
==== Front
Int J Parasitol Parasites Wildl
Int J Parasitol Parasites Wildl
International Journal for Parasitology: Parasites and Wildlife
2213-2244
Elsevier

S2213-2244(24)00083-X
10.1016/j.ijppaw.2024.100987
100987
Article
Toxoplasma gondii in rodents and shrews in Armenia, Transcaucasia
Aghayan Sargis A. asargisa@gmail.com
ab⁎
Asikyan Manan V. b
Shcherbakov Oleg ac
Ghazaryan Astghik b
Hayrapetyan Tigran b
Malkhasyan Alexander d
Gevorgyan Hasmik a
Makarikov Arseny e
Kornienko Svetlana e
Daryani Ahmad af
a Laboratory of Molecular Parasitology, Scientific Center of Zoology and Hydroecology, NAS RA, 7 P. Sevak st., Yerevan, 0014, Armenia
b Chair of Zoology, Yerevan State University, 1 Alek Manukyan St, Yerevan, 0025, Armenia
c Research Center of Veterinary and Sanitary Expertise, Armenian National Agrarian University, 74 Teryan St, Yerevan, 0025, Armenia
d WWF-Armenia, 11/1 Proshyan Str., Yerevan, 0019, Armenia
e Laboratory of Parasitology, Institute of Systematics and Ecology of Animals SB RAS, Ulitsa Frunze, 11, Novosibirsk, 630091, Novosibirsk Oblast, Russia
f Toxoplasmosis Research Center, Communicable Diseases Institute, Mazandaran University of Medical Sciences, Mazandaran Province, Sari, North Ring, H27P+84G, Iran
⁎ Corresponding author. Laboratory of Molecular Parasitology, Scientific Center of Zoology and Hydroecology, NAS RA, 7 P. Sevak st., Yerevan, 0014, Armenia. asargisa@gmail.com
11 9 2024
12 2024
11 9 2024
25 10098721 6 2024
10 9 2024
11 9 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Toxoplasma gondii infections in small mammals are important because they serve as source of infection for the felids who excrete environmentally resistant oocysts in their feces. Here, the authors sought evidence for T. gondii infection in shrews and rodents in Armenia for the first time. Toxoplasma gondii DNA was detected in tissues of trapped animals using a specific PCR targeting gene with a non-coding fragment length of 529 bp. Toxoplasma gondii DNA was detected in 15 out of 137 (10.9%) samples from small mammals from 6 different localities of Armenia for the first time.

Graphical abstract

Image 1

Highlights

• None of the representatives of the order Eulipotyphla were infected by T. gondii.

• The prevalence of infection among rodents was 13.4%, with the highest on in Dryomis nitedula.

• A difference in T. gondii prevalence was found between male and female rodents, with females carrying no infection.

• There was no significant influence of host age and locality on the prevalence of T. gondii in rodents.
==== Body
pmcToxoplasma gondii infection is a worldwide zoonosis. It infects various species of mammals, birds, and humans, leading to toxoplasmosis, which can range from asymptomatic to severe and occasionally fatal disease (Ferguson, 2009). Humans become post-natally infected with T. gondii by ingesting food and water contaminated with oocysts excreted in the feces of the definitive hosts, felids or by eating infected meat. Cats themselves become infected with T. gondii by preying on infected small mammals and birds (Dubey et al., 2021). Although rodents and small mammals have been found infected with T. gondii worldwide (Galeh et al., 2020, 2022), we are not aware of any reports of T. gondii infections in small mammals in Armenia.

The goal of our study was to investigate the rate of T. gondii DNA in rodents and insectivores in Armenia and explore factors influencing prevalence and distribution.

Field sampling was conducted from June to September 2018 in 6 different localities in Armenia (Fig. 1).Fig. 1 Sampling localities in Armenia: The numbers on the map correspond to the numbers in the table with names of locations.

