
==== Front
Noncoding RNA
Noncoding RNA
ncrna
Non-Coding RNA
2311-553X
MDPI

10.3390/ncrna10050048
ncrna-10-00048
Article
Circulating miRNAs in the Plasma of Post-COVID-19 Patients with Typical Recovery and Those with Long-COVID Symptoms: Regulation of Immune Response-Associated Pathways
https://orcid.org/0000-0002-1270-7164
Timofeeva Anna M. Conceptualization Validation Investigation Resources Writing – review & editing Visualization Supervision Project administration 12*
https://orcid.org/0009-0004-2006-3022
Nikitin Artem O. Methodology Investigation Resources Writing – original draft Visualization 1
https://orcid.org/0000-0002-4988-8923
Nevinsky Georgy A. Writing – review & editing Funding acquisition 12
Santulli Gaetano Academic Editor
Gambardella Jessica Academic Editor
1 SB RAS Institute of Chemical Biology and Fundamental Medicine, 630090 Novosibirsk, Russia
2 Faculty of Natural Sciences, Novosibirsk State University, 630090 Novosibirsk, Russia
* Correspondence: anna.m.timofeeva@gmail.com
02 9 2024
10 2024
10 5 4812 7 2024
23 8 2024
27 8 2024
© 2024 by the authors.
2024
https://creativecommons.org/licenses/by/4.0/ Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Following the acute phase of SARS-CoV-2 infection, certain individuals experience persistent symptoms referred to as long COVID. This study analyzed the patients categorized into three distinct groups: (1) individuals presenting rheumatological symptoms associated with long COVID, (2) patients who have successfully recovered from COVID-19, and (3) donors who have never contracted COVID-19. A notable decline in the expression of miR-200c-3p, miR-766-3p, and miR-142-3p was identified among patients exhibiting rheumatological symptoms of long COVID. The highest concentration of miR-142-3p was found in healthy donors. One potential way to reduce miRNA concentrations is through antibody-mediated hydrolysis. Not only can antibodies possessing RNA-hydrolyzing activity recognize the miRNA substrate specifically, but they also catalyze its hydrolysis. The analysis of the catalytic activity of plasma antibodies revealed that antibodies from patients with long COVID demonstrated lower hydrolysis activity against five fluorescently labeled oligonucleotide sequences corresponding to the Flu-miR-146b-5p, Flu-miR-766-3p, Flu-miR-4742-3p, and Flu-miR-142-3p miRNAs and increased activity against the Flu-miR-378a-3p miRNA compared to other patient groups. The changes in miRNA concentrations and antibody-mediated hydrolysis of miRNAs are assumed to have a complex regulatory mechanism that is linked to gene pathways associated with the immune system. We demonstrate that all six miRNAs under analysis are associated with a large number of signaling pathways associated with immune response-associated pathways.

miRNA
COVID-19
long COVID
antibodies
catalytic antibodies
SARS-CoV-2
miRNA
RNA hydrolysis
miR-200c-3p
miR-766-3p
miR-142-3p
pathways
regulatory network
rheumatologically
Russian Science Foundation22-15-00103 Russian State-funded budget project of ICBFM SB RAS0245-2021-0009 (121031300041-4) This research was maintained by the Russian Science Foundation (Project 22-15-00103 to Georgy Nevinsky—all the research except for statistical analysis) and the Russian State-funded budget project of ICBFM SB RAS 0245-2021-0009 (121031300041-4) to Georgy Nevinsky—statistical analysis).
==== Body
pmc1. Introduction

MiRNAs are a class of noncoding RNAs that regulate the expression of numerous genes through degradation, translational repression, or activation of mRNAs [1] as they are involved in various biological processes such as regulation of immune response, immune cell differentiation, metabolism, apoptosis, cell cycle, and oncogenesis [2]. Numerous studies have demonstrated that miRNAs can be released into extracellular fluids [3]. Hence, extracellular miRNAs represent promising biomarkers for early diagnosis and prognosis of various diseases, as well as targets for therapy [4]. Moreover, miRNA-based drugs are expected to become the next generation of drugs for the treatment and prevention of various human diseases [5].

Various diseases, including viral infections, cause significant changes in the expression profile of miRNAs [6,7]. Currently, a large number of differentially expressed miRNAs associated with COVID-19 have been identified [8,9]. These studies identify miRNAs associated with severe COVID-19, and gene regulatory pathways to understand the underlying biological processes associated with COVID-19 [10]. For example, Nicoletti et al. [11] identified 18 plasma miRNAs that are differentially expressed in COVID-19 patients and controls, including miR-4433b-5p, miR-320b, and miR-16-2-3p. Expression of the miR-320 family (320a-3p, 320b, 320c, and 320d) is increased in patients with COVID-19 compared to healthy controls [12], and lower miR-320 expression is associated with death in patients [11,13]. Changes in the expression level of some miRNAs, such as miR-142-3p, miR-146b-5p, miR-148a-3p, miR-200c-3p, miR-370, miR-378a-3p, miR-483, miR-1246, and others, have been described during the acute period of SARS-CoV-2 infection [14,15,16]. Several miRNAs, such as miR-21, miR-143, miR-122, miR-133, miR-155, miR-208a, miR-499, miR-625, and others, are associated with disease severity [8,16,17]. Data on the expression of some miRNAs in COVID-19 are contradictory (e.g., miR-4433b-5p, miR-16-2-3p) [12,14,18,19], which is probably due to differences in the patient sample.

MiRNAs regulating the expression of viral genes are interesting. Several studies indicate that the interaction of host miRNAs with viral genes limits viral replication [20]. MiRNAs capable of targeting various regions of the SARS-CoV-2 genome, such as miR-197-5p and miR-18b-5p, have been identified [21,22].

MiRNA-mediated regulation has been shown not only for higher eukaryotes. To date, miRBase reports 30 viral miRNAs encoded by RNA viruses [23,24,25,26]. Several studies have demonstrated miRNAs originating from the SARS-CoV-2 genome [27,28,29].

Although most patients with COVID-19 fully recover, some experience lingering symptoms that may be related to previous SARS-CoV-2 infection (long COVID) [30]. The clinical manifestations associated with long-term COVID are incredibly heterogeneous and involve the respiratory system, gastrointestinal tract, joints, nervous system, endocrine system, etc. [31,32]. During the course of COVID-19, an important proportion of cases suffer from severe pneumonia and tend to have long-term sequelae [33]. Ongoing fibrosis during the recovery period results in decreased diffusion capacity of the lung [34]. There are a significant number of reports of patients with demyelinating pathologies such as Guillain–Barré syndrome, Miller–Fisher syndrome and others [35]. There is growing published data on a wide range of autoimmune diseases associated with SARS-CoV-2 [36,37]. To date, it has been confirmed that viral infections are associated with the development of various rheumatological diseases [38,39]. Medical experts have provided detailed descriptions and characterizations of certain cases, but the specific molecular mechanisms remain insufficiently researched.

Dysregulation of some miRNAs was suggested to lead to long COVID [40]. For example, miR-34a, contained in circulating extracellular vesicles, is associated with the risk of diabetes after COVID-19 infection [41]. Some miRNAs are involved in the pathogenesis of thromboembolic complications in COVID-19 [42]. For example, decreased expression of miR-103a, miR-145, and miR-885 and increased expression of miR-424 and miR-320 were found in a group of patients with a high frequency of thrombotic and ischemic events [43,44]. It has been shown that the concentration of exosomal miR-145 and miR-885 significantly correlates with D-dimer levels [45]. In some patients, SARS-CoV-2 causes an excessive immune response, resulting in a cytokine storm [46]. Some miRNAs are involved in the regulation of mediators associated with inflammation and appear to be important in some inflammatory diseases [47]. Significantly decreased miRNA-106a and miRNA-20a expression are associated with increased IL-10, TNF-α, INF-γ, and TLR-4 levels in COVID-19 patients [12,14,48]. This is not surprising since these miRNAs target proinflammatory cytokine genes (e.g., TNF, CCL2, CXCL9, IL10) and cytokine and chemokine receptors (IL1R1, IL2RA, IFNAR2) [49].

In light of the COVID-19 pandemic, extensive research has been dedicated to studying the immune response to the SARS-CoV-2 virus. Involved in the immune response to viral infection are catalytically active antibodies. These antibodies exhibit a dual function of antigen binding and catalyzing the hydrolysis of particular substrates, including proteins, nucleic acids, and polysaccharides [50,51]. To illustrate, antibodies displaying proteolytic activity were reported in several studies [52,53]. Additionally, there have been advancements in the creation of monoclonal antibodies that can directly hydrolyze the RNA of coronavirus and influenza virus [54,55,56,57]. Previous studies have described the capability of catalytically active antibodies to hydrolyze miRNAs in the context of autoimmune and neurological diseases [58,59,60,61].

Our study focused on evaluating the expression patterns of ten miRNAs in the plasma of COVID-19 patients, differentiating between those who had recovered without any complaints and those who continued to experience lingering rheumatological symptoms associated with long COVID. The focus of this study was to analyze the role of IgG in miRNA hydrolysis among COVID-19 patients. We proposed the idea that the presence of catalytically active antibodies with a specific affinity for particular miRNAs might lead to changes in the plasma concentration of these miRNAs through their hydrolysis. Also, among a large number of miRNA signaling pathways, pathways associated with the immune response have been identified.

