetic features related to the virulence of Bacillus cereus FORC_013 Gut Pathogens 2017 9 1 8 10.1186/s13099-017-0175-z 28053669
Koo, H. J. et al. Comparative genomic analysis reveals genetic features related to the virulence of Bacillus cereus FORC_013. Gut Pathogens 9, 1–8 (2017).28053669
13. Durán N Durán M De Jesus MB Seabra AB Fávaro WJ Nakazato G Silver nanoparticles: A new view on mechanistic aspects on antimicrobial activity Nanomed. Nanotechnol. Biol. Med. 2016 12 3 789 799 10.1016/j.nano.2015.11.016
Durán, N. et al. Silver nanoparticles: A new view on mechanistic aspects on antimicrobial activity. Nanomed. Nanotechnol. Biol. Med. 12(3), 789–799 (2016).
14. Zhang Y Peng H Huang W Zhou Y Yan D Facile preparation and characterization of highly antimicrobial colloid Ag or Au nanoparticles J. Colloid Interface Sci. 2008 325 2 371 376 10.1016/j.jcis.2008.05.063 18572178
Zhang, Y., Peng, H., Huang, W., Zhou, Y. & Yan, D. Facile preparation and characterization of highly antimicrobial colloid Ag or Au nanoparticles. J. Colloid Interface Sci. 325(2), 371–376 (2008).18572178
15. Rudramurthy GR Swamy MK Sinniah UR Ghasemzadeh A Nanoparticles: Alternatives against drug-resistant pathogenic microbes Molecules 2016 21 7 836 10.3390/molecules21070836 27355939
Rudramurthy, G. R., Swamy, M. K., Sinniah, U. R. & Ghasemzadeh, A. Nanoparticles: Alternatives against drug-resistant pathogenic microbes. Molecules 21(7), 836 (2016).27355939
16. Salem SS Hashem AH Sallam AAM Doghish AS Al-Askar AA Arishi AA Shehabeldine AM Synthesis of silver nanocomposite based on carboxymethyl cellulose: Antibacterial, antifungal and anticancer activities Polymers 2022 14 16 3352 10.3390/polym14163352 36015608
Salem, S. S. et al. Synthesis of silver nanocomposite based on carboxymethyl cellulose: Antibacterial, antifungal and anticancer activities. Polymers 14(16), 3352 (2022).36015608
17. Van Der Zee A Molecular genotyping of Staphylococcus aureus strains: Comparison of repetitive element sequence-based PCR with various typing methods and isolation of a novel epidemicity marker J. Clin. Microbiol. 1999 37 2 342 349 10.1128/JCM.37.2.342-349.1999 9889215
Van Der Zee, A. et al. Molecular genotyping of Staphylococcus aureus strains: Comparison of repetitive element sequence-based PCR with various typing methods and isolation of a novel epidemicity marker. J. Clin. Microbiol. 37(2), 342–349 (1999).9889215
18. Del Vecchio VG Petroziello JM Gress MJ Mccleskey FK Melcher GP Crouch HK Lupski JR Molecular genotyping of methicillin-resistant Staphylococcus aureus via fluorophore-enhanced repetitive-sequence PCR J. Clin. Microbiol. 1995 33 8 2141 2144 10.1128/jcm.33.8.2141-2144.1995 7559964
Del Vecchio, V. G. et al. Molecular genotyping of methicillin-resistant Staphylococcus aureus via fluorophore-enhanced repetitive-sequence PCR. J. Clin. Microbiol. 33(8), 2141–2144 (1995).7559964
19. Manga I Vyletelova M Rep-PCR-based typing as a tool for tracking of MRSA infection origin Acta Univ. Agric. Silvicult. Mendel. Brun. 2012 40 251 256
Manga, I. & Vyletelova, M. Rep-PCR-based typing as a tool for tracking of MRSA infection origin. Acta Univ. Agric. Silvicult. Mendel. Brun. 40, 251–256 (2012).
