
==== Front
Curr Genomics
Curr Genomics
CG
Current Genomics
1389-2029
1875-5488
Bentham Science Publishers

38751602
CG-25-140
10.2174/0113892029284920240212091903
Life Sciences, Genetics & Genomics, Genetics & Heredity
Expression Profiling of EMT Transcriptional Regulators ZEB1 and ZEB2 in Different Histopathological Grades of Oral Squamous Cell Carcinoma Patients
Baqai Neha 1
Amin Rafat 2*
Fatima Tehseen 2
Ahmed Zeba 3
Faiz Nousheen 4
1 Dow Research Institute of Biotechnology and Biomedical Sciences, Dow University of Health Sciences, Ojha Campus, Karachi, Pakistan;
2 Dow College of Biotechnology, Dow University of Health Sciences, Ojha Campus, Karachi, Pakistan;
3 Otolaryngology, Dow Medical College-Dr.Ruth KM Pfau Civil Hospital Karachi, Dow University of Health Sciences, Karachi, Pakistan;
4 Institute of Basic Medical Sciences, Dow University of Health Sciences, Ojha Campus, Karachi, Pakistan
* Address correspondence to this author at the Dow College of Biotechnology, Dow University of Health Sciences, Ojha Campus, Karachi, Pakistan; Cell: 0092-333-2115079; E-mail: rafat.amin@dush.edu.pk
15 2 2024
2024
25 2 140151
06 11 2023
23 1 2024
23 1 2024
© 2024 The Author(s). Published by Bentham Science Publishers
2024
The Author(s)
https://creativecommons.org/licenses/by/4.0/ © 2024 The Author(s). Published by Bentham Science Publishers. This is an open access article published under CC BY 4.0 https://creativecommons.org/licenses/by/4.0/legalcode.
Background

Pakistan has a high burden of oral cancers, with a prevalence rate of around 9%. Oral Squamous Cell Carcinoma (OSCC) accounts for about 90% of oral cancer cases. Epithelial to Mesenchymal Transition (EMT) gets highly stimulated in tumor cells by adopting subsequent malignant features of highly invasive cancer populations. Zinc Finger E-Box binding factors, ZEB1 and ZEB2, are regulatory proteins that promote EMT by suppressing the adherent ability of cells transforming into highly motile cancerous cells. The present study aimed to analyze the expression of EMT regulators, ZEB1 and ZEB2, and their association with the clinicopathological features in different grades of OSCC patients.

Methods

Tissue samples were collected for both case and control groups from the recruited study participants. Cancer tissues (cases) were collected from the confirmed OSCC patients, and healthy tissues (controls) were collected from third-molar dental extraction patients. The study participants were recruited with informed consent and brief demographic and clinical characteristics. The case group was further segregated with respect to the histological cancer grading system into well-differentiated (WD), moderately differentiated (MD), and poorly differentiated (PD) squamous cell carcinoma (SCC) groups. RNA was extracted from the tissue samples for expression profiling of ZEB1 and ZEB2 genes through quantitative real-time PCR (qRT-PCR).

Results

All of the recruited participants had a mean age of 46.55 ± 11.7 (years), with most of them belonging to Urdu speaking ethnic group and were married. The BMI (kg/m2) of the healthy participants was in the normal range (18-22 kg/m2). However, BMI was found to be reduced with the proliferation in the pathological state of cancer. The oral hygiene of patients was better than the healthy participants, possibly due to the strict oral hygiene practice concerns of consultants. Every recruited OSCC patient had one or multiple addiction habits for more than a year. Patients reported health frailty (46.6%), unhealed mouth sores (40%), swallowing difficulties and white/reddish marks (80%), and restricted mouth opening (64.4%). Furthermore, 82.2% of the recruited patients observed symptoms within 1-12 months, and buccal mucosa was the most exposed tumor site among 55.6% of the patients. Expression profiling of EMT regulators showed gradual over-expressions of ZEB1 (8, 20, and 42 folds) and ZEB2 (4, 10, and 18 folds) in respective histological cancer grades.

Conclusion

High expressions of ZEBs have been significantly associated with cancer progression and poor health. However, no association was found between OSCC with other clinicopathological features when compared to healthy controls.

Keywords

Epithelial-mesenchymal transition
moderately differentiated squamous cell carcinoma
oral squamous cell carcinoma
poorly differentiated squamous cell carcinoma
well differentiated squamous cell carcinoma
zinc finger E-box
==== Body
pmc1 INTRODUCTION

Oral cancer with an intemperate mortality rate is one of the abrasive types of human cancer [1]. GLOBOCAN 2020 stated that oral cancer cases have globally progressed with a 0.3 M incident rate and 0.1 M mortality rate per year [2]. Among them, the highest frequency is of lip and oral cavity cancers reported highly in south-central Asia, including Pakistan, India, and Sri Lanka [3]. The prevalence of oral cancer is approximately 9%, with an average range of 2 to 19% in the heterogeneous population of five big cities of Pakistan [4, 5]. The frequency of lip and oral cancer in the population of Karachi is approximately 30% [6]. Within two years (2017-2019), the Karachi Cancer Registry (KCR) has registered 33,309 cancer cases, among which 42.82% were male and 16.68% were female cancer patients of the lip and oral cavity [7]. Oral squamous cell carcinoma (OSCC), an epithelial malignancy of the oral cavity, accounts for above 90% of all oral cancer cases [8]. This pathological condition is influenced by various internal (developmental processes) and external (adaptive living) conditions [9-12]. OSCC arises from the epithelial lining of oral squamous cells invading nearby tissues of the mouth, tongue, or alveolar bone [13]. Regardless of advancements in available technologies, most of the OSCC patients are diagnosed at a later stage where the cancer has already been metastasized [14]. Even if the cancer has cured in earlier stages, the drug resistivity and re-occurrence can lead approximately one-third of the patients to advanced cancer stage [15]. The patient survival rate in such cancers nearly reduce to the average of five years [16].

Expression of specialized protein markers is a characteristic of cellular differentiation to the progenitor cell that follows cell discretion through Epithelial to Mesenchymal Transitions (EMT) [17]. EMT is a vital biological process of embryonic cell differentiation, in which epithelial cells gradually lose their morphology and identity by acquiring mesenchymal features [18]. Conversely, cells undergoing Mesenchymal to Epithelial Transition (MET) can reverse the acquired epithelial features [19-21]. However, tumorigenesis or cancer development is a pathological state in which a cell loses its identity by adapting tumor cell characteristics via bypassing apoptosis and hijacking the transcriptional and epigenetic controls [22-24].

EMT plays a substantial role in cancer progression by undergoing cell migration and metastasis, which is the reason for 90% death of cancer patients [25-27]. A number of signaling pathways, such as tyrosine kinase-associated pathways [28], TGFβ signaling [29], Notch signaling, Sonic Hedgehog (SHH) [30], WNT signaling pathways, and growth promotors, including fibroblast growth factor (FGF) [31], epidermal growth factor (EGF) [32], hepatocyte growth factor (HGF) [9], transforming growth factor b (TGFb) [33] and bone morphogenetic protein (BMP) [34] promoting EMT transitions are involved in this process.