2. Results

2.1. General Characteristics of the Patient Groups

Following the acute phase of SARS-CoV-2 infection, certain individuals were found to experience persistent symptoms referred to as long COVID [62]. Numerous respiratory, cardiovascular, autoimmune, neurological, and psychiatric diseases, along with their associated symptoms, have been documented in relation to long COVID [63,64,65,66,67,68]. Additionally, there are reports on the incidence of autoimmune diseases after SARS-CoV-2 infection [69,70,71]. The focus of this study was to identify and analyze a particular group of patients who presented complaints related to rheumatological conditions, known as the Lon group. We established a cohort of COVID-19 survivors who exhibited no post-recovery symptoms (Cov) and a control group of healthy individuals who had not contracted COVID-19 (Neg). The collection of blood plasma from COVID-19 patients occurred during the circulation of the Wuhan strain of SARS-CoV-2. Between summer 2020 and spring 2021, the epidemic in Russia was characterized by the spread of three lineages: B.1.1.7, B.1.1.317, and a sublineage of B.1.1 including B.1.1.397 [72]. The study did not include subjects vaccinated against SARS-CoV-2.

2.2. Analysis of miRNA Concentration in the Plasma of Patients

The concentrations of ten miRNAs (miR-l7f-5p, miR-146b-5p, miR-148a-3p, miR-200c-3p, miR-378a-3p, miR-9-5p, miR-766-3p, miR-3125, miR-4742-3p, and miR-142-3p) were studied in the blood plasma of patients in three groups. For this purpose, a reverse transcription method using appropriate stem-loop (SL) primers followed by real-time PCR was used. A calibration line was constructed using a standard with a known concentration to quantify the miRNA concentration. A standard was prepared using synthetic miRNA miR-148a-3p at concentrations of 10−1 ng/μL, 10−3 ng/μL, and 10−5 ng/μL. The quantification of cycle (Cq) values were calculated based on the amplification curves for different concentrations of synthetic miRNA. These values were used to create a calibration curve, and an equation was derived to accurately calculate the concentration of the researched miRNAs.

Figure 1 demonstrates statistically significant differences in the concentrations of miR-200c-3p, miR-766-3p, and miR-142-3p between patient groups. In the Lon group, there was a significant reduction in the expression of miR-200c-3p, miR-766-3p, and miR-142-3p compared to the other two groups. It was previously shown that in the acute phase of COVID-19 infection, patients experience the decreased expression of miR-142-3p [14,15,73]. Decreased miR-142-3p expression is associated with the inflammatory process [74,75,76]. Our results demonstrate that miR-142-3p levels remain lower after recovery compared to healthy patients. It is likely that normalization of miR-142-3p expression requires a longer time than 3–6 months after recovery.

The highest concentration of miR-200c-3p and miR-766-3p was identified in the group of patients with no complaints after COVID-19. In the post-recovery period, we observed a reduced expression of these miRNAs. However, an increase in miR-200c-3p was reported in studies undertaken during the acute period of SARS-CoV-2 infection [77]. Moreover, the increase in the severity of the disease correlates with an increase in the expression of miR-200c-3p [78,79]. miR-200c-3p directly targets the 3′-untranslated region of ACE2 mRNA, resulting in decreased ACE2 expression [80]. miR-200c-3p expression is induced via the NF-κB pathway during infection. In particular, the NF-κB signaling pathway is hyperactivated during SARS-CoV-2 infection, leading to the overexpression of miR-200c-3p in COVID-19 patients with active disease. This leads to a decrease in ACE2 protein levels [81]. Decreased ACE2 expression leads to decreased susceptibility to SARS-CoV-2 entry into the host cell [82]. Thus, miR-200c-3p during COVID-19 infection by regulating ACE2 expression reduces further virus penetration into the cell, limits the spread of the virus, and has a positive effect on the recovery process. It is logical to assume that after recovery, normalization of ACE2 expression is necessary; therefore, miR-200c-3p expression decreases, which leads to an increase in ACE2 protein production until normal levels are reached. This is confirmed by our results of decreased miR-200c-3p expression in recovered patients from 3–6 months after COVID-19.

Data in the literature on the role of miR-766-3p in COVID-19 are scarce. Downregulation of this miRNA has been described in acute respiratory distress syndrome patients [19]. Our results demonstrate that miR-766-3p levels remain reduced 3–6 months after recovery.

2.3. Analysis of the Catalytic Activity of Antibodies in the Hydrolysis of miRNAs

The affinity chromatography method utilizing immobilized G-protein allows for the extraction of antibody preparations from different biological fluids, guaranteeing the absence of any protein or enzyme impurities [83]. In this study, IgG preparations were isolated from the blood plasma of the patients of the three study groups. To substantiate the specific catalytic function attributed to immunoglobulins, we employed the methodologies proposed by C. Paul [84] and further developed by the group of G. A. Nevinsky [50], in a similar way as described in [53].

The examination of miRNA hydrolyzing activity involved the utilization of oligonucleotide sequences labeled with fluorescent tags, specifically designed to correspond to the tested miRNAs and distinguished by the prefix “Flu”. Oligonucleotide hydrolysis products were subjected to separation via a 20% polyacrylamide gel electrophoresis. Antibody activity in substrate hydrolysis was calculated by the decrease in the relative amount of the initial substrate in the reaction mixture compared to the control without IgG. The plasma antibodies of the patients were subjected to incubation with Flu-miRNAs. The nonparametric Kruskal–Wallis test (Figure 2) was utilized to evaluate the differentiation among the three patient groups.

The IgG preparations of the Lon group patients demonstrated higher Flu-miR-378a-3p (p < 0.05) and lower Flu-miR-146b-5p, Flu-miR-148a-3p (p < 0.001), and Flu-miR-766-3p (p < 0.0001) hydrolysis activity compared to the control group of patients. Antibody preparations from Cov patients hydrolyzed Flu-miR-4742-3p and Flu-miR-142-3p (p < 0.001) with higher activity and hydrolyzed Flu-miR-148a-3p (p < 0.0001) with lower activity compared to the control group of patients.

3. Discussion

Although miRNAs have attracted attention as potential biomarkers, their practical use in diagnostics has faced obstacles. With miRNAs being short sequences that exhibit a significant degree of similarity [85], a high-specificity method is required for accurately quantifying each miRNA. Currently, the RT-qPCR method is considered the most reliable technique for detecting miRNA. The sensitivity of RT-qPCR is remarkable, allowing for the detection of miRNA molecules at the single nucleotide level, even when present in very low concentrations in the attomolar range [86,87]. Typically, the quantitative analysis of RNA by RT-qPCR involves a two-step procedure: (i) Reverse transcription (RT) employed to create complementary DNA from the initial RNA and (ii) subsequent amplification of the DNA by PCR. The amplification process is monitored in real time using a specific dye (e.g., SYBR Green I) or a specific fluorescent probe. RT-qPCR was initially developed to quantitatively analyze long RNA sequences. This involved using PCR primers that are typically 20 bases long, equivalent to the size of a full-length miRNA. The issue was effectively addressed through the implementation of stem-loop (SL) primers [87]. SL primers enable reliable analysis of miRNAs at low concentrations, enhance result accuracy by ensuring sequence specificity, and mitigate the influence of genomic DNA contaminants. The accuracy of the method is greatly enhanced by its resistance to contaminants [87,88]. In this study, we used this method to determine the concentrations of miRNAs in the plasma of patients, with the focus on convalescent individuals. Throughout the period of recovery, a complex mechanism is implemented to control inflammatory processes, with miRNA serving as a single component of the overall puzzle. We detected an alteration in the expression of three miRNAs out of 10 miRNAs, namely, miR-200c-3p, miR-766-3p, and miR-142-3p. It is worth mentioning that among the patients experiencing rheumatologic complications of long COVID, a notable decrease in the expression of these miRNAs was observed.

One potential method for reducing miRNA concentrations is antibody-mediated hydrolysis. In addition to their ability to recognize specific substrates, antibodies with catalytic functions can also hydrolyze the substrate [89]. Hence, the isolation of IgG from the blood plasma of patients was followed by an assessment of their catalytic activity in the degradation of fluorescently labeled oligonucleotides corresponding to ten miRNAs. The analysis of antibody catalytic activity revealed that patients in the Lon group exhibited reduced activity in hydrolyzing Flu-miR-146b-5p, Flu-miR-766-3p, Flu-miR-4742-3p, and Flu-miR-142-3p sequences, but increased activity against Flu-miR-378a-3p compared to other patient groups. Lower concentrations of miRNAs correspond to lower activity of antibodies in miRNA degradation. Thus, changes in miRNA concentrations are not associated with their hydrolysis by antibodies, but are regulated by more intricate mechanisms. There is reason to believe that a decrease in the concentration of miRNAs in blood plasma is associated with a decrease in the concentration of corresponding antibodies with miRNA-hydrolyzing activity.

We hypothesized that changes in miRNA concentrations and antibody-mediated hydrolysis of miRNAs have a complex regulatory mechanism associated with gene pathways concerned with the immune system. Consequently, we conducted a more in-depth analysis of the target genes and pathways related to miR-200c-3p, miR-766-3p, miR-142-3p, miR-146b-5p, miR-4742-3p, and miR-378a-3p. The analysis framework is outlined in Figure S1 (Supplementary Materials). We searched for specific miRNA genes in the miRTarBase [90] and TargetScan [91] databases (accessed on 16 June 2024). Interactions between six specific miRNAs were observed with 1621 genes in the miRTarBase database and 1702 genes in the TargetScan database. Further analysis was conducted on a set of 338 common target genes, which were selected based on their association with six miRNAs. Then, gene-pathway associations were analyzed using the WikiPathways database [92,93] and pathways related to immune response regulation were selected (Figure 3).