20. Ferguson NM Report 9: Impact of Non-Pharmaceutical Interventions (NPIs) to Reduce COVID19 Mortality and Healthcare Demand 2020 Imperial College London
Ferguson, N. M. et al. Report 9: Impact of Non-Pharmaceutical Interventions (NPIs) to Reduce COVID19 Mortality and Healthcare Demand Vol. 16 (Imperial College London, 2020).
21. McMillan K Moore SC McAuley CM Fegan N Fox EM Characterization of Staphylococcus aureus isolates from raw milk sources in Victoria, Australia BMC Microbiol. 2016 16 1 12 10.1186/s12866-016-0789-1 26728027
McMillan, K., Moore, S. C., McAuley, C. M., Fegan, N. & Fox, E. M. Characterization of Staphylococcus aureus isolates from raw milk sources in Victoria, Australia. BMC Microbiol. 16, 1–12 (2016).26728027
22. Langley, R., Wines, B., Willoughby, N., Basu, I., Proft, T., & Fraser, J. D. The staphylococcal superantigen-like protein 7 binds IgA and complement C5 and inhibits IgA-FcαRI binding and serum killing
23. Chung, M. C., Wines, B. D., Baker, H., Langley, R., Baker, E., & Fraser, J. The crystal structure of staphylococcal superantigen-like protein 11 (SSL11) in complex with sialyl Lewis X reveals the mechanism for cell binding and immune inhibition ‏(2007).
24. Contreras A Sierra D Sánchez A Corrales JC Marco JC Paape MJ Gonzalo C Mastitis in small ruminants Small Ruminant Res. 2007 68 1–2 145 153 10.1016/j.smallrumres.2006.09.011
Contreras, A. et al. Mastitis in small ruminants. Small Ruminant Res. 68(1–2), 145–153 (2007).
25. Pignataro D Methicillin-resistant Staphylococcus aureus: Epidemiology and antimicrobial susceptibility experiences from the University Hospital ‘Luigi Vanvitelli’of Naples Pathogens Glob. Health 2020 114 8 451 456 10.1080/20477724.2020.1827197
Pignataro, D. et al. Methicillin-resistant Staphylococcus aureus: Epidemiology and antimicrobial susceptibility experiences from the University Hospital ‘Luigi Vanvitelli’of Naples. Pathogens Glob. Health 114(8), 451–456 (2020).
26. Frana TS Isolation and characterization of methicillin-resistant Staphylococcus aureus from pork farms and visiting veterinary students PLoS One 2013 8 1 e53738 10.1371/journal.pone.0053738 23301102
Frana, T. S. et al. Isolation and characterization of methicillin-resistant Staphylococcus aureus from pork farms and visiting veterinary students. PLoS One 8(1), e53738 (2013).23301102
27. Cassini A Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis Lancet Infect. Dis. 2019 19 1 56 66 10.1016/S1473-3099(18)30605-4 30409683
Cassini, A. et al. Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis. Lancet Infect. Dis. 19(1), 56–66 (2019).30409683
28. Silva V Capelo JL Igrejas G Poeta P Molecular epidemiology of Staphylococcus aureus lineages in wild animals in Europe: A review Antibiotics 2020 9 3 122 10.3390/antibiotics9030122 32183272
Silva, V., Capelo, J. L., Igrejas, G. & Poeta, P. Molecular epidemiology of Staphylococcus aureus lineages in wild animals in Europe: A review. Antibiotics 9(3), 122 (2020).32183272
29. Sundararaj N Kalagatur NK Mudili V Krishna K Antonysamy M Isolation and identification of enterotoxigenic Staphylococcus aureus isolates from Indian food samples: Evaluation of in-house developed aptamer linked sandwich ELISA (ALISA) method J. Food Sci. Technol. 2019 56 1016 1026 10.1007/s13197-019-03568-1 30906059
