
==== Front
PLoS Pathog
PLoS Pathog
plos
PLOS Pathogens
1553-7366
1553-7374
Public Library of Science San Francisco, CA USA

39259722
10.1371/journal.ppat.1012534
PPATHOGENS-D-23-02098
Research Article
Biology and Life Sciences
Organisms
Bacteria
Legionella
Legionella Pneumophila
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Bacterial Pathogens
Legionella
Legionella Pneumophila
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Bacterial Pathogens
Legionella
Legionella Pneumophila
Biology and Life Sciences
Physiology
Immune Physiology
Cytokines
Biology and Life Sciences
Immunology
Immune System
Innate Immune System
Cytokines
Medicine and Health Sciences
Immunology
Immune System
Innate Immune System
Cytokines
Biology and Life Sciences
Developmental Biology
Molecular Development
Cytokines
Research and Analysis Methods
Electrophoretic Techniques
Gel Electrophoresis
Electrophoretic Staining
Silver Staining
Research and Analysis Methods
Specimen Preparation and Treatment
Staining
Electrophoretic Staining
Silver Staining
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Blood Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Immune Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Medicine and Health Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Organisms
Bacteria
Legionella
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Bacterial Pathogens
Legionella
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Bacterial Pathogens
Legionella
Biology and life sciences
Molecular biology
Molecular biology techniques
DNA construction
Plasmid Construction
Research and analysis methods
Molecular biology techniques
DNA construction
Plasmid Construction
Biology and Life Sciences
Genetics
Mutation
Mutant Strains
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Virulence Factors
The unique Legionella longbeachae capsule favors intracellular replication and immune evasion
Legionella longbeachae encodes a unique capsule
Schmidt Silke Formal analysis Investigation Validation Writing – original draft 1 2
Mondino Sonia Formal analysis Investigation Supervision Writing – review & editing 1 ¤
Gomez-Valero Laura Formal analysis Investigation 1
Escoll Pedro Formal analysis Investigation 1
Mascarenhas Danielle P. A. Formal analysis Investigation 3
Gonçalves Augusto Formal analysis Investigation 3
Camara Pedro H. M. Formal analysis Investigation 3
Garcia Rodriguez Francisco J. Resources 1
Rusniok Christophe Formal analysis Investigation 1
Sachse Martin Formal analysis Investigation 4
Moya-Nilges Maryse Formal analysis Investigation 4
Fontaine Thierry Formal analysis Investigation Methodology Supervision 5
Zamboni Dario S. Data curation Formal analysis Funding acquisition Supervision Validation 3
https://orcid.org/0000-0003-3477-9190
Buchrieser Carmen Conceptualization Funding acquisition Project administration Supervision Validation Writing – review & editing 1 *
1 Institut Pasteur, Université Paris Cité, Biologie des Bactéries Intracellulaires, CNRS UMR 6047, Paris, France
2 Sorbonne Université, Collège Doctoral, Paris, France
3 Department of Cell Biology, Medical School of Ribeirão Preto, FMRP/USP, Ribeirão Preto, Brazil
4 UTechS UBI, Centre de Ressources et Recherches Technologiques, Institut Pasteur, Paris, France
5 Biologie et Pathogénicité fongiques, Institut Pasteur, Paris, France
Kubori Tomoko Editor
Gifu University, JAPAN
The authors have declared that no competing interests exist.

¤ Current address: Laboratory of Molecular and Structural Microbiology, Institut Pasteur de Montevideo, Montevideo, Uruguay

* E-mail: cbuch@pasteur.fr
11 9 2024
9 2024
20 9 e101253428 11 2023
26 8 2024
© 2024 Schmidt et al
2024
Schmidt et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Legionella longbeachae and Legionella pneumophila are the most common causative agents of Legionnaires’ disease. While the clinical manifestations caused by both species are similar, species-specific differences exist in environmental niches, disease epidemiology, and genomic content. One such difference is the presence of a genomic locus predicted to encode a capsule. Here, we show that L. longbeachae indeed expresses a capsule in post-exponential growth phase as evidenced by electron microscopy analyses, and that capsule expression is abrogated when deleting a capsule transporter gene. Capsule purification and its analysis via HLPC revealed the presence of a highly anionic polysaccharide that is absent in the capsule mutant. The capsule is important for replication and virulence in vivo in a mouse model of infection and in the natural host Acanthamoeba castellanii. It has anti-phagocytic function when encountering innate immune cells such as human macrophages and it is involved in the low cytokine responses in mice and in human monocyte derived macrophages, thus dampening the innate immune response. Thus, the here characterized L. longbeachae capsule is a novel virulence factor, unique among the known Legionella species, which may aid L. longbeachae to survive in its specific niches and which partly confers L. longbeachae its unique infection characteristics.

Author summary

Legionella longbeachae can cause a severe pneumonia, known as Legionnaires’ disease. In Australia and New Zealand, L. longbeachae is the predominant species causing up to 50% of all infections due to Legionella. However, L. longbeachae virulence factors are nearly unknown. Here, we show that L. longbeachae expresses a capsule that is a major virulence factor of this pathogen as it is important for virulence in vivo in mice and in the environment in its natural host Acanthamoeba castellanii. It dampens the innate immune response in mice and human cells. Our study sheds light on an understudied environmental pathogen and identifies a new virulence feature of Legionellae.

http://dx.doi.org/10.13039/501100001665 Agence Nationale de la Recherche ANR-10-LABX-62-IBEID https://orcid.org/0000-0003-3477-9190
Buchrieser Carmen http://dx.doi.org/10.13039/501100001665 Agence Nationale de la Recherche ANR-15-CE17-0014-03 https://orcid.org/0000-0003-3477-9190
Buchrieser Carmen Fondation pour la Recherche Médicale EQU201903007847 https://orcid.org/0000-0003-3477-9190
Buchrieser Carmen http://dx.doi.org/10.13039/501100002915 Fondation pour la Recherche Médicale FDT202204015116 Schmidt Silke http://dx.doi.org/10.13039/501100003762 Institut Pasteur DIM1 Health Région Île-de-France DIM1 Health FAPESP 2019/11342-6 Zamboni Dario S. This work is supported by the French Government (grants ANR-10-LABX-62-IBEID to C.B.) and the “Fondation pour la Recherche Médicale” (grant EQU201903007847 to C.B.). S.S. is a scholar in the Pasteur-Paris University (PPU) International Ph.D. program and received stipends from the Institut Pasteur and the “Fondation pour la Recherche Médicale” (FDT202204015116). We gratefully acknowledge the kind financial support of the Institut Pasteur (Paris) and the Région Ile-de-France (program DIM1Health to UTechs PBI). Work in the D.S.Z. laboratory is financed by The São Paulo Research Foundation (FAPESP grant 2019/11342-6). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. PLOS Publication Stagevor-update-to-uncorrected-proof
Publication Update2024-09-23
Data AvailabilityAll relevant data are within the paper, are submitted to public databases and are its Supporting information files.
Data Availability

All relevant data are within the paper, are submitted to public databases and are its Supporting information files.
==== Body
pmcIntroduction

Legionella longbeachae is a rod-shaped Gram-negative bacterium that can cause Legionnaires’ disease, a severe form of pneumonia. Like other Legionella species, L. longbeachae is a facultative intracellular bacterium that causes the disease by inhalation of contaminated aerosols [1]. Legionella spp. are typically found in aquatic environments, either as free-living bacteria or in biofilm communities [2,3]. Legionella longbeachae, however, is predominantly isolated from potting soils and infections have been associated with gardening activities. Thus, gardening can constitute a risk factor for infection with L. longbeachae [4,5]. The clinical symptoms of Legionnaires’ disease caused by L. longbeachae are similar to those caused by L. pneumophila, the most common causative agent of Legionnaires’ disease [6]. Like L. pneumophila, L. longbeachae critically depends on a highly conserved type IVB Dot/Icm secretion system (T4SS) to establish an intracellular infection and to build a replication niche, the so-called Legionella-containing vacuole (LCV) [7–10]. Analyses of the genomic content of the Legionella genus genome showed that it is highly diverse with an astounding 18,000 predicted T4SS effector proteins [11]. For L. longbeachae, about 220 effectors were predicted, but only about 34% are shared with the L. pneumophila effector repertoire [12,13]. Furthermore, in-depth analyses of the L. longbeachae genome revealed unique sets of genes and extensive genomic recombination events that reflect both an adaptation to its soil environment as well as dynamic genetic exchange with other microorganisms [13–15].

Interestingly, common laboratory mouse strains are resistant to L. pneumophila replication, except A/J mice which allow replication of L. pneumophila due to Naip5 mutations. In contrast, L. longbeachae effectively replicates in the lungs, disseminates, and causes death in mouse strains such as A/J, BALBc, and C57BL/6 mice [16,17]. It was hypothesized that this is due to the lack of flagella in L. longbeachae, as the detection of flagella expressed by L. pneumophila leads to a rapid activation of the NLRC4 inflammasome and clearing of the infection in BALBc or C57BL/6 mice [18–20]. However, a flagellum-deficient L. pneumophila strain Paris is not lethal for C57BL/6 mice, and it induces a robust pro-inflammatory cytokine response in vitro [19,21]. In contrast, mice infected with wild type (WT) L. longbeachae die within 6 days after infection [21]. L. longbeachae spreads from the primary site of infection (the lungs) to the blood and spleens of the animals. In contrast to L. pneumophila, L. longbeachae only induces a low pro-inflammatory cytokine response in vitro [21]. A unique feature identified in the L. longbeachae genome is the presence of a gene cluster of 48 kb predicted to code for a capsule [13]. It comprises 33 genes that are annotated as glycosyltransferases, enzymes for the synthesis of nucleotide sugar precursors, and an ABC transporter, likely for the export of the capsule. The transporter was found to be homologous to the capsule transporter of Neisseria meningitidis [13]. We thus hypothesized that the capsule encoded in the L. longbeachae genome may be responsible for the enhanced virulence of L. longbeachae in mice as compared to L. pneumophila [21].

Many bacterial pathogens such as Klebsiella pneumoniae [22,23], Streptococcus pneumoniae [24,25], N. meningitidis [26–28], or Acinetobacter baumannii [29,30] encode capsules in their genomes and the roles of these capsules in infection have been studied extensively. Capsules can protect bacteria from adverse environmental conditions, or antimicrobial agents such as antibiotics or antimicrobial peptides [31–35]. Likewise, in pathogenic bacteria, capsules can mimic surface polysaccharides of mammalian cells, thus avoiding recognition by the host immune system [36]. For example, the capsule of E. coli K1 contains polysialic acids that are anti-phagocytic and protect the bacteria from complement-mediated killing [37,38].

In this study, we visualized and characterized the L. longbeachae capsule and analyzed its functional role in infection. Comparing a knockout mutant in the capsule transporter and a WT strain, we reveal that the capsule plays a key role during infection in mammalian and protozoan hosts. Furthermore, we provide evidence that the capsule is responsible for the low cytokine response in infected macrophages and mice. Thus, we demonstrate that the capsule is a novel virulence feature of L. longbeachae, which is unique among the known Legionella species.

Results

The L. longbeachae capsule cluster is unique among Legionella species

We first analyzed the presence of the putative capsule cluster and orthologous genes among 58 different Legionella species (Fig 1). This analysis shows that L. longbeachae is the only Legionella species to encode the entire 48 kb capsule cluster. Two other species, L. massiliensis and L. gormanii, carry genes similar to the ABC-type transporter genes ctrBCD and bexD. However, these two species lack most of the glycosyltransferases encoded by L. longbeachae. We did not find similar genes in the genomes of L. pneumophila, except for an orthologous gene of llo3163, a hydroxyacid dehydrogenase similar to serA, indicating that the capsule cluster is specific for L. longbeachae (S1 Table).

10.1371/journal.ppat.1012534.g001 Fig 1 Presence or absence of orthologous genes coding for the capsule in 80 Legionella species/strains.

Colored squares represent orthologous genes. Orthologous gene reconstruction was done with PanOCT: amino acid percentage identity cutoff was 30%, BLAST e-value cutoff 10−5, and minimum percentage match length of subject and query was 65%. For reference, the L. longbeachae NSW150 capsule cluster genes and gene names are shown on the top of the Fig. Color code: blue, pathway genes for nucleotide sugar precursor synthesis; yellow, putative transportation genes; green, putative glycosyltransferases; grey, genes of unknown function.

To deepen these analyses, we selected twelve publicly available L. longbeachae strains, comprising nine strains from serogroups 1 (sg1) and three strains from 2 (sg2). All of them contain a similar capsule cluster whose genomic organization and genomic location are conserved (S1 Fig). Only a small region in the central part of the capsule cluster shows few differences among the glycosyltransferases and a duplication of galE in the NSW150 and B41211CHC genomes (Figs 1 and S1). All twelve strains encode genes for the predicted ABC type transporter ctrBCD and bexD (ctrA-like). Furthermore, they all encode glycosyltransferases and nucleotide sugar precursor genes belonging to the same groups of enzymes (S2 Table). This extremely high conservation in gene content, sequence similarity, and in the genomic location suggest that the acquisition of the capsule cluster dated back to a common ancestor of L. longbeachae.

The L. longbeachae capsule cluster genes share homology to soil-dwelling bacteria

The evolutionary history of the capsule cluster in L. longbeachae is not known. Thus, we performed BLAST analysis on all its genes using L. longbeachae strain NSW150 (sg1) as the reference. S1 Table lists the best hits obtained by BLAST search. Across the cluster, we find homologous genes from β-proteobacteria often found in soils, and of γ- and δ-proteobacteria such as the soil-dwelling Burkholderia spp., Geobacter spp., or Pseudomonas spp., but also from Nitrococcus mobilis or Alteromonas spp., which are present in marine environments. Thus, the capsule cluster may have been acquired from soil-dwelling bacteria.

Electron microcopy analyses confirm that L. longbeachae expresses a capsule that is absent from L. pneumophila

To further analyze the L. longbeachae capsule and to study its functional role, we constructed a mutant in the capsule transporter gene ctrC (llo3151) by replacing it with an apramycin cassette. We chose ctrC as a target, since a knockout mutant of a homologous gene in Campylobacter jejuni abrogated capsule expression [39]. When grown in ACES-buffered yeast extract broth (BYE) medium with or without apramycin, the ΔctrC mutant did not display any significant growth differences as compared to the L. longbeachae WT (S2 Fig). To confirm that L. longbeachae indeed expresses a capsule and that the identified gene cluster is responsible for its expression, we used transmission electron microscopy (TEM). The L. longbeachae WT and the ΔctrC mutant as well as L. pneumophila WT (negative control) were grown in BYE until the optical density OD600 reached mid-log phase and late-log phase, referred to as exponential (E) phase and post-exponential (PE) phase, respectively. Cells were fixed and stained with cationized ferritin. TEM revealed a capsular layer surrounding the L. longbeachae WT (Fig 2A). The capsule was observed only in PE phase, indicating a growth phase dependent expression (S3A Fig). Its thickness was estimated to be between 50–100 nm, which is similar to ferritin-stained capsules observed in E. coli K30 [40]. In contrast, the ΔctrC mutant strain was devoid of such a layer (Fig 2A) and L. pneumophila WT cells were not stained by the ferritin dye (Fig 2A). Complementation of the ΔctrC mutant strain with a plasmid containing ctrC as well as the downstream genes ctrD and bexD under the control of their native promoter restored capsule expression (Fig 2B). We included the downstream genes as macrocolonies of a ΔctrC mutant strain complemented with ctrC and ctrD only barely restored the WT phenotype compared to those complemented with the longer construct (S3B Fig). However, 50% of the complemented capsule mutant strains expressed a capsular structure indicating that regulation of capsule expression may be more complex (S3C Fig). We confirmed that there was no growth defect of the complemented mutant in liquid culture in comparison to the WT or ΔctrC harboring the empty plasmid (S3D Fig). Taken together, our results confirm that, in contrast to L. pneumophila, L. longbeachae expresses a capsule and that ctrC is mainly responsible for its expression on the cell surface.

10.1371/journal.ppat.1012534.g002 Fig 2 The L. longbeachae capsule is expressed in exponential growth phase and contains a highly anionic polysaccharide that cannot be stained by silver staining.

A) L. longbeachae WT, ΔctrC and L. pneumophila WT (negative control) were grown in BYE medium to post-exponential phase. Fixed cells were stained with cationized ferritin. TEM images are representative of n = 3 independent experiments. Scale bar = 200 nm. B) L. longbeachae WT or ΔctrC harboring an empty plasmid (pBCKS) or the complementation plasmid (SSM083) were fixed in post-exponential phase and processed like samples in A). Representative images of n = 3 independent experiments. Scale bar = 500 nm. C) Polysaccharides were extracted from Llo WT, ΔctrC or Lpp WT by enzymatic isolation and subjected to ultracentrifugation. SDS gels were stained with silver nitrate or Stains-all dye. Purified LPS from E. coli O111:B4 (Sigma) was used as a control for silver staining. D) Extracts from Llo WT or ΔctrC harboring the empty plasmid (pBCKS) or the complemented mutant were stained by silver nitrate or Stains-all.

