
==== Front
MycoKeys
MycoKeys
11
urn:lsid:arphahub.com:pub:C004A564-9D6A-5F9F-B058-6A3815DFE9C3
urn:lsid:zoobank.org:pub:A4FD9303-3F01-45D9-B438-FCCFE465D2F7
MycoKeys
1314-4057
1314-4049
Pensoft Publishers

10.3897/mycokeys.108.128889
128889
Research Article
Ascomycota
Dothideomycetes
Pleosporomycetidae
Tubeufiaceae
Taxonomy
Asia
﻿Novel Helicoma and Neohelicosporium (Tubeufiaceae, Tubeufiales) species and two new host records of Helicoma on tropical palms (Arecaceae) from China
Xiong Yinru https://orcid.org/0000-0002-4673-606X
12Writing - original draft Data curation Investigation Methodology
Hyde Kevin D. kdhyde3@gmail.com
https://orcid.org/0000-0002-2191-0762
23Writing - review and editing Funding acquisition Project administration Resources
Lu Li https://orcid.org/0000-0003-0977-6414
24Data curation Investigation Methodology
Harishchandra Dulanjalee L. https://orcid.org/0000-0003-1538-4951
5Writing - review and editing
Mapook Ausana https://orcid.org/0000-0001-7929-2429
2Writing - review and editing
Xu Biao 1Funding acquisition
Alotibi Fatimah 6Funding acquisition
Manawasinghe Ishara S. ishara9017@gmail.com
https://orcid.org/0000-0001-5730-3596
1Writing - review and editing Formal analysis Supervision Visualization
1 Innovative Institute for Plant Health, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, Guangdong, China
2 School of Science, Mae Fah Luang University, Chiang Rai 57100, Thailand
3 Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai 57100, Thailand
4 CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Science, Kunming, China
5 Center for Yunnan Plateau Biological Resources Protection and Utilization, College of Biological Resource and Food Engineering, Qujing Normal University, Qujing, Yunnan 655011, China
6 Office of Research Administration, Chiang Mai University, Chiang Mai 50200, Thailand
7 Department of Entomology and Plant Pathology, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
8 Department of Botany and Microbiology, College of Science, King Saud University, P.O. Box 22452, 11495 Riyadh, Saudi Arabia
Corresponding authors: Kevin D. Hyde (kdhyde3@gmail.com); Ishara S. Manawasinghe (ishara9017@gmail.com)
Academic editor: S. C. Karunarathna

2024
13 9 2024
108 287315
296E506C-1738-5A07-A634-5B0A90DA8F5F03 6 2024
30 7 2024
Yinru Xiong, Kevin D. Hyde, Li Lu, Dulanjalee L. Harishchandra, Ausana Mapook, Biao Xu, Fatimah Alotibi, Ishara S. Manawasinghe
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
﻿Abstract

Asexual species of Tubeufiaceae are characterised as helicosporous hyphomycetes and are abundantly discovered in tropical and subtropical regions. The present study collected helicosporous fungal samples from rotting tissues of Caryotamitis, Elaeisguineensis and E.oleifera in Xishuangbanna, Yunan Province, China. Fungal isolates were identified, based on the morphological characteristics and multi-gene phylogeny with DNA sequence data of the internal transcribed spacer (ITS), part of the large subunit nuclear rRNA gene (LSU), translation elongation factor 1-alpha gene (tef 1-α) and RNA polymerase II second largest subunit gene (rpb2). Herein, we introduce three new species viz. Helicomaoleifera, Neohelicosporiumguineensis and N.xishuangbannaensis. In addition, we introduce two new host records of Helicomaguttulatum and H.rufum on Caryotamitis. The illustrations of all identified species, detailed descriptions and in-depth phylogenetic analyses are provided. Our results add new knowledge of fungal species associated with palm hosts in southern China. Moreover, our data will contribute to the biodiversity of fungi in tropical China.

Key words: Caryotamitis
Elaeisguineensis
Elaeisoleifera
helicosporous fungi
phylogeny
saprobic fungi
taxonomy
three new species
High-level Talents at Zhongkai University of Agriculture and Engineering, grant no: J2201080102 Researchers Supporting Project number (RSP2024R114), King Saud University, Riyadh, Saudi ArabiaCitation

Xiong Y, Hyde KD, Lu L, Harishchandra DL, Mapook A, Xu B, Alotibi F, Manawasinghe IS (2024) Novel Helicoma and Neohelicosporium (Tubeufiaceae, Tubeufiales) species and two new host records of Helicoma on tropical palms (Arecaceae) from China. MycoKeys 108: 287–315. https://doi.org/10.3897/mycokeys.108.128889
==== Body
pmc﻿Introduction

Regions in southern China exhibit characteristics of a monsoon climate and its weather patterns are additionally influenced by the geographical distribution and differentiation of land and sea (Wang et al. 1999; Peng et al. 2021). Therefore, the boundaries of China’s tropics are long and incoherent (Gongfu et al. 1990). In this fragmented tropical region spanning from south-eastern to south-western China, the flora shows certain differences depending on the geographical composition in different regions (Zhu 2017). There are 23 large plant families containing 100–200 species of tropical flora in different regions, amongst which 101 species and 18 genera are from Arecaceae (Zhu 2016, 2017).

Arecaceae species are commonly known as palms and they are common in tropical evergreen forests. These species are available in every ecological habitat in the Tropics and Sub-tropics and regulate the composition and climate in those ecosystems (Reichgelt et al. 2018; Fehr et al. 2020). They are rich in fungal diversity covering most major groups of fungi and have been widely reported and studied (Fröhlich and Hyde 1999, 2000; Taylor et al. 1999; Konta et al. 2023; Pereira and Phillips 2023). Amongst these, many Tubeufiaceae species are recorded in the history of studies of palm fungi (Pereira and Phillips 2023). A few examples are: Pirozynski (1972) reporting Helicomaambiens on oil palm from Tanzania, Aquaphilaramdayalea reported by Bhat (2008) on Caryotaurens from India and Berkleasmiumcorticola reported by Capdeet and Romero (2010) on Butiayatay and Syagrusromanzoffiana from Argentina.

Tubeufiaceae was introduced by Barr (1979), based on the type genus Tubeufia to accommodate bitunicate ascomycetes occurring as saprobes on decaying wood. Tubeufiaceae has fascinating and peculiar morphs of both sexual and asexual morphs (Zhao et al. 2007; Li et al. 2022). These species are prevalently distributed in temperate and tropical regions (Rossman 1987; Kirk et al. 2001; Lumbsch and Huhndorf 2010; Boonmee et al. 2014; Luo et al. 2017; Lu et al. 2018a, b). Although members of this family can be found in both terrestrial woody substrates and in aquatic habitats, an interesting phenomenon is that most asexual morphs of Tubeufiaceae are collected from freshwater habitats (Hyde et al. 2016, 2017; Brahamanage et al. 2017; Chaiwan et al. 2017; Lu et al. 2017a, b, c, 2018a, b; Liu et al. 2018; Hongsanan et al. 2020). The distinguishing characteristic of Tubeufiaceae is the asexual morph mostly found as helicosporous hyphomycetes, while some contain phragmosporous and chlamydosporous conidia (Lu et al. 2018b; Dong et al. 2020). Their sexual morphs are characterised by superficial ascomata, bitunicate asci and ascospores which are hyaline to pale brown, elongate, obovoid or oblong and septate (Barr 1980; Kodsueb et al. 2006; Boonmee et al. 2011, 2014; Brahamanage et al. 2017; Lu et al. 2018b). Following Wijayawardene et al. (2022) and Ma et al. (2023), 47 genera have been accepted in Tubeufiaceae including Helicoma and Neohelicosporium.

Helicoma was proposed by Corda (1837), with H.muelleri as the type species. It is one of the earliest genera of helicosporous hyphomycetes (Linder 1929; Moore 1955; Goos 1986; Boonmee et al. 2014; Lu et al. 2018b). Helicoma species are frequently reported as saprobes inhabiting terrestrial and aquatic environments (Zhao et al. 2007; Boonmee et al. 2011, 2014; Hyde et al. 2016; Lu et al. 2018b, 2023; Liu et al. 2019; Tian et al. 2022). Based on phylogenetic analysis of combined ITS, LSU, tef 1-α and rpb2, Lu et al. (2018b) accepted species that are different from typical-Helicoma morphs described by Goos (1986) as Helicoma. These species are characterised by conidiogenous cells that are intercalary, cylindrical, with denticles, arising laterally from the lower portion of conidiophores as tooth-like protrusions. Conidia are pleurogenous, helicoid, hygroscopic, tapering towards the apex and rounded at the tip, coiled 1½–5 times, becoming loosely coiled in water. Subsequently, H.hydei (Liu et al. 2019), H.wuzhishanense (Lu et al. 2022), H.acropleurogenum and H.liyui (Lu et al. 2023) were reported in this genus.

Neohelicosporium was introduced by Lu et al. (2018a) to accommodate taxa with special helicosporous spores based on morphology and phylogenetic analysis of combined ITS, LSU, tef 1-α, and rpb2. Their unique characteristics include branched or unbranched conidiophores arising from creeping hyphae, mono- to polyblastic, integrated, sympodial conidiogenous cells with denticles and acrogenous and/or acropleurogenous conidia, which are used to distinct Neohelicosporium from Helicosporium (Lu et al. 2018b). After synonymising several species from Helicoma, Helicomyces, Helicosporium, and Tubeufia, 25 species are accepted in Neohelicosporium (Lu et al. 2018b; Index Fungorum 2024).