Sundararaj, N., Kalagatur, N. K., Mudili, V., Krishna, K. & Antonysamy, M. Isolation and identification of enterotoxigenic Staphylococcus aureus isolates from Indian food samples: Evaluation of in-house developed aptamer linked sandwich ELISA (ALISA) method. J. Food Sci. Technol. 56, 1016–1026 (2019).30906059
30. Magiorakos AP Srinivasan A Carey RB Carmeli Y Falagas ME Giske CG Monnet DL Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance Clin. Microbiol. Infect. 2012 18 3 268 281 10.1111/j.1469-0691.2011.03570.x 21793988
Magiorakos, A. P. et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18(3), 268–281 (2012).21793988
31. Shankar N Soe PM Tam CC Prevalence and risk of acquisition of methicillin-resistant Staphylococcus aureus among households: A systematic review Int. J. Infect. Dis. 2020 92 105 113 10.1016/j.ijid.2020.01.008 31945492
Shankar, N., Soe, P. M. & Tam, C. C. Prevalence and risk of acquisition of methicillin-resistant Staphylococcus aureus among households: A systematic review. Int. J. Infect. Dis. 92, 105–113 (2020).31945492
32. Neopane P Nepal HP Shrestha R Uehara O Abiko Y In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance Int. J. Gen. Med. 2018 11 25 32 10.2147/IJGM.S153268 29403304
Neopane, P., Nepal, H. P., Shrestha, R., Uehara, O. & Abiko, Y. In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance. Int. J. Gen. Med. 11, 25–32 (2018).29403304
33. Mahmoud SA El-Shatoury EH Tolba S Abdallah NA Detection of mecA and class1 integron in Staphylococcus aureus isolated from Egyptian hospitals Afr. J. Biol. Sci. 2021 17 1 251 259
Mahmoud, S. A., El-Shatoury, E. H., Tolba, S. & Abdallah, N. A. Detection of mecA and class1 integron in Staphylococcus aureus isolated from Egyptian hospitals. Afr. J. Biol. Sci. 17(1), 251–259 (2021).
34. Holmes MA Zadoks RN Methicillin resistant S. aureus in human and bovine mastitis J. Mammary Gland Biol. Neoplas. 2011 16 373 382 10.1007/s10911-011-9237-x
Holmes, M. A. & Zadoks, R. N. Methicillin resistant S. aureus in human and bovine mastitis. J. Mammary Gland Biol. Neoplas. 16, 373–382 (2011).
35. Collins SM Surette M Bercik P The interplay between the intestinal microbiota and the brain Nat. Rev. Microbiol. 2012 10 11 735 742 10.1038/nrmicro2876 23000955
Collins, S. M., Surette, M. & Bercik, P. The interplay between the intestinal microbiota and the brain. Nat. Rev. Microbiol. 10(11), 735–742 (2012).23000955
36. Yang Y Alvarez PJ Sublethal concentrations of silver nanoparticles stimulate biofilm development Environ. Sci. Technol. Lett. 2015 2 8 221 226 10.1021/acs.estlett.5b00159
Yang, Y. & Alvarez, P. J. Sublethal concentrations of silver nanoparticles stimulate biofilm development. Environ. Sci. Technol. Lett. 2(8), 221–226 (2015).
37. Teffo LA Tabit FT An assessment of the food safety knowledge and attitudes of food handlers in hospitals BMC Public Health 2020 20 1 12 10.1186/s12889-020-8430-5 31898494
Teffo, L. A. & Tabit, F. T. An assessment of the food safety knowledge and attitudes of food handlers in hospitals. BMC Public Health 20, 1–12 (2020).31898494
38. Menanteau-Ledouble S Krauss I Santos G Fibi S Weber B El-Matbouli M Effect of a phytogenic feed additive on the susceptibility of Onchorhynchus mykiss to Aeromonas salmonicida Dis. Aquat. Org. 2015 115 1 57 66 10.3354/dao02875
Menanteau-Ledouble, S. et al. Effect of a phytogenic feed additive on the susceptibility of Onchorhynchus mykiss to Aeromonas salmonicida. Dis. Aquat. Org. 115(1), 57–66 (2015).