The highly anionic L. longbeachae capsule is resistant to silver staining

To isolate the L. longbeachae capsule and to characterize its composition, we first used phenol-extraction for polysaccharide (PS) isolation followed by HPLC analyses. This approach allowed the identification of galactosamine, glucosamine, mannose and possibly quinovosamine in both the WT and the capsule mutant extracts (S4A Fig). After elution of the column, we detected high peaks in the WT sample that might correspond to phosphosugars. However, when visualizing these samples by silver or Alcian blue staining, we observed that phenol extraction seems to collapse the LPS structure, similarly to what has been seen for L. pneumophila [41]. Thus, L. longbeachae LPS neither nor CPS can be extracted by phenol (S4B Fig). Using an enzymatic isolation method [42] and silver staining revealed that L. longbeachae expresses a long O-antigen chain of different lengths between 30–70 kDa. In contrast, a different pattern was present for L. pneumophila with two shorter O-antigen fractions as shown previously, confirming that enzymatic PS isolation preserves the LPS structure in both Legionella species (Fig 2C) [43]. However, no differences between the WT and capsule mutant were observed. Therefore, we tested other dyes to visualize CPS. When using Stains-all dye, a carbocyanine dye that stains highly anionic compounds such as glucosaminoglycans [44], the enzymatically prepared L. longbeachae PS extracts showed a strong signal in the WT, but not the capsule mutant or L. pneumophila (Fig 2C). When we complemented the capsule mutant, Stains-all reveals that the band observed in WT extracts is restored in the complemented mutant as well (Fig 2D). Again, silver staining did not detect any CPS in the complemented strain (Fig 2D). To test whether capsule expression may be temperature-dependent, we grew Llo WT, ΔctrC and complemented ΔctrC at 20°C in liquid medium. CPS extracted from bacteria grown at 20°C showed that also at 20°C the capsule is expressed in PE phase only in the Llo WT and complemented ΔctrC (S4C Fig). The presence of a highly anionic PS corroborates our findings from staining with cationized ferritin for TEM and may explain our unique peak seen in HPLC. Taken together, the L. longbeachae capsule consists of highly anionic PS that cannot be stained by conventional silver staining methods.

Encapsulated L. longbeachae is more sensitive to salt stress

The capsule may protect L. longbeachae from adverse environmental conditions. Thus, we grew the bacteria in liquid culture to PE phase and treated the cells with 0.05% Tween-20 with or without added NaCl or sucrose, as described previously [45]. After treatment with Tween-20, we did not observe a growth defect neither in the WT nor in the capsule mutant. However, in comparison to L. pneumophila, L. longbeachae seems inherently more resistant to detergent, independent of the capsule (S5A Fig). Similarly, both the L. longbeachae WT and the capsule mutant grew at similar rates after treatment with 2 mM or 10 mM H2O2. In comparison to L. pneumophila, the two L. longbeachae strains were more tolerant to high H2O2 present in the medium (S5B Fig). Thus, we conclude that L. longbeachae is inherently more resistant to detergent and oxidative stress than L. pneumophila.

It has been shown that salt stress in L. pneumophila is linked to virulence [46]. Indeed, a L. pneumophila mutant in the response regulator LqsR was shown to be less virulent but more resistant to salt stress than WT bacteria [46,47]. To test the role of the capsule under salt stress, we grew the L. longbeachae WT and capsule mutant as well as L. pneumophila WT to PE phase in liquid culture and plated the bacteria on BCYE in the presence or absence of 50 mM or 100 mM NaCl, respectively (S6 Fig). At high salt concentrations, both the capsule mutant and L. pneumophila exhibit a 3-log-fold growth difference. Surprisingly, however, there is also a 2-log-fold growth difference between the L. longbeachae WT, and the capsule mutant grown in the presence of 100 mM NaCl. Hence, similar to L. pneumophila, the analysis reveals that the less virulent L. longbeachae capsule mutant is more resistant to salt stress (S6 Fig). This growth difference was not detectable at a lower concentration of 50 mM NaCl, indicating that salt concentration is an important factor for optimal growth of both Legionella species.

The capsule is expressed in vitro and during infection in a growth phase dependent manner

Legionella pneumophila is known to have distinct gene transcription profiles in vitro and during infection depending on the growth phase [48]. Thus, to learn when the genes encoding the capsule of L. longbeachae are expressed and if their expression is growth phase dependent, we performed RNAseq analyses. The L. longbeachae WT and the ΔctrC mutant strain were grown in BYE until the OD600 reached E or PE phase. Total RNA was isolated from the bacterial cells, depleted for rRNA, and sequenced to follow their transcriptional profile in both growth phases. This showed that almost all genes of the capsule cluster in the L. longbeachae WT strain were significantly downregulated in PE as compared to E phase (Fig 3A), indicating that the expression of the capsule on the cell surface is growth phase dependent. However, the capsule is visible only in the PE phase (S3A Fig) suggesting that the building of its complex polysaccharides and their export to the cell surface takes time and thus expression of the CPS (Fig 2) is highest in later growth phases. Moreover, when comparing L. longbeachae WT and the ΔctrC mutant strain, apart from the expression of ctrC and the downstream genes of the capsule transporter operon, no significant differences in the transcription of the other capsule genes were observed neither in E phase (S7A Fig) nor in PE phase (S7B Fig, S3 Table). The transcription of the capsule in E phase and its expression in PE phase suggest that L. longbeachae synthesizes its capsule later in infection, probably to be prepared for cell attachment and a new infection of host cells, and/or for survival in the environment.

10.1371/journal.ppat.1012534.g003 Fig 3 The L. longbeachae capsule is transcribed in liquid medium and in cellulo, but it is not expressed in a ΔctrC mutant.

A) RNAseq of WT transcripts (n = 4); E vs. PE (E is the reference); consider relevant genes with log2 fold change of ±2 and adjusted p value ≤ 0.05. B) THP-1 cells were infected with wild type L. longbeachae expressing constitutive mKate2 and inducible sfGFP under the control of the capsule promoter (promcap). A control plasmid containing constitutive mKate2 and two copies of sfGFP without the capsule promoter was included. Cells were imaged at 22 hours post infection. Scale bar = 50 μm.

To test this hypothesis, we analyzed the capsule expression during infection, using a dual reporter to follow the transcription of the capsule transporter operon in cellulo. This dual reporter contains a constitutively expressed red fluorescent protein (mKate2) and two copies of superfolder GFP (sfGFP), each under the control of the native promoter of the capsule transporter. As a negative control we used a plasmid containing constitutively expressed mKate2 and two copies of sfGFP without the native capsule promoter. These plasmids were transformed into L. longbeachae WT and used to infect THP-1 cells or Acanthamoeba castellanii (Figs 3B and S8, S1–S4 Videos). We followed the expression of sfGFP and mKate2 expression over time by live confocal imaging on an Opera Phenix system. We detected GFP expression starting at 12 hours that continuously increased in intracellularly replicating bacteria containing the capprom promoter construct, but not the negative control. This revealed that the capsule is transcribed in both eukaryotic hosts. Thus, the capsule is universally transcribed in vitro and upon infection.

The capsule is crucial for virulence in vivo in mice and in the environmental host Acanthamoeba castellanii

To learn if the L. longbeachae capsule plays a role in virulence in vivo, we infected mice with either the L. longbeachae WT or the ΔctrC mutant at different bacterial loads and followed their survival over 10–15 days. Upon infection with the WT strain with 107 bacteria, all animals succumb to the infection within 5 to 6 days, similar to what has been reported previously [21]. However, all mice infected with the ΔctrC mutant survived the infection (Figs 4A and S9). To confirm that the observed phenotype is due to the missing capsule, we infected mice with the L. longbeachae ΔctrC mutant either complemented or harboring an empty plasmid. All mice infected with the mutant strain carrying the empty plasmid survived the infection. In contrast, 40% of mice infected with the complemented strain died, indicating that complementation partially restored virulence in vivo (Fig 4B).

10.1371/journal.ppat.1012534.g004 Fig 4 The capsule mutant is impaired in replication and avirulent in mammalian and protozoan hosts, despite a functional Dot/Icm type IV secretion system.

A) Female C57BL/6 mice were infected with 107 CFU of Llo WT or ΔctrC via the nasal route. Survival was monitored over 15 days. Each group contained 9 mice. B) Infection of female C57BL/6 mice with the capsule mutant harboring an empty plasmid (pBCKS) or the complementation plasmid (SSM083) with 107 CFUs. 10 mice per group. Statistical significance was determined by Log-rank (Mantel-Cox) test. *, p≤0.05; ****, p≤0.0001. C) CFUs from lungs of infected mice were plated at 4, 48, and 96 hours post-infection. Dots represent number of animals per group. D) CFUs from spleens of infected mice were plated at 48 and 96 hours post-infection. Dots represent number of animals per group. Statistical analysis was performed by two-way ANOVA with Tukey’s post-test. E) LDH activity test in converting L-lactate + NAD+ to pyruvate + NADH, measured as absorbance at 490 nm. Lung lavage fluid from mice infected with Llo WT or ΔctrC at 72 hours post-infection. Data points correspond to individual mice and are shown as means ± SD. Statistical significance was tested by unpaired t-test. ns, non-significant; *, p≤0.1; **, p≤0.01; **** p≤0.0001. F) Acanthamoeba castellanii trophozoites were infected at MOI 0.1 at 20°C over 7 days. Samples were taken every 24 hours and CFUs are normalized to the input control. Data show means ± SD for n = 3 independent experiments. G) A. castellanii trophozoites were infected with Llo WT or ΔctrC harboring an empty control plasmid (pBCKS) or the complementation plasmid (SSM083) at an MOI of 1. Samples were taken every 24 hours and CFUs normalized to t = 1. Data show means ± SD for n = 3 independent experiments. H) A. castellanii trophozoites were infected at MOI 0.1 with equal amounts of Llo WT or ΔctrC. Samples were taken at 1, 8, 24, 30, 48, 96, 120, and 144 hours post-infection and normalized to the input control. Data show the competitive index of Llo ΔctrC over Llo WT for n = 3 independent experiments. I) Translocation of the known T4SS effector RomA was tested in THP-1 cells infected with Llo WT, ΔctrC, or a T4SS mutant, ΔdotB. Data represent means ± SD of n = 2 experiments. Statistical significance was tested by two-tailed t-test. J) Bacterial replication of Llo WT, ΔctrC and ΔdotB in hMDMs at 20 hours post-infection. Data show median bacteria area ± SD of infected cells of n = 3 independent experiments. Statistical significance was tested by one-way ANOVA. ns, non-significant; *, p≤0.05, **, p≤0.01, ***, p≤0.001, ****, p≤0.0001.

L. longbeachae WT replicates to higher numbers in the murine lungs as compared to the capsule mutant, but both seem to reach the blood stream as we measured comparable levels of CFUs in the spleen (Fig 4C and 4D). Furthermore, we measured levels of lactate dehydrogenase (LDH) from bronchoalveolar lavage fluid (BALF) of infected mice to determine whether the capsule plays a role in lung damage. Indeed, the WT induces higher levels of LDH than the ΔctrC strain (Fig 4E), indicating that the capsule is implicated in lung damage.

We then infected A. castellanii at a low MOI of 0.1 and at an environmental temperature of 20°C with L. longbeachae WT, the ΔctrC or the ΔdotB mutant strain. The latter is deficient in the T4SS and was used as a negative control. Replication of the bacteria was monitored by plating the bacteria every 24 hours over seven days. We observed a strong replication defect of the capsule mutant as compared to the WT, which becomes apparent at 72 hours post-infection (Fig 4F). As expected, the ΔdotB mutant failed to replicate in A. castellanii but seems to persist over extended periods of time indicated by the stable CFU counts towards the end of the experiment. Like in mouse infections, A. castellanii infected with the complemented strain restored replication of the bacteria to WT levels while the capsule mutant harboring the empty plasmid was impaired in replication (Fig 4G). We further tested the competitive fitness of the capsule mutant by performing a competition assay in A. castellanii as described previously [49]. This showed that the capsule mutant is completely outcompeted by the L. longbeachae WT strain between 24 to 48 hours of infection (Fig 4H), further underlining the importance of the capsule in virulence of L. longbeachae also in its environmental host.

An important question that arose from the in vivo infections was whether the strong virulence defect of the capsule mutant may be due to impaired effector secretion through the Dot/Icm T4SS in the ΔctrC strain. We thus tested effector translocation using the beta-lactamase (BlaM) secretion assay as described previously [11]. We used a BlaM-fusion to the known T4SS effector RomA [50] and measured BlaM secretion in infected THP-1 cells by flow cytometry after 2 hours of infection. We included the L. longbeachae ΔdotB mutant as negative control and L. pneumophila strain Paris as positive control. Both, the L. longbeachae WT and the ΔctrC mutant translocated RomA successfully into the host cells to similar levels, whereas the ΔdotB mutant failed to translocate the effector (Fig 4I). Thus, the virulence phenotype of the capsule mutant in vivo and in A. castellanii is not due to an impaired Dot/Icm T4SS, as this strain maintains the ability to secrete effectors upon infection.

The capsule provides a replicative advantage in primary human macrophages

To confirm that both Llo WT and ΔctrC replicate inside the LCV, we infected U2OS cells constitutively expressing Sec61β-GFP, a marker of the ER. We followed the replication of the WT, ΔctrC expressing dsRed and as negative control ΔdotB, a strain deficient in a functional T4SS, over time (S11 Fig). Both, WT and ΔctrC replicate inside the cells building large vacuoles. More importantly, both strains recruit Sec61β early in infection, like L. pneumophila for which the recruitment of ER vesicles is a hallmark of intracellular replication.

Since L. longbeachae can cause the severe pneumonia Legionnaires’ disease in humans, we also tested bacterial replication in human monocyte-derived macrophages (hMDMs). We observed that the WT replicates more efficiently in hMDMs than the capsule mutant as indicated by a larger, bacteria containing vacuole size in the WT infected cells (Fig 4J). To address the question whether the capsule plays a role in modulating cell death, we stained living, infected hMDMs for annexin V, an early marker of apoptosis. However, we did not observe significant difference in annexin V labelling of WT or ΔctrC infected cells (S12A Fig). In addition, we tested whether the capsule may influence the induction of reactive oxygen species (ROS) in hMDMs. We labelled hMDMs with CellROX live cell dye to follow ROS production in infected cells, but we did not observe a significant difference in ROS production (S12B Fig). Interestingly, when we infected human macrophage-like THP-1 cells or murine bone marrow-derived macrophages in vitro, we observed no replication defect of the capsule mutant as compared to the WT, suggesting that successful infection of mice by L. longbeachae depends on the interaction of immune cells with the capsule in vivo (S13A and S13B Fig). These data show that there is a different replicative behavior in cell lines as compared to primary human or protozoan host cells as well as in the murine host.

Taken together, these results show that the capsule is important for replication in both protozoan and mammalian hosts and that the lack of the capsule renders the bacteria avirulent in mice.

The L. longbeachae capsule delays phagocytosis in human cells

Based on data published for other bacteria, we hypothesized that the capsule of L. longbeachae could be implicated in modulating phagocytosis or attachment to eukaryotic cells. To quantify phagocytosis, we incubated the bacteria with THP-1 cells and, after washing off unbound bacteria, we added gentamycin to kill extracellular bacteria and followed the infection by plating bacteria at different timepoints. For attachment studies, we pre-treated half of the cells with 2 μM cytochalasin D (cytoD), a known inhibitor of actin polymerization, and followed the infection by plating the bacteria recovered from the cytoD- as well as the non-treated cells. The overall CFU counts were normalized to the input control. We observed that WT bacteria were phagocytosed more slowly over time than the capsule mutant (Fig 5A). In contrast, both strains attached to THP-1 cells at similar rates, likely due to the synchronization of the infection by centrifugation at the start of each experiment (Fig 5B). This suggests that the capsule is important to delay phagocytosis by host cells.

10.1371/journal.ppat.1012534.g005 Fig 5 The capsule delays phagocytosis of host cells.

A) For phagocytosis, differentiated THP-1 cells were infected with Llo WT or the ctrC mutant at MOI 10. Gentamycin was added at the indicated timepoints for 1 hour to kill extracellular bacteria and cells were lysed in water for CFU plating. Data show means ± SD of n = 3 independent experiments normalized to the input control at t = 0. B) For attachment, THP-1 cells were pre-treated with 2 μM cytochalasin D for two hours before infection with Llo WT or ΔctrC at MOI 10. At the indicated timepoints, gentamycin was added to half of the wells to kill extracellular bacteria. Cells were lysed in water and CFUs of gentamycin-treated cells (intracellular bacteria) and non-treated cells (total bacteria) were plated. Intracellular bacteria were deducted from total CFUs, normalized to the input control at t = 0 and data plotted as means ± SD of n = 3 independent experiments. Statistical significance was tested by two-way ANOVA with Tukey’s post-test. ns, non-significant; *, p≤0.05, **, p≤0.01, ***, p≤0.001.