Cell signaling pathways involved in the phenotypic switching of epithelial and mesenchymal transitions are under the regulatory control of various master regulators, including the TWIST family, SNAIL/SLUG family, ZEB1/ βEF1, ZEB2/ SIP1, and E12/E47 [35-37]. These transcriptional factors promote EMT by down-regulating the expression of the EMT regulator, i.e., E-Cadherin. The whole process disrupts the cellular adhesion property of the cell and causes it to remain detached and mobile in a mesenchymal state. Detached cells, through sequential transformation, adopt tumor characteristics and lead toward cancer progression. The role of these transcriptional factors has been studied in various cancers, including oral squamous cell carcinoma [38].

ZEB is an EMT transcriptional regulator belonging to the Zinc Finger E-box Binding Homeobox family [39]. It includes two closely related proteins: ZEB1 and ZEB2 [40]. The distinctive role of ZEB is to upsurge EMT towards sequential cancer progression and metastasis by dysregulating EMT transcriptional regulator E-Cadherin [41, 42]. Members of the ZEB family are not only involved in the cancer progression but also act as therapy resistance to the cancer that helps in escape and poor prognosis of the cancer [35].

In OSCC, higher expression of ZEB1 was reported to down-regulate the expression of E-cadherin, which causes loss of morphology of epithelial cells and has a crucial role in node metastasis in advanced oral cancer stages [43]. However, ZEB2, the second member of the ZEB family, is also specific to the E-box-like sequence and has the same function in EMT and tumor progression as ZEB1. It has been demonstrated that the high level of the ZEB2 mRNA is associated with poor patient prognosis and increased cancer stem cell-like properties [35].

Both ZEB1 and ZEB2 are homologous proteins. However, the transcription initiation site of ZEB1 lies near the start codon, while ZEB-2 has a transcription initiation site that lies more than 2.7 upstream of the start codon [22]. Overexpression of both ZEB1 and ZEB2 has been reported in a number of cancers, including prostate cancer [44, 45], breast cancer [46], gynecological cancers [47-49], head and neck cancers, and specifically in oral squamous cell carcinoma [29, 50, 51]. As there are no previous studies that revealed the expression of ZEB in the Pakistani population, the current study aims to determine the expression level of EMT transcription regulators (ZEB) in different grades of OSCC patients of the Pakistani population. The present study is based on molecular evaluation and thus determines the association between different etiological and pathological factors that may direct toward the screening of EMT markers ZEBs in the future for early diagnosis. The results of this study are expected to provide valuable insights into the OSCC treatment.

2 MATERIALS AND METHODS

2.1 Study Participants and Sample Recruitment

It is a case-control study with a ratio of 3:1 of OSCC cases to healthy controls with a total of 60 participants (n=60) with the approval of the Institutional Review Board (IRB) of Dow University of Health Sciences (DUHS), Karachi. The study subjects were recruited from 2020 to 2022 with informed signed consent, and their previous clinical history was obtained through a brief questionnaire. Healthy controls (n=15) were the patients appearing for third molar tooth extraction at the dental clinics of DUHS with no other clinical complications and cancer history. However, OSCC cases (n=45) were patients admitted for tissue biopsy and surgery at different health sectors of Karachi, including Indus Hospital, Karachi, and Dr. Ruth K. M. Pfau Civil Hospital Karachi. The patients were segregated on the basis of histological grading into well (n=15), moderately (n=15), and poorly differentiated (n=15) squamous cell carcinoma groups.

2.2 Human Tissue Sample Collection and Histopathology

Surgically excised tissue mass of ≤30 mg from recruited participants was collected into two separate micro-centrifuge tubes, one for RNA extraction containing RNA later and one for histopathology containing 10% formalin. Cancer tissue (cases) was excised from the OSCC patients, and noncancerous tissue (controls) was collected from third molar tooth extraction patients. Tissue samples were stored at -80°C for subsequent processing of RNA extraction.

2.3 RNA Extraction

RNA from the collected tissue samples of both cases and controls were extracted by an all-in-one DNA/RNA/protein Mini-preps kit (BIO BASIC, CAT#: BS88003) following the manufacturer’s protocol. Extracted RNA was then treated with an RNase-Free DNase kit (Promega) for the removal of any traces of DNA present following the manufacturer’s protocol. Furthermore, the optical density of each eluted sample was quantified at A260/280 using a micro-volume spectrophotometer, NanoDrop (Thermo Scientific 2000c). Both DNA and RNA samples were immediately stored at -20°C and -80°C, respectively.

2.4 Quantitative Real-time PCR (qPCR)

A total of 500 ng purified RNA was reversely transcribed for cDNA synthesis by Revert Aid First Strand cDNA synthesis kit (Thermo Scientific CAT#: K1622) by following the manufacturer’s protocol. Quantitative real-time PCR was performed in the QuantStudio-7 Flex Real-Time PCR Detection System, Applied Bioscience, with the specifically designed primers (Table 1) for the targeted genes, ZEB1 and ZEB2. In contrast, GAPDH was used as the reference housekeeping gene for the endogenous control. Furthermore, qPCR amplification of each cDNA sample for the respective genes was performed in triplicate using 10µl reaction mixture by using cDNA, 2x PowerUP SYBER Green Master Mix and 10 µM of each forward and reverse primer for respective genes. Afterward, the final volume was made up of RNase-free water. The reaction mixture was kept for the hold stage at 50°C, 2 min and 95°C, 2 min, and for the PCR stage at 95°C, 1 sec and 60°C, 1 sec. Forty qPCR cycles were used for the amplification. The amplified expression of the targeted genes was determined by Relative Quantification (RQ) calculated through the proposed comparative 2-∆∆Ct method. MIQE guidelines were followed for the overall qPCR experimentation [52].

2.5 Statistical Analysis

Mean and standard deviation were reported for quantitative variables (normally distributed data) while median (IQR) was reported for qualitative variables (non-normally distributed data). Frequencies and percentages were calculated for all categorical variables. Pearson’s chi-square test was used for the comparison of baseline and clinicopathological characteristics of study participants. Kruskal-Wallis test and post-hoc by Dunnet’s test were used to compare the expression levels of ZEBs in different grades of OSCC patients, with a p-value of <0.05 considered significant.

3 RESULTS

3.1 Baseline Characteristics of the Study Participants

A total of 60 male participants were recruited in this case-control study. The cases (n=45) were categorized with international histological classification of tumor [51] into well, moderately, and poorly differentiated squamous cell carcinoma groups. However, healthy controls were individuals with no pathological conditions. Each study group consisted of 15 participants. The baseline data of the recruited participants are presented in Table 2. Demographic data demonstrated that the mean age of study participants was 47 ± 11.70 (years). Age group categorization demonstrated that the highest 43.3% of participants were within 36-50 years of age group. The BMI (non-normal data) of the study participants was 18.13 (kg/m2) (IQR:16.3-34.4). BMI was also categorized according to WHO BMI cut-off ranges, which indicated that 43.3% of the individuals were in the normal BMI range, i.e., 18.5-24.9 (kg/m2). Among the study participants, 72% were married, and 53% belonged to Urdu speaking ethnic group.

Basic demographic characteristics of OSCC grades with a healthy control group were also compared by using Pearson's chi-square test. The statistical analysis showed no significant difference within age groups, marital status, and ethnicity, while body mass index (BMI) indicated a significant decrease with the upsurge of the cancer grade. The details of the comparison of baseline characteristics of different OSCC grades with healthy controls are briefly mentioned in Table 3.