39. Schnall J Rajkhowa A Ikuta K Rao P Moore CE Surveillance and monitoring of antimicrobial resistance: Limitations and lessons from the GRAM project BMC Med. 2019 17 1 1 3 10.1186/s12916-019-1412-8 30651111
Schnall, J., Rajkhowa, A., Ikuta, K., Rao, P. & Moore, C. E. Surveillance and monitoring of antimicrobial resistance: Limitations and lessons from the GRAM project. BMC Med. 17(1), 1–3 (2019).30651111
40. Vernet G Mary C Altmann DM Doumbo O Morpeth S Bhutta ZA Klugman KP Surveillance for antimicrobial drug resistance in under-resourced countries Emerg. Infect. Dis. 2014 20 3 434 10.3201/EID2003.121157 24564906
Vernet, G. et al. Surveillance for antimicrobial drug resistance in under-resourced countries. Emerg. Infect. Dis. 20(3), 434 (2014).24564906
41. Shaalan M Saleh M El-Mahdy M El-Matbouli M Recent progress in applications of nanoparticles in fish medicine: A review Nanomed. Nanotechnol. Biol. Med. 2016 12 3 701 710 10.1016/j.nano.2015.11.005
Shaalan, M., Saleh, M., El-Mahdy, M. & El-Matbouli, M. Recent progress in applications of nanoparticles in fish medicine: A review. Nanomed. Nanotechnol. Biol. Med. 12(3), 701–710 (2016).
42. Armanullah MD Dr A Kumar P Kumari S Kaushik P Archana S Arya S Prevalence of multi-drug resistant (MDR) Escherichia coli in bovine clinical samples Int. J. Curr. Microbiol. App. Sci 2018 7 1476 1485
Armanullah, M. D. et al. Prevalence of multi-drug resistant (MDR) Escherichia coli in bovine clinical samples. Int. J. Curr. Microbiol. App. Sci 7, 1476–1485 (2018).
43. Li WR Xie XB Shi QS Duan SS Ouyang YS Chen YB Antibacterial effect of silver nanoparticles on Staphylococcus aureus Biometals 2011 24 135 141 10.1007/s10534-010-9381-6 20938718
Li, W. R. et al. Antibacterial effect of silver nanoparticles on Staphylococcus aureus. Biometals 24, 135–141 (2011).20938718
44. Kourmouli A Valenti M van Rijn E Beaumont HJ Kalantzi OI Schmidt-Ott A Biskos G Can disc diffusion susceptibility tests assess the antimicrobial activity of engineered nanoparticles? J. Nanoparticle Res. 2018 20 1 6 10.1007/s11051-018-4152-3
Kourmouli, A. et al. Can disc diffusion susceptibility tests assess the antimicrobial activity of engineered nanoparticles?. J. Nanoparticle Res. 20, 1–6 (2018).
45. Abdelrehiem DAM Abd El-Aziz M Hanna M Ahmed M Husien M Feng Q Comparative synthesis and antimicrobial action of silver nanoparticles and silver nitrate J. Nanoparticle Res. 2015 10.1007/s11051-015-3279-8
Abdelrehiem, D. A. M. et al. Comparative synthesis and antimicrobial action of silver nanoparticles and silver nitrate. J. Nanoparticle Res.10.1007/s11051-015-3279-8 (2015).
46. Qing YA Cheng L Li R Liu G Zhang Y Tang X Qin Y Potential antibacterial mechanism of silver nanoparticles and the optimization of orthopedic implants by advanced modification technologies Int. J. Nanomed. 2018 13 3311 3327 10.2147/IJN.S165125
Qing, Y. A. et al. Potential antibacterial mechanism of silver nanoparticles and the optimization of orthopedic implants by advanced modification technologies. Int. J. Nanomed. 13, 3311–3327 (2018).