Capsules have been shown to surround the bacterial cell wall and to mask LPS or outer membrane proteins like a shield. To further investigate if this could also be the case for L. longbeachae, we tested agglutination by yeast mannan, a complex polysaccharide of the Saccharomyces cerevisiae cell wall that can bind bacterial fimbriae [51,52]. Indeed, the capsule mutant agglutinated, in contrast to the WT and the complemented mutant (S14 Fig). These results indicate that the capsule of L. longbeachae protects fimbriae and other attachment factors that are exposed on the surface of a capsule mutant.

The L. longbeachae capsule impacts the pro-inflammatory cytokine response in primary innate immune cells

Capsules have been shown to mask cell structures like LPS or outer membrane proteins in bacteria. Due to their inherently low immunological recognition, capsules can have detrimental effects in infection settings such as reduced bacterial clearance or failure to mount an effective cytokine response against the pathogen [53]. Pro-inflammatory cytokines such as IL-6, TNFα, or IL-1β can be induced upon engagement of pattern-recognition receptors such as Toll-like receptors (TLRs) or C-type lectin receptors (CLRs) by macrophages. To learn whether the L. longbeachae capsule plays a role in the cytokine response, we infected primary human monocyte-derived macrophages (hMDMs) with the L. longbeachae WT and the capsule mutant strains and measured cytokine levels in cell supernatants at 24 hours post-infection. Based on previous works [21], we expected low cytokine levels upon L. longbeachae infection. We therefore opted for the high sensitivity SP-X array for human pro-inflammatory cytokines (Simoa). We observed a significant increase in IL-6 levels in the capsule mutant compared to the complemented strain (Fig 6A). Moreover, cytokine levels of the complemented strain were as low as those of the L. longbeachae WT strain. In contrast, we did not detect significant differences in TNFα or IL-1β levels (Fig 6B and 6C). These cytokines are known mediators of inflammation in the context of L. pneumophila infections [54,55], and IL-6 and TNFα are highly induced upon infection with the L. longbeachae ΔdotB mutant. However, TNFα and IL-1β secretion in human macrophages does not seem to be driven by the capsule but are rather dependent on the presence of a functional Dot/Icm T4SS.

10.1371/journal.ppat.1012534.g006 Fig 6 The capsule influences the cytokine response of primary macrophages and dendritic cells.

A-C) Human monocyte derived macrophages (hMDMs) were infected at MOI 10 and cell supernatants were collected at 24 hours post-infection. High-sensitivity SP-X array was performed on cell supernatants. Data show means ± SD of fold change over L. longbeachae WT of n = 6 independent experiments. Statistical significance was tested by pairwise t-tests; ns, non-significant; *, p≤0.05. D-F) Murine bone-marrow derived DCs were infected at MOI 10 and cell supernatants collected at 24 hours post-infection. Data show means ± SD of n = 3 independent experiments. G-I) Murine bone-marrow derived macrophages were infected at MOI 10 and cell supernatants collected at 24 hours post-infection. Data show means ± SD of n = 3 independent experiments. Statistical significance was tested by one-way ANOVA with Tukey’s post-test. ns, non-significant; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001.

L. longbeachae is lethal for mice and fails to induce a strong cytokine response in vitro [21]. Our results show that the capsule plays a crucial role in virulence, and we therefore tested whether cytokine secretion during infection is also impacted by its presence or absence. We infected murine dendritic cells (DCs) with L. longbeachae WT or the capsule mutant. Similar to what was seen in human macrophages, the secretion of IL-6 was highly induced in the capsule mutant and lower in the L. longbeachae WT at 24 hours post-infection (Fig 6D). In contrast to human macrophages, secretion of IL-1β was also induced in murine DCs infected with the capsule mutant as compared to the WT (Fig 6E). Using murine bone marrow derived macrophages (BMDMs), higher IL-6 and IL-1β were detected at 24 hours in cells infected with the capsule mutant compared to those infected with the WT or the complemented mutant (Fig 6G and 6H). However, we did not detect a significant difference in TNFα secretion in murine DCs or macrophages (Fig 6F and 6I). Thus, our results show that in both human and murine infection models the capsule dampens the secretion of pro-inflammatory cytokines.

When cytokine induction by the capsule mutant or the complemented mutant was tested in BMDMs, we observed that complementation of the capsule reduces TNF-α levels in BMDMs as compared to the capsule mutant, but it does not influence IL-6 levels in vitro (S15A and S15B Fig). Further, we tested cytokine levels in BALF from Llo WT or ΔctrC infected mice. Here we observe higher IL-6 induction in the WT as compared to the mutant, but no difference in TNF-α levels in BALF of infected mice at 72 hours post-infection (S15C and S15D Fig). However, we detected higher protein levels in BALF of WT infected mice as measured by Bradford assay (S15E Fig). These data indicate that proinflammatory cytokine induction in vivo is due to higher lung damage caused by the WT as shown by protein levels and lactate measurements.

Discussion

In this study, we report that L. longbeachae expresses a capsule that is unique within the genus Legionella (Figs 1 and S1). Its genes seem to have been acquired from bacteria such as Pseudomonas, Klebsiella, or Neisseria which are present in soil environments or the soil-dwelling bacteria Burkholderia spp. and Geobacter spp., as evidenced by our comparative genomics analyses. This fits well with the environmental niche of L. longbeachae, as this bacterium is mostly isolated from moist soils and potting mixes [4,56,57]. Importantly, the genetic organization of the cluster and its position in the genome are conserved among all L. longbeachae strains analyzed, suggesting that these genes have been acquired by horizontal gene transfer by a common ancestor of L. longbeachae (S1 Fig). However, the exact organism from which it has been acquired, probably en bloc given the high conservation in all strains, is not known as it has probably not been sequenced yet.

Transmission electron microscopy (TEM) confirmed that L. longbeachae expresses a capsule, which can be stained by cationized ferritin and that the ctrC mutant does not export the capsule (Fig 2A). CtrC is the inner membrane protein component in contact with CtrD, the nucleotide-binding domain containing ATPase of ABC capsule transporters. A deletion of the homologous kpsM gene in Campylobacter jejuni also abrogated capsule expression and impaired bacterial virulence in a ferret model of infection [39,58]. Interestingly, RNAseq analyses showed that the capsule cluster is highly transcribed in E phase, and TEM analyses revealed that the L. longbeachae capsule is visible in PE phase (S3 Fig). Thus, export of the capsule on the surface happens in later stages of bacterial growth, suggesting that the bacteria prepare themselves for a new infection and/or for survival in the environment. Indeed, using a fluorescence dual reporter to follow capsule transcription in living cells, we showed that the capsule transporter is expressed in both the human macrophage-like cell line THP-1 and in the environmental host A. castellanii upon infection (Figs 3B and S8).

Using conventional silver staining methods, we did not detect any fraction that corresponded to a possible CPS in the L. longbeachae WT, but the pattern looked highly similar to the LPS ladder in both the WT and in the capsule mutant strain (Fig 2C). Hence, depletion of the capsule does not impact bacterial LPS expression, which might have been an explanation for its low virulence (Fig 4). Only when we applied Stains-all dye, we detected a band at around 100 kDa in the WT, which is absent in the mutant and in L. pneumophila (Fig 2C). Stains-all can be used for differential staining of highly anionic compounds such as glycosaminoglycans like hyaluronic acid, chondroitin sulfate, dermatan sulfate, or heparin [44]. Possibly, we cannot detect the capsular polysaccharides by silver staining because it contains highly modified acidic sugars, which are not available for oxidation by periodate in silver staining. Indeed, it has been reported that some C. jejuni strains express hyaluronic acid-like and teichoic acid-like capsules, which often cannot be stained by silver, due to a high degree of O-methyl phosphoramidate groups in these CPSs [42,59,60]. Our results open new paths for further research into the biochemical composition of the L. longbeachae capsule, to determine what confers the highly anionic charge and its anti-phagocytic function.

Capsules have also been shown to mediate resistance to environmental stresses such as oxidative stress, detergent, or osmotic stress [32,61,62]. Interestingly, as shown here, L. longbeachae is inherently more resistant to oxidative stress and detergents than L. pneumophila, independent of the capsule (S5 Fig). These differences may be due to different LPS structures of these two Legionella species, which confer resistance to oxidative stress or detergents. During our attempts to isolate the CPS, we observed that L. longbeachae produces a longer O-antigen than L. pneumophila (Fig 2C), which may be an indication as to why this species is more resistant to H2O2 and Tween-20. In contrast, when we tested hyperosmotic stress due to NaCl, growth of the WT was highly impaired in the presence of 100 mM NaCl as compared to the capsule mutant and L. pneumophila, whose growth was less disturbed (S6 Fig). This is similar to what has been shown for the less virulent LsqR mutant of L. pneumophila, and our data point to a link between virulence of L. longbeachae and osmotic stress [47]. Capsules are hydrated shells surrounding bacteria, which may contain over 95% water [63] and which can protect them from hyperosmotic stress [61,64,65]. According to our TEM studies, the capsule is likely negatively charged. Thus, it is plausible that Na+ ions present in high salt environments may disrupt the integrity of the capsule, causing membrane stress and leading to a growth defect in the WT.

Capsules have been shown to be important virulence factors of many Gram-negative bacteria that are human pathogens, such as N. meningitidis group B, E. coli K1 and K5, K. pneumoniae, or Haemophilus influenzae type b [66–71]. Using a mouse model of infection revealed that the capsule is a crucial virulence factor of L. longbeachae (Fig 4A). Remarkably, the capsule mutant was even completely avirulent in mice, a phenotype that was partially restored in vivo by complementation (Fig 4B). The virulence of L. longbeachae is linked to its capacity to replicate better in the lungs of infected mice and to cause higher lung damage as indicated by the release of LDH in lungs of infected mice (Fig 4C and 4E) and higher protein levels (S15E Fig). Previous studies have shown that L. longbeachae infection is lethal in common laboratory mouse strains [16,17,21]. Here, we provide evidence that the observed high virulence for mice is due to the capsule encoded by L. longbeachae. Thus, the L. longbeachae capsule is the first virulence factor described for human pathogenetic Legionella whose virulence phenotype is comparable with that of the loss of a functional Dot/Icm type IV secretion system.

Early studies on the pathogenicity of L. pneumophila revealed that the bacteria can replicate inside the amoeba and likely use the same mechanisms for infection of human cells [72]. Here, we show that the capsule mutant is impaired in intracellular replication in A. castellanii, and upon coinfection the WT rapidly outcompetes the capsule mutant (Fig 4F and 4H). Thus, the capsule of L. longbeachae is important for infection of both mammalian cells and environmental protozoa. Importantly, all Legionella species analyzed to date critically depend on the secretion of effector proteins into host cells via a highly conserved Dot/Icm type IV secretion system (T4SS), in order to establish infection and their replicative vacuole [7,10,73–76]. A L. longbeachae ΔdotB mutant having a nonfunctional T4SS cannot replicate in THP-1 cells, A549 cells and HEK cells in vitro [76]. Here, we show that it also fails to replicate in A. castellanii (Fig 4F). However, the capsule mutant is not impaired in effector translocation through the T4SS (Fig 4I). Thus, the observed infection phenotypes are not linked to a dysfunctional T4SS but to the lack of a capsule in the mutant strain.

Furthermore, we show that both WT and capsule mutant recruit Sec61β early in infection (S11 Fig). Sec61β is a marker of the ER and recruitment of ER-derived material to the LCV is a hallmark of Legionella infection and LCV formation [77]. Thus, both the WT and the capsule mutant replicate in the LCV. We further show that the WT replicates better in hMDMs as compared to the capsule mutant (Fig 4J). However, we did not observe any differences in apoptosis or ROS induction between the two strains (S12 Fig). This finding may be explained by the fact that both strains harbor a functional T4SS that allows the bacteria to secrete effector proteins into the host cell and to modulate host cellular pathways, such as apoptosis or ROS formation. Our data also point towards a difference in replication phenotypes depending on the infection models used. We observed a replication defect for the capsule mutant in primary cells such as hMDMs and amoeba as well as in vivo, but not in cell lines in vitro (S13 Fig). This result might point to the known metabolic differences between primary cells and cell lines, a topic that warrants further research.

Capsules have been shown to modulate phagocytosis by host cells by masking cellular receptors on the bacterial surface, or by impairing recognition of LPS by TLRs [78–80]. Indeed, in L. longbeachae, the capsule is involved in delaying bacterial phagocytosis by THP-1 cells (Fig 5). Moreover, when exposing bacteria to yeast mannan, which can bind proteins on bacterial cell walls leading to agglutination of bacteria [51,52], only the L. longebachae capsule mutant but not the WT or the complemented strain agglutinated (S14 Fig). Altogether, this shows that the L. longbeachae capsule is an anti-phagocytic factor and it shields bacterial outer membrane components from immune recognition. Further studies may shed light on whether the L. longbeachae capsule helps in evading the binding of complement factors, which may explain the difference in phagocytosis.

By avoiding immune recognition, bacterial capsules have been shown to dampen the host pro-inflammatory cytokine response [68,78,81]. The Salmonella enterica serotype Typhi Vi capsule dampens the expression of pro-inflammatory cytokines IL-6, TNFα, and IL8, and it prevents recognition by TLR4 [82,83]. A non-encapsulated strain of K. pneumoniae induced higher IL-6 levels in bronchoalveolar lavage fluid from infected mice than an encapsulated WT strain [84]. It was shown that the anti-stimulatory CPS1 capsule of the gut symbiont Bacteroides thetaiotaomicron dampens pro-inflammatory cytokines IL-6 and TNFα both in bone marrow-derived macrophages and dendritic cells, correlating with higher bacterial loads in the intestine [85]. Furthermore, it has been shown that the lack of capsule in Campylobacter jejuni leads to an increased release of IL-6 and TNFα in murine dendritic cells and macrophages [86,87]. Similarly, the L. longbeachae capsule modulates cytokine release in hMDMs, inducing a lower response of pro-inflammatory IL-6 in the WT as compared to the capsule mutant (Fig 6A). However, we did not detect any differences in secretion of TNFα or IL-1β in hMDMs. In contrast, when we infected murine dendritic cells and murine macrophages, the capsule mutant induced a higher immune response for IL-6 and IL-1β, but not TNFα (Fig 6D–6I), suggesting that the absence of capsule permits the liberation of bacterial-derived immunostimulatory components that would be only recognized by murine cells and not by human cells. Such immunostimulatory bacterial-derived components and their receptor counterparts in the host are yet to be identified, however an existing example of such differences between murine and human macrophages is the NAIP5 inflammasome, present in mice and absent in humans, which allows the exclusive recognition of flagellin from L. pneumophila by murine macrophages [88]. However, the leaked immunostimulatory component(s) cannot be flagellin as it is absent from L. longbeachae. Additionally, we observed that the complemented capsule mutant induces lower TNF-α than the capsule mutant harboring the empty plasmid (S15B Fig). In vivo, we see a reversed phenotype, the WT induces higher proinflammatory cytokine than the capsule mutant (S15C Fig). This is likely linked to the WT causing a high degree of lung damage (Figs 4E and S15E).

Thus, the L. longbeachae capsule dampens the immune response in innate immune cells in vitro by a mechanism that might involve the masking of immunostimulatory bacterial-derived components and their release, avoiding their recognition by innate immune pattern-recognition receptors.

In conclusion, our study provides evidence for a novel virulence mechanism of L. longbeachae, the expression of a capsule. This capsule is important for L. longbeachae replication in the environmental host A. castellanii and in mice. During infection, the L. longbeachae capsule modulates phagocytosis and dampens the innate immune response favoring bacterial replication. Importantly, our findings provide exciting new insights into how Legionella escape recognition by host cells and their defenses, and it opens new avenues to explore the architecture of this unique capsular type and to discover its anti-phagocytic molecules.

Materials and methods

Ethics statement

All mouse experiments were conducted according to the institutional ethical committees for animal care (Comissão de Ética em Experimentação Animal da Faculdade de Medicina de Ribeirão Preto FMRP/USP), approved protocol number 1248/2023.

Bacterial strains, growth conditions, and cell culture

Bacterial strains used in this study are listed in Table 1. Escherichia coli DH5α subcloning efficiency bacteria were grown in Luria-Bertani broth or on LB agar. Legionella longbeachae strains and L. pneumophila were cultured in N-(2-acetamido)-2-aminoethanesulfonic acid (ACES)-buffered yeast extract broth (BYE) or on ACES-buffered charcoal-yeast (BCYE) extract agar with antibiotics added where appropriate [89]. For the L. longbeachae ΔctrC mutant, 15 μg/ml apramycin (Sigma) were added to the medium. For plasmid maintenance, 5 μg/ml of chloramphenicol was added to the medium. For growth in minimal medium, cells were grown in CDM or MDM according to published protocols [90]. Acanthamoeba castellanii strain C3 (ATCC 50739) trophozoites were grown in PYG medium according to published protocols [13,91]. Infection buffer was prepared as PYG 712 medium [2% proteose peptone, 0.1% yeast extract, 0.1 M glucose, 4 mM MgSO4, 0.4 M CaCl2, 0.1% sodium citrate dihydrate, 0.05 mM Fe(NH4)2(SO4)2•6H2O, 2.5 mM NaH2PO3, 2.5 mM K2HPO3] without proteose peptone, yeast extract, and glucose. The human monocyte cell THP-1 cell line (ATCC TIB-202) was maintained in RPMI GlutaMax supplemented with 10% fetal calf serum (FCS) at 37°C and 5% CO2. For infections, undifferentiated THP-1 cells were seeded with RPMI and 50 μg/ml of Phorbol 12-myristate 13-acetate (PMA) to start differentiation into adherent cells. Cells were grown in the presence of PMA for three days and recovered overnight in fresh RPMI medium before infection.