Figure 3 clearly demonstrates the impact of all miRNAs on pathways related to the immune response. To illustrate, miR-200c-3p effectively targets 18 genes that are associated with a wide range of signaling pathways, including IL-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-18, IL-19, interferon type I, chemokine, T-cell, B-cell, and toll-like receptors signaling pathways. Consequently, the scientific literature has noted an increase in the expression of miR-200c-3p in viral infections, including influenza A [94]. miR-200c-3p is involved in the regulation of angiotensin-converting enzyme II (ACE2). ACE2 has many physiological functions in lung tissue, among which it physiologically hydrolyzes angiotensin II [95,96,97]. Overexpression of miR-200c-3p leads to increased angiotensin II concentrations [98]. It has proinflammatory and pro-oxidant effects, which causes vasoconstriction, increased inflammation, thrombosis, and increased collagen synthesis in lung fibroblasts [99,100]. This leads to acute lung injury, alveolar edema, and increased incidence of pulmonary fibrosis [101,102]. Pulmonary fibrosis is a well-known long-term complication of COVID-19, which may be caused by the same mechanism. It was shown that miR-200c-3p expression level increases with increasing disease severity in COVID-19 patients [78,79].

miR-142-3p is associated with 11 genes that influence the immune response through IL-1, IL-7, IL-11, IL-18, chemokine, T- and B-cell, toll-like receptor signaling pathways. miR-142-3p is an evolutionarily conserved vertebrate miRNA that exhibits expression in a variety of hematopoietic cells, including dendritic cells, monocytes, T cells, and B cells [103,104]. miR-142-3p plays an important role in the modulation of immune responses [105,106]. It was shown that miR-142-3p is part of a detrimental regulatory axis with proinflammatory cytokines IL-1β [107,108] and IL-6 [109] in COVID-19 patients, inducing a response associated with respiratory failure and death. miR-142 regulates the expression of occludin, which affects endothelial permeability [110,111,112], contributing to endothelial dysfunction [113,114,115]. This leads to thromboembolic events [116,117] in patients with severe COVID-19 [118,119,120].

miR-146b-5p, miR-378a-3p, and miR-766-3p are found to be associated with 7, 7, and 3 genes, respectively, and are known to be connected to diverse pathways involved in the immune response. Although miR-4742-3p is associated with just one gene, it shares common associations with IL-1, IL-18, IL-19, interferon type I, T- and B-cell, and toll-like receptor signaling pathways, just like the other miRNAs being considered. MiR-146b-5p and miR-378a-3p have been described as a tumor suppressor and anti-inflammatory effector [121,122]. Furthermore, the computational analysis determined the capacity of miR-4742-3p to bind to the RNA of SARS-CoV-2 and hinder the production of viral proteins [123].

In conclusion, our findings have revealed the changes in the expression of three specific miRNAs (miR-200c-3p, miR-766-3p, miR-142-3p) among COVID-19 survivors and individuals with long-COVID-related rheumatologic issues. These patients exhibited changes in the antibody-mediated hydrolysis activity of five specific miRNAs (Flu-miR-146b-5p, Flu-miR-378a-3p, Flu-miR-766-3p, Flu-miR-4742-3p, and Flu-miR-142-3p). Viral infection activates or represses the expression of cellular miRNAs, which in turn modulate the host response to infections [124]. MiRNAs are post-transcriptional regulators of gene expression. They target specific mRNA sequences and control protein production by binding to the untranslated region of the mRNA [125]. Many miRNAs are associated with the regulation of a large number of pathways. The bioinformatics methods allow us to identify the genes that miRNAs influence. In this work, we have shown that all miRNAs participate in a complex network of interactions. Numerous signaling pathways related to the immune system function have been associated with all these miRNAs. The study of the interplay between miRNAs and immune reactions in organisms holds significance in the field of modern biomedicine. It has the potential to greatly enhance our understanding of pathogenesis mechanisms, facilitate the development of diagnostic biomarkers, and inform treatment strategies for the consequences of not only COVID-19 but also other viral infections.

4. Materials and Methods

4.1. Donors and Patients

This study protocol underwent a thorough review and received approval from the local ethical committee at the ICBFM SB RAS, (the protocol of 15 August 2021). In accordance with the Helsinki Ethics Committee’s recommendations, patients and healthy donors were duly informed and gave consent for their blood donation for scientific purposes.

Venous blood was collected on an empty stomach using vacuum tubes that contained coagulation activators. The blood samples in the tubes underwent centrifugation at 3000× g for 10 min using a refrigerated Centrifuge 5810. The resulting plasma, which had been separated from red blood cells, was divided into 1 mL aliquots and stored at a temperature of −70 °C.

The patients involved in this study were categorized into 3 study groups:

Cov refers to patients who successfully recovered from COVID-19 without any complaints, with a total number of 24 donors. The blood plasma of the Cov group patients was collected in 2020–2021.

Lon refers to patients who experienced persistent rheumatologic symptoms alongside COVID-19. The Lon group was formed in 2021, with a total number of 16 donors. The patients were examined by a rheumatologist in dynamics, with most patients in this group complaining of joint and muscle pain (n = 16), fever to subfebrile digits (n = 15), fatigue and weakness (n = 13), shooting pains in the body (n = 7), increased anxiety related to their condition (n = 6), and numbness of extremities (n = 5).

Neg refers to conditionally healthy donors who did not have COVID-19, with a total number of 18 donors.

The characteristics of the study groups of patients are presented in Table S1. The composition of the groups was adjusted to ensure gender and age parity. ELISA was used to confirm the presence of persistent SARS-CoV-2 infection and the absence of infection in the control group, targeting the S- and N-proteins of the virus [53,126].

4.2. Isolation of miRNAs

MiRNA isolation from blood plasma samples was performed using the reagents from the “Total RNA and miRNA isolation kit” (LRU-100-50, Biolabmix, Russia, Novosibirsk) according to the manufacturer’s instructions. The isolated miRNA pool was stored in low sorption tubes at −20 °C. The RNA concentration was determined spectrophotometrically by measuring the absorbance at 260 nm.

4.3. Reverse Transcription Using SL-Primers

The reverse transcription reaction was performed using the OT kit M-MuLV-RH (Biolabmix, Novosibirsk, Russia) in combination with a specific SL-primer (Table 1). The reaction mixture comprised 2 μL of SL-primer (1 μM), 2 μL of the miRNA being tested, and 8 μL of DEPC pretreated water. The mixture was heated at 70 °C for 3 min to disrupt secondary structures and immediately cooled in ice. The subsequent addition involved a reaction mixture composed of 4 μL of 5 × OT buffer, 1 μL of M-MuLV-RH revertase (concentration: 10 units/μL), and 3 μL of DEPK-pretreated water.

Reverse transcription was performed in 45 cycles according to the following protocol:

1. 30 min at 16 °C;

2. (30 s at 30 °C, 30 s at 42 °C, 1 s at 50 °C) × 45;

3. 5 min at 85 °C.

4.4. Real-Time PCR

The cDNA generated by reverse transcription was analyzed using the BioMaster HS-qPCR PCR kit (Biolabmix, Novosibirsk, Russia). The reaction mixture (20 µL) contained 10 µL of BioMaster HS-qPCR (2×), 0.4 µL of forward primer (10 µM), 0.4 µL of universal reverse primer SL_rev (Table 2), 0.2 µL of universal probe with FAM dye (10 µM), 2 µL of cDNA (SL-OT product), and 7 µL of sterile water.

The amplification procedure included the following steps: 5 min at 95 °C, 45 cycles (20 s at 95 °C and 1 min at 55 °C). The fluorescent signal detection was performed through the FAM at the end of each cycle.

MiRNAs were quantified in the blood plasma using a synthetic miR-148a-3p with known concentration as normalization. A calibration curve was generated using synthetic miRNA at concentrations of 10–1 ng/µL, 10–3 ng/µL, and 10–5 ng/µL. Subsequently, OT-PCR and real-time PCR reactions were conducted. The construction of calibration curves involved the utilization of Microsoft Excel 2016 software and the analysis of four repeated measurements. The equation for the calibration curve was derived using CFX Maestro software version 2.3 (BioRad, Singapore, Tower): y = −2.384 ln(x) − 1.983, with y representing the Cq value obtained post-amplification, and x denoting the concentration.

4.5. Identification of IgG Activity in the miRNA Hydrolysis Reaction

IgGs were isolated from the blood plasma of patients using affinity chromatography on Protein-G-Sepharose similar to [127]. The efficiency of miRNA cleavage in 20% PAAG was used to determine the relative catalytic activity of IgG, as described in [58,59]. The reaction mixture (10 µL) contained 20 mM tris–HCl, pH 7.5; IgG preparation (0.1 mg/mL), and fluorescently labeled synthetic miRNA (Table 3), with a concentration from 0.09 to 0.39 f.u./mL (depending on the miRNA). The reaction mixture was incubated for 1 h at 37 °C. A reaction mixture without IgG was used as a control. Following the incubation, the reaction mixture was supplemented with 10 μL of denaturing buffer containing 8 M urea and 0.025% xylenecyanol. The marker (Leader) was procured via a process of limited alkaline hydrolysis, employing a bicarbonate buffer with a concentration of 0.05 M and miRNA concentrations ranging from 0.08 to 0.35 f.u./mL. The mixture was incubated for 15 min at 90 °C. After that, 10 µL of denaturing buffer was added. The hydrolysis products were analyzed using electrophoresis under denaturing conditions (20% acrylamide, 8 M urea, 1× TBE pH 8.3) at 800 V, 40 mA, for 2 h. The hydrolysis products were visualized using the iBright™ CL1500 Imaging System (Invitrogen™, Waltham, MA, USA), and the analysis was performed using the GelAnalyzer 23.1 software.