To explore the relationship between Tubeufiaceae associated with various palms, the present study collected terrestrial decaying samples of Caryotamitis, Elaeisguineensis and E.oleifera. A total of 12 isolates were obtained, from which we introduce three new species: Helicomaoleifera, Neohelicosporiumguineensis and N.xishuangbannaensis and two new host records: Helicomaguttulatum and H.rufum. Species descriptions, illustrations of macroscopic and microscopic morphology and phylogenetic analyses are provided to delineate new and known species.

﻿Materials and methods

﻿Samples collection and isolation

Samples were collected in 2023 from an unidentified forest area beside National Highway 219 in Xishuangbanna in Yunnan Province, China (21°93'20"N, 101°24'57"E, 549.6 m elev.). These samples were rotting materials from different palm species namely, Caryotamitis, Elaeisoleifera and E.guineensis. Samples were brought into the laboratory using plastic ziplock bags and relevant macro and micro-characteristics were photographed by a ZEISS SteREO Discovery V20 stereomicroscopy (Germany) and Nikon Eclipse 80i and the industrial DigitaL Sight DS-Fi1 (Panasonic, Japan) microscope. Following the methods of Senanayake et al. (2018, 2020), single-spore isolation was performed. Germinated spores were aseptically transferred into fresh potato dextrose agar (PDA) plates and incubated at 25 °C to obtain pure cultures (Senanayake et al. 2020). The cultures obtained during the study were deposited in the culture collection of Zhongkai University of Agriculture and Engineering (ZHKUCC). Herbarium materials were deposited at the Mycological Herbarium of Zhongkai University of Agriculture and Engineering (MHZU). Facesoffungi (FoF) numbers and Index Fungorum (IF) numbers were obtained as explained in Jayasiri et al. (2015) and Index Fungorum (2024).

﻿Morphological characterisation

After the fungal samples were brought into the laboratory, the Cnoptec SZ650 series (Cnoptec, China) stereomicroscope was used to observe the macromorphological characteristics and photographs were taken using SteReo Discovery V20. Nikon Eclipse 80i and the industrial DigitaL Sight DS-Fi1 (Panasonic, Japan) microscope and imaging system were used to take pictures of micromorphological characters. Digital images of micromorphological structures, including shape, size and colour were recorded. The measurement of structures, including spore dimensions for each species was conducted using NIS-Elements BR 5.30.03. Adobe Photoshop CC 2019 and Adobe Illustrator CC 2019 software (Adobe Systems Inc., San Jose, America) were used to develop images and make photo plates. All pure cultures obtained in this study were grown on potato dextrose agar (PDA) at 25 °C in 12 hours of daylight for a week and the diameter of the culture was measured after six weeks. AxioVersion Rel. 4.8 was used to take photos of the cultures.

﻿DNA extraction, PCR amplification and sequencing

The pure cultures were cultured on PDA plates for 1–2 weeks and about 500 mg of fresh fungal mycelia were scraped. Total genomic DNA was extracted from the mycelia using MagPure Plant AS Kit (Magen Biotech, China) following the manufacturer’s instructions. Four nuclear gene regions: internal transcribed spacer (ITS), large subunit nuclear rRNA gene (LSU), translation elongation factor 1-α (tef 1-α) and RNA polymerase II second largest subunit gene (rpb2) were amplified using the primers shown in Table 1. The PCR reaction mixture contained 25 μl of total volume, which consisted of 12.5 μl 2 × FastTaq Premix (mixture of FastTaq TM DNA Polymerase, buffer, dNTP Mixture and stabiliser) (Beijing Qingke Biological Technology Co., Ltd., Beijing, PR China), 1 μl of forward and reverse primers each, 9.5 μl ddH2O and 1 μl DNA. The polymerase chain reaction (PCR) was performed in a C1000 TouchTM thermal cycler. The PCR procedure is as follows: for ITS/LSU, the initial denaturation step is performed at 95 °C for 2 minutes, then 35 amplification cycles at 95 °C for 1 minute, 50 °C for 1 minute and 72 °C for 1 minute. Finally, extension for 10 minutes at 72 °C. For tef 1-α, an initial step of 2 minutes at 95 °C followed by 35 cycles of 1 minute at 95 °C, 1 minute at 52 °C, 1 minute at 72 °C and 7 minutes at 72 °C. For rpb2 PCR conditions, an initial denaturation step was performed at 95 °C for 5 minutes and then 30 cycles at 94 °C for 1 minute, 53 °C for 30 seconds, 72 °C for 90 seconds and finally 72 °C for 10 minutes. After PCR amplification, the product was observed on a 1% agarose gel under ultraviolet light. DNA sequencing was completed in Tianyi (Guangzhou, China) Co., Ltd. New sequences are deposited in GenBank. The sequences used for analyses with accession numbers are given in Table 2.

Table 1. Genes and corresponding primers used in this study.

Gene	Primer	Sequence (5’-3’)	Reference	
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	White et al. (1990)	
ITS4	TCCTCCGCTTATTGATATGC	
LSU	LR0R	ACCCGCTGAACTTAAGC	Vilgalys and Hester (1990)	
LR5	TCCTGAGGGAAACTTCG	
tef 1-α	EF1-983F	GCYCCYGGHCAYCGTGAYTTYAT	Carbone and Kohn (1999)	
EF1-2218R	TACTTGAAGGAACCCTTACC	
rpb2	fRPB2-5F	GAYGAYMGWGATCAYTTYGG	O’Donnell et al. (2007)	
RPB2-7cr	CCCATRGCTTGYTTRCCCAT	

Table 2. Taxon names, strain numbers and corresponding GenBank accession numbers of the taxa used in the Tubeufiaceae phylogenetic analyses.