10.1371/journal.ppat.1012534.t001 Table 1 Bacteria and plasmids used in this study.

Bacteria	
Name	Source	Additional information	
E. coli DH5α	Invitrogen	Ref. 18265017	
L. longbeachae strain NSW150	[13]	Wild type strain, serogroup 1	
L. longbeachae ΔctrC	This study	KO of ctrC in NSW150 background	
L. longbeachae ΔdotB	[76]	Genomic deletion of dotB	
L. pneumophila strain Paris	[104]	Wild type strain, serogroup 1	
Plasmids	
Name	Source	Additional information	
pGEM®-T easy vector	Promega	Cloning vector, AmpR	
pBCKS+	Stratagene	lacZ, CmR	
TOPO-mKate2	Addgene	Ref. 68441, mKate2, KanR	
pLAW344	[92]	Suicide plasmid incl. sacB cassette, CmR	
pSW001	[105]	Constitutive dsRed, CmR	
pLGV012	This study	pLAW344-ctrC::Apramycin	
pXDC61	[106]	N-terminal blaM, CmR	
pSSM012	[50]	pXDC61-blaM-RomA	
pSSM073	This study	Complementation of ctrC, including ctrD, under the control of the native capsule promoter promcap, CmR	
pSSM083	This study	Complementation of ctrC, including ctrD and bexD, native capsule promoter promcap, CmR	
pSS016	This study	Dual reporter without promcap, CmR	
pSS017	This study	Dual reporter incl. promcap, CmR	

Construction of L. longbeachae ΔctrC

The 0.5 kb flanking regions of L. longbeachae ctrC (llo3151) were amplified using the primer pairs P3/P4 (upstream segment) and P1/P2 (downstream segment) using genomic DNA of L. longbeachae NSW150 as a template (see primers listed in Table 2). The apramycin cassette was amplified with primer pair Apra_s/Apra_as using pTOPO-ApraR plasmid as template. The three PCR fragments were ligated by PCR using primers P1/P3 and cloned into pGEM-T easy vector (Promega). Plasmid was then digested with NotI, and the combined ctrC::Apramycin fragment was ligated into the suicide plasmid pLAW344 [92] cut with the same restriction enzyme. The resulting plasmid, pLGV012, was introduced into L. longbeachae NSW150 as described above, and transformants were plated onto BCYE agar with apramycin. Resulting colonies were grown in BYE with apramycin and plated onto BCYE agar supplemented with apramycin and 5% sucrose. Sucrose-resistant/chloramphenicol-sensitive clones were screened, and successful deletion was verified through PCR and whole genome sequencing.

10.1371/journal.ppat.1012534.t002 Table 2 Primers used in this study.

Oligo name	Sequence	Direction	
Apra_as	CCCTCCAACGTCATCTCGTTCTC	reverse	
Apra_s	CATCAGCAAAAGGGGATGATAAGTTT	forward	
P1	TCCCGAGCTCAGTGAAGTCT	forward	
P2	AAACTTATCATCCCCTTTTGCTGATGACGCACCCATTACTCCATTC	reverse	
P3	TTGGGAAAACGCTCAGAAAC	forward	
P4	GAGAACGAGATGACGTTGGAGGGGGGCTCAAGAGCAAACCATA	reverse	
SSM_79	GGATCCCTCTCTCCCTTTACGGCGGTAT	forward	
SSM_80	TTGTTAGGAAATGCACATTTTGCATCGACACCAATCCTTAATGTCAAAA	reverse	
SSM_82	GGTACCTTAAGTTTGCTTGTTGTAAAATTCG	forward	
SSM_85	ATGCAAAATGTGCATTTCCTAAC	reverse	
SSM_86	GGCCGCTCTAGAACTAGTGGATCCCTCTCTCCCTTTACGGCG	forward	
SSM_087	ACTAAAGGGAACAAAAGCTGGGTACCTTAAGTTTGCTTGTTGTAAAATTCG	reverse	
SSM_113	GGAAGCTTACGAATTTTACAACAAGCAAACTTAAATAAGTTTTTACAGGAGTTAATTTTTAAAGTGATAAAG	forward	
SSM_114	ACTAAAGGGAACAAAAGCTGGGTACCCTAAGCCCTTATAACCTGTGTTGC	reverse	
SSO_025	GGCCGCTCTAGAACTAGTGGATCCACTCTCTCCCTTTACGGCG	forward	
SSO_049	CAGTTCTTCACCTTTACTCATCGACACCAATCCTTAATGTCAAAATTTC	reverse	
SSO_050	CTACAAACCAGGCATCAAATAGTAAAAGCTTACTCTCTCCCTTTACGGCG	forward	
SSO_049	CAGTTCTTCACCTTTACTCATCGACACCAATCCTTAATGTCAAAATTTC	reverse	
SSO_051	ATGAGTAAAGGTGAAGAACTGTTCAC	forward	
SSO_052	CGCCGTAAAGGGAGAGAGTAAGCTTTTACTATTTGATGCCTGGTTTGTAG	reverse	
SSO_053	GAACAAAAGCTGGGTACCTTACTATTTGATGCCTGGTTTGTAG	reverse	
SSO_045	TGGATGAACTCTACAAACCAGGCATCAAAGCTGCTAATGATGAAAATTATGCTGATGCT	forward	
SSO_046	GAGGTCGACGGTATCGATAAGCTTTTACTAAGAAGCATCAGCATAATTTTCATCATTAGC	reverse	
SSO_047	CATTTTTATCTATAATATTGGCAAATCTGCTACAGCGCTGCTAATGATGAAAATTATGCTG	forward	
SSO_048	CATTATTATTTATCCTGATTGATTCAGGTTATTTACTAAGAAGCATCAGCATAATTTTCATCA	reverse	
SSO_065	GCGGTGGCGGCCGCTTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCGAATTCGCTAGATTTAAGAAGGAGATATACATATGGTGAGCGAGCTGATTAAG	forward	
SSO_066	GGAGAGAGTGGATCCTCATCTGTGCCCCAGTTTGC	reverse	
SSO_621	GATGATGGATCCTGACTAACTAGCAGTAAAGGTGAAGAACTGTTCACC	forward	
SSO_622	GATGATAAGCTTTTAAGAAGCATCAGCATAATTTTCATC	reverse	
SSO_623	GATGATAAGCTTTGACTAACTAGCAGTAAAGGTGAAGAACTGTTCACC	forward	
SSO_624	GATGATGGTACCTTAAGAAGCATCAGCATAATTTTCATC	reverse	

Transformation of L. longbeachae

L. longbeachae was grown on BCYE agar plates at 37°C. Bacteria from a fresh plate were washed three times with ice-cold 10% glycerol, and the final pellet was resuspended in ice-cold 10% glycerol. For transformation, a 400 μl aliquot of electrocompetent cells was freshly mixed with 300–600 ng of plasmid DNA and electroporated at 2.5 kV, 1000 Ω, and 25 μF. The cultures were recovered in BYE broth at 37°C with shaking for 16 h and then plated onto BCYE agar with the appropriate antibiotic.

Transmission electron microscopy

Bacterial strains were grown overnight in BYE and OD600 was followed constantly to determine E phase (OD600 2.0–2.5) or PE phase (OD600 3.7–4.2). Samples of 10 ml were taken at E and PE phase and centrifuged for 15 minutes at 500 g to remove medium. The medium was discarded, and cells were immediately fixed overnight in 0.1 M cacodylate fixation buffer containing 2.5% glutaraldehyde. Subsequently, fixed cells were washed in 0.2 M cacodylate buffer and stained with 1 mg/ml cationized ferritin (Sigma, F7879-2ML) for 30 minutes at room temperature. After another wash, cells were immobilized in 4% agar before osmium fixation. Agar blocks were sequentially dehydrated in increasing volumes of ethanol and embedded in resin and thin sections were sliced on a Leica UC7 ultramicrotome to 70 μm thickness. Resin slices were mounted and imaged on a Tecnai BioTWIN 20–120 kV transmission electron microscope.

RNA sequencing and analysis

Bacteria were grown at 37°C in BYE and OD600 was measured to follow their growth. When bacteria reached exponential phase (OD600 2.0–2.5), 2x5 ml were pelleted and snap frozen in dry ice and ethanol. Bacterial morphology was checked under a microscope. Similarly, pellets were collected from bacteria grown to post-exponential phase (OD600 3.7–4.2) and stationary phase the following day. Bacterial pellets were resuspended in Qiazol (Qiagen) and RNA was isolated according to the miRNA Mini kit (Qiagen). The samples were Turbo DNase digested (Thermo Scientific) and rRNA was depleted using the RiboCop rRNA Depletion Kit for Gram-negative bacteria (Lexogen). Depleted RNA was metal-catalyzed heat-fragmented using the RNA Fragmentation kit (Ambion). RNA quantity was measured using a Qubit 2.0 (Invitrogen) and size distribution was confirmed between 100–200 nt by BioAnalyzer (Agilent Technologies). Fragmented RNA was subsequently processed according to the TruSeq mRNA sample preparation guide by Illumina. RNAseq was performed using Illumina NextSeq 550 multiplex sequencing (Illumina). For analyzing capsule gene expression, we used FASTQ files containing single end reads generated by Illumina sequencing. Sequencing reads were processed with Cutadapt software (version 1.15) to remove adapters. Trimming was performed with Sickle (version 1.33, https://github.com/najoshi/sickle) with a quality threshold (Phred Score) of 20. Reads shorter than 20 nucleotides were discarded. Clean reads were aligned to the Legionella longbeachae NSW150 sequence using Bowtie2 (version 2.3.4.3), and only uniquely mapped reads were kept for the read counts. We used Samtools package (https://github.com/samtools/samtools) to build indexed BAM files from the mapping results. To count the number of reads overlapping each genomic feature, we used featureCounts from the Subread package (version 1.6.3). Only primary alignments were counted. Differential analysis between the different conditions was performed with the R package Sartools (version 1.3.0) using DESeq2 methods. The “median” option was used to compute size factors.

Construction of complementation and dual reporter plasmids

Capsule cluster promoter was amplified using primers SSM_79 and SSM_80, and the region containing ctrC (llo3151) and ctrD (llo3150) was amplified using primers SSM_82 and SSM_85. Both PCRs were performed using genomic DNA of L. longbeachae NSW150 as a template. Fragments were then ligated by PCR, with primers SSM_86 and SSM_87. The obtained amplicon was cloned into pBCKS (Stratagene) by restriction-free cloning [93], resulting in plasmid SSM073. To construct plasmid SSM083, bexD (llo3149) was amplified using primers SSM_113 and SSM_114, and subcloned into SSM073 vector by restriction-free cloning [93]. For construction of the reporter plasmid, the capsule transporter promoter (promcap) was PCR amplified using primers SSO_025 and SSO_049 (promcap1) or SSO_050 and SSO_049 (promcap2) (listed in Table 2). Superfolder GFP (sfGFP, gift from David Bikard) was PCR amplified using primers SSO_051 and SSO_052 (sfGFP1) or SSO_053 and SSO_054 (sfGFP2). A C-terminal degradation tag was added to each sfGFP construct by restriction-free cloning [93] using primers SSO_045 and SSO_046 or SSO_047 and SSO_048. The GFP constructs were fused to the capsule transporter promoter by overlap PCR, one copy with restriction sites for BamHI and HindIII and the second copy with restriction sites HindIII and KpnI. Each copy was first ligated into pBCKS and inserts were confirmed by sequencing. The second copy was subsequently ligated into the first copy pBCKS vector using restriction sites HindIII and KpnI. One copy of mKate2 (Addgene #68441) was fused to a strong promoter from the Anderson collection (Table 2) by overlap PCR using primers SSO_065 and SSO_066 and ligated into the two copy pBCKS vector through restriction sites NotI and BamHI. A control plasmid was constructed by replacing the two promoter regions capprom with a triple stop codon by restriction-free cloning using primers SSO_621/SSO_622 and SSO_623/SSO_624, respectively. Plasmid DNA was isolated using Nucleospin Plasmid kit (Macherey Nagel) and all plasmids were confirmed by sequencing.

Imaging of dual reporter in THP-1 cells and A. castellanii

Bacteria expressing the dual reporter constructs (pSS016 or pSS017) were grown to PE phase in BYE medium with 5 μg/ml chloramphenicol. Differentiated THP-1 cells were infected at an MOI of 10 in a μClear 96-well plate (Greiner) for 1 hour. Cells were washed three times in PBS and supplemented with fresh RPMI medium. Subsequently, cells were stained with CellMask Deep Red Plasma Membrane Stain (Invitrogen, C10046) at 5 μg/ml for 20 minutes and washed once. Nuclei were stained with Hoechst dye (Invitrogen, H3570) at 1 μg/ml. Live imaging was performed at 40x magnification using the Opera Phenix confocal microscope (PerkinElmer). Images were obtained every hour and analyzed using the Harmony high-content analysis software (PerkinElmer). A. castellanii were infected in infection buffer at an MOI of 10 for 1 hour at 25°C. After one hour, cells were extensively washed in PBS to remove extracellular bacteria and maintained in infection buffer at 25°C. Cells were imaged at 40x magnification using the EVOS inverted digital microscope (Thermo Fisher).

Animals and in vivo infections

Mice used in this study were bred and maintained in institutional animal facilities of University of São Paulo—School of Medicine of Ribeirão Preto/SP. All mice were at least 8 weeks old at the time of infection and were in a C57BL/6 (Jax 000664) genetic background. For the survival and CFU experiments, approximately 10 and 7 mice per group were used, as indicated in the Figs 4A–4E and S9. For in vivo experiments, the mice were anesthetized with ketamine and xylazine (300 mg/kg and 30 mg/kg, respectively) by intraperitoneal injection followed by intranasal inoculation with 40 μl of RPMI 1640 containing bacteria. For CFU determination, the lungs were harvested and homogenized in 5 ml of RPMI 1640 in a tissue homogenizer (Power Gen 125; Thermo Scientific) [94,95]. Lung homogenates were diluted in RPMI and plated on BCYE agar plates containing streptomycin for CFU determination as previously described. For survival determination, mice were observed once a day with the measurement of their weight [21]. The care of the mice followed the institutional guidelines on ethics in animal experiments.

Bone marrow-derived dendritic cells and macrophages

Bone marrow-derived dendritic cells (BMDCs) and bone marrow-derived macrophages (BMDMs) were generated from C57BL/6 mice as previously described [96,97]. Mice were euthanized and bone marrow cells were obtained from femurs and tibias. BMDCs were harvested from femurs and differentiated with RPMI 1640 (Gibco, Thermo Fisher) containing 20% Fetal Bovine Serum (FBS, Gibco) and 20 ng/ml of recombinant GM-CSF (eBioscience), 2 mM L-glutamine (Sigma-Aldrich), 15 mM Hepes (Gibco) and 100 U/ml penicillin-streptomycin (Sigma-Aldrich) at 37°C with 5% CO2 for 7 days. The non-adherent/loosely adherent fraction was harvested by collecting the culture supernatant and carefully washing the plate with PBS. After centrifugation of the total volume collected, BMDCs were resuspended in RPMI 1640 supplemented with 10% FBS and plated as indicated. BMDMs were harvested from femurs and differentiated with RPMI 1640 (Gibco, Thermo Fisher) containing 20% FBS and 30% L929-Cell Conditioned Medium (LCCM), 2 mM L-glutamine (Sigma-Aldrich), 15 mM Hepes (Gibco) and 100 U/ml penicillin-streptomycin (Sigma-Aldrich) at 37°C with 5% CO2 for 7 days. Of note, in some experiments LCCM was replaced for 10% of a conditional medium from 3T3 cells stably expressing mouse MCSF. Cells were detached with cold PBS, resuspended in RPMI 1640 supplemented with 10% FBS and plated as indicated.

Replication and competition assays in Acanthamoeba castellanii

Amoeba trophozoites grown at 20°C were washed in infection buffer, seeded at 1x106/ml and left to adhere for one hour prior to infection. Bacteria were resuspended in infection buffer to an MOI of 0.1 and left to infect for 1 hour. Dilutions of an aliquot of input bacteria was plated on BCYE to determine CFUs used for infection (t0). After one hour of infection, amoeba were washed three times in PBS to remove extracellular bacteria and resuspended in infection buffer. Samples of 500 μl were taken at this timepoint (t1), centrifuged at 14000 rpm for 3 minutes and vortexed for one minute to break up amoebae. Samples were subsequently taken every 24 hours for seven days. Experiments were carried out in triplicates and CFUs were counted after three to four days of growth on BCYE at 37°C. Competition assay was carried out as previously described [98]. Briefly, A. castellanii (5 × 106 per flask) in infection buffer was infected at an MOI of 0.1 with a 1:1 mix of wild type L. longbeachae and ΔctrC mutant bacteria. The infected amoebae were grown for seven days at 37°C. Every two days, a sample of lysed amoebae was diluted 1:100 and used to infect a fresh flask of amoebae (100 μl homogenate per flask). Dilutions were plated on BCYE agar plates containing apramycin or not, to determine CFUs.