3.2 Clinicopathological Characteristics of OSCC Patients

Clinical features among recruited OSCC case groups were studied. It was found that 31.7% of the OSCC patients were habitual in consuming betel quid (paan). Among those, buccal mucosa was the most commonly affected site (55.6%) in OSCC patients and 46.6% of patients suffered from frailty (Table 4).

3.3 Oral Health Status

The association of the clinical features within each case group (WDSSC, MDSCC, and PDSCC) was recorded with the confirmed tissue histopathology through H&E staining. The clinical representations of tumor sites are shown in Fig. (1). By brief clinical history, it was found that 27% of patients lost their teeth, 42% suffered from ear pain, 89% from mouth sores, and 80% with food swallowing difficulty and reported restricted mouth opening within the duration of 1-12 months. Among OSCC patients, the most common tumor site was buccal mucosa (56%). No association was reported by the chi-square test of the respective data sets of the case groups (Table 5).

3.4 Expression Profiling of EMT Regulators ZEB1 and ZEB2

The transcript levels of both ZEB1 and ZEB2 were over-expressed in patients’ groups as compared to the healthy controls. The mean fold change in ZEB1 expression was found to be 8, 20, and 42 times elevated. However, ZEB2 expression was 4, 10, and 18 times elevated in respective case groups of well, moderately, and poorly differentiated patients. Expression profiling of EMT regulators is shown in Figs. (2 and 3). A significant difference in terms of ZEB1 and ZEB2 expressions was found among OSCC groups. Furthermore, transcript levels of EMT regulators, ZEB1 and ZEB2, were further compared in OSCC groups with healthy controls, which also reported a significant difference in healthy control vs. well, moderate, and poorly differentiated groups, i.e., <0.001 (Table 6).

3.5 Comparison of EMT Regulators ZEB1 and ZEB2 Expression

The study reported overexpression of ZEB1 and ZEB2 relative quantification in the median, i.e., 20.0 (IQR: 22.9-2.35) and 13.9 (IQR:15.4-1.5), respectively, as compared to healthy controls. The expression of both ZEB1 and ZEB2 was not associated with any of the patient’s characteristics, i.e., age, BMI, marital status, ethnicity, and oral habits (Table 7).

4 DISCUSSION

OSCC is referred to as clinical and histopathological changes that are initiated from any minor injury till the development of the tumorous neoplasm through several precancerous phases [53]. The histopathological grading of the tumor is characterized based on the expansion of epithelial lesions during cancer development [54]. The epithelial changes include hyperkeratosis, hyperplasia, acanthosis or preneoplastic changes of dysplasia [55]. These changes vary in severity, being mild, moderate, and severe and play key roles in the development of cancer [56]. Oral cancer appears as epithelial dysplasia, followed by the abnormal proliferation of the squamous cells. This further causes the deterioration of the sub-epithelial basement (BM) and leads to local destruction and cancer invasion through metastasis. According to the two recent guidelines for tumor classification systems, namely patterns of tumor interstitial fluids [57] and international histological classification of tumor [58], the tumor lesion grading system is classified based on the histological grades as per the standard grading system into well, moderated, and undifferentiated or poorly differentiated tumor grades [59].

For the present study, the estimated sample size of each histological group was set to be n=15. To justify and validate study findings, only male OSCC patients were recruited to thoroughly examine the prevalence pattern of OSCC in male patients reported in most of the previous literature [59-62].

The present study confirmed the clinical and histopathological findings of the OSCC patients of different tumor grades, i.e., WDSCC, MDSCC, and PDSSC, compared to HC. Most of the patients were found to be in the age range between 36 to 50 years (Table 3), which aligned with previously reported data on the Pakistani population, i.e., 46.7, S.D ± 10.2 years [59], 47.62, S.D ± 12.18 years [60], and 39.62 years [61]. The data ratifies that the onset of the disease occurs in the middle age individuals (36-50 years). An alternative reason could be late screening and diagnosis after the appearance of symptoms or due to inconsistent treatment patterns in OSCC patients. Nevertheless, contradictory to our results, some studies found deviations in the age ranges of OCSS patients. A comprehensive study from the Netherlands conducted from 1989 to 2018 reported that the incidence of OSCC has significantly increased by 2.5% (95% CI, 1.1-3.8) per year in younger patients of the age group 20-34 [59]. This might be due to early screening of the OSCC patients and/or differences in the effective social and geological environment.

The present study also evaluated Body Mass Index (BMI) in kg/m2 with respect to the histopathological grades of OCSS patients. It was found that 60% of poorly differentiated patients were underweight with <18.5 (kg/m2) BMI (Table 3). Previous data demonstrated that the surgical excision of tumors in underweight patients needs critical care, and they suffer more from preoperative [63] and postoperative difficulties than other patients [64]. However, it was also reported that overweight OSCC patients have an increased risk of poor prognosis, re-occurrence, and patient mortality [65].

Some definite factors have been associated with the pathological state of OSCC, including oral hygiene, oral dependence habits, socioeconomic pressure, and ecological and communal factors [66]. Oral health patterns were also observed, and it was found that the recruited participants were habitual of consuming tobacco and had addictions to betel quid (Paan), gutka, areca nut, smoking, sweet suparis, etc., as mentioned in Table 4. Due to these oral addictions, the buccal mucosa is the most prominent tumor site in such individuals [62, 65, 67, 68]. These findings were further confirmed in the present study, which are briefly illustrated in Fig. (1). Previous studies also identified that these oral habits, individually (e.g., areca nut alone) or in combination, are responsible for the initiation and progression of mouth cancers, i.e., OSCC [69, 70]. In OSCC patients, oral discomfort was another aspect of examining the disease condition. The present study reported certain oral distresses, including unhealed mouth sores, restricted mouth opening, and trouble in food swallowing (Table 5). The current findings are in favor of previously reported literature [71-73], with pain being the prominent symptom in the suffering of OSCC patients.

The stimulation of EMT is the primary mechanism by which the tumor cells acquire malignant features through suppressing E-cadherin protein and transform into a highly migratory and invasive cancer cell population [52]. There are abundant regulatory factors involved in the regulation of EMT. However, the present study has focused on only Zinc-finger E-box binding proteins, ZEB1 and ZEB2. The overexpression of ZEBs is known to alter normal functioning and suppress E-cadherin expression and is critically involved in cancer progression. This current study reported overexpression of both transcriptional regulators ZEB1 and ZEB2 (Figs. 2 and 3). However, a significant difference was found in each tumor grade, WDSCC, MDSCC, and PDSCC, when compared to healthy controls. The expression profiling of these proteins was consistent with the reported literature, which detected over-expression of ZEB1 [74-77] and ZEB2 [78-80] in human cancers, including lung cancer, prostate cancer, colorectal cancer, and bladder cancer. Hence, the altered expressions of ZEBs could be used as prognostic signals in human cancers [81].