47. AbuDalo MA Al-Mheidat IR Al-Shurafat AW Grinham C Oyanedel-Craver V Synthesis of silver nanoparticles using a modified Tollens’ method in conjunction with phytochemicals and assessment of their antimicrobial activity PeerJ 2019 7 e6413 10.7717/peerj.6413 30775181
AbuDalo, M. A., Al-Mheidat, I. R., Al-Shurafat, A. W., Grinham, C. & Oyanedel-Craver, V. Synthesis of silver nanoparticles using a modified Tollens’ method in conjunction with phytochemicals and assessment of their antimicrobial activity. PeerJ 7, e6413 (2019).30775181
48. Vazquez-Muñoz R Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane PLoS One 2019 14 11 e0224904 10.1371/journal.pone.0224904 31703098
Vazquez-Muñoz, R. et al. Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane. PLoS One 14(11), e0224904 (2019).31703098
49. Chen X Schluesener HJ Nanosilver: A nanoproduct in medical application Toxicol. Lett. 2008 176 1 1 12 10.1016/j.toxlet.2007.10.004 18022772
Chen, X. & Schluesener, H. J. Nanosilver: A nanoproduct in medical application. Toxicol. Lett. 176(1), 1–12 (2008).18022772
50. El-Gedawy AA Abd-elghafar AE Abd El-Dayem GA Role of methicillin Resistant Staphylococcus aureus in rabbits infections Egypt. J. Anim. Health 2021 1 4 25 34 10.21608/ejah.2021.205191
El-Gedawy, A. A. et al. Role of methicillin Resistant Staphylococcus aureus in rabbits infections. Egypt. J. Anim. Health 1(4), 25–34 (2021).
51. Shepheard MA Fleming VM Connor TR Corander J Feil EJ Fraser C Hanage WP Historical zoonoses and other changes in host tropism of Staphylococcus aureus, identified by phylogenetic analysis of a population dataset PLoS One 2013 8 5 e62369 10.1371/journal.pone.0062369 23667472
Shepheard, M. A. et al. Historical zoonoses and other changes in host tropism of Staphylococcus aureus, identified by phylogenetic analysis of a population dataset. PLoS One 8(5), e62369 (2013).23667472
52. Abdelrahman, A. M. Molecular investigation of some virulence genes and antibiotic resistance of s. aureus of animal origin. PhD thesis in Microbiology, Fac. Vet. Med., Alex. Univ. Egypt (2021).
53. Abo-Shama UH Prevalence and antimicrobial susceptibility of Staphylococcus aureus isolated from cattle, buffalo, sheep and goat’s raw milk in Sohag Governorate, Egypt Assiut Vet. Med. J. 2014 60 141 63 72 10.21608/avmj.2014.170753
Abo-Shama, U. H. Prevalence and antimicrobial susceptibility of Staphylococcus aureus isolated from cattle, buffalo, sheep and goat’s raw milk in Sohag Governorate, Egypt. Assiut Vet. Med. J. 60(141), 63–72. 10.21608/avmj.2014.170753 (2014).
54. Fleiss JL Statistical Methods for Rates and Proportions 1981 Wiley
Fleiss, J. L. Statistical Methods for Rates and Proportions (Wiley, 1981).
55. Kelsey JL Whittemore AS Evans AS Thompson WD Methods in Observational Epidemiology 1996 Oxford University Press
Kelsey, J. L., Whittemore, A. S., Evans, A. S. & Thompson, W. D. Methods in Observational Epidemiology (Oxford University Press, 1996).
56. Artursson K Nilsson-Öst M Waller KP An improved method to culture Staphylococcus aureus from bovine milk J. Dairy Sci. 2010 93 4 1534 1538 10.3168/jds.2009-2544 20338430
Artursson, K., Nilsson-Öst, M. & Waller, K. P. An improved method to culture Staphylococcus aureus from bovine milk. J. Dairy Sci. 93(4), 1534–1538 (2010).20338430
57. Wang X Characterization of Staphylococcus aureus isolated from powdered infant formula milk and infant rice cereal in China Int. J. Food Microbiol. 2012 153 1–2 142 147 10.1016/j.ijfoodmicro.2011.10.030 22119265
Wang, X. et al. Characterization of Staphylococcus aureus isolated from powdered infant formula milk and infant rice cereal in China. Int. J. Food Microbiol. 153(1–2), 142–147 (2012).22119265
58. Quinn PJ Clinical Veterinary Microbiology 1994 Wolfe Publishing
Quinn, P. J. Clinical Veterinary Microbiology (Wolfe Publishing, 1994).