Infection of U2OS cells

Human osteosarcoma epithelial cells stably expressing Sec61β-GFP (U2OS-Sec61β-GFP) for labelling of the Endoplasmic Reticulum [99] were cultured in DMEM + GlutaMAX (Life Technologies), supplemented with 10% heat-inactivated FBS (Life Technologies). 20000 cells were seeded in DMEM in 96-well Greiner μClear plates and allowed to adhere before infection. Cells were infected with L. longbeachae at MOI 100 for two hours and extracellular bacteria were washed off using PBS. Cells were stained with Hoechst dye (Invitrogen, H3570) at 1 μg/ml to label nuclei. Live imaging was performed at 63x magnification at 37°C and 5% CO2 using the Opera Phenix confocal microscope (PerkinElmer). Images were analyzed using the Harmony high-content analysis software (PerkinElmer).

Replication assays in THP-1 cells

Infection assays of THP-1 cells (ATTC: TIB-202) were done as previously described [100]. Briefly, cells were seeded and differentiated into macrophage-like adherent cells in 12-well tissue culture trays (Falcon, BD lab ware) at a density of 2 x 105 cells/well. Stationary phase L. longbeachae were resuspended in serum free medium and added to cells at an MOI of 10. After 2 h of incubation, cells were treated with 100 μg/ml gentamycin for 30 minutes to kill extracellular bacteria. Infected cells were then washed before incubation with serum-free medium. At 2, 24, 48, and 72 h, THP-1 cells were lysed with 0.1% Triton X-100. The infection efficiency of the different L. longbeachae strains was monitored by determining the number of CFUs after plating on BCYE agar.

Bacterial replication in BMDMs

For CFU determination, macrophages were seeded at 2×105 cells/well in 24-well plates and cultivated in RPMI 1640 with 10% FBS. Cultures were infected at a multiplicity of infection (MOI) of 10, centrifuged for 5 minutes at 200 ×g at room temperature. After 1 hour of infection, BMDMs were washed twice with PBS, and 1 ml of medium was added to each well. For CFU determination, the cultures were lysed in sterile water, and the cell lysates were combined with the cell culture supernatant from the respective wells. Lysates plus supernatants from each well were diluted in water, plated on BCYE agar plates, and incubated for 4 days at 37°C for CFU determination [94,95].

Beta-lactamase translocation assay

Translocation of T4SS effectors was performed as previously described [101]. Plasmids pXDC61 or SSM012 were electroporated into L. longbeachae strains or L. pneumophila strain Paris as a positive control. Triplicate wells of THP-1 cells were seeded in 96- well plates at 105 cells/well and differentiated into adherent cells with 50 μg/ml PMA for three days. Cells were recovered in RPMI without PMA for another night. Freshly transformed bacteria were induced by addition of 1 mM IPTG and THP-1 cells were infected at MOI 50 with stationary phase bacteria. Cells were subsequently centrifuged to synchronize the infection. At 1h30 after infection cell were incubated with CCF4-AM (Life Technologies) and 0.1 M probenecid at room temperature in the dark. After another 1.5 hours, cells were detached with non-enzymatic cell dissociation solution (Sigma). Flow cytometry was performed using a MACSQuant VYB system (Miltenyi Biotec), with excitation at 405 nm (violet) and emission collection with filters at 525/50 nm (Green) and 450/50 nm (Blue). Flow data were analyzed by FlowJo 10 software (LLC). Gates for green and blue fluorescence were set based on uninfected cells without any treatment. Western blots were performed on protein lysates from induced bacteria to confirm expression of blaM (see S10 Fig for gating strategy and Western blot).

Isolation of human monocyte-derived macrophages (hMDMs)

Ficoll gradient centrifugation (Lympholyte, Cedarlane) was performed to isolate human peripheral blood mononuclear cells (PMBCs) from freshly extracted blood from healthy donors. To isolate CD14+ cells, anti-hCD14 magnetic beads were used and isolated cells were differentiated to hMDMs by addition of 50 ng/ml rhM-CSF (R&D Systems) to XVivo medium (Lonza). After 3 days, medium was exchanged, and cells were differentiated for another 3 days in fresh XVivo supplemented with rhM-CSF. All donors gave written consent under the agreement C- CPSL UNT–No. 15/EFS/023 between the Institut Pasteur and EFS (L’Établissement français du sang), in accordance with articles L1243-4 and R1243-61 of the French Public Health Code and approved by the French Ministry of Science and Technology. Supply and handling of human blood cells followed official guidelines of the agreement between the Institut Pasteur, EFS, and the regulation of blood donation in France.

Bacterial replication, early apoptosis, and ROS production in hMDMs

Human monocyte-derived macrophages were seeded in XVivo medium (Lonza) at 37°C and 5% CO2. Cells were stained with CellTracker Blue (CMF2HC, Invitrogen) and Hoechst dye (Invitrogen, H3570) for 1 hour pre-infection, before washing the cells in PBS. Cells were subsequently infected with L. longbeachae expressing dsRed (plasmid SW001, kind gift from Hubert Hilbi) at MOI 10 for 1 hour and extracellular bacteria were removed by washing with PBS. To monitor ROS production, cells were stained with CellROX DeepRed (C10422, Invitrogen) for 30 minutes and dye was washed off as indicated by the manufacturer. To monitor early apoptosis, cells were stained with Annexin V AlexaFluor 488 dye for living cells (A13201, Invitrogen). Live cell imaging was performed using the Opera Phenix confocal microscope (PerkinElmer) and bacterial replication, early apoptosis, and ROS production in single infected cells were analyzed using the Harmony high-content analysis software (PerkinElmer).

Attachment and phagocytosis assays

THP-1 cells (ATTC: TIB-202) were seeded at 4x105 cells/well in 12 well plates in RPMI-10% FCS and differentiated for three days with 50 nM PMA. After 96 hours of differentiation, RPMI without PMA was used to recover the cells overnight. For attachment assays, cells were treated with 2 μM cytochalasin D (Sigma) for two hours prior to infection. Bacterial strains were grown in BYE overnight and bacterial growth was monitored until the bacteria reached post-exponential growth phase (OD600 3.7–4.2). The bacteria were diluted to reach an MOI of 10 in RPMI with or without 2 μM cytochalasin D for attachment assays. At the indicated timepoints, cells were washed three times with PBS to remove non-adhered bacteria and half of the wells were treated with 100 μg/ml gentamycin for one hour to kill extracellular bacteria (control for internalized bacteria). Cells were lysed by addition of ddH2O for 15’ at 37°C. Dilutions of CFUs were plated for both the gentamycin-treated and untreated wells to determine total CFUs vs. adhered CFUs, respectively. For phagocytosis assays, cells were washed at the indicated timepoints and treated with 100 μg/ml gentamycin for one hour to kill extracellular bacteria. Cells were lysed in ddH2O for 15 minutes at 37°C and dilutions were plated to determine CFUs. An aliquot of bacteria used for infections was plated for each strain to determine CFUs at t0.

Detergent, oxidative, and osmotic stress assays

To test the resistance of the capsule mutant to salt stress, bacteria were grown in BYE to PE phase (OD600 3.7–4.2) and diluted to 2x109/ml. Ten-fold dilutions were spotted in triplicates onto BCYE plates supplemented with 100 mM NaCl or plain BCYE plates and bacteria were grown at 37°C for 6 days. Tween-20 was tested as previously described [45]. Briefly, bacteria were grown in BYE medium to post-exponential growth phase (OD600 3.7–4.2), washed in ultrapure water and adjusted to an OD600 of 2.5. Subsequently, cells were treated with 0.05% Tween-20 ± 300 mM of either NaCl or sucrose for 30 minutes at 37°C with moderate shaking. Ten-fold dilutions were spotted in duplicates on BCYE plates and bacteria were grown at 37°C for 6 days. Similarly, for oxidative stress, post-exponential bacteria were washed once, adjusted to OD600 of 2.5, and incubated in the presence of 2 mM or 10 mM H2O2 for 30 minutes at 37°C with moderate shaking. Ten-fold dilutions were spotted onto BCYE agar plates in duplicates and bacteria were grown at 37°C for 6 days.

Agglutination assay

Bacteria were grown to post-exponential phase (OD600 3.7–4.2), washed in PBS adjusted to an OD600 of 2.5. Subsequently, agglutination was tested by adding 1 mg/ml yeast mannan (Sigma) to the bacterial solutions and incubation at 37°C for 15 minutes. Cells were subsequently observed at 100x magnification on an EVOS inverted digital microscope (Thermo Fisher).

Polysaccharide extractions, gel electrophoresis and HPLC analysis

Bacteria were grown to post-exponential growth phase in BYE medium and washed in PBS. For phenol extraction, cells were treated with 45% hot phenol for 30 minutes according to previous protocols [102]. The aqueous phase was subsequently extracted and extensively dialyzed against water to remove residual phenol. To remove nucleic acids and proteins, extracts were treated with DNase, RNase, and proteinase K, each overnight. After dialysis, extracts were ultracentrifuged using a Beckman Coulter Optima ultracentrifuge at 100 000 rpm for two hours. Samples were freeze-dried and resuspended in ultrapure water for analysis by Dionex and SDS gel electrophoresis. For enzymatic extractions of polysaccharides, bacterial cell pellets were treated with mutanolysin (Sigma) and lysozyme (Sigma) according to published protocols [42]. Cell debris was removed by centrifugation and extracts were treated with DNase, RNase, and proteinase K, and subsequently dialyzed against water. Following ultracentrifugation, extracts were resuspended in ultrapure water.

SDS gel electrophoresis was performed using pre-cast mPAGE 4–20% bis-tris gels (Merck) and 20 μl of PS extracts were mixed in Laemmli buffer and boiled at 95°C for 10 minutes. For silver staining, SDS gels were fixed in 45% ethanol solution containing 0.5% periodic acid (Sigma). After extensive washes in water, gels were submerged in 0.1% silver nitrate solution in water for 15 minutes. Gels were rinsed in water and developed in 3% sodium carbonate solution with added formaldehyde to fix the silver dye. Developer was neutralized by addition of citric acid (Sigma). For Alcian blue staining, gels were stained in 0.1% Alcian blue solution in 40% ethanol/5% acetic acid for 1 hour and destained in acetic acid solution [58]. For Stains-all staining, gels were fixed in 50% ethanol/10% acetic acid solution for 1 hour and extensively washed in water. A 0.1% Stains-all solution was prepared in water and gels were stained in the dark for 30 minutes. Gels were subsequently destained in water. For analysis of monosaccharides. monosaccharides were first released by acid hydrolysis (TFA 4 N, 4 hours at 100°C or HCl 6 N, 6 hours at 100°C). After vacuum drying of the hydrolysate, monosaccharides were identified and quantified by high performance anion exchange chromatography (HPAEC) with a pulsed electrochemical detector and an anion exchange column (CarboPAC PA-1, 4.6 x 250 mm, Dionex) using 18 mM NaOH as mobile phase at a flow rate of 1 mL/min; glucosamine and galactosamine were used as standards [103].

ELISA of human pro-inflammatory cytokines

Differentiated hMDMs were seeded at 3x104 cells per well in XVivo (Lonza) and infected with different bacterial strains at an MOI of 10. Cell supernatants were collected at 24 hours post-infection and centrifuged to remove cell debris and extracellular bacteria. The cleared cellular supernatants were rapidly frozen on dry ice and stored at -80°C until cytokine measurements were performed. ELISA was performed using the SP-X CorPlex Human Cytokine Panel 1 (Quanterix), a sandwich-based multiplex ELISA with higher sensitivity and broad range of detection of 10 human pro-inflammatory cytokines. The SP-X array was performed from 6 independent experiments according to the manufacturer’s instructions, including triplicate standard wells and duplicate wells for each sample. The data was analyzed using the proprietary SP-X analysis software.

ELISA of murine pro-inflammatory cytokines

For ELISA experiments, BMDMs and BMDCs were seeded in 24-well plates (5x105 cells/well). Infections were performed in RPMI 1640 supplemented with 10% FBS. After the indicate time points, the supernatants were collected for cytokine determination using ELISA kits according to the manufacturer’s recommendations (R&D and BD Bioscience).

Supporting information

S1 Table List of the highest hits of the L. longbeachae capsule cluster genes against the NCBI database (Trembl).

(PDF)

S2 Table Capsule cluster (CPS) gene identitiy among L. longbeachae strains compared to NSW150.

(PDF)

S3 Table List of genes up-or downregulated in exponential (E) compared to post-exponetial (PE) phase in the L. longbeachae WT strain compared to the capsule mutant strain.

(PDF)

S1 Fig The capsule cluster is conserved among different L. longbeachae strains.

Visualization of the gene content of the cluster capsule in serogroup 1 and serogroup 2 Legionella longbeachae strains using GeneSpy [107]. Genes coding for the capsule plus two flanking genes on either side are represented. To obtain homogeneous and comparable annotations, all the genome sequences were reannotated using PROKKA. Based on the new annotation files, gene names and biochemical functions are used to infer families, and a color is attributed for each one.

(TIF)

S2 Fig The L. longbeachae WT and capsule mutant grow at similar rates in BYE medium.

Llo WT or ΔctrC ± apramycin were grown in BYE medium at 37°C and OD600 was followed using a BioTek Synergy Plate Reader 2. Data show means ± SD of n = 3 independent experiments.

(TIF)

S3 Fig Growth phase dependent expression of the capsule and quantification of capsule complementation.

A) Llo WT bacteria were grown to E phase (OD600 2.0–2.5) or PE phase (OD600 3.7–4.2), fixed and stained with cationized ferritin for TEM imaging. Scale bar = 1μm. B) Macrocolonies of Llo WT or ΔctrC harboring an empty control plasmid (pBCKS) or the complementation plasmids (SSM073 or SSM083). Cells were grown to PE phase and 10 μl were spotted onto BCYE plates for 6 days. Colonies were imaged using a Leica M80 Stereo Microscope with top light and 1x magnification. C) Quantification of encapsulated bacteria from TEM images presented in Fig 2B. D) Llo WT with the empty vector and ΔctrC with the empty vector or the complementation vector were grown in BYE medium at 37°C and OD600 was followed using the Tecan Infinite M Nano plate reader. Data show means ± SD of n = 4 independent experiments.

(TIF)

S4 Fig Characterization and visualization of L. longbeachae cell wall polysaccharides.

A) Elution profiles of High-Performance Anion Exchange Chromatography. Top graph, standard reference hydrolyzed with TFA. Middle and bottom panel, bacterial phenol extracts hydrolyzed with HCl and TFA. Blue line, Llo WT; green line, Llo ΔctrC; black line, Lpp WT. B) SDS gel electrophoresis of phenol extracts stained with silver nitrate or Alcian blue. C) Gel electrophoresis of extracts from Llo WT, ΔctrC or Lpp WT grown at 20°C in BYE to different optical densities and stained with Stains-all dye. QuiN, quinovosamine; GalN, galactosamine; GlcN, glucosamine; Gal, galactose; Glc, glucose; Man, mannose; Xyl, xylose; UC_sn, supernatants after ultracentrifugation; UC_P, pellets after ultracentrifugation; E, exponential; PE, post-exponential.

(TIF)

S5 Fig L. longbeachae is inherently more resistant to detergent and oxidative stress than L. pneumophila.

Bacteria were grown to PE phase (OD600 3.7–4.2) in BYE medium for each experiment. A) Treatment with Tween-20 ± 300 mM NaCl or 300 mM sucrose. B) Treatment with 2 mM or 10 mM H2O2. Representative images of n = 2 independent experiments.

(TIF)

S6 Fig Growth of L. longbeachae WT and capsule mutant strains under salt stress, compared to L. pneumophila.

Cells were grown to PE phase (OD600 3.7–4.2) in BYE medium and spotted onto BCYE plates ± NaCl. Representative images of n = 3 independent experiments.

(TIF)

S7 Fig RNAseq data of L. longbeachae WT vs. capsule mutant in E and PE phase (WT is the reference).

A) Comparison of E phase bacteria. B) Comparison of PE phase bacteria. WT vs. ΔctrC (WT is the reference); consider relevant genes with log2 fold change of ±2 and adjusted p value ≤ 0.05. n = 4 independent experiments.

(TIF)

S8 Fig The L. longbeachae capsule is transcribed upon infection of Acanthamoeba castellanii.

A. castellanii was infected with Llo WT bacteria harboring the dual reporter plasmid (pSS017) at MOI 10 and 25°C for 1 hour. Cells were imaged 48 hours post-infection using an EVOS inverted digital microscope. Scale bar = 50 μm.