CONCLUSION

The current study thoroughly examined the association between the clinicopathological features of OSCC patients of different grades with healthy control subjects. The data showed that among all the features, BMI has a significant effect on OSCC patients. It was found that as the tumor grade increased, the BMI decreased, indicating the poor health of the patients. Similarly, the expressions of ZEbs were gradually over-expressed with each cancer grade. However, no association was found with other clinical features of the study participants. This study provides evidence that as the OSCC progresses, the mRNA transcript levels significantly over-express from well-differentiated to poorly differentiated.

ACKNOWLEDGEMENTS

The authors would like to express their gratitude to Dr. Noureen for providing samples from individuals serving as healthy controls. This research work is a part of the post-graduate research thesis of Miss Neha Baqai. The authors would like to thank Dow University of Health Sciences for all the support and facilitation to conduct this study.

AUTHORS’ CONTRIBUTIONS

Neha Baqai contributed to the conceptualization of the study, methodology, formal analysis and investigation, and manuscript writing. Rafat Amin contributed to the conceptualization of the study, supervision, final analysis, manuscript writing, and editing. Tehseen Fatima participated in the supervision, protocol optimization, final analysis, and writing and reviewing of the manuscript. Nousheen Fiaz contributed to the sample collection, methodology selection, statistical analysis, and manuscript writing. Zeba Ahmed participated in the clinical validation of study subjects, sample collection, and supervision. All authors read and approved the final manuscript.

LIST OF ABBREVIATIONS

BMI Body Mass Index

BMP Bone Morphogenetic Protein

EGF Epidermal Growth Factor

EMT Epithelial to Mesenchymal Transition

FGF Fibroblast Growth Factor

HGF Hepatocyte Growth Factor

IRB Institutional Review Board

KCR Karachi Cancer Registry

MD Moderately Differentiated

MET Mesenchymal to Epithelial Transition

OSCC Oral Squamous Cell Carcinoma

PD Poorly Differentiated

qRT-PCR Quantitative Real-time PCR

RQ Relative Quantification

SCC Squamous Cell Carcinoma

TGFb Transforming Growth Factor b

WD Well-differentiated

ZEB Zinc Finger E-box

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The approval for this study was granted by the Institutional Review Board, Dow University of Health Sciences, Karachi, Pakistan (IRB-1438/duhs/Approval/2020 dated 30th January, 2020).

HUMAN AND ANIMAL RIGHTS

All procedures performed in studies involving human participants were in accordance with the ethical standards of institutional and/or research committee and with the 1975 Declaration of Helsinki, as revised in 2013.

CONSENT FOR PUBLICATION

Written informed consent was obtained from all individual participants included in the study.

STANDARDS OF REPORTING

STROBE guidelines were followed.

AVAILABILITY OF DATA AND MATERIALS

The authors declare that all the data supporting the findings of this study are available within the article.

FUNDING

None.

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.

Fig. (1) Clinical and histopathological representation of OSCC patients. Clinical and H&E stained slide representation of tumor grades: A) Well differentiated, B) Moderately differentiated, and C) Poorly differentiated squamous cell carcinoma case group recruited in the present study.

Fig. (2) Expression profiling of EMT regulator ZEB1. Comparison of mRNA expression levels of ZEB1 in case groups of different tumor grades, well, moderately and poorly differentiated, with healthy controls. ***p-value < 0.001 was considered significant.

Fig. (3) Expression profiling of EMT regulator ZEB2. Comparison of mRNA expression levels of ZEB2 in case groups of different tumor grades: well, moderately and poorly differentiated, with healthy controls. ***p-value <0.001 was considered significant.

Table 1 Primers for real-time quantitative polymerase chain reaction (RT-PCR).

Primer Name	Primer Sequence	
ZEB1	Forward	5-’TGCACTGAGTGTGGAAAAGC-3’	
Reverse	3’- TGGTGATGCTGAAAGAGACG -5’	
ZEB2	Forward	5’-CGCTTGACATCACTGAAGGA-3’	
Reverse	3’- CTTGCCACACTCTGTGCATT -5’	
GAPDH	Forward	5’-AGGGCTGCTTTTAACTCTGGT-3’	
Reverse	3’- CCCCACTTGATTTTGGAGGGA -5’	

Table 2 Baseline characteristics of the study participants (n=60).

Characteristics	n (%)	
Age Categories (years)	-	
20-35	15(25.0)	
36-50	26(43.3)	
>50	19(31.7)	
BMI Categories (kg/m2)	-	
<18.5	18(30.0)	
18.5-24.9	26(43.3)	
>25	16(26.7)	
Marital Status	-	
Single	17(28.3)	
Married	43(71.7)	
Ethnicity	-	
Urdu	32(53.3)	
Sindhi	12(20.0)	
Punjabi	6(10.0)	
Pathan	10(16.7)	

Table 3 Comparison of OSCC grades with healthy controls according to the baseline characteristics (n=60).

Characteristics	HC n=15 (%)	WDSSC n=15 (%)	p-value (HI vs WD)	MDSCC n=15 (%)	p-value (HI vs MD)	PDSCC n=15 (%)	p-value (HI vs PD)	Total n=60 (%)	†Overall p-value	
Age (years)	
20-35	6(40)	3(20)	0.295	2(13.3)	0.234	4(26.7)	0.514	15(25)	0.637	
36-50	4(26.7)	8(53.3)	7(46.7	7(46.7)	26(43.3)	
>50	5(33.3)	4(26.7)	6(40)	4(26.7)	19(31.7)	
BMI (kg/m2)	
<18.5	1(6.7)	4(26.7)	0.113	4(26.7)	0.113	9(60)	0.009*	18(30)	0.024*	
18.5-24.9	6(40)	8(53.3)	8(53.3)	4(26.7)	26(43.3)	
>25	8(53.3)	3(20)	3(20)	2(13.3)	16(26.7)	
Marital Status	
Single	6(40)	2(13.3)	0.090	4(26.7)	0.700	5(33.3)	0.999	17(28.3)	0.412	
Married	9(60)	13(86.7)	11(73.3)	10(66.7)	43(71.7)	
Ethnicity	
Urdu	10(66.7)	7(46.7)	0.675	7(46.7)	0.317	8(53.3)	0.670	32(53.3)	0.704	
Sindhi	2(13.3)	4(26.7)	2(13.3)	4(26.7)	12(20)	
Punjabi	2(13.3)	2(13.3)	1(6.7)	1(6.7)	6(10)	
Pathan	1(6.7)	2(13.3)	5(33.3)	2(13.3)	10(16.7)	
Do not know	5(33.3)	4(26.7)	6(40)	2(13.3)	17(28.3)	
Abbreviations: HC: Healthy Controls; WDSCC: Well Differentiated Squamous Cell Carcinoma; MDSCC: Moderately Differentiated Squamous Cell Carcinoma; PDSCC: Poorly Differentiated Squamous Cell Carcinoma.

Note: P-value was calculated by using Pearson's Chi-square test and Fisher’s exact test.

†Overall p-value: Healthy Controls v/s Well, Moderately and Poorly Differentiated Squamous Cell Carcinoma.

*p-value <0.05 was considered as significant.

Table 4 Clinicopathological characteristics of OSCC patients (n=45).