Fig. 1

Animals were captured using Sherman traps placed in forest localities at 7 p.m., with the animals collection conducted the following day at 7 a.m. Initially, the morphological identification of the captured small mammals was carried out. Species names were referenced from The Integrated Taxonomic Information System (ITIS Global) (“Integrated Taxonomic Information System,” n.d.) and IUCN (IUCNRedList, n.d.). Blood samples from the captured animals were collected and preserved for future examination in 96% ethanol (approximately 50% blood and 50% ethanol). In total, 137 samples of 14 species were collected (Table 1).Table 1 Number and prevalence (%) of T. gondii in studied rodents and shrews.

Table 1Species	Number of samples	Prevalence n (%)	
Rodentia	
Gliridae	
Dryomys nitedula (Pallas, 1778)	9	3 (33)	
Muridae	
Apodemus uralensis (Pallas, 1811)	46	6 (13)	
Apodemus witherbyi (Thomas, 1902)	32	4 (13)	
Cricetidae	
Mesocricetus brandti (Nehring, 1898)	2	0 (0)	
Microtus arvalis (Pallas, 1778)	1	0 (0)	
M. daghestanicus (Shidlovsky, 1919)	4	0 (0)	
M. majori (Thomas, 1906)	17	2 (12)	
Chionomys nivalis (Martins, 1842)	1	0 (0)	
Eulipotyphla	
Soricidae	
Crocidura leucodon (Hermann, 1780)	4	0 (0)	
C. suaveolens (Pallas, 1811)	7	0 (0)	
Neomys teres (Miller, 1908)	3	0 (0)	
Sorex satunini (Ognev, 1922)	5	0 (0)	
S. raddei (Satunin, 1895)	1	0 (0)	
S. volnuchini (Ognev, 1921)	5	0 (0)	
TOTAL	137		

DNA extraction from the collected blood samples were performed using corresponding protocols of Extran 2 DNA extraction KIT (EX-511-100, Synthol, Russia).

Toxoplasma gondii was identified using specific primers derived from RE gene with a non-coding fragment length of 529 bp (Toxo-4: CGCTGCAGGGAGGAAGACGAAAGTTG and Toxo-5: CGCTGCAGACACAGTGCATCTGGATT). The PCR reaction with a final volume of 25 μl, containing 12.5 μl master mix 1x, 0.5 μl of each primer (0.2 μM), 5 μl of DNA template and 6.5 μl deionized water․ Conditions for PCR reaction were as follows: initial hot start at 95 °C for 5 min, 35 cycles of each consisting of denaturation for 30 s at 94 °C, annealing for 30 s at 53 °C, elongation for 40 s at 72 °C and a final extension step at 72 °C for 5 min. For visual detection by ultraviolet transillumination, we used 1.5% agarose gel electrophoresis with SYBR® Green stain (Homan et al., 2000; Hosseini et al., 2020).

A total of 15 of 137 (10.9%) blood samples from rodents were PCR positive, none of the 25 representatives of the order Eulipotyphla were infected by T. gondii (Table 1). The overall prevalence of infection among rodents is 13.4%.

Among rodent species, Dryomis nitedula, the sole representative of the family Gliridae in our collection, had the highest prevalence of T. gondii DNA (Table 1). Among different age groups of rodents, adults were the most infected (13/79: 16.5%) followed by juveniles (1/12: 8.3%) and sub-adults (1/16: 6.3%). However, the difference was not statistically significant.

Statistically significant difference between prevalence of T. gondii DNA in males and females was found. None of female rodents were positive to T. gondii, while 16 out of 87 males (18.4%) were positive to the agent (Chi-square value: 5.045, P-value: 0.02470). However, our observations were limited to DNA in blood; serological and bioassay might provide more definitive result.

The highest prevalence was recorded in Karashamb, Kotayk region (Table 2). The rodents from the regions of Vayots Dzor and Syunik regions were free of T. gondii infection, but the sample size was small and uneven.Table 2 Prevalence of T. gondii infection in rodents by localities.