Species	Strain numbers	ITS	LSU	tef 1-α	rpb2	
Acanthohelicosporaaurea	GZCC 16-0060	KY321323	KY321326	KY792600	MF589911	
Acanthohelicosporapinicola	MFLUCC 10-0116	KF301526	KF301534	KF301555	NA	
Aquaphilaalbicans	BCC 3543	DQ341096	DQ341101	NA	NA	
Aquaphilaalbicans	MFLUCC 16-0010	KX454165	KX454166	KY117034	MF535255	
Berkleasmiumfusiforme	MFLUCC 17-1979	MH558694	MH558821	MH550885	MH551008	
Berkleasmiumlongisporum	MFLUCC 17-1990	MH558697	MH558824	MH550888	MH551011	
Botryosphaeriaagaves T	MFLUCC 10-0051	JX646790	JX646807	JX646855	NA	
Botryosphaeriadothidea	CBS 115476	NA	NG_027577	NA	NA	
Chlamydotubeufiacylindrica T	MFLUCC 16-1130	MH558702	MH558830	MH550893	MH551018	
Chlamydotubeufiahuaikangplaensis T	MFLUCC 10-0926	JN865210	JN865198	NA	NA	
Chlamydotubeufiakrabiensis T	MFLUCC 16-1134	KY678767	KY678759	KY792598	MF535261	
Dematiohelicomyceshelicosporus T	MFLUCC 16-0213	KX454169	KX454170	KY117035	MF535258	
Dematiohelicomyceshelicosporus	MFLUCC 16-0003	MH558703	MH558831	MH550894	MH551019	
Helicoarctatusaquaticus T	MFLUCC 17-1996	MH558707	MH558835	MH550898	MH551024	
Helicodochiumaquaticum	MFLUCC 16-0008	MH558708	MH558836	MH550899	MH551025	
Helicodochiumaquaticum T	MFLUCC 17-2016	MH558709	MH558837	MH550900	MH551026	
Helicohyalinumaquaticum T	MFLUCC 16-1131	KY873625	KY873620	KY873284	MF535257	
Helicohyalinuminfundibulum T	MFLUCC 16-1133	MH558712	MH558840	MH550903	MH551029	
Helicomaacropleurogenum T	GZCC 22-2035	OP806857	OP806854	OP821894	OP821897	
Helicomaambiens	UAMH 10533	AY916451	AY856916	NA	NA	
Helicomaambiens	UAMH 10534	AY916450	AY856869	NA	NA	
Helicomaaquaticum T	MFLUCC 17-2025	MH558713	MH558841	MH550904	MH551030	
Helicomabrunneisporum T	MFLUCC 17-1983	MH558714	MH558842	MH550905	MH551031	
Helicomadennisii	NBRC 30667	AY916455	AY856897	NA	NA	
Helicomafreycinetiae T	MFLUCC 16-0363	MH275062	MH260295	MH412770	NA	
Helicomafusiforme T	MFLUCC 17-1981	MH558715	NA	MH550906	NA	
Helicomaguttulatum T	MFLUCC 16-0022	KX454171	KX454172	MF535254	MH551032	
Helicomaguttulatum	GZCC 22-2004	OP508739	OP508779	OP698090	OP698079	
Helicomaguttulatum	GZCC 22-2024	OP508733	OP508773	OP698084	OP698073	
Helicomaguttulatum	GZCC 22-2025	OP508737	OP508777	OP698088	OP698077	
Helicomaguttulatum	MFLUCC 21-0152	OL545456	OL606150	OL964521	OL964527	
Helicomaguttulatum	ZHKUCC 24-0139	PP860094	PP860106	PP858054	PP858066	
Helicomaguttulatum	ZHKUCC 24-0140	PP860095	PP860107	PP858055	PP858067	
Helicomahongkongense	MFLUCC 17-2005	MH558716	MH558843	MH550907	MH551033	
Helicomahydei	MFLUCC 18-1270	MH747101	MH747116	MH747100	NA	
Helicomainthanonense T	MFLUCC 11-0003	JN865211	JN865199	NA	NA	
Helicomakhunkornensis T	MFLUCC 10-0119	JN865203	JN865191	KF301559	NA	
Helicomalinderi	NBRC 9207	AY916454	AY856895	NA	NA	
Helicomaliyui	GZCC 22-2033	OP806858	OP806855	OP821895	NA	
Helicomalongisporum	GZCC 22-2005	OP508740	OP508780	OP698091	OP698080	
Helicomalongisporum	MFLUCC 16-0211	MH558719	MH558845	MH550910	MH551036	
Helicomalongisporum T	MFLUCC 17-1997	MH558720	MH558846	MH550911	MH551037	
Helicomamiscanthi T	MFLUCC 11-0375	KF301525	KF301533	KF301554	NA	
Helicomamuelleri	CBS 964.69	AY916453	AY856877	NA	NA	
Helicomamuelleri	UBC F13877	AY916452	AY856917	NA	NA	
Helicomamultiseptatum T	GZCC 16-0080	MH558721	MH558847	MH550912	MH551038	
Helicomanematosporum T	MFLUCC 16-0011	MH558722	MH558848	MH550913	MH551039	
Helicomaoleifera T	ZHKUCC 24-0121	PP860086	PP860098	PP858056	PP858068	
Helicomaoleifera	ZHKUCC 24-0122	PP860087	PP860099	PP858057	PP858069	
Helicomaoleifera	ZHKUCC 24-0766	PP860088	PP860100	PP858058	PP858070	
Helicomaoleifera	ZHKUCC 24-0767	PP860089	PP860101	PP858059	PP858071	
Helicomarubriappendiculatum T	MFLUCC 18-0491	MH558723	MH558849	MH550914	MH551040	
Helicomarufum T	MFLUCC 17-1806	MH558724	MH558850	MH550915	NA	
Helicomarufum	ZHKUCC 24-0143	PP860096	PP860108	PP858060	PP858072	
Helicomarufum	ZHKUCC 24-0144	PP860097	PP860109	PP858061	PP858073	
Helicomarugosum	GZCC 22-2034	OP806859	OP806856	OP821896	NA	
Helicomarugosum	ANM 196	GQ856138	GQ850482	NA	NA	
Helicomarugosum	ANM 953	GQ856139	GQ850483	NA	NA	
Helicomarugosum	ANM 1169	NA	GQ850484	NA	NA	
Helicomarugosum	JCM 2739	NA	AY856888	NA	NA	
Helicomaseptoconstrictum	MFLUCC 17-1991	MH558725	MH558851	MH550916	MH551041	
Helicomaseptoconstrictum T	MFLUCC 17-2001	MH558726	MH558852	MH550917	MH551042	
Helicomasiamense T	MFLUCC 10-0120	JN865204	JN865192	KF301558	NA	
Helicoma sp.	HKUCC 9118	NA	AY849966	NA	NA	
Helicomatectonae T	MFLUCC 12-0563	KU144928	KU764713	KU872751	NA	
Helicomavaccinii	CBS 216.90	AY916486	AY856879	NA	NA	
Helicomawuzhishanense	GZCC 22-2003	OP508732	OP508772	OP698083	OP698072	
Helicomyceschiayiensis T	BCRC FU30842	LC316604	NA	NA	NA	
Helicomyceshyalosporus	MFLUCC 17-0051	MH558731	MH558857	MH550922	MH551047	
Helicomycestorquatus	MFLUCC 16-0217	MH558732	MH558858	MH550923	MH551048	
Helicosporiumflavum T	MFLUCC 16-1230	KY873626	KY873621	KY873285	NA	
Helicosporiumluteosporum T	MFLUCC 16-0226	KY321324	KY321327	KY792601	MH551056	
Helicosporiumvesicarium T	MFLUCC 17-1795	MH558739	MH558864	MH550930	MH551055	
Helicotruncatumpalmigenum	NBRC 32663	AY916480	AY856898	NA	NA	
Helicotruncatumpalmigenum	KUMCC 21-0474	OM102542	OL985959	OM355488	OM355492	
Helicotubeufiaguangxiensis T	MFLUCC 17-0040	MH290018	MH290023	MH290028	MH290033	
Helicotubeufiahydei T	MFLUCC 17-1980	MH290021	MH290026	MH290031	MH290036	
Helicotubeufiajonesii T	MFLUCC 17-0043	MH290020	MH290025	MH290030	MH290035	
Kamalomycesmangrovei	MFLUCC 17-0407	MH878781	MH878779	MH886508	NA	
Kamalomycesthailandicus	MFLUCC 13-0233	MF506884	MF506882	MF506886	NA	
Muripulchraaquatica	KUMCC 15-0245	KY320533	KY320550	KY320563	MH551057	
Muripulchraaquatica	KUMCC 15-0276	KY320534	KY320551	KY320564	MH551058	
Neoacanthostigmafusiforme T	MFLUCC 11-0510	KF301529	KF301537	NA	NA	
Neochlamydotubeufiafusiformis T	MFLUCC 16-0016	MH558740	MH558865	MH550931	MH551059	
Neochlamydotubeufiakhunkornensis	MFLUCC 16-0025	MH558742	MH558867	MH550933	MH551061	
Neohelicomycesaquaticus	KUMCC 15-0463	KY320529	KY320546	KY320562	MH551065	
Neohelicomycesgrandisporus T	KUMCC 15-0470	KX454173	KX454174	NA	MH551067	
Neohelicomycessubmersus T	MFLUCC 16-1106	KY320530	KY320547	NA	MH551068	
Neohelicosporiumabuense	CBS 101688	AY916470	NA	NA	NA	
Neohelicosporiumacrogenisporum T	MFLUCC 17-2019	MH558746	MH558871	MH550937	MH551069	
Neohelicosporiumaquaticum T	MFLUCC 17-1519	MF467916	MF467929	MF535242	MF535272	
Neohelicosporiumastrictum T	MFLUCC 17-2004	MH558747	MH558872	MH550938	MH551070	
Neohelicosporiumaurantiellum	ANM 718	GQ856140	GQ850485	NA	NA	
Neohelicosporiumbambusicola T	MFLUCC 21-0156	OL606157	OL606146	OL964517	OL964523	
Neohelicosporiumellipsoideum T	MFLUCC 16-0229	MH558748	MH558873	MH550939	MH551071	
Neohelicosporiumfluviatile	MFLUCC 15-0606	NA	OP377957	OP473050	OP473111	
Neohelicosporiumfusisporum T	MFUCC 16-0642	MG017612	MG017613	MG017614	NA	
Neohelicosporiumgriseum	CBS 961.69	AY916474	AY856884	NA	NA	
Neohelicosporiumgriseum	CBS 113542	AY916475	AY916088	NA	NA	
Neohelicosporiumguangxiense	GZCC 16-0042	MF467920	MF467933	MF535246	MF535276	
Neohelicosporiumguangxiense	MFLUCC 17-0054	MH558750	MH558875	MH550941	MH551073	
Neohelicosporiumguineensis T	ZHKUCC 24-0113	PP860090	PP860102	PP858062	PP858074	
Neohelicosporiumguineensis	ZHKUCC 24-0114	PP860091	PP860103	PP858063	PP858075	
Neohelicosporiumhyalosporum T	GZCC 16-0076	MF467923	MF467936	MF535249	MF535279	
Neohelicosporiumhyalosporum	GZCC 16-0063	MH558751	MH558876	MH550942	MH551074	
Neohelicosporiumirregulare T	MFLUCC 17-1796	MH558752	MH558877	MH550943	MH551075	
Neohelicosporiumirregulare	MFLUCC 17-1808	MH558753	MH558878	MH550944	MH551076	
Neohelicosporiumkrabiense T	MFLUCC 16-0224	MH558754	MH558879	MH550945	MH551077	
Neohelicosporiumlaxisporum T	MFLUCC 17-2027	MH558755	MH558880	MH550946	MH551078	
Neohelicosporiummorganii	CBS 281.54	AY916468	AY856876	NA	NA	
Neohelicosporiummorganii	CBS 222.58	AY916469	AY856880	NA	NA	
Neohelicosporiumovoideum T	GZCC 16-0064	MH558756	MH558881	MH550947	MH551079	
Neohelicosporiumovoideum	GZCC 16-0066	MH558757	MH558882	MH550948	MH551080	
Neohelicosporiumpanacheum	CBS 257.59	AY916471	AY916087	NA	NA	
Neohelicosporiumparvisporum	GZCC 16-0078	MF467924	MF467937	MF535250	MF535280	
Neohelicosporiumparvisporum	MFLUCC 17-2010	MH558763	MH558888	MH550954	MH551086	
Neohelicosporium sp.	CBS 189.95	AY916472	AY856882	NA	NA	
Neohelicosporium sp.	HKUCC 10235	NA	AY849942	NA	NA	
Neohelicosporiumsuae	CGMCC 3.23541	OP184079	OP184068	OP186052	OP265702	
Neohelicosporiumsubmersum	MFLUCC 17-2376	MT627738	MN913738	NA	NA	
Neohelicosporiumtaiwanense T	BCRC FU30841	LC316603	NA	NA	NA	
Neohelicosporiumthailandicum T	MFLUCC 16-0221	MF467928	MF467941	MF535253	MF535283	
Neohelicosporiumxishuangbannaensis T	ZHKUCC 24-0119	PP860092	PP860104	PP858064	PP858076	
Neohelicosporiumxishuangbannaensis	ZHKUCC 24-0120	PP860093	PP860105	PP858065	PP858077	
Neotubeufiakrabiensis T	MFLUCC 16-1125	MG012031	MG012024	MG012010	MG012017	
Parahelicomycesaquaticus T	MFLUCC 16-0234	MH558766	MH558891	MH550958	MH551092	
Parahelicomyceschiangmaiensis T	MFLUCC 21-0159	OL697884	OL606145	OL964516	OL964522	
Parahelicomycestalbotii	MFLUCC 17-2021	MH558765	MH558890	MH550957	MH551091	
Pleurohelicosporiumhyalinum T	GZCC 20-0489	OP377816	OP377915	OP472996	OP473089	
Pleurohelicosporiumparvisporum T	MFLUCC 17-1982	MH558764	MH558889	MH550956	MH551088	
Pseudohelicoongigantisporum	BCC 3550	AY916467	AY856904	NA	NA	
Pseudohelicoonsubglobosum T	BCRC FU30843	LC316607	LC316610	NA	NA	
Thaxteriellopsislignicola	MFLUCC 10-0123	JN865207	JN865195	KF301562	NA	
Thaxteriellopsislignicola	MFLUCC 10-0124	JN865208	JN865196	KF301561	NA	
Tubeufiaabundata T	MFLUCC 17-2024	MH558769	MH558894	MH550961	MH551095	
Tubeufiaaquatica T	MFLUCC 16-1249	KY320522	KY320539	KY320556	MH551142	
Tubeufiabambusicola T	MFLUCC 17-1803	MH558771	MH558896	MH550963	MH551097	
Tubeufiachlamydospora T	MFLUCC 16-0223	MH558775	MH558900	MH550967	MH551101	
Tubeufiacocois T	MFLUCC 22-0001	OM102541	OL985957	OM355486	OM355491	
Tubeufiasympodilaxispora T	MFLUCC 17-0048	MH558808	MH558932	MH551001	MH551135	
Ex-type strains are indicated by T after the species name. Newly-generated sequences are indicated in bold. The “NA” indicates information unavailable.