Characteristics	n (%)	
Oral Habits (Yes)	
Betal quid (Paan)	19(31.7)	
Betal nuts (Areca nuts)	13(21.7)	
Tobacco	6(10.0)	
Gutka	21(35.0)	
Sweets	3(5.0)	
Supari	3(5.0)	
Smoking	18(30.0)	
Any other	12(20.0)	
Tumor Site	
Lip and Tongue	14(13.1)	
Buccal Mucosa	25(55.6)	
Palate	6(13.3)	
Comorbidity (Yes)	
Hypertension	6(10.0)	
Diabetes	2(3.3)	
Allergy	4(6.6)	
Frailty	28(46.6)	
Other conditions	2(3.3)	

Table 5 Association of clinicopathological characteristics with OSCC grades (n=45).

Characteristics	WDSCC n=15(%)	MDSCC n=15(%)	PDSCC n=15(%)	p-value	
Chewing Habits (Yes)	
Paan	9(60.0)	4(26.7)	6(40.0)	0.177	
Areca nuts	2(13.3)	2(20.0)	6(40.0)	0.209	
Tobacco	2(13.3)	1(6.7)	3(20.0)	0.562	
Gutka	8(53.3)	11(73.3)	2(13.3)	0.004**	
Sweets	2(13.3)	1(6.7)	0(0.0)	0.343	
Supari	2(13.3)	1(6.7)	0(0.0)	0.343	
Smoking	8(53.3)	4(26.7)	5(33.3)	0.293	
Any other	3(20.0)	4(26.7)	2(13.3)	0.659	
Clinical Condition (Yes)	
Loose teeth	5(33.3)	6(40.0)	1(6.7)	0.092	
Ear pain	8(53.3)	6(40.0)	5(33.3)	0.649	
Sores that do not heal itself	13(86.7)	12(80.0)	15(100.0)	0.207	
Difficulty in swallowing	11(73.3)	11(73.3)	14(93.3)	0.287	
White/Reddish marks in the mouth	12(80.0)	12(80.0)	12(80.0)	0.091	
Restricted mouth opening	9(60.0)	8(53.3)	12(80.0)	0.283	
Tumor Site	
Lip and tongue	6(40.0)	5(33.3)	3(20.0)	0.677	
Buccal mucosa	7(46.7)	9(60.0)	9(60.0)	
Palate	2(13.3)	1(6.7)	3(20.0)	
Note: P-value was calculated using Pearson's Chi-square test and Fisher’s exact test.

**p-value <0.05 was considered as significant.

Table 6 mRNA transcript levels of EMT regulators (ZEBs) in OSCC.

MRNA Transcript Levels of ZEBs	ZEB1	ZEB2	
Median IQR	†p-value	Median IQR	†p-value	
HC	0.0 (1.0-1.0)	<0.001***	0.0 (1.0-1.0)	<0.001***	
WDSCC	1.5(8.0-6.4)	0.6(3.8-3.2)	
MDSCC	4.5(22.4-17.8)	1.3(10.7-9.4)	
PDSCC	8.8(31.9-23.1)	0.5(17.5-16.9)	
Comparison of ZEBs’ mRNA Transcript Level Vs Healthy Control	-	
WD	-	<0.001***	-	<0.001***	
WDSSC	<0.001***	<0.001***	
PDSSC	<0.001***	<0.001***	
Abbreviations: HC: Healthy Controls; WDSCC: Well Differentiated Squamous Cell Carcinoma; MDSCC: Moderately Differentiated Squamous Cell Carcinoma; PDSCC: Poorly Differentiated Squamous Cell Carcinoma.

Note: p-value was calculated by using the Kruskal-Wallis test with post-hoc by Dunnet’s test.

†Overall p-value: Healthy Controls v/s Well, Moderately and Poorly Differentiated Squamous Cell Carcinoma

***p-value <0.001 was considered significant.

Table 7 Comparison of mRNA transcript levels of EMT regulators (ZEBs) with patients characteristics (n=45).

-	ZEB1	ZEB2	
Median (Q1-Q3)	p-value	Median (Q1-Q3)	p-value	
Age (Years)	
20-35	22.8(30.8-8.0)	0.948	13.9 (17.5-3.6)	0.955	
36-50	16.7(24.7-8.0)	13.8 (17.1-3.3)	
>50	15.1(23.1-8.0)	13.1(16.9-3.8)	
BMI (kg/m2)	
<18.5	16.7(29.6-12.9)	0.317	10.8(17.4-6.6)	0.432	
18.5-24.9	14.5(22.4-7.9)	6.9(10.7-3.8)	
>25	19.8(27.8-8.0)	12.5(15.8-3.3)	
Marital Status	
Single	11.8(29.6.-17.8)	0.288	8.0(17.4-9.4)	0.232	
Married	15.1(23.1-8.0)	13.6(17.0-3.0)	
Ethnicity	
Urdu	16.8 (24.7-7.9)	0.866	13.4(17.1-3.7)	0.835	
Sindhi	17.2(24.7-7.5)	13.4(17.1-3.7)	
Punjabi	18.7(26.7-8.0)	12.4(15.7-3.3)	
Pathan	13.1(26.0-12.9)	7.5(14.1-6.6)	
Oral Habits (Yes)	
Paan	15.2(23.1-7.9)	0.355	13.6(16.9-3.3)	0.355	
Areca nuts	11.8(29.6-17.8)	0.184	8.0(17.4-9.4)	0.144	
Tobacco	6.4(31-9-7.5)	0.401	13.8(17.5-3.7)	0.314	
Gutka	14.5(22.4-7.9)	0.137	7.4(7.0-3.3)	0.086	
Smoking	15.2(23.1-7.9)	0.150	13.3(16.9-3.3)	0.190	
Any other	18.0(26.0-8.0)	0.880	10.5(14.1-3.6)	0.880	
Note: P-value calculated by using the Kruskal-Wallis test; p-value <0.05 was considered significant.
==== Refs
REFERENCES