(TIF)

S9 Fig Survival of mice infected with 106 bacteria.

A) Female C57BL/6 mice were infected with 106 bacteria and survival was monitored over ten days. Survival was monitored for 9 mice per group.

(TIF)

S10 Fig Gating strategy for beta-lactamase translocation assay and Western Blot confirming the expression of BlaM-constructs in L. longbeachae.

A) Gating strategy for flow cytometry. Cells were gated on THP-1 cells, and single cells were gated by FSC and SSC. Within the single cell population, gates for the signal showing the blue channel and the green channel were set based on non-infected stained cells. B) Original Western Blot showing the expression of BlaM-constructs with the known T4SS effectors LphD and RomA in L. longbeachae.

(TIF)

S11 Fig The L. longbeachae WT and capsule mutant replicate in the LCV and recruit the ER marker Sec61b to the vacuole.

A) U2OS cells constitutively expressing Sec61-GFP were infected with Llo WT, ΔctrC or ΔdotB at MOI 100 and LCV formation was followed over time. Note that both Llo WT and ΔctrC recruit Sec61b early in infection (white arrows), but not ΔdotB (see image inlets). Green: Sec61b-GFP; yellow: L. longbeachae; blue: Hoechst dye. Representative images of n = 3 independent experiments. Scale bar = 50 μm.

(TIF)

S12 Fig Annexin V and ROS production in infected hMDMs.

A) hMDMs were infected at MOI 10 with Llo WT, ΔctrC or ΔdotB and labelled with Annexin V dye for early apoptosis induction at 20 hours post-infection. B) hMDMs were infected at MOI 10 with Llo WT, ΔctrC or ΔdotB and labelled with CellROX dye for ROS production at 20 hours post-infection. Data show mean fluorescence intensity (MFI) ±SD of infected cells for n = 3 independent experiments. Statistical analysis was performed by one-way ANOVA. ns, non-significant.

(TIF)

S13 Fig The L. longbeachae WT and capsule mutant replicate to similar levels in THP-1 cells and murine BMDMs.

A) Differentiated THP-1 cells were infected at MOI 10 for 1 hour and treated with gentamycin to kill extracellular bacteria. CFUs were plated every 24 hours and normalized to the input control. Data show means ± SD of n = 6 independent experiments B) Bone marrow-derived macrophages (BMDMs) were infected at MOI 10 and CFUs plated every 24 hours normalized to the input control. Data show means ± SD of n = 3 independent experiments.

(TIF)

S14 Fig The capsule mutant agglutinates in the presence of yeast mannan.

Bacteria were grown to PE phase (OD600 3.7–4.2), washed, and treated with 1 mg/ml yeast mannan for 15 minutes. Scale bar = 10 μm.

(TIF)

S15 Fig Cytokine induction by capsule mutant and complemented mutant in murine cells and in vivo.

A-B) Murine bone-marrow derived macrophages (BMDMs) were infected with the capsule mutant or complemented strain at MOI 10 for 24 hours. A) IL-6 levels in cell supernatants. B) TNF-α levels in cell supernatants. C-D) Cytokine induction in vivo. Bronchoalveolar lavage fluid (BALF) of infected mice was collected 72 hours post-infection and levels of IL-6 and TNF-α were measured for Llo WT and ΔctrC, or non-infected mice. E) Protein levels in BALF were measured using Bradford assay from infected mice at 72 hours post-infection. Data points represent individual mice and show means ± SD. Statistical significance was tested by one-way ANOVA. ns, non-significant; *, p≤0.1; ** p≤0.01; ***, p≤0.001.

(TIF)

S1 Video Time-lapse confocal imaging of THP-1 infected with L. longbeachaeWT harboring the dual reporter plasmid for capsule transporter expression (as shown in Fig 3B).

Channels shown: blue, nuclei; green, inducible GFP expression of dual reporter plasmid; red, cell membrane. Infections were performed as described in Materials & Methods. Frames were acquired every hour from 2–23 hours post-infection.

(MP4)

S2 Video Time-lapse confocal imaging of THP-1 infected with L. longbeachae WT harboring the dual reporter plasmid for capsule transporter expression (as shown in Fig 3B).

Channels shown: blue, nuclei; yellow, constitutive mKate2 of dual reporter plasmid; red, cell membrane. Infections were performed as described in Materials & Methods. Frames were acquired every hour from 2–23 hours post-infection.

(MP4)

S3 Video Time-lapse confocal imaging of THP-1 infected with L. longbeachae WT harboring the triple-stop control plasmid of the dual reporter shown in S1 and S2 Videos (as shown in Fig 3B).

Channels shown: blue, nuclei; green, inducible GFP expression of control plasmid; red, cell membrane. Infections were performed as described in Materials & Methods. Frames were acquired every hour from 2–23 hours post-infection.

(MP4)

S4 Video Time-lapse confocal imaging of THP-1 infected with L. longbeachae WT harboring the triple-stop control plasmid of the dual reporter shown in S1 and S2 Videos (as shown in Fig 3B).

Channels shown: blue, nuclei; yellow, constitutive mKate2 of control plasmid; red, cell membrane. Infections were performed as described in Materials & Methods. Frames were acquired every hour from 2–23 hours post-infection.

(MP4)

We thank Hayley Newton for kindly gifting us the Llo ΔdotB mutant and David Bikard for sfGFP. Further we thank the Institut Pasteur UTechs CB platform for cytometry and biomarkers for assistance with SP-X ELISA measurements.

10.1371/journal.ppat.1012534.r001
Decision Letter 0
Wolfgang Matthew C. Section Editor
Kubori Tomoko Academic Editor
© 2024 Wolfgang, Kubori
2024
Wolfgang, Kubori
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

13 Feb 2024

Dear Dr. Buchrieser,

Thank you very much for submitting your manuscript "The unique Legionella longbeachae capsule favors intracellular replication and immune evasion" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

The reviewers appreciate the presented importance of a Llo capsule in bacterial virulence. However, they raised several concerns on presentation of the experimental data aimed to support the main conclusion that the capsule is crucial for bacterial replication in host organisms.

According to all the reviewers’ comments, the authors need to substantially edit the manuscript (text/ data presentation/ figure design/ data organization) in addition to the requested experiments before submitting the revised version of the manuscript.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Tomoko Kubori, Ph.D.

Academic Editor

PLOS Pathogens

Matthew Wolfgang

Section Editor

PLOS Pathogens

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

The reviewers appreciate the presented importance of a Llo capsule in bacterial virulence. However, they raised several concerns on presentation of the experimental data aimed to support the main conclusion that the capsule is crucial for bacterial replication in host organisms.

According to all the reviewers’ comments, the authors need to substantially edit the manuscript (text/ data presentation/ figure design/ data organization) in addition to the requested experiments before submitting the revised version of the manuscript.

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The manuscript by Schmidt et al. reports the characterization of Legionella longbeachae capsule as a new virulence factor that confers L. longbeachae its virulence in vivo in mice and its natural host Acanthamoeba castellani. The manuscript's content is interesting, but the structure of the text impairs the reading. Paragraphs should be rearranged (e.g. salt stress in the middle of the in vivo/in cellulo experiments; paragraphs with eukaryotic cells, then mice, then cytokines on cells again). Mice experiments are the strongest and should represent the last part of the results. The title “The unique Legionella longbeachae capsule favors intracellular replication and immune evasion” doesn’t seem to fully fit the manuscript as no strong evidence is presented (no experiment on LCV, microscopy imaging on replication/evasion, no difference on THP-1/BMDM replication in FigS8).

Reviewer #2: The paper convincingly demonstrates that in contrast to Legionella pneumophila (Lp), Legioenlla longbeachae (Llo) expresses a highly anionic capsule and that capsule formation can be disrupted by a mutation in the gene ctrC. The manuscript furthermore convincingly demonstrates that a ctrC mutant is less virulent in both amoebal and murine hosts. In case of mammalian cell infection, cell culture data implicates a role for capsule in phagocytosis avoidance and limitation of a proinflammatory cytokine response. Therefore, evasion of an immune response may underlie the virulence potential of the capsule in mice. However, whether these cell culture observations are linked to what happens during an in vivo infection was not further explored.

The MS provides evidence that a ctrC mutant has a growth defect within amoeba but not within human monocytic THP1 cells or murine bone marrow derived macrophages – these data thus suggest that loss of virulence in amoeba vs the mammalian host is mechanistically distinct. The MS does not provide any mechanistic model to account for the virulence defect in amoeba. The latter question warrants at least at some further discussion.

The data presentation/ figure design/ data organization could be substantially improved to render figures more reader-friendly and the content of the entire MS more readily digestible. Not all experimental designs include all the expected controls and/or meaningful timepoints. Despite these various shortcomings, this work constitutes an intriguing and important contribution to the Legionella literature.

Reviewer #3: This study characterises a polysaccharide capsule produced by Legionella longbeachae (Llo). Capsules are unprecedented across the Legionella genus and so the discovery of this genetic locus and the composition of the capsule is of interest. The authors identified that capsule expression is growth phase dependent and that the capule comprises highly anionic polysaccharide, although they did not define the carbohydrate composition. A capsule mutant (delta ctrC) showed defects in intracellular replication in Acanthamoeba and reduced virulence in a mouse infection model, which defines the capsule as a major virulence factor of Llo. This adds to knowledge of the role of capsules in bacterial virulence although this has been shown previously for different pathogens. I think the authors need to reevaluate some of the conclusions as outlined in my comments.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: The authors stated that the capsule is expressed in eukaryotic hosts, but there is no explanation/experiment that could explain the benefit of having this capsule. It would be interesting to design Llo WT and ΔctrC expressing GFP (or immunostaining) to decipher their replicative behavior: are they both in LCV? Does the capsule favor the survival? Are the bacteria egressing the cells by killing them? Is the capsule used for abiotic adherence?

Reviewer #2: There are couple of ‘straightforward’ experiments that would significantly strengthen the MS, as they would interconnect some of the observations made in this MS and provide more insights into the virulence mechanism of the Llo capsule. While desirable, I don’t consider these experiments essential for acceptance of the MS:

- data in Fig6 indicate that the Llo capsule reduces immune stimulation as assessed by IL-6 and IL-1beta secretion in murine DCs and BMDMs. Do these immunomodulatory activities observed in cell culture correlate with similar observations in vivo, possibly indicative of a causative link? I think the study would be significantly strengthened if cytokines were measured in BALF of Wt vs ctrC mutant infected animals

- it is intriguing that the ctrC mutant has a cell-autonomous growth defect in amoeba but not in the tested mammalian cells. Why would that be? And by what mechanism would the capsule provide Llo with a competitive advantage within amoeba ( but not mammalian cells). It would be helpful if the authors could provide some discussion on this topic (and maybe streamline the current – somewhat meandering – version of the MS Discussion

- Is the cytokine phenotype functionally linked to the block in phagocytosis? A simple cytoD experiment would address this question

Reviewer #3: Major comments

1. Fig 4E, F, how was statistical analysis and standard deviation done on n=2? Surely n=3 is the minimum for this calculation.

2. Fig. 4D, does the capsule mutant survive and persist in broth similar to wt over this time, ie. is the effect just due to the presence of amoebae?

3. Although the authors show that phagocytosis of delta CtrC is increased in THP-1 cells, the mutant shows no reduction in replication in these cells and BMDM. The mouse virulence effects would suggest otherwise. I’m not sure I understand the explanation for this in the sentence (line 241) “In contrast, when we infected human macrophage-like THP-1 cells or murine bone marrow-derived macrophages in vitro, we observed only a slight replication defect of the capsule mutant as compared to the WT, indicating that successful infection by L. longbeachae depends on the interaction of immune cells with the capsule in vivo” What is the evidence for this, what immune cells are implicated here, or is the capsule mutant simply more susceptible to complement mediated bacterial killing in vivo? This could at least be tested in vitro

4. In Fig 5 and 6, the authors move away from THP-1 cells to primary macrophages and murine bone-marrow derived dendritic cells. These experiments have not controlled for bacterial load. If the increased phagocytosis in THP-1 cells of the CtrC mutant is consistent in these cells, this would directly relate to the cytokine response. ie. increased bacterial load leads to increased production of cytokines. Hence the idea that the capsule inhibits cytokine production or contributes to a low cytokine level is not correct.

5. Related to the point above, have the authors tested cell death of macrophages upon infection with wt and the ctrC mutant, which could also explain differences in cytokine secretion

6. Fig. A-C, why was fold change used here and not pg/mL which is the usual way to express a cytokine response. Biological relevance is much easier to judge with the latter.

7. Line 333, I’m not sure I understand statement that “IL-6 and TNF are highly induced upon infection with the L. longbeachae ΔdotB mutant. However, TNF and IL-1b secretion in human macrophages does not seem to be driven by the capsule but are rather dependent on the presence of a functional Dot/Icm T4SS” when there is no difference statistically and huge variability in data points among the strains/samples (Fig6A-C). The only significant result shown was in IL-6 between the capsule mutant and complemented strain (not even between the wt and crtC mutant). I think these results have been overinterpreted.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: The capsule is known to protect bacteria from antibiotics. Have you tried to test the potential sensitivity of the capsulated/non-capsulated strains for several antibiotics?

The paragraph “Encapsulated L. longbeachae is more sensitive to salt stress” could be placed after the “The highly anionic L. longbeachae capsule is resistant to silver staining.” as it interferes with the reading of the in vivo/in cellulo section.

Line 39-40/53: The word “crucial” is overstated.

Line 49: Missing “.”

Line 64: Rephrase – Gardening activity is a risk factor.

Line 85: Ref after infection

Line 106: Wild type is written in line 84 and an abbreviation should be put here.

Line 130-132: Rephrase, the word “indicate” should be replaced by “suggest”.

Line 140-142: The conclusion seems too strong compared to the data, you could qualify it.

Line 166-168: “80% of the cells express the capsule…” instead.

Line 168-170: Rephrase the conclusion.

Line 230: “and” instead of “at”

Line 652: Typo

Line 1091: “images”

Line 1116: ΔctrC

Line 1119: “MOI XYZ”

Line 1134: ΔctrC or ctrC mutant

Correct “gentamycin/gentamicin” in the text and figure legends.

References should be fixed (ex ref 36, 41, 78)

Figure 1: The names of the genes are missing.

Figure 2: C) “100” on the ladder

Figure S2: ΔctrC

Figure S3: The legend doesn’t match the figure.

Figure S4: “Llo WT; red line” but it appears black on the figure.

Figure S8: Y-axis for the two figures is different. The y-axis of FigS7B is not expressed in log10CFU, is it on purpose?

Figure 2A/B: Have you tried to knock-out ctrB, ctrD or bexD to see if the capsule was missing and then do a complementation? The complementation only restores 50% of the phenotype, if you need two other genes to restore the capsule expression, your ctrC deletion might have impeded the expression of the genes downstream as well. These points should be discussed later in the manuscript as several other genes could be involved in the phenotype observed. “ctrC is mainly responsible for its expression on the cell surface” is then an overstatement at this stage.

Figure 2C/D: The capsule characterization should be strengthened. Are the exopolysaccharides surface-associated and/or secreted? Could the PS observed on WesternBlot? What are the genes involved in the first step of the synthesis of the polysaccharides?

Figure S2: Please add the strain ΔctrC+empty as it is used later in the manuscript.

Figure 3A/Figure S4: A control of the RNAseq could be included with RTqPCR on a few genes (for example ctrC, ctrD and bexD). As stated in the M&M, the exponential phase is reached at OD600 2.0-2.5 and the post-exponential phase OD600 3.7-4.2 but the stationary phase of the stains is obtained OD600 around 1.2 in FigS2. Is OD600 2.0-2.5 truly an exponential phase?

Figure S5: The mutant being ΔctrC, I would expect no data for the gene.

Line 204-206: The statement “This showed that almost all genes of the capsule cluster in the L. longbeachae WT strain were significantly downregulated in PE as compared to E phase (Figure 3A). This correlates with the visualization of the capsule in the PE phase (Figure S3A).” is challenging to apprehend. Is the expression of these genes that delayed compared to their transcription (timewise)? Overall, it would have been interesting to have an RNAseq on the intracellular bacteria at different time points to strengthen the statement.

Figure 3B: The authors should provide a quantification of the mKate2/GFP of the bacteria in several infected cells.

- Some bacteria seem to express mKate2 but not sfGFP, are those extracellular or intracellular?

- Does an antibiotic was used to kill extracellular bacteria for this experiment (not written in the M&M)? If gentamicin is used to kill extracellular bacteria; the MIC of each strain should be assessed.

- Is the GFP detected at 14 hours for the THP-1 and the amoebae? Does the GFP signal change over time? The authors are showing 22hrs and 24hrs images in Figures 3B and S6 but the GFP signal is stated to be detected at 14hrs. I would recommend showing a figure of the timelapse instead of just one time point.

- This experiment is carried out with PE-phase bacteria which, as indicated in the manuscript, express the capsule, have you tried using E-phase bacteria?

Figure S6: The shape of the amoebae is concerning and raises the question of their viability. Most of the bacteria seem to be extracellular, this experiment should show intracellular bacteria and a quantification.