4.6. Statistical Analysis

The calculation of the significance of differences between patient groups was performed utilizing the Mann–Whitney U-test from the Python library SciPy v 1.11.4 [128] and the Kruskal–Wallis criterion from the standard R package v 4.3.2. The correlation coefficients between groups were computed using the nonparametric Spearman rank correlation method available in the Python library SciPy. The p-value was used to determine statistical significance, with a minimum threshold set at 0.05.

4.7. Target Predictions of the miRNAs Analyzed

The miRTarBase [90] and TargetScan [91] databases were utilized to search for target miRNA genes. This was performed through the CyTargetLinker 4.0.0+ application [129] (accessed on 15 June 2024). Subsequently, we utilized the WikiPathways database [92,93] to perform pathway analysis on the identified genes. Genes associated with the control of the immune response were specifically selected. The interaction network was visualized using Cytoscape 3.10.2.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ncrna10050048/s1, Table S1. Characteristics of the patients. Figure S1: Interaction networks between target genes and six miRNAs.

Author Contributions

Conceptualization, A.M.T.; methodology, A.O.N.; validation, A.M.T.; investigation, A.O.N. and A.M.T.; resources, A.O.N. and A.M.T.; writing—original draft preparation, A.O.N.; writing—review and editing, A.M.T. and G.A.N.; visualization, A.O.N. and A.M.T.; project administration, A.M.T.; funding acquisition G.A.N. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Local Ethics Committee of the Institute of Chemical Biology and Fundamental Medicine (Protocol Number 21-4 from 15 August 2020).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study. Written informed consent was obtained from all patients before their inclusion in the study.

Data Availability Statement

Empirical data that do not relate to the personal data of donors can be provided by Anna Timofeeva upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Figure 1 Examination of miRNA levels in the plasma of individuals within the three study cohorts: Lon refers to patients who experienced persistent rheumatologic symptoms alongside COVID-19, Cov denotes patients who successfully recovered from COVID-19 without any lingering complaints, and Neg represents disease-free donors. *—p-value < 0.05; **—p-value < 0.01; ***—p-value < 0.001, ****—p-value < 0.0001, ns—not significant.

Figure 2 The comparative activity of Flu-miRNA hydrolysis by plasma IgG preparations of patients in the three study groups. Lon refers to patients who experienced persistent rheumatologic symptoms alongside COVID-19, Cov denotes patients who successfully recovered from COVID-19 without any lingering complaints, and Neg represents disease-free donors. *—p-value < 0.05; **—p-value < 0.01; ***—p-value < 0.001, ns—not significant.

Figure 3 The network diagram of the interactions between target genes (highlighted in green) and six miRNAs (miR-200c-3p, miR-766-3p, miR-142-3p, miR-146b-5p, miR-4742-3p, miR-378a-3p) (highlighted in gray). The information is based on miRTarBase [90] and TargetScan [91] (accessed on 15 June 2024). The representation is limited to genes that regulate the immune response. Purple indicates the ontology of genes. The network is visualized using Cytoscape version 3.10.2.

ncrna-10-00048-t001_Table 1 Table 1 SL-primers used in the study.

Name	Nucleotide Sequence	
let–7f–5p SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACTAT–3′	
146b–5p SL	5′–GTTGGCTCTGGTGCGGGTCCGAGGTATTGCACCAAGAGCCAACCAGCCT–3′	
148a–3p SL	5′–GTTGGCTCTGGTGCGGGTCCGAGGTATTGCACCAAGAGCCAACACAAAG–3′	
200c–3p SL	5′–GTTGGCTCTGGTGCGGGTCCGAGGTATTGCACCAAGAGCCAACCTCCATC–3′	
378a–3p SL	5′–GTTGGCTCTGGTGCGGGTCCGAGGTATTGCACCAAGAGCCAACGCCTTC–3′	
9–5p SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTCATAC–3′	
766–3p SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGCTGAG–3′	
3125 SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTCTCTC–3′	
4742–3p SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCTGCAG–3′	
142–3p SL	5′–GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTCCATA–3′	

ncrna-10-00048-t002_Table 2 Table 2 Primers used in the study.

Name	Nucleotide Sequence	Length in Nucleotides	Melting Point (°C)	
let–7f–5p for	5′–GTTTGGTGAGGTAGTAGATTGT–3′	22	51	
146b–5p for	5′–GTTTTTCGTGAGAACTGAATTCCAT–3′	25	52.8	
148a–3p for	5′–GTTTTGGTCAGTGCACTACAGAA–3′	23	53.5	
200c–3p for	5′–GTTTGGTAATACTGCCGGGTAAT–3′	23	53.5	
378a–3p for	5′–GTTTTTGACTGGACTTGGAGTCA–3′	23	53.5	
9–5p for	5′–GUGGAAGACUUCGAGGCCUUG–3′	22	56.3	
766–3p for	5′–GAGCUUGGGAUAGAGGGCUUA–3′	22	54.4	
3125 for	5′–GCCAGCUGGAAGUUGAGGAAG–3′	22	56.3	
4742–3p for	5′–GCUUAGCUCGUGGUCCCGGAC–3′	21	60.2	
142–3p for	5′–UGGAGGAAGAGGUGGAGGAAG–3′	21	56.3	
Un rev primer	5′–GTGCAGGGTCCGAGGT–3′	16	51.1	

ncrna-10-00048-t003_Table 3 Table 3 5′-Flu-labeled oligoribonucleotides used as substrates in this study.

Flu-miR	Nucleotide Sequence	Length in Nucleotides	
Flu-let–7f–5p	5′–Flu–UGAGGUAGUAGAUUGUAUAGUU	22	
Flu-146b–5p	5′–Flu–UGAGAACUGAAUUCCAUAGCCUG	23	
Flu-148a–3p	5′–Flu–UCAGUGCACUACAGAACUUUGU	22	
Flu-200c–3p	5′–Flu–UAAUACUGCCGGGUAAUGAUGGA	23	
Flu-378a–3p	5′–Flu–ACUGGACUUGGAGUCAGAAGGC	22	
Flu-9–5p	5′–Flu–UCUUUGGUUAUCUAGCUGUAUGA	23	
Flu-766–3p	5′–Flu–ACUCCAGCCCCACAGCCUCAGC	22	
Flu-3125	5′–Flu–UAGAGGAAGCUGUGGAGAGA	20	
Flu-4742–3p	5′–Flu–UCUGUAUUCUCCUUUGCCUGCAG	23	
Flu-142–3p	5′–Flu–UGUAGUGUUUCCUACUUUAUGGA	23	