1 Ciantelli N.M.M. Yoong J. Deschamps J. Jaqua E.E. Exploring the interplay between lifestyle medicine and oral health: A bidirectional relationship. Am. J. Lifestyle Med. 2023 15598276231213339 10.1177/15598276231213339
2 Sung H. Ferlay J. Siegel R.L. Siegel, global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021 71 3 209 249 10.3322/caac.21660 33538338
3 Ferlay J. Global cancer Observatory: cancer today Lyon, France International Agency For Research On Cancer 2018
4 Idrees R. Fatima S. Abdul-Ghafar J. Raheem A. Ahmad Z. Cancer prevalence in Pakistan: Meta-analysis of various published studies to determine variation in cancer figures resulting from marked population heterogeneity in different parts of the country. World J. Surg. Oncol. 2018 16 1 129 10.1186/s12957-018-1429-z 29976196
5 Pervez S. Karachi Cancer Registry (KCR): Consolidated data of 5-years 2017-2021. J Coll Physicians Surg Pak 2023 33 5 560 565 37190693
6 Qureshi M.A. Mirza T. Khan S. Sikandar B. Zahid M. Aftab M. Mohsin S. Sharafat S. Avesi L. Hassan S. Cancer patterns in Karachi (all districts), Pakistan: First results (2010–2015) from a pathology based cancer registry of the largest government-run diagnostic and reference center of Karachi. Cancer Epidemiol. 2016 44 114 122 10.1016/j.canep.2016.08.011 27566468
7 Pervez S. Jabbar A.A. Haider G. Ashraf S. Qureshi M. Lateef F. Bashir I. Zaidi M. Khurshid M. Quraishy M. Siddiqi T. Rizwan U. Saqib M.A. Memon M. Alam E. Qureshi H. Karachi cancer registry (KCR): Age-standardized incidence rate by age-group and gender in a mega city of Pakistan. Asian Pac. J. Cancer Prev. 2020 21 11 3251 3258 10.31557/APJCP.2020.21.11.3251 33247682
8 Badwelan M. Muaddi H. Ahmed A. Lee K.T. Tran S.D. Oral squamous cell carcinoma and concomitant primary tumors, what do we know? a review of the literature. Curr. Oncol. 2023 30 4 3721 3734 10.3390/curroncol30040283 37185396
9 Bibi K. Fatima T. Sohrab S. Haider G. Zarina S. Ilyas A. Polymorphic variants of ASS1 gene related to arginine metabolism and the risk of HCC. Protein Pept. Lett. 2023 30 7 587 596 10.2174/0929866530666230529143121 37254538
10 Ullah A. Razzaq A. Zhou C. Ullah N. Shehzadi S. Aziz T. Alfaifi M.Y. Elbehairi S.E.I. Iqbal H. Biological significance of ephb4 expression in cancer. Curr. Protein Pept. Sci. 2023 24 10.2174/0113892037269589231017055642 37909437
11 Ullah A. Shehzadi S. Ullah N. Nawaz T. Iqbal H. Aziz T. Hypoxia a typical target in human lung cancer therapy. Curr. Protein Pept. Sci. 2023 24 10.2174/0113892037252820231114045234 38031268
12 Cheng Y.S.L. Rees T. Wright J. A review of research on salivary biomarkers for oral cancer detection. Clin. Transl. Med. 2014 3 1 e3 10.1186/2001-1326-3-3 24564868
13 Gulati A. Sobti R. Oral squamous cell carcinoma. Biomarkers in Cancer Detection and Monitoring of Therapeutics. Elsevier 2024 1 87 10.1016/B978-0-323-95114-2.00008-X
14 Tumban E. A current update on human papillomavirus‐associated head and neck cancers. Viruses 2019 11 10 922 10.3390/v11100922 31600915
15 Lei Z.N. Tian Q. Teng Q.X. Wurpel J.N.D. Zeng L. Pan Y. Chen Z.S. Understanding and targeting resistance mechanisms in cancer. MedComm 2023 4 3 e265 10.1002/mco2.265 37229486
16 Ling Z. Cheng B. Tao X. Epithelial-to-mesenchymal transition in oral squamous cell carcinoma: Challenges and opportunities. Int. J. Cancer 2021 148 7 1548 1561 10.1002/ijc.33352 33091960
17 Ang H.L. Mohan C.D. Shanmugam M.K. Leong H.C. Makvandi P. Rangappa K.S. Bishayee A. Kumar A.P. Sethi G. Mechanism of epithelial-mesenchymal transition in cancer and its regulation by natural compounds. Med. Res. Rev. 2023 43 4 1141 1200 10.1002/med.21948 36929669
18 Akhurst R.J. From shape-shifting embryonic cells to oncology: The fascinating history of epithelial mesenchymal transition. Seminars in Cancer Biology. Elsevier 2023 10.1016/j.semcancer.2023.10.003
19 Georgakopoulos-Soares I. Chartoumpekis D.V. Kyriazopoulou V. Zaravinos A. EMT factors and metabolic pathways in cancer. Front. Oncol. 2020 10 499 10.3389/fonc.2020.00499 32318352
20 Kalluri R. Weinberg R.A. The basics of epithelial-mesenchymal transition. J. Clin. Invest. 2009 119 6 1420 1428 10.1172/JCI39104 19487818
21 Lamouille S. Xu J. Derynck R. Molecular mechanisms of epithelial–mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014 15 3 178 196 10.1038/nrm3758 24556840
22 Vandewalle C. Van Roy F. Berx G. The role of the ZEB family of transcription factors in development and disease. Cell. Mol. Life Sci. 2009 66 5 773 787 10.1007/s00018-008-8465-8 19011757
23 Davies A. Zoubeidi A. Beltran H. Selth L.A. The transcriptional and epigenetic landscape of cancer cell lineage plasticity. Cancer Discov. 2023 13 8 1771 1788 10.1158/2159-8290.CD-23-0225 37470668
24 Ciriello G. Cancer evolution: A multifaceted affair. Cancer Discov. 2023 14 1 36 48 38047596
25 Kang N. Xie X. Zhou X. Wang Y. Chen S. Qi R. Liu T. Jiang H. Identification and validation of EMT-immune-related prognostic biomarkers CDKN2A, CMTM8 and ILK in colon cancer. BMC Gastroenterol. 2022 22 1 190 10.1186/s12876-022-02257-2 35429970
26 Chaffer C.L. Weinberg R.A. A perspective on cancer cell metastasis. Science 2011 331 6024 1559 1564 10.1126/science.1203543 21436443
27 Derynck R. Weinberg R.A. EMT and cancer: More than meets the eye. Dev. Cell 2019 49 3 313 316 10.1016/j.devcel.2019.04.026 31063750
28 Edme N. Downward J. Thiery J.P. Boyer B. Ras induces NBT-II epithelial cell scattering through the coordinate activities of Rac and MAPK pathways. J. Cell Sci. 2002 115 12 2591 2601 10.1242/jcs.115.12.2591 12045229
29 Göppel J. Möckelmann N. Münscher A. Sauter G. Schumacher U. Expression of epithelial-mesenchymal transition regulating transcription factors in head and neck squamous cell carcinomas. Anticancer Res. 2017 37 10 5435 5440 28982853
30 Sreeshma B. Unravelling the crosstalk of Hedgehog with Wnt, Notch and TGF-β signaling pathways. Stem Cells and Signaling Pathways. Elsevier 2024 181 203 10.1016/B978-0-443-18800-8.00001-0
31 Zhou Y. Sun S. Ling T. Chen Y. Zhou R. You Q. The role of fibroblast growth factor 18 in cancers: Functions and signaling pathways. Front. Oncol. 2023 13 1124520 10.3389/fonc.2023.1124520 37228502