﻿Phylogenetic analyses

The quality of the DNA sequences was checked from their chromatograms and the sequences generated by forward and reverse primers were combined using Geneious Prime v. 2021.0.3 (Biomatters Ltd., San Diego, CA, USA). The BLASTn tool (Basic Local Alignment Search Tool) in the search engine of the National Center for Biotechnology Information (NCBI) to analyse the sequences is used in this study (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on the BLASTn results, we identified that our isolates belong to Helicoma and Neohelicosporium. Phylogenetic analyses for Tubeufiaceae were performed following Yang et al. (2023). The sequences for the phylogenetic analysis were downloaded from GenBank and listed in Table 2. MAFFT v. 7 (https://mafft.cbrc.jp/alignment/server/) was used to align and adjust the sequence datasets of the four gene regions. BioEdit 7.0.9.0 was used to improve the alignment manually when necessary. Using Alignment Transformation Environment online (https://sing.ei.uvigo.es/ALTER/), files were converted to run phylogenetic trees. Phylogenetic analysis was conducted using Maximum Likelihood (ML) inferred in RAxML v. 8.2.12 (Stamatakis 2014), Maximum Parsimony (MP) implied on PAUP v. 4.0b10 (Swofford 2003) and Bayesian Inference (BI) on MrBayes v. 3.1.2 (Huelsenbeck and Ronquist 2001).

Maximum parsimony analysis was performed in PAUP (phylogenetic analysis using parsimony) v.4.0b10 (Swofford 2003) using the heuristic search option with tree bisection-reconnection (TBR) branch swapping and 1,000 random sequence additions. Ambiguous regions in the alignment were excluded and gaps were treated as missing data. The stability of the trees was evaluated by 1,000 bootstrap replications. Branches of zero length were collapsed and all multiple parsimonious trees were saved. Descriptive statistics, including tree length (TL), consistency index (CI), retention index (RI), relative consistency index (RC) and homoplasy index (HI) were calculated.

Maximum Likelihood analyses were accomplished using RAxML-HPC2 on XSEDE v. 8.2.8 (Stamatakis et al. 2008; Stamatakis 2014) in the CIPRES Science Gateway platform (Miller et al. 2010) using the GTR+I+G model of evolution with 1,000 non-parametric bootstrapping iterations. MrBayes v.3.0b4 (Huelsenbeck and Ronquist 2001) used for the Bayesian analyses, implemented in MrMTgui (Nuin 2007), was used to determine the best-fit evolution model for Bayesian Inference analyses using the Akaike Information Criterion (AIC). The Markov Chain Monte Carlo sampling (BMCMC) analysis was conducted with four simultaneous Markov chains. The best model of evolution determined for LSU, ITS, rpb2 and tef 1-α by MrModelTest v. 2.2 was GTR+I+G. They were run for 1,000,000 generations, sampling the trees at every 100th generation. From the 10,000 trees obtained, the first 2,000 representing the burn-in phase were discarded. The remaining 8,000 trees were used to calculate posterior probabilities in the majority rule consensus tree. The phylogenetic tree was visualised in FigTree v. 1.4.2. Taxonomic novelties were submitted to the Facesoffungi database (Jayasiri et al. 2015), Index Fungorum (http://www.indexfungorum.org) and Palm Fungi (Xiong et al. 2024) databases. Species delineation was based on criteria set by Chethana et al. (2021) and Pem et al. (2021).

﻿Results

﻿Phylogenetic analyses

Phylogenetic trees were generated by ML, MP and BI of combined ITS (971 bp), LSU (1,172 bp), rpb2 (1,045 bp) and tef 1-α (912 bp) sequence data. The tree topologies generated by these three methods were similar and close to the topology of Yang et al. (2023); the best-scoring ML tree is shown in Fig. 1. The sequence alignment comprised 139 taxa of representative strains of Tubeufiaceae, including 12 isolates obtained in this study. Botryosphaeriaagaves (MFLUCC 10-0051) and B.dothidea (CBS 115476) were used as the outgroup taxa. Maximum parsimony analysis consisted of 2,223 constant characters and 1,628 informative characters resulting in 368 equally parsimonious trees (Fig. 1) (CI = 0.293, RI = 0.752, RC = 0.220, HI = 0.707). The best-scoring ML tree had an optimisation likelihood value of -51369.027254. The matrix had 2,120 distinct alignment patterns with a 32.53% proportion of gaps and completely undetermined characters. Estimated base frequencies were as follows: A = 0.245833, C = 0.250339, G = 0.261605, T = 0.242223; substitution rates: AC = 1.153811, AG = 5.616698, AT = 2.094588, CG = 0.769981, CT = 8.981963, GT = 1.0; gamma distribution shape parameter α = 0.237020. Incomplete portions at the ends of the sequences were excluded from the analysis. Our 12 new isolates are distributed in five clades, of which eight were distributed in Helicoma and four were distributed in Neohelicosporium. Based on the phylogenetic evidence and morphology, here we introduce three novel species and two new host records.

10.3897/mycokeys.108.128889.figure1 72AD91A4-8D92-5CD1-B37A-76C07CAFE2C2 Figure 1. Maximum Likelihood majority rule consensus tree for Tubeufiaceae using ITS, LSU, rpb2 and tef 1-α sequence dataset with Botryosphaeriaagaves (MFLUCC 10-0051) and B.dothidea (CBS 115476) as the outgroup taxa. Bootstrap support for Maximum Likelihood (ML) and Maximum Parsimony (MP) equal to or greater than 75% and Bayesian Inference posterior probability (BIPP) equal to or greater than 0.90 are indicated above branches as MP/ML/BIPP. The scale bar indicates 0.2 nucleotide changes per site. Isolates from this study are marked in blue and ex-type strains are marked in bold.

https://binary.pensoft.net/fig/1132311

﻿Taxonomy

Taxon classification Fungi
Tubeufiales
Tubeufiaceae
﻿ Helicoma oleifera

Y.R. Xiong, Manawas. & K.D. Hyde sp. nov.

0364608D-CFE2-5BF0-979D-99E43E0C5F94

Index Fungorum: IF902153

Facesoffungi Number: FoF15911

Fig. 2

Etymology.

Species epithet refers to the host species name “oleifera” from which the fungus was isolated.

Holotype.

MHZU 23-0157.

Description.

Saprobic on the rotting petiole of Elaeisoleifera. Sexual morph: Not observed. Asexual morph: Hyphomycetous, helicosporous. Colonies on the substratum superficial, effuse, gregarious, brown. Mycelium composed of partly immersed, partly superficial, hyaline, septate, branched hyphae. Conidiophores 145–360 µm long, 6.5–7.5 µm wide (x̄ = 210 × 6.5 μm, n = 20), macronematous, mononematous, cylindrical, unbranched or branched at base, straight to slightly bent, septate, deep brown at root part, brown at apex, pale brown at middle part mixing with some brown areas, smooth-walled with irregular inclusion. Conidiogenous cells 13–22 µm long, 5–7.5 µm wide (x̄ = 17 × 6.4 μm, n = 20), monoblastic, integrated, sympodial, terminal, cylindrical or fertile at the apex of conidiophores, brown, smooth-walled with irregular inclusion; with denticles, 1.3–2.3 µm long, 1.4–2.5 µm wide (x̄ = 1.6 × 1.8 μm, n = 20), arising from the apex portion of conidiophores as tooth-like and papillate protrusions, exposed or imbedded in the apex of conidiophore, mono- to polyblastic, brown, smooth-wall. Conidia 18–22.5 μm diam. (x̄ = 20.4 μm, n = 40) and conidial filament 6.8–9 μm wide (x̄ = 8.2 μm, n = 40), 45–55 μm long (x̄ = 50.6 μm, n = 40), solitary, acrogenous, helicoid, rounded at tip, tapering towards flat end, conic truncate at base, tightly coiled 1½ times, 8-septate, not becoming loose in water, guttulate, hyaline to pale brown, smooth-walled, the third cell shrinking and producing the root canal.