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
==== Refs
References

1. Kincaid R.P. Sullivan C.S. Virus-Encoded MicroRNAs: An Overview and a Look to the Future PLoS Pathog. 2012 8 e1003018 10.1371/journal.ppat.1003018 23308061
2. Intartaglia D. Giamundo G. Conte I. The Impact of MiRNAs in Health and Disease of Retinal Pigment Epithelium Front. Cell Dev. Biol. 2021 8 589985 10.3389/fcell.2020.589985 33520981
3. O’Brien J. Hayder H. Zayed Y. Peng C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation Front. Endocrinol. 2018 9 402 10.3389/fendo.2018.00402
4. Galvão-Lima L.J. Morais A.H.F. Valentim R.A.M. Barreto E.J.S.S. MiRNAs as Biomarkers for Early Cancer Detection and Their Application in the Development of New Diagnostic Tools Biomed. Eng. Online 2021 20 21 10.1186/s12938-021-00857-9 33593374
5. Dash S. Dash C. Pandhare J. Therapeutic Significance of MicroRNA-Mediated Regulation of PARP-1 in SARS-CoV-2 Infection Non-Coding RNA 2021 7 60 10.3390/ncrna7040060 34698261
6. Belmonte T. Perez-Pons M. Benítez I.D. Molinero M. García-Hidalgo M.C. Rodríguez-Muñoz C. Gort-Paniello C. Moncusí-Moix A. Madè A. Devaux Y. Addressing the Unsolved Challenges in MicroRNA-Based Biomarker Development: Suitable Endogenous Reference MicroRNAs for SARS-CoV-2 Infection Severity Int. J. Biol. Macromol. 2024 269 131926 10.1016/j.ijbiomac.2024.131926 38688344
7. Wicik Z. Eyileten C. Nowak A. Keshwani D. Simões S.N. Martins D.C. Klos K. Wlodarczyk W. Assinger A. Soldacki D. Alteration of Circulating ACE2-Network Related MicroRNAs in Patients with COVID-19 Sci. Rep. 2024 14 13573 10.1038/s41598-024-58037-3 38866792
8. Garcia-Giralt N. Du J. Marin-Corral J. Bódalo-Torruella M. Blasco-Hernando F. Muñoz-Bermúdez R. Clarós M. Nonell L. Perera-Bel J. Fernandez-González M. Circulating MicroRNA Profiling Is Altered in the Acute Respiratory Distress Syndrome Related to SARS-CoV-2 Infection Sci. Rep. 2022 12 6929 10.1038/s41598-022-10738-3 35484171
9. Togami Y. Matsumoto H. Yoshimura J. Matsubara T. Ebihara T. Matsuura H. Mitsuyama Y. Kojima T. Ishikawa M. Sugihara F. Significance of Interferon Signaling Based on MRNA-MicroRNA Integration and Plasma Protein Analyses in Critically Ill COVID-19 Patients Mol. Ther.-Nucleic Acids 2022 29 343 353 10.1016/j.omtn.2022.07.005 35855895
10. Gao L. Kyubwa E.M. Starbird M.A. Diaz de Leon J. Nguyen M. Rogers C.J. Menon N. Circulating MiRNA Profiles in COVID-19 Patients and Meta-Analysis: Implications for Disease Progression and Prognosis Sci. Rep. 2023 13 21656 10.1038/s41598-023-48227-w 38065980
11. de Souza Nicoletti A. Berlofa Visacri M. Regina da Silva Correa da Ronda C. Tiemi Siguemoto J. Motta Neri C. Nogueira de Souza R. de Souza Ventura D. Eguti A. Ferreira de Souza Silva L. Wesley Perroud Junior M. Increased Expression of MiR-320b in Blood Plasma of Patients in Response to SARS-CoV-2 Infection Sci. Rep. 2024 14 13702 10.1038/s41598-024-64325-9 38871789
12. Giannella A. Riccetti S. Sinigaglia A. Piubelli C. Razzaboni E. Di Battista P. Agostini M. Dal Molin E. Manganelli R. Gobbi F. Circulating MicroRNA Signatures Associated with Disease Severity and Outcome in COVID-19 Patients Front. Immunol. 2022 13 968991 10.3389/fimmu.2022.968991 36032130
13. Duecker R.P. Adam E.H. Wirtz S. Gronau L. Khodamoradi Y. Eberhardt F.J. Donath H. Gutmann D. Vehreschild M.J.G.T. Zacharowski K. The MiR-320 Family Is Strongly Downregulated in Patients with COVID-19 Induced Severe Respiratory Failure Int. J. Mol. Sci. 2021 22 10351 10.3390/ijms221910351 34638691
14. Li C. Hu X. Li L. Li J. Differential MicroRNA Expression in the Peripheral Blood from Human Patients with COVID-19 J. Clin. Lab. Anal. 2020 34 e23590 10.1002/jcla.23590 32960473
15. Meidert A.S. Hermann S. Brandes F. Kirchner B. Buschmann D. Billaud J.-N. Klein M. Lindemann A. Aue E. Schelling G. Extracellular Vesicle Associated MiRNAs Regulate Signaling Pathways Involved in COVID-19 Pneumonia and the Progression to Severe Acute Respiratory Corona Virus-2 Syndrome Front. Immunol. 2021 12 784028 10.3389/fimmu.2021.784028 34956213
16. Zeng Q. Qi X. Ma J. Hu F. Wang X. Qin H. Li M. Huang S. Yang Y. Li Y. Distinct MiRNAs Associated with Various Clinical Presentations of SARS-CoV-2 Infection iScience 2022 25 104309 10.1016/j.isci.2022.104309 35502319
17. Garg A. Seeliger B. Derda A.A. Xiao K. Gietz A. Scherf K. Sonnenschein K. Pink I. Hoeper M.M. Welte T. Circulating Cardiovascular microRNAs in Critically Ill COVID-19 Patients Eur. J. Heart Fail. 2021 23 468 475 10.1002/ejhf.2096 33421274
18. Nicoletti A.d.S. Visacri M.B. da Ronda C.R.d.S.C. Vasconcelos P.E.d.N.S. Quintanilha J.C.F. de Souza R.N. Ventura D.d.S. Eguti A. Silva L.F.d.S. Perroud Junior M.W. Differentially Expressed Plasmatic MicroRNAs in Brazilian Patients with Coronavirus Disease 2019 (COVID-19): Preliminary Results Mol. Biol. Rep. 2022 49 6931 6943 10.1007/s11033-022-07338-9 35301654
19. Najafipour R. Mohammadi D. Estaki Z. Zarabadi K. Jalilvand M. Moghbelinejad S. Screening for Differentially Expressed MicroRNAs in BALF and Blood Samples of Infected COVID-19 ARDS Patients by Small RNA Deep Sequencing J. Clin. Lab. Anal. 2022 36 e24672 10.1002/jcla.24672 36166345
20. tenOever B.R. RNA Viruses and the Host MicroRNA Machinery Nat. Rev. Microbiol. 2013 11 169 180 10.1038/nrmicro2971 23411862
21. Rad S.M.A.H. Wannigama D.L. Hirankarn N. McLellan A.D. The Impact of Non-Synonymous Mutations on MiRNA Binding Sites within the SARS-CoV-2 NSP3 and NSP4 Genes Sci. Rep. 2023 13 16945 10.1038/s41598-023-44219-y 37805621
22. Hosseini Rad SM A. McLellan A.D. Implications of SARS-CoV-2 Mutations for Genomic RNA Structure and Host MicroRNA Targeting Int. J. Mol. Sci. 2020 21 4807 10.3390/ijms21134807 32645951
23. Nanbo A. Furuyama W. Lin Z. RNA Virus-Encoded MiRNAs: Current Insights and Future Challenges Front. Microbiol. 2021 12 679210 10.3389/fmicb.2021.679210 34248890
24. Kozomara A. Griffiths-Jones S. MiRBase: Integrating MicroRNA Annotation and Deep-Sequencing Data Nucleic Acids Res. 2011 39 D152 D157 10.1093/nar/gkq1027 21037258
25. Grundhoff A. Sullivan C.S. Virus-Encoded MicroRNAs Virology 2011 411 325 343 10.1016/j.virol.2011.01.002 21277611
26. Cullen B.R. Five Questions about Viruses and MicroRNAs PLoS Pathog. 2010 6 e1000787 10.1371/journal.ppat.1000787 20195463
27. Greco F. Lorefice E. Carissimi C. Laudadio I. Ciccosanti F. Di Rienzo M. Colavita F. Meschi S. Maggi F. Fimia G.M. A MicroRNA Arising from the Negative Strand of SARS-CoV-2 Genome Targets FOS to Reduce AP-1 Activity Non-Coding RNA 2023 9 33 10.3390/ncrna9030033 37368333
28. Morales L. Oliveros J.C. Fernandez-Delgado R. TenOever B.R. Enjuanes L. Sola I. SARS-CoV-Encoded Small RNAs Contribute to Infection-Associated Lung Pathology Cell Host Microbe 2017 21 344 355 10.1016/j.chom.2017.01.015 28216251
29. Meng F. Siu G.K.-H. Mok B.W.-Y. Sun J. Fung K.S.C. Lam J.Y.-W. Wong N.K. Gedefaw L. Luo S. Lee T.M.H. Viral MicroRNAs Encoded by Nucleocapsid Gene of SARS-CoV-2 Are Detected during Infection, and Targeting Metabolic Pathways in Host Cells Cells 2021 10 1762 10.3390/cells10071762 34359932
30. Gracia-Ramos A.E. Martin-Nares E. Hernández-Molina G. New Onset of Autoimmune Diseases Following COVID-19 Diagnosis Cells 2021 10 3592 10.3390/cells10123592 34944099
31. Talotta R. Robertson E. Autoimmunity as the Comet Tail of COVID-19 Pandemic World J. Clin. Cases 2020 8 3621 3644 10.12998/wjcc.v8.i17.3621 32953841