- Can you explain why the experiment is done at 37°C while amoebae are usually kept at 20-25°C?

- Could the temperature influence the synthesis of the capsule?

Figure 4 C/D: The experiment in Fig4C shows ΔctrC replication compared to the ΔctrC+empty in FigD. These experiments should be done with both ΔctrC and ΔctrC+empty strains to exclude any effect of the empty plasmid.

- Why different MOI were used for Fig4C/D experiments (figure legend)? Can you comment on why changing the MOI seems to influence the replication of ΔctrC.

- Furthermore, the ΔctrC+compl strain is showing the same behavior as Llo WT while it has been shown that only 50% of the capsule is restored and 60% of the mice are surviving, can you comment?

Overall, the experiments on amoebae need to be strengthened, for example with microscopy images and quantification of intracellular replication to match the paragraph’s title.

Figure 4A/S7A: Is there a particular reason why you used 2 different bacterial loads? Do you have CFUs for the bacterial load of 107 with the ΔctrC+compl?

Figure 4F: The western blot and the flow cytometry data should be provided in a supplemental figure.

Figure 5: The authors should include the complemented strain for these experiments.

Figure S7B: The CFU of t=0 should be provided. I would recommend a later point for the ΔctrC to know if the mice are clearing the infection or if the infection is stabilized over time .

Figure S7C: Related to this figure, it would be interesting to know if the capsule of L. longbeachae protects from complement-mediated binding/killing.

Figure 6: It would have been nice to know the cytokine production in mice.

Reviewer #2: - Why were only female mice used in this study? Can we expect sex differences?

- legend fig.4 “A. castellanii trophozoites were infected at MOI XYZ” – seems like the placeholder xyz needs to be replaced by actual MOI

- the figures are not always very reader-friendly. The fonts can be too small (especially 3A), the graph lines can be very thin (Fig.4) and the panels not sufficiently self-explanatory (e.g. can the panels in Fig.4 be annotated so it’s immediately obvious whether these experiments were carried out in amoeba or mice without having to refer to the figure legend)

- along those lines: could the mouse and amoeba data be shown in two separate figures? I would also recommend moving some of the supplementary data into the main figure. FigS7A-C provides more information than current Fig.4A. I would also recommend showing Fig.S8 as a main figure, because I think it is important to contrast the growth defect of ctrC mutanat in amoeba with the lack thereof in macrophages

- Fig.4E y axis label – percent survival of what? Display competitive index data instead?

- Fig.4E – at 48 hpi WT completely outcompeted the ctrC mutant; the graph only shows 0 and 48 hpi data (all the later timepoints are superfluous and can be deleted) – to show these data as a line graph, timepoints between 0 and 48 hpi - that actually are intermediate datapoints – need to be included

- Fig.4E – this experiment was done as an n of 2?

- fig6 figure legend – I think it should be A-C) hMDMS not A- D)

- Figure 6 – in panels A – C cytokine data is depicted as fold change; in all other panels as mass/ volume (pg/mL). I would recommend showing data as mass/ volume for panels A- C as well, since mas/ volume data are much more informative than fold changes, e.g. by allowing readers to assess whether any of the cytokine measurements are in the physiological range

- ctrC mutant phenotypes were complemented for experiments in in hMDMs (Fig6 A-C) but not in murine DCs (D-F) or murin BMDM (G-I). Ideally complementation should be done for experiments in murine DCs/ BMDMs (D – I) as well

- Fig. 6 why does Llo not induce TNFalpha in THP1 cells when it does so robustly in murine BMDMs? Could the authors provide a positive control demonstrating that their THP1 cells can be activated for TNFalpha production? Without such a control the data shown in Fig6C are difficult to interpret

Reviewer #3: Minor comments

1. Line 242, there is no difference not a slight reduction in replication (Fig. S8)

2. Line 240 …. indicating that complementation partially restored virulence

3. Line 1119 MOI XYZ?

4. Line 1121 percentage survival of amoebae or bacteria?

5. Fig. 4F. What does percent secretion mean? This result is usually expressed as ratio blue/green fluorescence I think

6. Line 1144 …A-C not A-D

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Charles Van der Henst & Alexandra Maure

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

10.1371/journal.ppat.1012534.r002
Author response to Decision Letter 0
Submission Version1
4 Jul 2024

Attachment Submitted filename: Point by point answers.pdf

10.1371/journal.ppat.1012534.r003
Decision Letter 1
Wolfgang Matthew C. Section Editor
Kubori Tomoko Academic Editor
© 2024 Wolfgang, Kubori
2024
Wolfgang, Kubori
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
26 Aug 2024

Dear Dr. Buchrieser,

We are pleased to inform you that your manuscript 'The unique Legionella longbeachae capsule favors intracellular replication and immune evasion' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Tomoko Kubori, Ph.D.

Academic Editor

PLOS Pathogens

Matthew Wolfgang

Section Editor

PLOS Pathogens

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

The reviewers are fully satisfied with the revised manuscript and have no further concerns.

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: Dear,

I can see that the authors performed additional experiments and that the manuscript has improved significantly.

Reviewer #2: The reviewers addressed my main concerns. The paper makes an important discovery for the Legionella field and I fully support publication of the revised MS in PLoS Pathogens

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: NA

Reviewer #2: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: Fig S11: There is no white arrow on the images. Please add them or remove it from the legend.

Reviewer #2: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Charles Van der Henst

Reviewer #2: No

10.1371/journal.ppat.1012534.r004
Acceptance letter
Wolfgang Matthew C. Section Editor
Kubori Tomoko Academic Editor
© 2024 Wolfgang, Kubori
2024
Wolfgang, Kubori
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
7 Sep 2024

Dear Dr. Buchrieser,

We are delighted to inform you that your manuscript, "The unique Legionella longbeachae capsule favors intracellular replication and immune evasion," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064
==== Refs
References