32 Atwell B. Chen C.Y. Christofferson M. Montfort W.R. Schroeder J. Sorting nexin-dependent therapeutic targeting of oncogenic epidermal growth factor receptor. Cancer Gene Ther. 2023 30 2 267 276 10.1038/s41417-022-00541-7 36253541
33 Uckun F.M. Qazi S. Trieu V. High intra-tumor transforming growth factor beta 2 level as a predictor of poor treatment outcomes in pediatric diffuse intrinsic pontine glioma. Cancers 2023 15 6 1676 10.3390/cancers15061676 36980562
34 Alkhathami A.G. Abdullah M.R. Ahmed M. Ahmed H.H. Alwash S.W. Mahdi M.Z. Alsaikhan F. Dera A.A. Bone morphogenetic protein (BMP)9 in cancer development: Mechanistic, diagnostic, and therapeutic approaches? J. Drug Target. 2023 31 7 714 724 10.1080/1061186X.2023.2236330 37461888
35 soleymani L. Zarrabi A. Hashemi F. Hashemi F. Zabolian A. Banihashemi S.M. Moghadam S.S. Hushmandi K. Samarghandian S. Ashrafizadeh M. Khan H. Role of ZEB family members in proliferation, metastasis, and chemoresistance of prostate cancer cells: revealing signaling networks. Curr. Cancer Drug Targets 2021 21 9 749 767 10.2174/1568009621666210601114631 34077345
36 Das V. Bhattacharya S. Chikkaputtaiah C. Hazra S. Pal M. The basics of epithelial–mesenchymal transition (EMT): A study from a structure, dynamics, and functional perspective. J. Cell. Physiol. 2019 234 9 14535 14555 10.1002/jcp.28160 30723913
37 Stemmler M.P. Eccles R.L. Brabletz S. Brabletz T. Non-redundant functions of EMT transcription factors. Nat. Cell Biol. 2019 21 1 102 112 10.1038/s41556-018-0196-y 30602760
38 Tan Y. Wang Z. Xu M. Li B. Huang Z. Qin S. Nice E.C. Tang J. Huang C. Oral squamous cell carcinomas: State of the field and emerging directions. Int. J. Oral Sci. 2023 15 1 44 10.1038/s41368-023-00249-w 37736748
39 Saitoh M. Transcriptional regulation of EMT transcription factors in cancer. Seminars in Cancer Biology. Elsevier 2023 10.1016/j.semcancer.2023.10.001
40 Waryah C. Alves E. Mazzieri R. Dolcetti R. Thompson E.W. Redfern A. Blancafort P. Unpacking the complexity of epithelial plasticity: From master regulator transcription factors to non-coding RNAs. Cancers 2023 15 12 3152 10.3390/cancers15123152 37370762
41 Li D. Xia L. Huang P. Wang Z. Guo Q. Huang C. Leng W. Qin S. Heterogeneity and plasticity of epithelial–mesenchymal transition (EMT) in cancer metastasis: Focusing on partial EMT and regulatory mechanisms. Cell Prolif. 2023 56 6 e13423 10.1111/cpr.13423 36808651
42 Cho E.S. Kang H.E. Kim N.H. Yook J.I. Therapeutic implications of cancer epithelial-mesenchymal transition (EMT). Arch. Pharm. Res. 2019 42 1 14 24 10.1007/s12272-018-01108-7 30649699
43 Li J. Riedt T. Goossens S. Carrillo García C. Szczepanski S. Brandes M. Pieters T. Dobrosch L. Gütgemann I. Farla N. Radaelli E. Hulpiau P. Mallela N. Fröhlich H. La Starza R. Matteucci C. Chen T. Brossart P. Mecucci C. Huylebroeck D. Haigh J.J. Janzen V. The EMT transcription factor Zeb2 controls adult murine hematopoietic differentiation by regulating cytokine signaling. Blood 2017 129 4 460 472 10.1182/blood-2016-05-714659 27683414
44 Hanrahan K. O’Neill A. Prencipe M. Bugler J. Murphy L. Fabre A. Puhr M. Culig Z. Murphy K. Watson R.W. The role of epithelial–mesenchymal transition drivers ZEB 1 and ZEB 2 in mediating docetaxel‐resistant prostate cancer. Mol. Oncol. 2017 11 3 251 265 10.1002/1878-0261.12030 28133913
45 Ang L. Zheng L. Wang J. Huang J. Hu H.G. Zou Q. Zhao Y. Liu Q.M. Zhao M. Wu Z.S. Expression of and correlation between BCL6 and ZEB family members in patients with breast cancer. Exp. Ther. Med. 2017 14 5 3985 3992 10.3892/etm.2017.5101 29104620
46 Arima Y. Hayashi H. Sasaki M. Hosonaga M. Goto T.M. Chiyoda T. Kuninaka S. Shibata T. Ohata H. Nakagama H. Taya Y. Saya H. Induction of ZEB proteins by inactivation of RB protein is key determinant of mesenchymal phenotype of breast cancer. J. Biol. Chem. 2012 287 11 7896 7906 10.1074/jbc.M111.313759 22262832
47 Kim H.R. Seo C.W. Han S.J. Zinc finger e-box binding homeobox 2 as a prognostic biomarker in various cancers and its correlation with infiltrating immune cells in ovarian cancer. Curr Issues Mol Biol. 2022 44 3 1203 1214 10.3390/cimb44030079 35723302
48 Hurt E.M. Saykally J.N. Anose B.M. Kalli K.R. Sanders M.M. Expression of the ZEB1 (δEF1) transcription factor in human: Additional insights. Mol. Cell. Biochem. 2008 318 1-2 89 99 10.1007/s11010-008-9860-z 18622689
49 Li Y. Fei H. Lin Q. Liang F. You Y. Li M. Wu M. Qu Y. Li P. Yuan Y. Chen T. Jiang H. ZEB2 facilitates peritoneal metastasis by regulating the invasiveness and tumorigenesis of cancer stem-like cells in high-grade serous ovarian cancers. Oncogene 2021 40 32 5131 5141 10.1038/s41388-021-01913-3 34211089
50 Yao X. Sun S. Zhou X. Zhang Q. Guo W. Zhang L. Clinicopathological significance of ZEB-1 and E-cadherin proteins in patients with oral cavity squamous cell carcinoma. OncoTargets Ther. 2017 10 781 790 10.2147/OTT.S111920 28243114
51 Kong Y.H. Syed Zanaruddin S.N. Lau S.H. Ramanathan A. Kallarakkal T.G. Vincent-Chong V.K. Wan Mustafa W.M. Abraham M.T. Rahman A.Z.A. Zain R.B. Cheong S.C. Co-expression of TWIST1 and ZEB2 in oral squamous cell carcinoma is associated with poor survival. PLoS One 2015 10 7 e0134045 10.1371/journal.pone.0134045 26214683
52 Bustin S.A. The MIQE Guidelines: M inimum I nformation for Publication of Q uantitative Real-Time PCR E xperiments. Oxford University Press 2009
53 Natarajan E. Oral and oropharyngeal cancer. Dental Science for the Medical Professional 2023 261 301 10.1007/978-3-031-38567-4_19
54 Odell E. Kujan O. Warnakulasuriya S. Sloan P. Oral epithelial dysplasia: Recognition, grading and clinical significance. Oral Dis. 2021 27 8 1947 1976 10.1111/odi.13993 34418233
55 Woo S.B. Oral epithelial dysplasia and premalignancy. Head Neck Pathol. 2019 13 3 423 439 10.1007/s12105-019-01020-6 30887394
56 Abati S. Bramati C. Bondi S. Lissoni A. Trimarchi M. Oral cancer and precancer: A narrative review on the relevance of early diagnosis. Int. J. Environ. Res. Public Health 2020 17 24 9160 10.3390/ijerph17249160 33302498