32. Gollapudi S. Chimurkar V. Comprehensive Insights Into the Multi-Faceted Manifestations of COVID-19: A Narrative Review Cureus 2024 16 e63493 10.7759/cureus.63493 39081420
33. Sugino K. Ono H. Haraguchi S. Igarashi S. Hebisawa A. Tsuboi E. Post-coronavirus Disease 2019 Organizing Pneumonia Confirmed Pathologically by Video-assisted Thoracoscopic Surgery Respirol. Case Rep. 2021 9 e0871 10.1002/rcr2.871 34745634
34. Bazdyrev E. Rusina P. Panova M. Novikov F. Grishagin I. Nebolsin V. Lung Fibrosis after COVID-19: Treatment Prospects Pharmaceuticals 2021 14 807 10.3390/ph14080807 34451904
35. Abu-Rumeileh S. Abdelhak A. Foschi M. Tumani H. Otto M. Guillain–Barré Syndrome Spectrum Associated with COVID-19: An up-to-Date Systematic Review of 73 Cases J. Neurol. 2021 268 1133 1170 10.1007/s00415-020-10124-x 32840686
36. Kozłowski P. Leszczyńska A. Ciepiela O. Long COVID Definition, Symptoms, Risk Factors, Epidemiology and Autoimmunity: A Narrative Review Am. J. Med. Open 2024 11 100068 10.1016/j.ajmo.2024.100068 39034937
37. Roghani S.A. Dastbaz M. Lotfi R. Shamsi A. Abdan Z. Rostampour R. Soleymani B. Zamanian M.H. Soufivand P. Pournazari M. The Development of Anticyclic Citrullinated Peptide (Anti-CCP) Antibody Following Severe COVID-19 Immun. Inflamm. Dis. 2024 12 e1276 10.1002/iid3.1276 38780036
38. Ciaffi J. Vanni E. Mancarella L. Brusi V. Lisi L. Pignatti F. Naldi S. Assirelli E. Neri S. Reta M. Post-Acute COVID-19 Joint Pain and New Onset of Rheumatic Musculoskeletal Diseases: A Systematic Review Diagnostics 2023 13 1850 10.3390/diagnostics13111850 37296705
39. Migliorini F. Bell A. Vaishya R. Eschweiler J. Hildebrand F. Maffulli N. Reactive Arthritis Following COVID-19 Current Evidence, Diagnosis, and Management Strategies J. Orthop. Surg. Res. 2023 18 205 10.1186/s13018-023-03651-6 36922870
40. Reyes-Long S. Cortés-Altamirano J.L. Bandala C. Avendaño-Ortiz K. Bonilla-Jaime H. Bueno-Nava A. Ávila-Luna A. Sánchez-Aparicio P. Clavijo-Cornejo D. Dotor-LLerena A.L. Role of the MicroRNAs in the Pathogenic Mechanism of Painful Symptoms in Long COVID: Systematic Review Int. J. Mol. Sci. 2023 24 3574 10.3390/ijms24043574 36834984
41. Mone P. Jankauskas S.S. Manzi M.V. Gambardella J. Coppola A. Kansakar U. Izzo R. Fiorentino G. Lombardi A. Varzideh F. Endothelial Extracellular Vesicles Enriched in MicroRNA-34a Predict New-Onset Diabetes in Coronavirus Disease 2019 (COVID-19) Patients: Novel Insights for Long COVID Metabolic Sequelae J. Pharmacol. Exp. Ther. 2024 389 34 39 10.1124/jpet.122.001253 38336381
42. Izzo C. Visco V. Gambardella J. Ferruzzi G.J. Rispoli A. Rusciano M.R. Toni A.L. Virtuoso N. Carrizzo A. Di Pietro P. Cardiovascular Implications of MicroRNAs in Coronavirus Disease 2019 J. Pharmacol. Exp. Ther. 2023 384 102 108 10.1124/jpet.122.001210 35779946
43. Gambardella J. Santulli G. What Is Linking COVID-19 and Endothelial Dysfunction? Updates on Nanomedicine and Bioengineering from the 2020 AHA Scientific Sessions Eur. Hear. J.-Cardiovasc. Pharmacother. 2021 7 e2 e3 10.1093/ehjcvp/pvaa145 33377481
44. Fayyad-Kazan M. Makki R. Skafi N. El Homsi M. Hamade A. El Majzoub R. Hamade E. Fayyad-Kazan H. Badran B. Circulating MiRNAs: Potential Diagnostic Role for Coronavirus Disease 2019 (COVID-19) Infect. Genet. Evol. 2021 94 105020 10.1016/j.meegid.2021.105020 34343725
45. Gambardella J. Kansakar U. Sardu C. Messina V. Jankauskas S.S. Marfella R. Maggi P. Wang X. Mone P. Paolisso G. Exosomal MiR-145 and MiR-885 Regulate Thrombosis in COVID-19 J. Pharmacol. Exp. Ther. 2023 384 109 115 10.1124/jpet.122.001209 35772782
46. Ye Q. Wang B. Mao J. The Pathogenesis and Treatment of the `Cytokine Storm’ in COVID-19 J. Infect. 2020 80 607 613 10.1016/j.jinf.2020.03.037 32283152
47. Chandan K. Gupta M. Sarwat M. Role of Host and Pathogen-Derived MicroRNAs in Immune Regulation During Infectious and Inflammatory Diseases Front. Immunol. 2020 10 3081 10.3389/fimmu.2019.03081 32038627
48. Mohamed H.A. Abdelkafy A.E. Khairy R.M.M. Abdelraheim S.R. Kamel B.A. Marey H. MicroRNAs and Cytokines as Potential Predictive Biomarkers for COVID-19 Disease Progression Sci. Rep. 2023 13 3531 10.1038/s41598-023-30474-6 36864077
49. Liu Z. Yu H. Guo Q. MicroRNA-20a Promotes Inflammation via the Nuclear Factor-κB Signaling Pathway in Pediatric Pneumonia Mol. Med. Rep. 2017 17 612 617 10.3892/mmr.2017.7899 29115456
50. Nevinsky G.A. Buneva V.N. Natural Catalytic Antibodies in Norm, Autoimmune, Viral, and Bacterial Diseases Sci. World J. 2010 10 1203 1233 10.1100/tsw.2010.98
51. Tolmacheva A.S. Onvumere M.K. Sedykh S.E. Timofeeva A.M. Nevinsky G.A. Catalase Activity of IgGs of Patients Infected with SARS-CoV-2 Int. J. Mol. Sci. 2023 24 10081 10.3390/ijms241210081 37373231
52. McConnell S.A. Sachithanandham J. Mudrak N.J. Zhu X. Farhang P.A. Cordero R.J.B. Wear M.P. Shapiro J.R. Park H.-S. Klein S.L. Spike-Protein Proteolytic Antibodies in COVID-19 Convalescent Plasma Contribute to SARS-CoV-2 Neutralization Cell Chem. Biol. 2023 30 726 738.e4 10.1016/j.chembiol.2023.05.011 37354908
53. Timofeeva A.M. Shayakhmetova L.S. Nikitin A.O. Sedykh T.A. Matveev A.L. Shanshin D.V. Volosnikova E.A. Merkuleva I.A. Shcherbakov D.N. Tikunova N.V. Natural Antibodies Produced in Vaccinated Patients and COVID-19 Convalescents Hydrolyze Recombinant RBD and Nucleocapsid (N) Proteins Biomedicines 2024 12 1007 10.3390/biomedicines12051007 38790969
54. Lee G. Budhathoki S. Lee G.-Y. Oh K. Ham Y. Kim Y.-J. Lim Y. Hoang P. Lee Y. Lim S.-W. Broad-Spectrum Antiviral Activity of 3D8, a Nucleic Acid-Hydrolyzing Single-Chain Variable Fragment (ScFv), Targeting SARS-CoV-2 and Multiple Coronaviruses In Vitro Viruses 2021 13 650 10.3390/v13040650 33918914
55. Luong Q.X.T. Hoang P.T. Lee Y. Ayun R.Q. Na K. Park S. Lin C. Ho P.T. Lee T.-K. Lee S. An RNA-Hydrolyzing Recombinant Minibody Prevents Both Influenza A Virus and Coronavirus in Co-Infection Models Sci. Rep. 2024 14 8472 10.1038/s41598-024-52810-0 38605110
56. Hoang P.T. Luong Q.X.T. Ayun R.Q. Lee Y. Oh K.-J. Kim T. Lee T.-K. Lee S. A Synergistic Therapy against Influenza Virus A/H1N1/PR8 by a HA1 Specific Neutralizing Single-Domain VL and an RNA Hydrolyzing ScFv Front. Microbiol. 2024 15 1355599 10.3389/fmicb.2024.1355599 38706966
57. Lee Y. Hoang P. Kim D. Ayun R. Luong Q. Na K. Kim T. Oh Y. Kim W.-K. Lee S. A Therapeutically Active Minibody Exhibits an Antiviral Activity in Oseltamivir-Resistant Influenza-Infected Mice via Direct Hydrolysis of Viral RNAs Viruses 2022 14 1105 10.3390/v14051105 35632846
58. Ermakov E.A. Kabirova E.M. Sizikov A.E. Buneva V.N. Nevinsky G.A. IgGs-Abzymes from the Sera of Patients with Systemic Lupus Erythematosus Hydrolyzed MiRNAs J. Inflamm. Res. 2020 13 681 699 10.2147/JIR.S258558 33116748
59. Ermakov E.A. Kabirova E.M. Buneva V.N. Nevinsky G.A. IgGs-Abzymes from the Sera of Patients with Multiple Sclerosis Recognize and Hydrolyze MiRNAs Int. J. Mol. Sci. 2021 22 2812 10.3390/ijms22062812 33802122
60. Nevinsky G.A. Urusov A.E. Aulova K.S. Ermakov E.A. Experimental Autoimmune Encephalomyelitis of Mice: IgGs from the Sera of Mice Hydrolyze MiRNAs Int. J. Mol. Sci. 2023 24 4433 10.3390/ijms24054433 36901861
61. Ermakov E.A. Ivanova S.A. Buneva V.N. Nevinsky G.A. Hydrolysis by Catalytic IgGs of MicroRNA Specific for Patients with Schizophrenia IUBMB Life 2018 70 153 164 10.1002/iub.1712 29341394