Culture characteristics.

Conidia germinating on water agar and germ tubes produced from conidia within 12 h. Colonies growing on PDA attaining 2.5 cm diam. after six weeks at 25 °C, irregular, undulate, rough, superficial and partially immersed, brown aerial mycelium mixed with pale brown, deep brown at up and down junction area; reverse brown with pale brown.

Material examined.

China, Yunnan Province, Xishuangbanna City, an unidentified forest beside National Highway 219 (21°93'N, 101°24'E, 549.6 m elev.), rotting petiole of the Elaeisoleifera, 5 February 2023, Y.R. Xiong and Li Lu, XG198 (MHZU 23-0157, holotype); ex-type culture, ZHKUCC 24-0121, other living cultures ZHKUCC 24-0122, ZHKUCC 24-0766, ZHKUCC 24-0767.

Notes.

Four isolates obtained in this study from the rotting petiole of the Elaeisoleifera clustered in an independent clade in the phylogenetic tree with 78% ML, 76% MP bootstrap support and 1.00 BIPP bootstrap support. The nucleotide differences between Helicomaoleifera and its phylogenetically related species were checked, excluding gaps: H.acropleurogenum (GZCC 22-2035) - ITS: 3.53% (18/510 base pairs), LSU: 0.71% (6/844 base pairs), tef 1-α: 2.85% (26/912 base pairs), rpb2: 3.92% (41/1045 base pairs); H.dennisii (NBRC 30667) - ITS: 4.36% (25/573 base pairs), LSU: 0.35% (2/564 base pairs), tef 1-α and rpb2 sequence unavailable; H.hydei (MFLUCC 18-1270) - ITS: 3.50% (26/744 base pairs), LSU: 0.71% (6/847 base pairs), tef 1-α: 2.74% (25/912 base pairs), rpb2 sequence is unavailable; H.inthanonense (MFLUCC 11-0003) - ITS: 4.56% (26/570 base pairs), LSU: 1.63% (14/860 base pairs), tef 1-α and rpb2 sequence is unavailable. Helicomaoleifera is different from related species not only in the size of conidia and conidiophores (Table 3), but also in conidia, which shrink and produce the tubular structure at the third cell (Fig. 2q, r, s), while other species do not produce any deformation. In addition, H.acropleurogenum (Lu et al. 2023) has intercalary and mostly monoblastic, rarely polyblastic conidiogenous cells; however, H.oleifera has terminal and monoblastic or polyblastic conidiogenous cells. Helicomadennisii (Tsui et al. 2006) has intercalary and polyblastic conidiogenous cells and fertile denticle structure at several cells on the upper end of the conidiophore. However, H.oleifera only has fertile denticle structures at the apex cell of the conidiophore. Furthermore, H.oleifera differs from H.hydei (Liu et al. 2019) by having an embedded denticle structure, while H.hydei (Liu et al. 2019) has an exposed denticle structure. Furthermore, H.inthanonense (Boonmee et al. 2011) has acropleurogenous and brown conidia with 7-septate and produces an asexual morph from MEA culture, while H.oleifera has acrogenous and hyaline to pale brown conidia with 8-septate. Therefore, we introduce H.oleifera as a new species.

Table 3. Comparison of asexual morph characteristics of Helicoma species in this study; the names of strains in this study are indicated in bold.

Species names and culture accession numbers	Conidiophores	Conidiogenous cells	Conidia	Septate number	Colour	Coiled times	References	
Helicomaacropleurogenum GZCC 22-2035	118–389 μm long, 5.5–8.5 μm wide (x̄ = 219 × 6.5 μm, n = 20)	20–32 μm long, 5–8 μm wide (x̄ = 25 × 6 μm, n = 20)	21–24 μm diam. and conidial filament 8.5–10.5 μm wide (x̄ = 22.0 × 9.5 μm, n = 20), 48–58 μm long	6–7	pale brown	tightly coiled 1½–1¾ times	Lu et al. (2023)	
Helicomainthanonense MFLUCC 11-0003	(14.5–)26.5–34(−42) μm in diam., 3 μm wide	NA	(10–)13–20 μm in diam., 4–7 μm wide (x̄ = 14 × 6 μm)	7	hyaline to brown	NA	Boonmee et al. (2011)	
Helicomahydei MFLUCC 18-1270	135–310 μm long, 4.5–7.0 μm wide	13–37 μm long, 4.5–7.0 μm wide	19–30 μm diam. (x̄ = 25.0 μm, n = 20), conidial filament 6–12 μm wide (x̄ = 8.1 μm, n = 20)	NA	pale brown to brown	tightly coiled 1–1½ times	Liu et al. (2019)	
Helicomadennisii NBRC 30667	3.5–5 µm wide at the basal part and tapering to 3–3.5 µm wide at the apical part, up to 190 µm long	1–1.5 × 0.5–1 µm	10–15 (13.5) µm in diam.; conidial filament hyaline to dilute fuscous, 4–5.5 (4.5) µm thick	6–9 (8)	Hyaline	tightly coiled 1¼–1¾ (1½) times	Zhao et al. (2007)	
HelicomaoleiferaZHKUCC 24-0121	145–360 μm long, 6.5–7.5 μm wide (x̄ = 235 × 6.8 μm, n = 20)	13–22 μm long, 5–7.5 μm wide, tiny tooth–like protrusions (1.3–2.3 μm long, 1.4–2.5 μm wide)	18–22.5 μm diam. and conidial filament 6.8–9 μm wide (x̄ = 20.4 μm diam., 8.2 μm wide, n = 50), 45–55 μm long	8	pale brown to brown	tightly coiled 1½ times	This study	
Helicomaguttulatum MFLUCC 16-0022	74–182 (197) μm long, 4–6 μm wide (x̄ = 120 × 5 μm, n = 20)	NA	18–23 μm diam. and conidial filament 6–8 μm wide (x̄ = 20 × 7 μm, n = 20)	8–9	hyaline to pale brown	tightly coiled 1–1½ times	Hyde et al. (2016)	
HelicomaguttulatumZHKUCC 24-0139	75–225 μm long, 5.5–6 μm wide (x̄ = 152 × 5.7 μm, n = 20)	10–29 μm long, 5–8.8 μm wide, tiny tooth–like protrusions (1.6–3.5 μm long, 1.6–2.5 μm wide)	21–30 μm diam. and conidial filament 7.2–10 μm wide (x̄ = 25 μm diam., 8.4 μm wide, n = 50), 48–69 μm long	8–9	pale brown	tightly coiled 1½ times	This study	
Helicomarufum MFLUCC 17-1806	110–210 μm long, 7–8.5 μm wide	9–14 μm long, 5.5–8.5 μm wide, tiny tooth–like protrusions (2.5–3.6 μm long, 1.5–2 μm wide)	35–45 μm diam. and conidial filament 4–5.5 μm wide (x = 41 × 4.5 μm, n = 20), 240–410 μm long	27–37	hyaline to pale brown	coiled 2–3 times, becoming loosely coiled in water	Lu et al. (2018b)	
HelicomarufumZHKUCC 24-0143	150–270 µm long, 4–7.5 µm thick (x̄ = 225 × 5.9 μm, n = 20)	7–15 μm long, 4–7 μm wide, tiny tooth–like protrusions (3–6 μm long, 1.5–3 μm wide)	21–47 μm diam. and conidial filament 2–5 μm wide (x̄ = 36 × 3.8 μm, n = 40), 145–345 μm long	25–35	hyaline	tightly coiled 3–4.5 coils	This study	
Neohelicosporiumhyalosporum GZCC 16-0076	up to 540 μm long, 4–5.5 μm wide	9–13 μm long, 4–5.5 μm wide	25–33 μm diam. and conidial filament 3–4 μm wide (x̄ = 28 μm diam., 3.5 μm wide, n = 50), 125–225 μm long	NA	hyaline	tightly coiled 2.5–3.5 times, becoming loosely coiled in water	Lu et al. (2018a)	
Neohelicosporiumovoideum GZCC 16-0064	up to 420 μm long, 4–6 μm wide	10–15 μm long, 4–6 μm wide	25–35 μm diam. and conidial filament 3–4 μm wide (x̄ = 28 × 3.5 μm, n = 50), 180–230 μm long	multi–septate	hyaline	tightly coiled 2–3 times, becoming loosely coiled in water	Lu et al. (2018b)	
NeohelicosporiumguineensisZHKUCC 24-0113	50–160 μm long, 4–6 μm wide (x̄ = 120 × 5.2 μm, n = 10)	11.5–20 μm long, 3.5–5.5 μm wide, tiny tooth–like protrusions (1.4–2.7 μm long, 1.2–2 μm wide)	16–20 μm diam. and conidial filament 1.8–3 μm wide (x̄ = 18 μm diam., 2.4 μm wide, n = 50), 90–130 μm long	11–12	hyaline	tightly coiled 2½–3½ times, loosely coiled in water	This study	
Neohelicosporiumfusisporum MFUCC 16-0642	NA	12–20 μm long, 1.5–2.5 μm wide	18–22 μm diam. and conidial filament 1.5–2.5 μm wide (x̄ = 18 μm × 2 μm, n = 50), 100–150 μm long	multi–septate	hyaline	tightly coiled 2½–3¼ times, loosely coiled in water	Jayasiri et al. (2017)	
NeohelicosporiumxishuangbannaensisZHKUCC 24-0119	40–125 μm long, 3–6 μm wide (x̄ = 68.4 × 4.4 μm, n = 20)	7–14 μm long, 2.5–5.5 μm wide, tiny tooth–like protrusions (1.8–3.3 μm long, 1.1–2.3 μm wide)	16.5–20.5 μm diam. and conidial filament 1.8–3.2 μm wide (x̄ = 18.5 μm diam., 2.4 μm wide, n = 50), 90–125 μm long	9–13	hyaline	tightly coiled 2–3¼ times, loosely coiled in water	This study	