57 Rivera C. Venegas B. Histological and molecular aspects of oral squamous cell carcinoma (Review). Oncol. Lett. 2014 8 1 7 11 10.3892/ol.2014.2103 24959211
58 Speight P.M. Takata T. New tumour entities in the 4th edition of the World Health Organization Classification of Head and Neck tumours: Odontogenic and maxillofacial bone tumours. Virchows Archiv 2018 472 3 331 339 28674741
59 Anwar N. Pervez S. Chundriger Q. Awan S. Moatter T. Ali T.S. Oral cancer: Clinicopathological features and associated risk factors in a high risk population presenting to a major tertiary care center in Pakistan. PLoS One 2020 15 8 e0236359 10.1371/journal.pone.0236359 32760151
60 Wolfer S. Foos T. Kunzler A. Ernst C. Schultze-Mosgau S. Association of the preoperative body mass index with postoperative complications after treatment of oral squamous cell carcinoma. J. Oral Maxillofac. Surg. 2018 76 8 1800 1815 10.1016/j.joms.2018.02.029 29605536
61 Wang C. Pan Y. Xu Q. Li B. Kim K. Mao M. Li J. Qin L. Li H. Han Z. Feng Z. Relationship between body mass index and outcomes for patients with oral squamous cell carcinoma. Oral Dis. 2019 25 1 87 96 10.1111/odi.12963 30144246
62 Elebyary O. Barbour A. Fine N. Tenenbaum H.C. Glogauer M. The crossroads of periodontitis and oral squamous cell carcinoma: Immune implications and tumor promoting capacities. Frontiers in Oral Health 2021 1 584705 10.3389/froh.2020.584705 35047982
63 Shrestha A.D. Vedsted P. Kallestrup P. Neupane D. Prevalence and incidence of oral cancer in low- and middle-income countries: A scoping review. Eur. J. Cancer Care 2020 29 2 e13207 10.1111/ecc.13207 31820851
64 Lin N.C. Hsu J.T. Tsai K.Y. Survival and clinicopathological characteristics of different histological grades of oral cavity squamous cell carcinoma: A single-center retrospective study. PLoS One 2020 15 8 e0238103 10.1371/journal.pone.0238103 32841288
65 Ettinger K.S. Ganry L. Fernandes R.P. Oral cavity cancer. Oral Maxillofac. Surg. Clin. North Am. 2019 31 1 13 29 10.1016/j.coms.2018.08.002 30454788
66 Do W. Elzerman T. de Bree R. Rosenberg A. Forouzanfar T. Van Cann E.M. Is low or high body mass index in patients operated for oral squamous cell carcinoma associated with the perioperative complication rate? Int. J. Oral Maxillofac. Surg. 2021 50 5 591 597 10.1016/j.ijom.2020.07.023 32861557
67 Bagan J. Sarrion G. Jimenez Y. Oral cancer: Clinical features. Oral Oncol. 2010 46 6 414 417 10.1016/j.oraloncology.2010.03.009 20400366
68 Tadbir A.A. Ebrahimi H. Pourshahidi S. Zeraatkar M. Evaluation of levels of knowledge about etiology and symptoms of oral cancer in southern Iran. Asian Pac. J. Cancer Prev. 2013 14 4 2217 2220 10.7314/APJCP.2013.14.4.2217 23725115
69 Cuffari L. Siqueira J.T.T. Nemr K. Rapaport A. Pain complaint as the first symptom of oral cancer: A descriptive study. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2006 102 1 56 61 10.1016/j.tripleo.2005.10.041 16831673
70 Giovannucci E. Stampfer M.J. Krithivas K. Brown M. Brufsky A. Talcott J. Hennekens C.H. Kantoff P.W. Kantoff P.W. The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. Proc. Natl. Acad. Sci. 1997 94 7 3320 3323 10.1073/pnas.94.7.3320 9096391
71 Xue C. Plieth D. Venkov C. Xu C. Neilson E.G. The gatekeeper effect of epithelial-mesenchymal transition regulates the frequency of breast cancer metastasis. Cancer Res. 2003 63 12 3386 3394 12810675
72 Chaw S.Y. Abdul Majeed A. Dalley A.J. Chan A. Stein S. Farah C.S. Epithelial to mesenchymal transition (EMT) biomarkers – E-cadherin, beta-catenin, APC and Vimentin – in oral squamous cell carcinogenesis and transformation. Oral Oncol. 2012 48 10 997 1006 10.1016/j.oraloncology.2012.05.011 22704062
73 Slean M.M. Panigrahi G.B. Castel A.L. Pearson A.B. Tomkinson A.E. Pearson C.E. Absence of MutSβ leads to the formation of slipped-DNA for CTG/CAG contractions at primate replication forks. DNA Repair 2016 42 107 118 10.1016/j.dnarep.2016.04.002 27155933
74 Jia B. Liu H. Kong Q. Li B. Overexpression of ZEB1 associated with metastasis and invasion in patients with gastric carcinoma. Mol. Cell. Biochem. 2012 366 1-2 223 229 10.1007/s11010-012-1299-6 22466758
75 Gemmill R.M. Roche J. Potiron V.A. Nasarre P. Mitas M. Coldren C.D. Helfrich B.A. Garrett-Mayer E. Bunn P.A. Drabkin H.A. ZEB1-responsive genes in non-small cell lung cancer. Cancer Lett. 2011 300 1 66 78 10.1016/j.canlet.2010.09.007 20980099
76 Shen A. Zhang Y. Yang H. Xu R. Huang G. Overexpression of ZEB1 relates to metastasis and invasion in osteosarcoma. J. Surg. Oncol. 2012 105 8 830 834 10.1002/jso.23012 22213004
77 Larsen J.E. Nathan V. Osborne J.K. Farrow R.K. Deb D. Sullivan J.P. Dospoy P.D. Augustyn A. Hight S.K. Sato M. Girard L. Behrens C. Wistuba I.I. Gazdar A.F. Hayward N.K. Minna J.D. ZEB1 drives epithelial-to-mesenchymal transition in lung cancer. J. Clin. Invest. 2016 126 9 3219 3235 10.1172/JCI76725 27500490
78 Kahlert C. Lahes S. Radhakrishnan P. Dutta S. Mogler C. Herpel E. Brand K. Steinert G. Schneider M. Mollenhauer M. Reissfelder C. Klupp F. Fritzmann J. Wunder C. Benner A. Kloor M. Huth C. Contin P. Ulrich A. Koch M. Weitz J. Overexpression of ZEB2 at the invasion front of colorectal cancer is an independent prognostic marker and regulates tumor invasion in vitro. Clin. Cancer Res. 2011 17 24 7654 7663 10.1158/1078-0432.CCR-10-2816 22042972
79 Fardi M. Alivand M. Baradaran B. Farshdousti Hagh M. Solali S. The crucial role of ZEB2: From development to epithelial‐to‐mesenchymal transition and cancer complexity. J. Cell. Physiol. 2019 234 9 14783 14799 10.1002/jcp.28277 30773635
80 Li M-Z. Wang J.J. Yang S.B. Li W.F. Xiao L.B. He Y.L. Song X.M. ZEB2 promotes tumor metastasis and correlates with poor prognosis of human colorectal cancer. Am. J. Transl. Res. 2017 9 6 2838 2851 28670373
81 Kurahara H. Takao S. Maemura K. Mataki Y. Kuwahata T. Maeda K. Ding Q. Sakoda M. Iino S. Ishigami S. Ueno S. Shinchi H. Natsugoe S. Epithelial–mesenchymal transition and mesenchymal–epithelial transition via regulation of ZEB-1 and ZEB-2 expression in pancreatic cancer. J. Surg. Oncol. 2012 105 7 655 661 10.1002/jso.23020 22213144