62. Tesch F. Ehm F. Vivirito A. Wende D. Batram M. Loser F. Menzer S. Jacob J. Roessler M. Seifert M. Incident Autoimmune Diseases in Association with SARS-CoV-2 Infection: A Matched Cohort Study Clin. Rheumatol. 2023 42 2905 2914 10.1007/s10067-023-06670-0 37335408
63. Al-Aly Z. Xie Y. Bowe B. High-Dimensional Characterization of Post-Acute Sequelae of COVID-19 Nature 2021 594 259 264 10.1038/s41586-021-03553-9 33887749
64. Taquet M. Geddes J.R. Husain M. Luciano S. Harrison P.J. 6-Month Neurological and Psychiatric Outcomes in 236 379 Survivors of COVID-19: A Retrospective Cohort Study Using Electronic Health Records Lancet Psychiatry 2021 8 416 427 10.1016/S2215-0366(21)00084-5 33836148
65. Xie Y. Xu E. Bowe B. Al-Aly Z. Long-Term Cardiovascular Outcomes of COVID-19 Nat. Med. 2022 28 583 590 10.1038/s41591-022-01689-3 35132265
66. Xie Y. Xu E. Al-Aly Z. Risks of Mental Health Outcomes in People with COVID-19: Cohort Study BMJ 2022 376 e068993 10.1136/bmj-2021-068993 35172971
67. Xu E. Xie Y. Al-Aly Z. Long-Term Neurologic Outcomes of COVID-19 Nat. Med. 2022 28 2406 2415 10.1038/s41591-022-02001-z 36138154
68. Roessler M. Tesch F. Batram M. Jacob J. Loser F. Weidinger O. Wende D. Vivirito A. Toepfner N. Ehm F. Post-COVID-19-Associated Morbidity in Children, Adolescents, and Adults: A Matched Cohort Study Including More than 157,000 Individuals with COVID-19 in Germany PLOS Med. 2022 19 e1004122 10.1371/journal.pmed.1004122 36355754
69. Wang E.Y. Mao T. Klein J. Dai Y. Huck J.D. Jaycox J.R. Liu F. Zhou T. Israelow B. Wong P. Diverse Functional Autoantibodies in Patients with COVID-19 Nature 2021 595 283 288 10.1038/s41586-021-03631-y 34010947
70. Yazdanpanah N. Rezaei N. Autoimmune Complications of COVID-19 J. Med. Virol. 2022 94 54 62 10.1002/jmv.27292 34427929
71. Chang R. Yen-Ting Chen T. Wang S.-I. Hung Y.-M. Chen H.-Y. Wei C.-C.J. Risk of Autoimmune Diseases in Patients with COVID-19: A Retrospective Cohort Study eClinicalMedicine 2023 56 101783 10.1016/j.eclinm.2022.101783 36643619
72. Klink G.V. Safina K.R. Garushyants S.K. Moldovan M. Nabieva E. Komissarov A.B. Lioznov D. Bazykin G.A. Spread of Endemic SARS-CoV-2 Lineages in Russia before April 2021 PLoS ONE 2022 17 e0270717 10.1371/journal.pone.0270717 35857745
73. Tang H. Gao Y. Li Z. Miao Y. Huang Z. Liu X. Xie L. Li H. Wen W. Zheng Y. The Noncoding and Coding Transcriptional Landscape of the Peripheral Immune Response in Patients with COVID-19 Clin. Transl. Med. 2020 10 e200 10.1002/ctm2.200 33135345
74. O’Connell R.M. Rao D.S. Baltimore D. MicroRNA Regulation of Inflammatory Responses Annu. Rev. Immunol. 2012 30 295 312 10.1146/annurev-immunol-020711-075013 22224773
75. Sheedy F.J. Turning 21: Induction of MiR-21 as a Key Switch in the Inflammatory Response Front. Immunol. 2015 6 19 10.3389/fimmu.2015.00019 25688245
76. Cheng H.S. Sivachandran N. Lau A. Boudreau E. Zhao J.L. Baltimore D. Delgado-Olguin P. Cybulsky M.I. Fish J.E. MicroRNA-146 Represses Endothelial Activation by Inhibiting Pro-inflammatory Pathways EMBO Mol. Med. 2013 5 1017 1034 10.1002/emmm.201202318 23733368
77. Pimenta R. Viana N.I. Dos Santos G.A. Candido P. Guimarães V.R. Romão P. Silva I.A. de Camargo J.A. Hatanaka D.M. Queiroz P.G.S. MiR-200c-3p Expression May Be Associated with Worsening of the Clinical Course of Patients with COVID-19 Mol. Biol. Res. Commun. 2021 10 141 147 10.22099/mbrc.2021.40555.1631 34476267
78. Shaker O. El Amir M. Elfatah Y.A. Elwi H.M. Expression Patterns of LncRNA MALAT-1 in SARS-CoV-2 Infection and Its Potential Effect on Disease Severity via MiR-200c-3p and SIRT1 Biochem. Biophys. Rep. 2023 36 101562 10.1016/j.bbrep.2023.101562 37965063
79. Roustai Geraylow K. Hemmati R. Kadkhoda S. Ghafouri-Fard S. MiRNA Expression in COVID-19 Gene Rep. 2022 28 101641 10.1016/j.genrep.2022.101641 35875722
80. Nersisyan S. Shkurnikov M. Turchinovich A. Knyazev E. Tonevitsky A. Integrative Analysis of MiRNA and MRNA Sequencing Data Reveals Potential Regulatory Mechanisms of ACE2 and TMPRSS2 PLoS ONE 2020 15 e0235987 10.1371/journal.pone.0235987 32726325
81. Onabajo O.O. Banday A.R. Stanifer M.L. Yan W. Obajemu A. Santer D.M. Florez-Vargas O. Piontkivska H. Vargas J.M. Ring T.J. Interferons and Viruses Induce a Novel Truncated ACE2 Isoform and Not the Full-Length SARS-CoV-2 Receptor Nat. Genet. 2020 52 1283 1293 10.1038/s41588-020-00731-9 33077916
82. Hoffmann M. Kleine-Weber H. Schroeder S. Krüger N. Herrler T. Erichsen S. Schiergens T.S. Herrler G. Wu N.-H. Nitsche A. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor Cell 2020 181 271 280.e8 10.1016/j.cell.2020.02.052 32142651
83. Sensi S. Goebel A. Human Auto-IgG Purification from High Volume Serum Sample by Protein G Affinity Purification Bio-Protocol 2022 12 e4562 10.21769/BioProtoc.4562 36561118
84. Paul S. Li L. Kalaga R. Wilkins-Stevens P. Stevens F.J. Solomon A. Natural Catalytic Antibodies: Peptide-Hydrolyzing Activities of Bence Jones Proteins and VL Fragment J. Biol. Chem. 1995 270 15257 15261 10.1074/jbc.270.25.15257 7797511
85. Roush S. Slack F.J. The Let-7 Family of MicroRNAs Trends Cell Biol. 2008 18 505 516 10.1016/j.tcb.2008.07.007 18774294
86. Shi R. Chiang V.L. Facile Means for Quantifying Microrna Expression by Real-Time PCR Biotechniques 2005 39 519 525 10.2144/000112010 16235564
87. Chen C. Real-Time Quantification of MicroRNAs by Stem-Loop RT-PCR Nucleic Acids Res. 2005 33 e179 10.1093/nar/gni178 16314309
88. Mei Q. Li X. Meng Y. Wu Z. Guo M. Zhao Y. Fu X. Han W. A Facile and Specific Assay for Quantifying MicroRNA by an Optimized RT-QPCR Approach PLoS ONE 2012 7 e46890 10.1371/journal.pone.0046890 23071657
89. Ermakov E.A. Nevinsky G.A. Buneva V.N. Immunoglobulins with Non-Canonical Functions in Inflammatory and Autoimmune Disease States Int. J. Mol. Sci. 2020 21 5392 10.3390/ijms21155392 32751323
90. Papadopoulos G.L. Reczko M. Simossis V.A. Sethupathy P. Hatzigeorgiou A.G. The Database of Experimentally Supported Targets: A Functional Update of TarBase Nucleic Acids Res. 2009 37 D155 D158 10.1093/nar/gkn809 18957447
91. Lewis B.P. Burge C.B. Bartel D.P. Conserved Seed Pairing, Often Flanked by Adenosines, Indicates That Thousands of Human Genes Are MicroRNA Targets Cell 2005 120 15 20 10.1016/j.cell.2004.12.035 15652477
92. Agrawal A. Balcı H. Hanspers K. Coort S.L. Martens M. Slenter D.N. Ehrhart F. Digles D. Waagmeester A. Wassink I. WikiPathways 2024: Next Generation Pathway Database Nucleic Acids Res. 2024 52 D679 D689 10.1093/nar/gkad960 37941138
93. Pico A.R. Kelder T. van Iersel M.P. Hanspers K. Conklin B.R. Evelo C. WikiPathways: Pathway Editing for the People PLoS Biol. 2008 6 e184 10.1371/journal.pbio.0060184 18651794
94. Buggele W.A. Johnson K.E. Horvath C.M. Influenza A Virus Infection of Human Respiratory Cells Induces Primary MicroRNA Expression J. Biol. Chem. 2012 287 31027 31040 10.1074/jbc.M112.387670 22822053
95. Lelis D.d.F. Freitas D.F.d. Machado A.S. Crespo T.S. Santos S.H.S. Angiotensin-(1-7), Adipokines and Inflammation Metabolism 2019 95 36 45 10.1016/j.metabol.2019.03.006 30905634
96. Meng Y. Yu C.-H. Li W. Li T. Luo W. Huang S. Wu P.-S. Cai S.-X. Li X. Angiotensin-Converting Enzyme 2/Angiotensin-(1-7)/Mas Axis Protects against Lung Fibrosis by Inhibiting the MAPK/NF-ΚB Pathway Am. J. Respir. Cell Mol. Biol. 2014 50 723 736 10.1165/rcmb.2012-0451OC 24168260
97. Dalan R. Bornstein S.R. El-Armouche A. Rodionov R.N. Markov A. Wielockx B. Beuschlein F. Boehm B.O. The ACE-2 in COVID-19: Foe or Friend? Horm. Metab. Res. 2020 52 257 263 10.1055/a-1155-0501 32340044