10.3897/mycokeys.108.128889.figure2 73ABF8F3-45B7-53F0-9B4E-4CF3AF9F082B Figure 2. Helicomaoleifera (MHZU 23-0157, holotype) a specimen observed b, c colony on decaying Elaeisoleiferad, e conidiophores f, g conidiogenous cell with attached conidia h–l conidiogenous cells m–p conidia q–s conidia produce the tubular structure at the third cell t germinated conidium u, v culture on PDA from above and reverse. Scale bars: 100 μm (d, e); 20 μm (f–t).

https://binary.pensoft.net/fig/1132312

Taxon classification Fungi
Tubeufiales
Tubeufiaceae
﻿ Helicoma guttulatum

Y.Z. Lu, Boonmee & K.D. Hyde, Fungal Diversity 80: 1–270 (2016)

6F3CF67D-C90E-5336-83AA-04A62CD9C50D

Index Fungorum: IF552218

Facesoffungi Number: FoF02358

Fig. 3

Description.

Saprobic on the rotting petiole of Caryotamitis. Sexual morph: Not observed. Asexual morph: Hyphomycetous, helicosporous. Colonies on the substratum superficial, effuse, gregarious, brown. Mycelium composed of partly immersed, partly superficial, brown, septate hyphae. Conidiophores 75–225 μm long, 5.5–6 μm wide (x̄ = 152 × 5.7 μm, n = 20), macronematous, crowded, erect, straight to slightly bent, brown, deep brown towards the base, septate, branched, smooth-walled with irregular inclusion. Conidiogenous cells 10–29 μm long, 5–8.8 μm wide (x̄ = 18 × 6.3 μm, n = 20), mono- to polyblastic, integrated, cylindrical, terminal, pale brown to brown, smooth-walled with irregular inclusion; with denticles, 1.6–3.5 μm long, 1.6–2.5 μm wide (x̄ = 2.4 × 2.1 μm, n = 20), arising from the apex portion of conidiophores as tooth-like protrusions, mono- to polyblastic, brown, smooth-wall. Conidia 21–30 μm diam. (x̄ = 25.1 μm, n = 40) and conidial filament 7.2–10 μm wide (x̄ = 8.4 μm, n = 40), 48–69 μm long (x̄ = 57.4 μm, n = 40), solitary, acropleurogenous, tightly coiled 1½ times, guttulate, not becoming loose in water, hyaline to pale brown, tapering towards flat end, 8–9-septate, rounded at the apex, conic truncate at the base, smooth-walled.

10.3897/mycokeys.108.128889.figure3 949508C2-1E45-5D90-B55D-49E0030D47CD Figure 3. Helicomaguttulatum (MHZU 23-0166, new host record) a specimen observed b, c colony on decaying Caryotamitisd conidiophores e–j conidiogenous cells, thereinto j with attached conidia k–o conidia p germinated conidium q, r culture on PDA from above and reverse. Scale bars: 50 μm (d); 20 μm (e–j); 10 μm (k–o); 20 μm (p).

https://binary.pensoft.net/fig/1132313

Culture characteristics.

Conidia germinating on water agar and germ tubes produced from conidia within 12 h. Colonies growing on PDA attaining 3 cm diam. after six weeks at 25 °C, irregular, undulate, rough, superficial and partially immersed, brown aerial mycelium mixed with pale brown; reverse brown with pale brown.

Material examined.

China, Yunnan Province, Xishuangbanna City, an unknown forest beside National Highway 219 (21°93'N, 101°24'E, 549.6 m elev.), rotting petiole of the Caryotamitis, 5 February 2023, Y.R. Xiong and Li Lu, XG215 (MHZU 23-0166, new host record; living culture, ZHKUCC 24-0139, ZHKUCC 24-0140).

Notes.

Two isolates on rotting petiole of the Caryotamitis obtained in this study clustered with the H.guttulatum clade, based on the phylogenetic tree with 100% ML, 100% MP bootstrap support and 0.91 BIPP bootstrap support. The nucleotide differences excluding gaps between H.guttulatum (ZHKUCC 24-0139) and H.guttulatum (MFLUCC 16-0022) in ITS is 3.60% (17/472 base pairs), while there is no difference in LSU and one base pair difference in tef 1-α and rpb2. Our two isolates are similar to H.guttulatum (Hyde et al. 2016) in shape, colour and size of conidia (Table 3). Although the conidiophores are longer than in previous collections, this might be due to the branching of the conidiophore of the isolates in this study, whereas the previous collections are unbranched. In addition, the location of the denticles is the same. Therefore, based on morphology and phylogenetic analysis, we identified our isolates as H.guttulatum and this is a new record of H.guttulatum on Caryotamitis. Helicomaguttulatum was first introduced on decaying wood from Thailand by Hyde et al. (2016), based on morphology and phylogeny. Tian et al. (2022) reported a new collection of H.guttulatum on decaying wood of an unidentified host from Thailand.

Taxon classification Fungi
Tubeufiales
Tubeufiaceae
﻿ Helicoma rufum

Y.Z. Lu, J.C. Kang & K.D. Hyde, Fungal Diversity 92: 131–344 (2018)

94D30D65-FAF0-5F56-9DEC-78E0E3658540

Index Fungorum: IF554843

Facesoffungi Number: FoF04718

Fig. 4

Description.

Saprobic on the rotting inflorescence of Caryotamitis. Sexual morph: Not observed. Asexual morph: Hyphomycetous, helicosporous. Colonies on the substratum superficial, effuse, gregarious, pale brown. Mycelium composed of partly immersed, partly superficial, hyaline to brown, septate, branched hyphae. Conidiophores 150–270 µm long, 4–7.5 µm wide (x̄ = 225 × 5.9 μm, n = 20), macronematous, mononematous, cylindrical, erect, straight to slightly bent, pale brown to deep brown from top towards the base, apex hyaline, septate, mostly unbranched, smooth-walled. Conidiogenous cells 7–15 μm long, 4–7 μm wide (x̄ = 12 × 5.9 μm, n = 20), mono- to polyblastic, cylindrical, integrated, intercalary, brown, smooth-walled; with denticles, 3–6 μm long, 1.5–3 μm wide (x̄ = 4.6 × 2.5 μm, n = 20), arising from the lower portion of conidiophores as tooth-like protrusions, mono- to polyblastic, pale brown to brown, smooth-walled. Conidia 21–47 μm diam. (x̄ = 36.2 μm, n = 40) and conidial filament 2–5 μm wide (x̄ = 3.8 μm, n = 40), 145–345 μm long (x̄ = 257.7 μm, n = 40), solitary, pleurogenous, tightly coiled 3–4½ times, guttulate, become loose in water, hyaline to pale brown, 25–35-septate, smooth-walled.

10.3897/mycokeys.108.128889.figure4 20B37E42-FF47-5C0A-828C-9714C8BD8549 Figure 4. Helicomarufum (MHZU 23-0168, new host record) a specimen observed b, c colony on decaying Caryotamitisd, e conidiophores f–i conidiogenous cells j–l conidia m germinated conidium. Scale bars: 50 μm (d, e, m); 10 μm (f–i); 20 μm (j–l).

https://binary.pensoft.net/fig/1132314

Culture characteristics.

Conidia germinating on water agar and germ tubes produced from conidia within 12 h. Colonies growing on PDA attaining 3 cm diam. after six weeks at 25 °C, irregular, undulate, rough, superficial and partially immersed, brown aerial mycelium mixed with pale brown; reverse brown with pale brown.

Material examined.

China, Yunnan Province, Xishuangbanna City, an unidentified forest beside National Highway 219 (21°93'N, 101°24'E, 549.6 m), rotting inflorescence of the Caryotamitis, 5 February 2023, Y.R. Xiong and Li Lu, XG217 (MHZU 23-0168, new host record; living culture, ZHKUCC 24-0143, ZHKUCC 24-0144).

Notes.

Two isolates on rotting inflorescence of Caryotamitis obtained in this study clustered with the H.rufum clade in the phylogenetic tree with 96% ML, 95% MP bootstrap values and 0.99 BIPP bootstrap support. The nucleotide differences between H.rufum (ZHKUCC 24-0143) and H.rufum (MFLUCC 17-1806) are LSU: 0.09% (1/1171 base pairs), tef 1-α: 0.22% (2/912 base pairs), rpb2 sequence unavailable and no difference in ITS, excluding gaps. Our collection is similar to H.rufum (Lu et al. 2018b) in the shape, colour and size of conidia (Table 3). Although the conidiophores and conidia are longer than in previous collections, this might be because the collections came from a different area, resulting in branching at the top of the conidiophores. Therefore, based on phylogenetic and morphological analysis, we identified our isolates as a new host record of H.rufum on Caryotamitis. Helicomarufum was introduced from decaying wood in Thailand by Lu et al. (2018b), based on the distinguished phylogenetic clade, wider conidiophores and larger tooth-like conidiogenous protrusions and larger conidia.