Table 2Regions	Locality	Number of samples	Prevalence (%)	Altitutde	
Vayots Dzor	Artavan	7	0 (0)	1850	
Gegharkunik	Lichk	16	3 (19)	1905	
Syunik	Arevis	19	0 (0)	1890	
Ararat	Khosrov	18	2 (11)	1350	
Kotayk	Karashamb	4	1 (25)	1455	
Kotayk	Artavaz	48	7 (17)	1830	

Future research with larger sample sizes is essential for a more detailed description of diseases carried by different rodent species in Armenia, considering also the spacial analyzes in study design.

CRediT authorship contribution statement

Sargis A. Aghayan: Writing – review & editing, Writing – original draft, Supervision, Project administration, Investigation, Funding acquisition, Data curation, Conceptualization. Manan V. Asikyan: Writing – review & editing, Investigation. Oleg Shcherbakov: Writing – original draft, Investigation. Astghik Ghazaryan: Writing – review & editing, Data curation, Conceptualization. Tigran Hayrapetyan: Writing – review & editing, Validation, Investigation, Conceptualization. Alexander Malkhasyan: Validation, Investigation. Hasmik Gevorgyan: Writing – review & editing, Investigation. Arseny Makarikov: Writing – review & editing, Methodology, Investigation. Svetlana Kornienko: Writing – review & editing, Investigation. Ahmad Daryani: Writing – review & editing, Writing – original draft, Validation, Supervision, Methodology, Investigation, Data curation, Conceptualization.

Acknowledgements

This study was supported by the Higher Education and Science Committee of The Republic of Armenia (project 21 T-1F219). We are thankful to Armine Grigoryan (bachelor student at the Chair of Zoology, 10.13039/100024183 Yerevan State University ) and Marine Arakelyan (head of Chair of Zoology, 10.13039/100024183 Yerevan State University ) for contribution in field and laboratory work of the study. Support for 10.13039/100026328 Arseny Makarikov and Svetlana Kornienko was provided by the Federal Fundamental Scientific Research Program (grant No. 1021051703269-9-1.6.12)
==== Refs
References

Dubey J.P. Murata F.H.A. Cerqueira-Cézar C.K. Kwok O.C.H. Su C. Epidemiological significance of toxoplasma gondii infections in wild rodents: 2009–2020 J. Parasitol. 107 2021 182 204 10.1645/20-121 33662119
Ferguson D.J.P. Toxoplasma gondii: 1908-2008, homage to nicolle, manceaux and splendore Mem. Inst. Oswaldo Cruz 104 2009 133 148 10.1590/S0074-02762009000200003 19430635
Galeh T.M. Sarvi S. Hosseini S.A. Daryani A. Genetic diversity of Toxoplasma gondii isolates from rodents in the world: a systematic review Transbound Emerg Dis 69 2022 943 957 10.1111/tbed.14096 33825346
Galeh T.M. Sarvi S. Montazeri M. Moosazadeh M. Nakhaei M. Shariatzadeh S.A. Daryani A. Global status of toxoplasma gondii seroprevalence in rodents: a systematic review and meta-analysis Front. Vet. Sci. 7 2020 10.3389/fvets.2020.00461
Homan W.L. Vercammen M. De Braekeleer J. Verschueren H. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR Int. J. Parasitol. 30 2000 69 75 10.1016/S0020-7519(99)00170-8 10675747
Hosseini S.A. Sharif M. Sarvi S. Abediankenari S. Hashemi-Soteh M.B. Amouei A. Montazeri M. Aghayan S.A. Gholami S. Shaker D. Mizani A. Shabanzadeh S. Daryani A. Genetic characterization of Toxoplasma gondii in Iranian HIV positive patients using multilocus nested-PCR-RFLP method Parasitology 147 2020 322 328 10.1017/S0031182019001598 31727203
Integrated Taxonomic Information System [WWW Document], n.d. 10.5066/F7KH0KBK.
IUCNRedList IUCN red list of threatened species [WWW Document]. URL https://www.iucnredlist.org/