59. Sallam KI Abd-Elghany SM Elhadidy M Tamura T Molecular characterization and antimicrobial resistance profile of methicillin-resistant Staphylococcus aureus in retail chicken J. Food Prot. 2015 78 10 1879 1884 10.4315/0362-028X.JFP-15-150 26408138
Sallam, K. I., Abd-Elghany, S. M., Elhadidy, M. & Tamura, T. Molecular characterization and antimicrobial resistance profile of methicillin-resistant Staphylococcus aureus in retail chicken. J. Food Prot. 78(10), 1879–1884 (2015).26408138
60. Mehrotra M Wang G Johnson WM Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance J. Clin. Microbiol. 2000 38 3 1032 1035 10.1128/JCM.38.3.1032-1035.2000 10698991
Mehrotra, M., Wang, G. & Johnson, W. M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J. Clin. Microbiol. 38(3), 1032–1035 (2000).10698991
61. White PA McIver CJ Deng YM Rawlinson WD Characterisation of two new gene cassettes, aadA5 and dfrA17 FEMS Microbiol. Lett. 2000 182 2 265 269 10.1111/j.1574-6968.2000.tb08906.x 10620677
White, P. A., McIver, C. J., Deng, Y. M. & Rawlinson, W. D. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182(2), 265–269 (2000).10620677
62. Sow AG Wane AA Diallo MH Boye CSB Aïdara-Kane A Genotypic characterization of antibiotic-resistant Salmonella enteritidis isolates in Dakar, Senegal J. Infect. Dev. Ctries. 2007 1 03 284 288 10.3855/jidc.365 19734606
Sow, A. G., Wane, A. A., Diallo, M. H., Boye, C. S. B. & Aïdara-Kane, A. Genotypic characterization of antibiotic-resistant Salmonella enteritidis isolates in Dakar, Senegal. J. Infect. Dev. Ctries. 1(03), 284–288 (2007).19734606
63. Bauer A Antibiotic susceptibility testing by a standardized single diffusion method Am. J. Clin. Pathol. 1966 45 493 496 10.1093/ajcp/45.4_ts.493 5325707
Bauer, A. Antibiotic susceptibility testing by a standardized single diffusion method. Am. J. Clin. Pathol. 45, 493–496 (1966).5325707
64. Christensen GD Simpson WA Younger JJ Baddour LM Barrett FF Melton DM Beachey EH Adherence of coagulase-negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices J. Clin. Microbiol. 1985 22 6 996 1006 10.1128/jcm.22.6.996-1006.1985 3905855
Christensen, G. D. et al. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices. J. Clin. Microbiol. 22(6), 996–1006 (1985).3905855
65. Mansour WA Abdelsalam NR Tanekhy M Khaled AA Mansour AT Toxicity, inflammatory and antioxidant genes expression, and physiological changes of green synthesis silver nanoparticles on Nile tilapia (Oreochromis niloticus) fingerlings Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021 247 109068 10.1016/j.cbpc.2021.109068 33915277
Mansour, W. A., Abdelsalam, N. R., Tanekhy, M., Khaled, A. A. & Mansour, A. T. Toxicity, inflammatory and antioxidant genes expression, and physiological changes of green synthesis silver nanoparticles on Nile tilapia (Oreochromis niloticus) fingerlings. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 247, 109068 (2021).33915277
66. Abdelsalam NR Fouda MM Abdel-Megeed A Ajarem J Allam AA El- Naggar ME Assessment of silver nanoparticles decorated starch and commercial zinc nanoparticles with respect to their genotoxicity on onion Int. J. Biol. Macromol. 2019 133 1008 1018 10.1016/j.ijbiomac.2019.04.134 31004635