Taxon classification Fungi
Tubeufiales
Tubeufiaceae
﻿ Neohelicosporium guineensis

Y.R. Xiong, Manawas. & K.D. Hyde sp. nov.

FA246873-BAD4-5372-98D3-136CF07F0C97

Index Fungorum: IF902154

Facesoffungi Number: FoF15912

Fig. 5

Etymology.

Species epithet refers to the host species name “guineensis” from which the fungus was isolated.

Holotype.

MHZU 23-0153.

Description.

Saprobic on the rotting petiole of Elaeisguineensis. Sexual morph: Not observed. Asexual morph: Hyphomycetous, helicosporous. Colonies on the substratum superficial, effuse, gregarious, brown. Mycelium composed of partly immersed, partly superficial, pale brown, glistening, septate, branched hyphae. Conidiophores 50–160 µm long, 4–6 µm wide (x̄ = 120 × 5.2 μm, n = 20), macronematous, mononematous, cylindrical, unbranched or branched at apex, straight, septate, pale brown, brown at root part, smooth-walled. Conidiogenous cells 11.5–20 µm long, 3.5–5.5 µm wide (x̄ = 15.5 × 4.8 μm, n = 20), mono- to polyblastic, integrated, sympodial, terminal or intercalary, cylindrical, yellowish to pale brown, smooth-walled; with denticles, 1.4–2.7 µm long, 1.2–2 µm wide (x̄ = 1.9 × 1.6 μm, n = 20), arising from the juncture portion of two conidiogenous cells as tooth-like protrusions, mono- to polyblastic, hyaline, smooth-walled. Conidia 16–20 μm diam. (x̄ = 18 μm, n = 40) and conidial filament 1.8–3 μm wide (x̄ = 2.4 μm, n = 40), 90–130 μm long (x̄ = 112.9 μm, n = 40), solitary, mostly pleurogenous, rarely acrogenous, helicoid, rounded at tip, obvious hump and constricted at septa, coiled 2½–3½ times, 11–12-septate, becoming loose in water, guttulate, hyaline, smooth-walled.

10.3897/mycokeys.108.128889.figure5 85004FA1-E8C1-557B-A89C-61C4FA0F05A4 Figure 5. Neohelicosporiumguineensis (MHZU 23-0153, holotype) a specimen observed b, c colony on decaying Elaeisguineensisd, e apical branches forming long connected conidiophores f–j conidiogenous cells k–q conidia r germinated conidium s, t culture on PDA from above and reverse. Scale bars: 50 μm (d, e); 10 μm (f–q); 20 μm (r).

https://binary.pensoft.net/fig/1132315

Culture characteristics.

Conidia germinating on water agar and germ tubes produced from conidia within 12 h. Colonies growing on PDA attaining 3.5 cm diam. after six weeks at 25 °C, irregular, undulate, umbonate, rough, superficial and partially immersed, white aerial mycelium, deep brown at immersed area; reverse white to deep brown.

Material examined.

China, Yunnan Province, Xishuangbanna City, an unidentified forest beside National Highway 219 (21°93'N, 101°24'E, 549.6 m elev.), rotting petiole of the Elaeisguineensis, 5 February 2023, Y.R. Xiong and Li Lu, XG186 (MHZU 23-0153, holotype); ex-type, ZHKUCC 24-0113, other living culture ZHKUCC 24-0114.

Notes.

Two isolates from this study formed a separate lineage and clustered with Neohelicosporiumhyalosporum and N.ovoideum in the phylogenetic tree with 88% ML, 78% MP bootstrap support and 1.00 BIPP bootstrap support. The nucleotide differences excluding gaps between N.guineensis and its phylogenetically related species were checked: N.hyalosporum (GZCC 16-0076) - ITS: 1.56% (8/513 base pairs), LSU: 0.83% (7/840 base pairs), tef 1-α: 1.32% (12/912 base pairs), rpb2: 3.63% (38/1045 base pairs); N.ovoideum (GZCC 16-0064) - ITS: 1.50% (8/534 base pairs), LSU: 0.48% (4/826 base pairs), tef 1-α: 1.21% (11/912 base pairs), rpb2: 3.16% (33/1045 base pairs). Neohelicosporiumguineensis differs from its closely-related species in the size of conidia and conidiophores (Table 3). Neohelicosporiumhyalosporum and N.ovoideum are multi-septate and are not constricted at the septa, while N.guineensis are 11–12-septate and constricted at the septa (Lu et al. 2018a, b). Neohelicosporiumhyalosporum (Lu et al. 2018a) has multi-denticles in one conidiogenous cell, while N.guineensis, has no more than three denticles (Fig. 5e, f) in one conidiogenous cell. Furthermore, N.ovoideum (Lu et al. 2018b) has 1–2 short-connecting cells between conidiophores, while N.guineensis has one long connecting cell (Fig. 5d, e) which connects conidiophores at the apex. Based on the phylogenetic placement and morphological variations, we introduce N.guineensis as a new species.

Taxon classification Fungi
Tubeufiales
Tubeufiaceae
﻿ Neohelicosporium xishuangbannaensis

Y.R. Xiong, Manawas., & K.D. Hyde sp. nov.

67B51B3E-4B98-5EAA-A79B-8E24337D3C23

Index Fungorum: IF902156

Facesoffungi Number: FoF15913

Fig. 6

Etymology.

Species epithet refers to the location name “Xishuangbanna” from where the holotype was collected.

Holotype.

MHZU 23-0156.

Description.

Saprobic on the rotting petiole of Elaeisguineensis. Sexual morph: Not observed. Asexual morph: Hyphomycetous, helicosporous. Colonies on the substratum superficial, effuse, gregarious, brown. Mycelium composed of partly immersed, partly superficial, brown, septate, unbranched hyphae. Conidiophores 40–125 μm long, 3–6 μm wide (x = 68.4 × 4.4 μm, n = 20), macronematous, mononematous, flexuous, long, cylindrical, branched, septate, smooth-walled. Conidiogenous cells 7–14 μm long, 2.5–5.5 μm wide (x̄ = 11.2 × 3.9 μm, n = 20), mono- to polyblastic, integrated, sympodial, terminal or intercalary, cylindrical, pale brown, smooth-walled; with denticles, 1.8–3.3 μm long, 1.1–2.3 μm wide (x̄ = 2.4 × 1.4 μm, n = 20), arising from the juncture portion of two conidiogenous cells as tooth-like and papillate protrusions, mono- to polyblastic, pale brown or hyaline, smooth-walled. Conidia 16.5–20.5 μm diam. (x̄ = 18.5 μm, n = 40) and conidial filament 1.8–3.2 μm wide (x̄ = 2.4 μm, n = 40), 90–125 μm long (x̄ = 107 μm, n = 40), solitary, acropleurogenous, helicoid, rounded at tip, coiled 2–3¼ times, 9–13-septate, becoming loose in water, guttulate, slightly constricted at septa, hyaline to pale brown, smooth-walled.

Culture characteristics.

Conidia germinating on water agar and germ tubes produced from conidia within 12 h. Colonies growing on PDA attaining 2.5 cm diam. after six weeks at 25 °C, irregular, undulate, umbonate, rough, superficial and partially immersed, brown aerial mycelium mixed with pale brown, deep brown at up and down junction area; reverse brown with deep brown.

Material examined.

China, Yunnan Province, Xishuangbanna City, an unidentified forest beside National Highway 219 (21°93'N, 101°24'E, 549.6 m elev.), rotting petiole of the Elaeisguineensis, 5 February 2023, Y.R. Xiong and Li Lu, XG197 (MHZU 23-0156, holotype); ex-type, ZHKUCC 24-0119, other living culture ZHKUCC 24-0120.

Notes.

Two isolates obtained in this study developed an independent clade in the phylogenetic tree with 77% ML, 79% MP bootstrap support and 0.99 BIPP bootstrap support. The nucleotide differences excluding gaps between Neohelicosporiumxishuangbannaensis and N.fusisporum (MFUCC 16-0642) are ITS: 2.81% (15/533 base pairs), LSU: 1.06% (9/852 base pairs), tef 1-α: 2.41% (22/912 base pairs) and rpb2 sequence is unavailable. Neohelicosporiumfusisporum was reported as a sexual and asexual morph by Jayasiri et al. (2017). Neohelicosporiumxishuangbannaensis is different from the asexual morph of N.fusisporum (Jayasiri et al. 2017) in the size of conidia and conidiogenous cells (Table 3). In addition, the asexual morph of N.fusisporum (Jayasiri et al. 2017) has an intercalary conidiogenous cell, while N.xishuangbannaensis has an intercalary (Fig. 6e, f) or terminal (Fig. 6g, h) conidiogenous cell. Furthermore, the asexual morph of N.fusisporum (Jayasiri et al. 2017) has denticles with tooth-like or long neck cells, while N.xishuangbannaensis has a denticle with tooth-like and papillate protrusions. Based on these differences, herein we introduce N.xishuangbannaensis as a new species.