1 Mondino S , Schmidt S , Rolando M , Escoll P , Gomez-Valero L , Buchrieser C . Legionnaires’ Disease: State of the Art Knowledge of Pathogenesis Mechanisms of Legionella. Annu Rev Pathol Mech Dis. 2020 Jan 24;15 (1 ):439–66.
2 Newton HJ , Ang DKY , van Driel IR , Hartland EL . Molecular Pathogenesis of Infections Caused by Legionella pneumophila. Clin Microbiol Rev. 2010 Apr;23 (2 ):274–98.20375353
3 Taylor M , Ross K , Bentham R . Legionella, Protozoa, and Biofilms: Interactions Within Complex Microbial Systems. Microb Ecol. 2009 Oct;58 (3 ):538–47.19365668
4 Steele TW , Lanser J , Sangster N . Isolation of Legionella longbeachae serogroup 1 from potting mixes. Appl Environ Microbiol. 1990 Jan;56 (1 ):49–53.1968736
5 Whiley H , Bentham R . Legionella longbeachae and Legionellosis. Emerg Infect Dis. 2011 Apr;17 (4 ):579–83.21470444
6 Amodeo MR , Murdoch DR , Pithie AD . Legionnaires’ disease caused by Legionella longbeachae and Legionella pneumophila: comparison of clinical features, host-related risk factors, and outcomes. Clin Microbiol Infect. 2010 Sep;16 (9 ):1405–7.19930271
7 Berger KH , Isberg RR . Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol Microbiol. 1993 Jan;7 (1 ):7–19.8382332
8 Lockwood DC , Amin H , Costa TRD , Schroeder GN . The Legionella pneumophila Dot/Icm type IV secretion system and its effectors. Microbiology. 2022;168 (5 ).
9 Roy CR , Berger KH , Isberg RR . Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake. Mol Microbiol. 1998 Apr;28 (3 ):663–74.9632267
10 Segal G , Purcell M , Shuman HA . Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of the Legionella pneumophila genome. Proc Natl Acad Sci. 1998 Feb 17;95 (4 ):1669–74.9465074
11 Gomez-Valero L , Rusniok C , Carson D , Mondino S , Pérez-Cobas AE , Rolando M , et al . More than 18,000 effectors in the Legionella genus genome provide multiple, independent combinations for replication in human cells. Proc Natl Acad Sci. 2019 Feb 5;116 (6 ):2265–73.30659146
12 Burstein D , Amaro F , Zusman T , Lifshitz Z , Cohen O , Gilbert JA , et al . Genomic analysis of 38 Legionella species identifies large and diverse effector repertoires. Nat Genet. 2016 Feb;48 (2 ):167–75.26752266
13 Cazalet C , Gomez-Valero L , Rusniok C , Lomma M , Dervins-Ravault D , Newton HJ , et al . Analysis of the Legionella longbeachae Genome and Transcriptome Uncovers Unique Strategies to Cause Legionnaires’ Disease. Matic I , editor. PLoS Genet. 2010 Feb 19;6 (2 ):e1000851.20174605
14 Slow S , Anderson T , Murdoch DR , Bloomfield S , Winter D , Biggs PJ . Extensive epigenetic modification with large-scale chromosomal and plasmid recombination characterise the Legionella longbeachae serogroup 1 genome. Sci Rep. 2022 Apr 6;12 (1 ):5810.35388097
15 Bacigalupe R , Lindsay D , Edwards G , Fitzgerald JR . Population Genomics of Legionella longbeachae and Hidden Complexities of Infection Source Attribution. Emerg Infect Dis. 2017 May;23 (5 ):750–7.28418314
16 Asare R , Santic M , Gobin I , Doric M , Suttles J , Graham JE , et al . Genetic Susceptibility and Caspase Activation in Mouse and Human Macrophages Are Distinct for Legionella longbeachae and L. pneumophila. Infect Immun. 2007 Apr;75 (4 ):1933–45.17261610
17 Gobin I , Susa M , Begic G , Hartland EL , Doric M . Experimental Legionella longbeachae infection in intratracheally inoculated mice. J Med Microbiol. 2009 Jun 1;58 (6 ):723–30.19429747
18 Molofsky AB , Byrne BG , Whitfield NN , Madigan CA , Fuse ET , Tateda K , et al . Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection. J Exp Med. 2006 Apr 17;203 (4 ):1093–104.16606669
19 Pereira MSF , Marques GG , DelLama JE , Zamboni DS . The Nlrc4 Inflammasome contributes to restriction of pulmonary infection by flagellated Legionella spp. that trigger pyroptosis. Front Microbiol. 2011;2 :33.21687424
20 Ren T , Zamboni DS , Roy CR , Dietrich WF , Vance RE . Flagellin-Deficient Legionella Mutants Evade Caspase-1- and Naip5-Mediated Macrophage Immunity. Isberg R , editor. PLoS Pathog. 2006 Mar 17;2 (3 ):e18.16552444
21 Massis LM , Assis-Marques MA , Castanheira FVS , Capobianco YJ , Balestra AC , Escoll P , et al . Legionella longbeachae is immunologically silent and highly virulent in vivo. J Infect Dis. 2016 Dec 8;jiw560.
22 Opoku-Temeng C , Kobayashi SD , DeLeo FR . Klebsiella pneumoniae capsule polysaccharide as a target for therapeutics and vaccines. Comput Struct Biotechnol J. 2019;17 :1360–6.31762959
23 Patro LPP , Rathinavelan T . Targeting the Sugary Armor of Klebsiella Species. Front Cell Infect Microbiol. 2019 Nov 8;9 :367.31781512
24 Hyams C , Camberlein E , Cohen JM , Bax K , Brown JS . The Streptococcus pneumoniae Capsule Inhibits Complement Activity and Neutrophil Phagocytosis by Multiple Mechanisms. Infect Immun. 2010 Feb;78 (2 ):704–15.19948837
25 Paton JC , Trappetti C . Streptococcus pneumoniae Capsular Polysaccharide. Fischetti VA , Novick RP , Ferretti JJ , Portnoy DA , Braunstein M , Rood JI , editors. Microbiol Spectr. 2019 Apr 12;7 (2 ):7.2.33.
26 Spinosa MR , Progida C , Talà A , Cogli L , Alifano P , Bucci C . The Neisseria meningitidis Capsule Is Important for Intracellular Survival in Human Cells. Infect Immun. 2007 Jul;75 (7 ):3594–603.17470547
27 Tzeng YL , Datta AK , Strole CA , Lobritz MA , Carlson RW , Stephens DS . Translocation and Surface Expression of Lipidated Serogroup B Capsular Polysaccharide in Neisseria meningitidis. Infect Immun. 2005 Mar;73 (3 ):1491–505.15731047
28 Virji M. Pathogenic neisseriae: surface modulation, pathogenesis and infection control. Nat Rev Microbiol. 2009 Apr;7 (4 ):274–86. doi: 10.1038/nrmicro2097 19287450
29 Valcek A , Philippe C , Whiteway C , Robino E , Nesporova K , Bové M , et al . Phenotypic Characterization and Heterogeneity among Modern Clinical Isolates of Acinetobacter baumannii. Kumar A , editor. Microbiol Spectr. 2023 Feb 14;11 (1 ):e03061–22.36475894
30 Whiteway C , Valcek A , Philippe C , Strazisar M , De Pooter T , Mateus I , et al . Scarless excision of an insertion sequence restores capsule production and virulence in Acinetobacter baumannii. ISME J. 2022 May;16 (5 ):1473–7.34949784
31 Buffet A , Rocha EPC , Rendueles O . Nutrient conditions are primary drivers of bacterial capsule maintenance in Klebsiella. Proc R Soc B. 2021 Feb 5;288 (20202876 ).
32 Campos MA , Vargas MA , Regueiro V , Llompart CM , Albertí S , Bengoechea JA . Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides. Infect Immun. 2004 Dec;72 (12 ):7107–14. doi: 10.1128/IAI.72.12.7107-7114.2004 15557634
33 Geisinger E , Isberg RR . Antibiotic Modulation of Capsular Exopolysaccharide and Virulence in Acinetobacter baumannii. Weiss D , editor. PLOS Pathog. 2015 Feb 13;11 (2 ):e1004691.25679516
34 Jones A , Geörg M , Maudsdotter L , Jonsson AB . Endotoxin, Capsule, and Bacterial Attachment Contribute to Neisseria meningitidis Resistance to the Human Antimicrobial Peptide LL-37. J Bacteriol. 2009 Jun 15;191 (12 ):3861–8.19376861
35 Tipton KA , Chin CY , Farokhyfar M , Weiss DS , Rather PN . Role of Capsule in Resistance to Disinfectants, Host Antimicrobials, and Desiccation in Acinetobacter baumannii. Antimicrob Agents Chemother. 2018 Dec;62 (12 ):e01188–18.30297362
36 Wen Z , Zhang JR . Chapter 3—Bacterial Capsules. In: Tang YW , Sussman M , Liu D , Poxton I , Schwartzman J , editors. Molecular Medical Microbiology (Second Edition). Boston: Academic Press; 2015. p. 33–53.
37 Kaper JB , Nataro JP , Mobley HLT . Pathogenic Escherichia coli. Nat Rev Microbiol. 2004 Feb;2 (2 ):123–40.15040260
38 Steenbergen SM , Vimr ER . Biosynthesis of the Escherichia coli K1 group 2 polysialic acid capsule occurs within a protected cytoplasmic compartment. Mol Microbiol. 2008 Jun;68 (5 ):1252–67.18435708
39 Bacon DJ , Szymanski CM , Burr DH , Silver RP , Alm RA , Guerry P . A phase-variable capsule is involved in virulence of Campylobacter jejuni 81–176. Mol Microbiol. 2001;40 (3 ):769–77.11359581
40 Reid AN , Whitfield C . Functional Analysis of Conserved Gene Products Involved in Assembly of Escherichia coli Capsules and Exopolysaccharides: Evidence for Molecular Recognition between Wza and Wzc for Colanic Acid Biosynthesis. J Bacteriol. 2005 Aug;187 (15 ):5470–81.16030241
41 Lück C , Helbig JH . Characterization of Legionella Lipopolysaccharide. In: Buchrieser C , Hilbi H , editors. Legionella: Methods and Protocols. Totowa, NJ: Humana Press; 2013. p. 381–90.
42 McNally DJ , Jarrell HC , Khieu NH , Vinogradov E , Szymanski CM , Brisson JR . The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups. FEBS J. 2005;272 (17 ):4407–22.16128810
43 Lüneberg E , Zähringer U , Knirel YA , Steinmann D , Hartmann M , Steinmetz I , et al . Phase-variable Expression of Lipopolysaccharide Contributes to the Virulence of Legionella pneumophila. J Exp Med. 1998 Jul 1;188 (1 ):49–60.9653083
44 Souza Andrade JP , Pacheco Oliveira C , Freire Tovar AM , de Souza Mourao PA , Vilanova E . A color-code for glycosaminoglycans identification by means of polyacrylamidegel electrophoresis stained with the cationic carbocyanine dye Stains-all. Electrophoresis. 2018;39 :666–9. doi: 10.1002/elps.201700391 29105785
45 Aurass P , Kim S , Pinedo V , Cava F , Isberg RR . Identification of Genes Required for Long-Term Survival of Legionella pneumophila in Water. McMahon K , editor. mSphere. 2023 Apr 20;8 (2 ):e00454–22.
46 Hales LM , Shuman HA . The Legionella pneumophila rpoS Gene Is Required for Growth within Acanthamoeba castellanii. J Bacteriol. 1999 Aug 15;181 (16 ):4879–89.10438758
47 Tiaden A , Spirig T , Weber SS , Brüggemann H , Bosshard R , Buchrieser C , et al . The Legionella pneumophila response regulator LqsR promotes host cell interactions as an element of the virulence regulatory network controlled by RpoS and LetA. Cell Microbiol. 2007 Dec;9 (12 ):2903–20.17614967
48 Brüggemann H , Hagman A , Jules M , Sismeiro O , Dillies MA , Gouyette C , et al . Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila. Cell Microbiol. 2006 Aug;8 (8 ):1228–40.16882028
49 Kessler A , Schell U , Sahr T , Tiaden A , Harrison C , Buchrieser C , et al . The Legionella pneumophila orphan sensor kinase LqsT regulates competence and pathogen-host interactions as a component of the LAI-1 circuit: Legionella sensor kinase LqsT. Environ Microbiol. 2013 Feb;15 (2 ):646–62.23033905
50 Rolando M , Sanulli S , Rusniok C , Gomez-Valero L , Bertholet C , Sahr T , et al . Legionella pneumophila Effector RomA Uniquely Modifies Host Chromatin to Repress Gene Expression and Promote Intracellular Bacterial Replication. Cell Host Microbe. 2013 Apr;13 (4 ):395–405.23601102
51 García-Contreras R , Zhang XS , Kim Y , Wood TK . Protein Translation and Cell Death: The Role of Rare tRNAs in Biofilm Formation and in Activating Dormant Phage Killer Genes. Herman C , editor. PLoS ONE. 2008 Jun 11;3 (6 ):e2394. doi: 10.1371/journal.pone.0002394 18545668
52 Rollenske T , Burkhalter S , Muerner L , von Gunten S , Lukasiewicz J , Wardemann H , et al . Parallelism of intestinal secretory IgA shapes functional microbial fitness. Nature. 2021 Oct 28;598 (7882 ):657–61. doi: 10.1038/s41586-021-03973-7 34646015
53 Wen Z , Zhang JR . Bacterial Capsules. In: Molecular Medical Microbiology [Internet]. Elsevier; 2015 [cited 2023 Jan 11]. p. 33–53. https://linkinghub.elsevier.com/retrieve/pii/B9780123971692000032.
54 Liu X , Boyer MA , Holmgren AM , Shin S . Legionella-Infected Macrophages Engage the Alveolar Epithelium to Metabolically Reprogram Myeloid Cells and Promote Antibacterial Inflammation. Cell Host Microbe. 2020 Nov;28 (5 ):683–698.e6. doi: 10.1016/j.chom.2020.07.019 32841604
55 Matsiota-Bernard P , Léfèbre C , Sedqui M , Cornillet P , Guenounou M . Involvement of tumor necrosis factor alpha in intracellular multiplication of Legionella pneumophila in human monocytes. Infect Immun. 1993 Dec;61 (12 ):4980–3.8225572
56 Koide M , Saito A , Okazaki M , Umeda B , Benson RF . Isolation of Legionella longbeachae Serogroup 1 from Potting Soils in Japan. Clin Infect Dis. 1999 Oct;29 (4 ):943–4.10589922
57 Steele TW , Moore CV , Sangster N . Distribution of Legionella longbeachae serogroup 1 and other Legionellae in potting soils in Australia. Appl Environ Microbiol. 1990 Oct;56 (10 ):2984–8.2285311
58 Karlyshev AV , Linton D , Gregson NA , Lastovica AJ , Wren BW . Genetic and biochemical evidence of a Campylobacter jejuni capsular polysaccharide that accounts for Penner serotype specificity: Genetics and biochemistry of C. jejuni LPS biosynthesis. Mol Microbiol. 2002 Apr 5;35 (3 ):529–41.
59 McNally DJ , Jarrell HC , Khieu NH , Li J , Vinogradov E , Whitfield DM , et al . The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group. FEBS J. 2006;273 (17 ):3975–89.16879613
60 Preston MA , Penner JL . Structural and antigenic properties of lipopolysaccharides from serotype reference strains of Campylobacter jejuni. Infect Immun. 1987 Aug;55 (8 ):1806–12.3301678
61 Cameron A , Frirdich E , Huynh S , Parker CT , Gaynor EC . Hyperosmotic Stress Response of Campylobacter jejuni. J Bacteriol. 2012 Nov 15;194 (22 ):6116–30.22961853
62 Da Cruz Nizer WS , Inkovskiy V , Versey Z , Strempel N , Cassol E , Overhage J . Oxidative Stress Response in Pseudomonas aeruginosa. Pathogens. 2021 Sep 14;10 (9 ):1187.34578219
63 Costerton JW , Irvin RT , Cheng KJ . The Bacterial Glycocalyx in Nature and Disease. Annu Rev Microbiol. 1981 Oct;35 (1 ):299–324. doi: 10.1146/annurev.mi.35.100181.001503 7027902
64 Kuzhiyil A , Lee Y , Shim A , Xiong A . Osmotic Stress Induces Kanamycin Resistance in Escherichia coli B23 through Increased Capsule Formation. 2012;16 .
65 Wang W , Cao Y , Li J , Lu S , Ge H , Pan S , et al . The impact of osmotic stresses on the biofilm formation, immunodetection, and morphology of Aeromonas hydrophila. Microbiol Res. 2023 Apr;269 :127301.36689842
66 Bortolussi R , Ferrieri P , Björkstén B , Quie P G . Capsular K1 polysaccharide of Escherichia coli: relationship to virulence in newborn rats and resistance to phagocytosis. Infect Immun. 1979 Jul 1;25 (1 ):293–8. doi: 10.1128/iai.25.1.293-298.1979 383617
67 Cortés G , Borrell N , De Astorza B , Gómez C , Sauleda J , Albertí S . Molecular Analysis of the Contribution of the Capsular Polysaccharide and the Lipopolysaccharide O Side Chain to the Virulence of Klebsiella pneumoniae in a Murine Model of Pneumonia. Infect Immun. 2002 May;70 (5 ):2583–90.11953399
68 Cress BF , Englaender JA , He W , Kasper D , Linhardt RJ , Koffas MAG . Masquerading microbial pathogens: capsular polysaccharides mimic host-tissue molecules. FEMS Microbiol Rev. 2014 Jul;38 (4 ):660–97. doi: 10.1111/1574-6976.12056 24372337
69 Lawlor MS , Hsu J , Rick PD , Miller VL . Identification of Klebsiella pneumoniae virulence determinants using an intranasal infection model: Klebsiella pneumoniae intranasal STM. Mol Microbiol. 2005 Nov;58 (4 ):1054–73.16262790
70 Sukupolvi-Petty S , Grass S , StGeme JW . The Haemophilus influenzae Type b hcsA and hcsB Gene Products Facilitate Transport of Capsular Polysaccharide across the Outer Membrane and Are Essential for Virulence. J Bacteriol. 2006 Jun;188 (11 ):3870–7.16707679
71 Tzeng YL , Thomas J , Stephens DS . Regulation of capsule in Neisseria meningitidis. Crit Rev Microbiol. 2015 Jun 19;1–14.23688248
72 Rowbotham TJ . Preliminary report on the pathogenicity of Legionella pneumophila for freshwater and soil amoebae. J Clin Pathol. 1980 Dec 1;33 (12 ):1179–83.7451664
73 Andrews HL , Vogel JP , Isberg RR . Identification of Linked Legionella pneumophila Genes Essential for Intracellular Growth and Evasion of the Endocytic Pathway. Infect Immun. 1998 Mar;66 (3 ):950–8.9488381
74 Marra A , Blander SJ , Horwitz MA , Shuman HA . Identification of a Legionella pneumophila locus required for intracellular multiplication in human macrophages. Proc Natl Acad Sci. 1992 Oct 15;89 (20 ):9607–11.1409673
75 Vogel JosephP , Andrews HL , Wong SK , Isberg RR . Conjugative Transfer by the Virulence System of Legionella pneumophila. Science. 1998 Feb 6;279 (5352 ):873–6.9452389
76 Wood RE , Newton P , Latomanski EA , Newton HJ . Dot/Icm Effector Translocation by Legionella longbeachae Creates a Replicative Vacuole Similar to That of Legionella pneumophila despite Translocation of Distinct Effector Repertoires. Roy CR , editor. Infect Immun. 2015 Oct;83 (10 ):4081–92.26216429
77 Derré I , Isberg RR . Legionella pneumophila Replication Vacuole Formation Involves Rapid Recruitment of Proteins of the Early Secretory System. Infect Immun. 2004 May;72 (5 ):3048–53.15102819
78 Evrard B , Balestrino D , Dosgilbert A , Bouya-Gachancard JLJ , Charbonnel N , Forestier C , et al . Roles of Capsule and Lipopolysaccharide O Antigen in Interactions of Human Monocyte-Derived Dendritic Cells and Klebsiella pneumoniae. Infect Immun. 2010 Jan;78 (1 ):210–9.19841082
79 Hsieh SA , Allen PM . Immunomodulatory Roles of Polysaccharide Capsules in the Intestine. Front Immunol. 2020 Apr 15;11 :690. doi: 10.3389/fimmu.2020.00690 32351514
80 Merino S , Tomás JM . Bacterial Capsules and Evasion of Immune Responses. In: John Wiley & Sons, Ltd, editor. 1st ed. Wiley; 2015. p. 1–10.
81 Akoolo L , Pires S , Kim J , Parker D . The Capsule of Acinetobacter baumannii Protects against the Innate Immune Response. J Innate Immun. 2022;14 (5 ):543–54.35320810
82 Raffatellu M , Chessa D , Wilson RP , Dusold R , Rubino S , Bäumler AJ . The Vi Capsular Antigen of Salmonella enterica Serotype Typhi Reduces Toll-Like Receptor-Dependent Interleukin-8 Expression in the Intestinal Mucosa. Infect Immun. 2005 Jun;73 (6 ):3367–74.15908363
83 Wilson RP , Raffatellu M , Chessa D , Winter SE , Tükel C , Bäumler AJ . The Vi-capsule prevents Toll-like receptor 4 recognition of Salmonella. Cell Microbiol. 2007 Nov 23;10 (4 ):876–90.18034866
84 Yoshida K , Matsumoto T , Tateda K , Uchida K , Tsujimoto S , Yamaguchi K . Role of bacterial capsule in local and systemic inflammatory responses of mice during pulmonary infection with Klebsiella pneumoniae. J Med Microbiol. 2000;49 :1003–10.11073154
85 Hsieh S , Porter NT , Donermeyer DL , Horvath S , Strout G , Saunders BT , et al . Polysaccharide Capsules Equip the Human Symbiont Bacteroides thetaiotaomicron to Modulate Immune Responses to a Dominant Antigen in the Intestine. J Immunol. 2020 Feb 15;204 (4 ):1035–46.31900343
86 Kim S , Vela A , Clohisey SM , Athanasiadou S , Kaiser P , Stevens MP , et al . Host-specific differences in the response of cultured macrophages to Campylobacter jejuni capsule and O-methyl phosphoramidate mutants. Vet Res. 2018 Dec;49 (1 ):3.29316981
87 Rose A , Kay E , Wren BW , Dallman MJ . The Campylobacter jejuni NCTC11168 capsule prevents excessive cytokine production by dendritic cells. Med Microbiol Immunol (Berl). 2012 May;201 (2 ):137–44.21863342
88 Zamboni DS , Kobayashi KS , Kohlsdorf T , Ogura Y , Long EM , Vance RE , et al . The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila infection. Nat Immunol. 2006 Mar;7 (3 ):318–25.16444259
89 Feeley JC , Gibson RJ , Gorman GW , Langford NC , Rasheed JK , Mackel DC , et al . Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila. J Clin Microbiol. 1979 Oct;10 (4 ):437–41.393713
90 Häuslein I , Manske C , Goebel W , Eisenreich W , Hilbi H . Pathway analysis using 13C-glycerol and other carbon tracers reveals a bipartite metabolism of Legionella pneumophila. Mol Microbiol. 2016;100 (2 ):229–46.26691313
91 Moffat JF , Tompkins LS . A quantitative model of intracellular growth of Legionella pneumophila in Acanthamoeba castellanii. Infect Immun. 1992 Jan;60 (1 ):296–301.1729191
92 Wiater LA , Sadosky AB , Shuman HA . Mutagenesis of Legionella pneumophila using Jn903 dllIacZ: identification of a growth-phase-regulated pigmentation gene. Mol Microbiol. 1994 Feb;11 (4 ):641–53.8196541
93 van den Ent F , Löwe J . RF cloning: A restriction-free method for inserting target genes into plasmids. J Biochem Biophys Methods. 2006 Apr;67 (1 ):67–74. doi: 10.1016/j.jbbm.2005.12.008 16480772
94 Mascarenhas DPA , Pereira MSF , Manin GZ , Hori JI , Zamboni DS . Interleukin 1 Receptor—Driven Neutrophil Recruitment Accounts to MyD88–Dependent Pulmonary Clearance of Legionella pneumophila Infection In Vivo. J Infect Dis. 2015 Jan 15;211 (2 ):322–30.25104770
95 Pereira MSF , Morgantetti GF , Massis LM , Horta CV , Hori JI , Zamboni DS . Activation of NLRC4 by Flagellated Bacteria Triggers Caspase-1–Dependent and—Independent Responses To Restrict Legionella pneumophila Replication in Macrophages and In Vivo. J Immunol. 2011 Dec 15;187 (12 ):6447–55.22079982
96 Lutz MB , Kukutsch N , Ogilvie ALJ , Rößner S , Koch F , Romani N , et al . An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods. 1999 Feb;223 (1 ):77–92. doi: 10.1016/s0022-1759(98)00204-x 10037236
97 Marim FM , Silveira TN , Lima DS , Zamboni DS . A Method for Generation of Bone Marrow-Derived Macrophages from Cryopreserved Mouse Bone Marrow Cells. Bozza PT , editor. PLoS ONE. 2010 Dec 17;5 (12 ):e15263. doi: 10.1371/journal.pone.0015263 21179419
98 Finsel I , Ragaz C , Hoffmann C , Harrison CF , Weber S , van Rahden VA , et al . The Legionella Effector RidL Inhibits Retrograde Trafficking to Promote Intracellular Replication. Cell Host Microbe. 2013 Jul;14 (1 ):38–50.23870312
99 Lomma M , Dervins-Ravault D , Rolando M , Nora T , Newton HJ , Sansom FM , et al . The Legionella pneumophila F-box protein Lpp2082 (AnkB) modulates ubiquitination of the host protein parvin B and promotes intracellular replication. Cell Microbiol. 2010 Sep;12 (9 ):1272–91.20345489
100 Sahr T , Escoll P , Rusniok C , Bui S , Pehau-Arnaudet G , Lavieu G , Buchrieser C . Translocated Legionella pneumophila small RNAs mimic eukaryotic microRNAs targeting the host immune response. Nat Commun. 2022 Feb 9;13 (1 ):762.35140216
101 Charpentier X , Gabay JE , Reyes M , Zhu JW , Weiss A , Shuman HA . Chemical Genetics Reveals Bacterial and Host Cell Functions Critical for Type IV Effector Translocation by Legionella pneumophila. Roy CR , editor. PLoS Pathog. 2009 Jul 3;5 (7 ):e1000501.19578436
102 Westphal O , Lüderitz O , Bister F . Über die Extraktion von Bakterien mit Phenol/Wasser. Z Für Naturforschung B. 1952 Mar 1;7 (3 ):148–55.
103 Talaga P , Vialle S , Moreau M . Development of a high-performance anion-exchange chromatography with pulsed-amperometric detection based quantification assay for pneumococcal polysaccharides and conjugates. Vaccine. 2002 Jun;20 (19–20 ):2474–84. doi: 10.1016/s0264-410x(02)00183-4 12057602
104 Cazalet C , Rusniok C , Brüggemann H , Zidane N , Magnier A , Ma L , et al . Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat Genet. 2004 Nov;36 (11 ):1165–73.15467720
105 Mampel J , Spirig T , Weber SS , Haagensen JAJ , Molin S , Hilbi H . Planktonic Replication Is Essential for Biofilm Formation by Legionella pneumophila in a Complex Medium under Static and Dynamic Flow Conditions. Appl Environ Microbiol. 2006 Apr;72 (4 ):2885–95.16597995
106 De Felipe KS , Glover RT , Charpentier X , Anderson OR , Reyes M , Pericone CD , et al . Legionella Eukaryotic-Like Type IV Substrates Interfere with Organelle Trafficking. Isberg RR , editor. PLoS Pathog. 2008 Aug 1;4 (8 ):e1000117.18670632
107 Garcia PS , Jauffrit F , Grangeasse C , Brochier-Armanet C . GeneSpy, a user-friendly and flexible genomic context visualizer. Hancock J , editor. Bioinformatics. 2019 Jan 15;35 (2 ):329–31. doi: 10.1093/bioinformatics/bty459 29912383