Abdelsalam, N. R. et al. Assessment of silver nanoparticles decorated starch and commercial zinc nanoparticles with respect to their genotoxicity on onion. Int. J. Biol. Macromol. 133, 1008–1018 (2019).31004635
67. Saravanan M Vemu AK Barik SK Rapid biosynthesis of silver nanoparticles from Bacillus megaterium (NCIM 2326) and their antibacterial activity on multi drug resistant clinical pathogens Colloids Surf. B Biointerfaces 2011 88 1 325 331 10.1016/j.colsurfb.2011.07.009 21798729
Saravanan, M., Vemu, A. K. & Barik, S. K. Rapid biosynthesis of silver nanoparticles from Bacillus megaterium (NCIM 2326) and their antibacterial activity on multi drug resistant clinical pathogens. Colloids Surf. B Biointerfaces 88(1), 325–331 (2011).21798729
68. Omara ST Zawrah MF Samy AA Minimum bactericidal concentration of chemically synthesized silver nanoparticles against pathogenic Salmonella and Shigella strains isolated from layer poultry farms J. Appl. Pharm. Sci. 2017 7 8 214 221
Omara, S. T., Zawrah, M. F. & Samy, A. A. Minimum bactericidal concentration of chemically synthesized silver nanoparticles against pathogenic Salmonella and Shigella strains isolated from layer poultry farms. J. Appl. Pharm. Sci. 7(8), 214–221 (2017).
69. Bresee J Nanoscale structure–activity relationships, mode of action, and biocompatibility of gold nanoparticle antibiotics J. Am. Chem. Soc. 2014 136 14 5295 5300 10.1021/ja408505n 24624950
Bresee, J. et al. Nanoscale structure–activity relationships, mode of action, and biocompatibility of gold nanoparticle antibiotics. J. Am. Chem. Soc. 136(14), 5295–5300 (2014).24624950
70. Ravikumar S Gokulakrishnan R Boomi P In vitro antibacterial activity of the metal oxide nanoparticles against urinary tract infectious bacterial pathogens Asian Pac. J. Trop. Dis. 2012 2 2 85 89 10.1016/S2222-1808(12)60022-X
Ravikumar, S., Gokulakrishnan, R. & Boomi, P. In vitro antibacterial activity of the metal oxide nanoparticles against urinary tract infectious bacterial pathogens. Asian Pac. J. Trop. Dis. 2(2), 85–89 (2012).
71. Swain P Antimicrobial activity of metal based nanoparticles against microbes associated with diseases in aquaculture World J. Microbiol. Biotechnol. 2014 30 2491 2502 10.1007/s11274-014-1674-4 24888333
Swain, P. et al. Antimicrobial activity of metal based nanoparticles against microbes associated with diseases in aquaculture. World J. Microbiol. Biotechnol. 30, 2491–2502 (2014).24888333
72. Chopra H Green metallic nanoparticles: Biosynthesis to applications Front. Bioeng. Biotechnol. 2022 10 874742 10.3389/fbioe.2022.874742 35464722
Chopra, H. et al. Green metallic nanoparticles: Biosynthesis to applications. Front. Bioeng. Biotechnol. 10, 874742 (2022).35464722
73. Sambrook J Fritsch EF Maniatis T Molecular Cloning: A Laboratory Manual 1989 Cold Spring Harbor Laboratory Press
Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning: A Laboratory Manual Vol. 3 (Cold Spring Harbor Laboratory Press, 1989).
74. Idil N Aksöz N Comparision of two pcr-based methods in typing of clinical staphylococcal strains Hacettepe J. Biol. Chem. 2013 41 1 43 50
Idil, N. & Aksöz, N. Comparision of two pcr-based methods in typing of clinical staphylococcal strains. Hacettepe J. Biol. Chem. 41(1), 43–50 (2013).