98. Uhal B.D. Dang M. Dang V. Llatos R. Cano E. Abdul-Hafez A. Markey J. Piasecki C.C. Molina-Molina M. Cell Cycle Dependence of ACE-2 Explains Downregulation in Idiopathic Pulmonary Fibrosis Eur. Respir. J. 2013 42 198 210 10.1183/09031936.00015612 23100504
99. Verdecchia P. Cavallini C. Spanevello A. Angeli F. The Pivotal Link between ACE2 Deficiency and SARS-CoV-2 Infection Eur. J. Intern. Med. 2020 76 14 20 10.1016/j.ejim.2020.04.037 32336612
100. Nemeth Z. Kiss E. Takacs I. The Role of Epigenetic Regulator SIRT1 in Balancing the Homeostasis and Preventing the Formation of Specific “Soil” of Metabolic Disorders and Related Cancers Front. Biosci. 2022 27 253 10.31083/j.fbl2709253
101. Rossi G.A. Sacco O. Capizzi A. Mastromarino P. Can Resveratrol-Inhaled Formulations Be Considered Potential Adjunct Treatments for COVID-19? Front. Immunol. 2021 12 670955 10.3389/fimmu.2021.670955 34093569
102. Bourgonje A.R. Abdulle A.E. Timens W. Hillebrands J. Navis G.J. Gordijn S.J. Bolling M.C. Dijkstra G. Voors A.A. Osterhaus A.D. Angiotensin-converting Enzyme 2 (ACE2), SARS-CoV-2 and the Pathophysiology of Coronavirus Disease 2019 (COVID-19) J. Pathol. 2020 251 228 248 10.1002/path.5471 32418199
103. Sun Y. Varambally S. Maher C.A. Cao Q. Chockley P. Toubai T. Malter C. Nieves E. Tawara I. Wang Y. Targeting of MicroRNA-142-3p in Dendritic Cells Regulates Endotoxin-Induced Mortality Blood 2011 117 6172 6183 10.1182/blood-2010-12-325647 21474672
104. Wu H. Neilson J.R. Kumar P. Manocha M. Shankar P. Sharp P.A. Manjunath N. MiRNA Profiling of Naïve, Effector and Memory CD8 T Cells PLoS ONE 2007 2 e1020 10.1371/journal.pone.0001020 17925868
105. Junker A. Krumbholz M. Eisele S. Mohan H. Augstein F. Bittner R. Lassmann H. Wekerle H. Hohlfeld R. Meinl E. MicroRNA Profiling of Multiple Sclerosis Lesions Identifies Modulators of the Regulatory Protein CD47 Brain 2009 132 3342 3352 10.1093/brain/awp300 19952055
106. Ma X. Zhou J. Zhong Y. Jiang L. Mu P. Li Y. Singh N. Nagarkatti M. Nagarkatti P. Expression, Regulation and Function of MicroRNAs in Multiple Sclerosis Int. J. Med. Sci. 2014 11 810 818 10.7150/ijms.8647 24936144
107. Mandolesi G. De Vito F. Musella A. Gentile A. Bullitta S. Fresegna D. Sepman H. Di Sanza C. Haji N. Mori F. MiR-142-3p Is a Key Regulator of IL-1β-Dependent Synaptopathy in Neuroinflammation J. Neurosci. 2017 37 546 561 10.1523/JNEUROSCI.0851-16.2016 28100738
108. De Vito F. Musella A. Fresegna D. Rizzo F.R. Gentile A. Stampanoni Bassi M. Gilio L. Buttari F. Procaccini C. Colamatteo A. MiR-142-3p Regulates Synaptopathy-driven Disease Progression in Multiple Sclerosis Neuropathol. Appl. Neurobiol. 2022 48 e12765 10.1111/nan.12765 34490928
109. Chen L.Y.C. Hoiland R.L. Stukas S. Wellington C.L. Sekhon M.S. Confronting the Controversy: Interleukin-6 and the COVID-19 Cytokine Storm Syndrome Eur. Respir. J. 2020 56 2003006 10.1183/13993003.03006-2020 32883678
110. Chen Z. Li G. Immune Response and Blood–Brain Barrier Dysfunction during Viral Neuroinvasion Innate Immun. 2021 27 109 117 10.1177/1753425920954281 32903111
111. Liu W. Xu L. Liang X. Liu X. Zhao Y. Ma C. Gao L. Tim-4 in Health and Disease: Friend or Foe? Front. Immunol. 2020 11 537 10.3389/fimmu.2020.00537 32300343
112. Santiago C. Ballesteros A. Martínez-Muñoz L. Mellado M. Kaplan G.G. Freeman G.J. Casasnovas J.M. Structures of T Cell Immunoglobulin Mucin Protein 4 Show a Metal-Ion-Dependent Ligand Binding Site Where Phosphatidylserine Binds Immunity 2007 27 941 951 10.1016/j.immuni.2007.11.008 18083575
113. Perico L. Benigni A. Casiraghi F. Ng L.F.P. Renia L. Remuzzi G. Immunity, Endothelial Injury and Complement-Induced Coagulopathy in COVID-19 Nat. Rev. Nephrol. 2021 17 46 64 10.1038/s41581-020-00357-4 33077917
114. Gustafson D. Raju S. Wu R. Ching C. Veitch S. Rathnakumar K. Boudreau E. Howe K.L. Fish J.E. Overcoming Barriers Arterioscler. Thromb. Vasc. Biol. 2020 40 1818 1829 10.1161/ATVBAHA.120.314558 32510978
115. Kang S. Tanaka T. Inoue H. Ono C. Hashimoto S. Kioi Y. Matsumoto H. Matsuura H. Matsubara T. Shimizu K. IL-6 Trans-Signaling Induces Plasminogen Activator Inhibitor-1 from Vascular Endothelial Cells in Cytokine Release Syndrome Proc. Natl. Acad. Sci. USA 2020 117 22351 22356 10.1073/pnas.2010229117 32826331
116. Malas M.B. Naazie I.N. Elsayed N. Mathlouthi A. Marmor R. Clary B. Thromboembolism Risk of COVID-19 Is High and Associated with a Higher Risk of Mortality: A Systematic Review and Meta-Analysis eClinicalMedicine 2020 29–30 100639 10.1016/j.eclinm.2020.100639
117. Piazza G. Morrow D.A. Diagnosis, Management, and Pathophysiology of Arterial and Venous Thrombosis in COVID-19 JAMA 2020 324 2548 10.1001/jama.2020.23422 33226423
118. Mondal S. Quintili A.L. Karamchandani K. Bose S. Thromboembolic Disease in COVID-19 Patients: A Brief Narrative Review J. Intensive Care 2020 8 70 10.1186/s40560-020-00483-y 32939266
119. Bilaloglu S. Aphinyanaphongs Y. Jones S. Iturrate E. Hochman J. Berger J.S. Thrombosis in Hospitalized Patients with COVID-19 in a New York City Health System JAMA 2020 324 799 10.1001/jama.2020.13372 32702090
120. Zhang L. Feng X. Zhang D. Jiang C. Mei H. Wang J. Zhang C. Li H. Xia X. Kong S. Deep Vein Thrombosis in Hospitalized Patients with COVID-19 in Wuhan, China Circulation 2020 142 114 128 10.1161/CIRCULATIONAHA.120.046702 32421381
121. Gjorgjieva M. Sobolewski C. Dolicka D. Correia de Sousa M. Foti M. MiRNAs and NAFLD: From Pathophysiology to Therapy Gut 2019 68 2065 2079 10.1136/gutjnl-2018-318146 31300518
122. Mosca N. Pezzullo M. De Leo I. Truda A. Marchese G. Russo A. Potenza N. A Novel CeRNET Relying on the LncRNA JPX, MiR-378a-3p, and Its MRNA Targets in Lung Cancer Cancers 2024 16 1526 10.3390/cancers16081526 38672608
123. Moatar A.I. Chis A.R. Marian C. Sirbu I.-O. Gene Network Analysis of the Transcriptome Impact of SARS-CoV-2 Interacting MicroRNAs in COVID-19 Disease Int. J. Mol. Sci. 2022 23 9239 10.3390/ijms23169239 36012503
124. Chowdhury D. Nayeem M. Vanderven H.A. Sarker S. Role of MiRNA in Highly Pathogenic H5 Avian Influenza Virus Infection: An Emphasis on Cellular and Chicken Models Viruses 2024 16 1102 10.3390/v16071102 39066264
125. Bartel D.P. MicroRNAs Cell 2004 116 281 297 10.1016/S0092-8674(04)00045-5 14744438
126. Timofeeva A.M. Sedykh S.E. Sedykh T.A. Nevinsky G.A. Natural Antibodies Produced in Vaccinated Patients and COVID-19 Convalescents Recognize and Hydrolyze Oligopeptides Corresponding to the S-Protein of SARS-CoV-2 Vaccines 2023 11 1494 10.3390/vaccines11091494 37766170
127. Timofeeva A.M. Sedykh S.E. Ermakov E.A. Matveev A.L. Odegova E.I. Sedykh T.A. Shcherbakov D.N. Merkuleva I.A. Volosnikova E.A. Nesmeyanova V.S. Natural IgG against S-Protein and RBD of SARS-CoV-2 Do Not Bind and Hydrolyze DNA and Are Not Autoimmune Int. J. Mol. Sci. 2022 23 13681 10.3390/ijms232213681 36430159
128. Virtanen P. Gommers R. Oliphant T.E. Haberland M. Reddy T. Cournapeau D. Burovski E. Peterson P. Weckesser W. Bright J. SciPy 1.0: Fundamental Algorithms for Scientific Computing in Python Nat. Methods 2020 17 261 272 10.1038/s41592-019-0686-2 32015543
129. Kutmon M. Ehrhart F. Willighagen E.L. Evelo C.T. Coort S.L. CyTargetLinker App Update: A Flexible Solution for Network Extension in Cytoscape F1000Research 2018 7 743 10.12688/f1000research.14613.1