10.3897/mycokeys.108.128889.figure6 AAB96302-7322-5D42-ADC4-DD3DA85BC1CA Figure 6. Neohelicosporiumxishuangbannaensis (MHZU 23-0156, holotype) a specimen observed b, c colony on decaying Elaeisguineensisd conidiophores e, f intercalary conidiogenous cells g, h terminal conidiogenous cells i–o conidia p germinated conidium q, r culture on PDA from above and reverse. Scale bars: 50 μm (d); 10 μm (e–o); 20 μm (p).

https://binary.pensoft.net/fig/1132316

﻿Discussion

In the present study, we identified and introduced three new species viz. Helicomaoleifera, Neohelicosporiumguineensis and N.xishuangbannaensis with two new host records of Helicoma viz. H.guttulatum and H.rufum, which are associated with palms in tropical China. Xishuangbanna forests comprise numerous palm species, including Caryota sp., Calamus sp. and Elaeis sp. This humid tropical area near streams is also an ideal environment for Tubeufiaceae species (Lu et al. 2018b). In addition, most previous reports of this family are on unknown decaying woods (Lu et al. 2023) and we believe that there may be more undiscovered records of Tubeufiaceae on palms in tropical regions. Furthermore, in our comparison with closely-related species, we observed that H.anastomosanse (David 1931), H.divaricatum (Holubová-Jechová 1987) and H.westonii (David 1931) were reported to inhabit palms, but no molecular data were available for conducting phylogenetic analysis. The spores of H.anastomosanse (David 1931) have 18–25 septa, H.westonii (David 1931) have 11–14 septa and H.divaricatum (Holubová-Jechová 1987) have branched conidiophores and pleurogenous spores, which can be clearly distinguished from H.oleifera. However, the lack of molecular data for the above-mentioned three species has posed a significant challenge, forcing us to spend more time on morphological comparisons to identify H.oleifera. Similarly, almost all Tubeufiaceae reported on palm hosts in the early 20th century lack molecular data, which further complicates our task of sorting out the information on Tubeufiaceae on palm hosts.

Helicoma is one of the most typical helicosporous genera (Lu et al. 2023), although Goos (1986) and Lu et al. (2018b) successively revised this genus. In addition, the species of this genus cluster on the same large branch in phylogenetic analysis; some morphologically similar species are in different subordinate clades. In addition, we observed that Helicomaguttulatum (ZHKUCC 24-0139), which was identified, based on phylogenetic analysis has a different morphology compared to the type (Hyde et al. 2016). Helicomaguttulatum (ZHKUCC 24-0139) was observed to have branched conidiophores and is different from H.guttulatum (MFLU 21-0183) unbranched conidiophores (Tian et al. 2022). Since the two collections were collected from different locations and climates, we hypothesise that isolations could be influenced by different locations and climates. However, further collections and detailed analysis are required to confirm this hypothesis.

Neohelicosporium was introduced to accommodate helicosporous taxa with distinct conidiophores and is supported by molecular phylogenies, based on ITS, LSU, tef 1-α and rpb2 sequence data (Lu et al. 2018a). However, the bootstrap values of ML and MP are below 0.75% for some species (e.g. N.abuense, N.astrictum and N.bambusicola) within this genus (Lu et al. 2018a; Tian et al. 2022). The three new species and two new host records introduced in this study are significant as they expand our understanding of the diversity and distribution of Tubeufiaceae in tropical regions and provide valuable insights into their ecological roles and interactions with palm hosts. In addition, Zhang et al. (2023) identified four useful chemical compounds from N.guangxiense and they can play a vital role in drug design and functional group modification. This underscores the urgent need for future studies to explore the potential chemical composition and corresponding applications of this genus, a call to action for professional researchers.

Supplementary Material

XML Treatment for Helicoma oleifera

XML Treatment for Helicoma guttulatum

XML Treatment for Helicoma rufum

XML Treatment for Neohelicosporium guineensis

XML Treatment for Neohelicosporium xishuangbannaensis

﻿Acknowledgements

Yinru Xiong would like to thank Mae Fah Luang University for the award of Tuition fee waiver scholarship for the PhD. Ishara Manawasinghe would like to acknowledge Zhongkai University of Agriculture and Engineering, talent funding (grant number KA210319288) and the Guangzhou Science and Technology Plan Project (2023A04J1427). Biao Xu thanks to the National Natural Science Foundation of China (Nos. 32370021) and the Innovative team program of the Department of Education of Guangdong Province (2022KCXTD015 and 2022ZDJS020). We would like to acknowledge the Innovative team programme of the Department of Education of Guangdong Province (2022KCXTD015 and 2022ZDJS020). The authors also extend their appreciation to the Researchers Supporting Project number (RSP2024R114), King Saud University, Riyadh, Saudi Arabia for funding this work.

﻿Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This research was funded by the High-level Talents at Zhongkai University of Agriculture and Engineering, grant no: J2201080102 Researchers Supporting Project number (RSP2024R114), King Saud University, Riyadh, Saudi Arabia.

Author contributions

Data curation: LL, YX. Formal analysis: ISM. Funding acquisition: KDH, FA, XB. Investigation: LL, YX. Methodology: YX, LL. Project administration: KDH. Resources: KDH. Supervision: ISM. Visualization: ISM. Writing - original draft: YX. Writing - review and editing: DLH, ISM, AM, KDH.

Author ORCIDs

Yinru Xiong https://orcid.org/0000-0002-4673-606X

Kevin D. Hyde https://orcid.org/0000-0002-2191-0762

Li Lu https://orcid.org/0000-0003-0977-6414

Dulanjalee L. Harishchandra https://orcid.org/0000-0003-1538-4951

Ausana Mapook https://orcid.org/0000-0001-7929-2429

Ishara S. Manawasinghe https://orcid.org/0000-0001-5730-3596

Data availability

All of the data that support the findings of this study are available in the main text.
==== Refs
﻿References

Barr ME (1979) A classification of Loculoascomycetes. Mycologia 71 (5 ): 935–957. 10.1080/00275514.1979.12021099
Barr ME (1980) On the family Tubeufiaceae (Pleosporales). Mycotaxon 12 : 137–167.
Bhat DJ (2008) The forests of Western Ghats, an abode of novel and interesting microfungi. Kavaka 36 : 1–11.
Boonmee S Zhang Y Chomnunti P Chukeatirote E Tsui CKM Bahkali AH Hyde KD (2011) Revision of lignicolous Tubeufiaceae based on morphological reexamination and phylogenetic analysis. Fungal Diversity 51 (1 ): 63–102. 10.1007/s13225-011-0147-4
Boonmee S Rossman AY Liu JK Li WJ Dai DQ Bhat JD Jones EBG McKenzie EHC Xu JC Hyde KD (2014) Tubeufiales, ord. nov., integrating sexual and asexual generic names. Fungal Diversity 68 (1 ): 239–298. 10.1007/s13225-014-0304-7
Brahamanage RS Lu YZ Bhat DJ Wanasinghe DN Yan JY Hyde KD Boonmee S (2017) Phylogenetic investigations on freshwater fungi in Tubeufiaceae (Tubeufiales) reveals the new genus Dictyospora and new species Chlamydotubeufiaaquatica and Helicosporiumflavum. Mycosphere 8(7): 917–933. 10.5943/mycosphere/8/7/8
Capdeet M Romero AI (2010) Fungi from palms in Argentina. 1. Mycotaxon 112 (1 ): 339–355. 10.5248/112.339
Carbone I Kohn L (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91 (3 ): 553–556. 10.1080/00275514.1999.12061051
Chaiwan N Lu YZ Tibpromma S Bhat DJ Hyde KD Boonmee S (2017) Neotubeufia gen. nov. and Tubeufiaguangxiensis sp. nov. (Tubeufiaceae) from freshwater habitats. Mycosphere 8 (9 ): 1443–1456. 10.5943/mycosphere/8/9/9
Chethana KWT Manawasinghe IS Hurdeal VG Bhunjun CS Appadoo MA Gentekaki E Raspé O Promputtha I Hyde KD (2021) What are fungal species and how to delineate them? Fungal Diversity 109(1): 1–25. 10.1007/s13225-021-00483-9
Corda ACJ (1837) Icones fungorum hucusque cognitorum. Vol.1. Praha. JG Calve, 32 pp.
David HL (1931) Brief Notes on the Helicosporeae with Descriptions of Four New Species. Annals of the Missouri Botanical Garden 18 (1 ): 9–16. 10.2307/2394042
Dong W Wang B Hyde KD McKenzie EHC Raja H Tanaka K Abdel-Wahab MA Abdel-Aziz FA Doilom M Phookamsak R Hongsanan S Wanasinghe DN Yu XD Wang GN Yang H Yang J Thambugala KM Tian Q Luo ZL Zhang H (2020) Freshwater Dothideomycetes. Fungal Diversity 105 (1 ): 319–575. 10.1007/s13225-020-00463-5
Fehr V Buitenwerf R Svenning JC (2020) Non‐native palms (Arecaceae) as generators of novel ecosystems: A global assessment. Diversity & Distributions 26 (11 ): 1523–1538. 10.1111/ddi.13150
Fröhlich J Hyde KD (1999) Biodiversity of palm fungi in the tropics: Are global fungal diversity estimates realistic? Biodiversity and Conservation 8(7): 977–1004. 10.1023/A:1008895913857
Fröhlich J Hyde KD (2000) Palm microfungi. Fungal Diversity Press, The University of Hong Kong.
Gongfu Z Yuanlue H Guozhao L (1990) Characteristics and regional diversity of tropical China. Acta Geographica Sinica 45 (22 ): 245–252.
Goos RD (1986) A review of the anamorph genus Helicoma. Mycologia 78(5): 744–761. 10.1080/00275514.1986.12025318
Holubová-Jechová V (1987) Studies on hyphomycetes from Cuba V. Six new species of dematiaceous hyphomycetes from Havana Province. Ceská Mykologie 41 (1 ): 29–36.
Hongsanan S Hyde KD Phookamsak R Wanasinghe DN McKenzie EHC Sarma VV Lücking R Boonmee S Bhat JD Liu NG Tennakoon DS Pem D Karunarathna A Jiang SH Jones GEB Phillips AJL Manawasinghe IS Tibpromma S Jayasiri SC Sandamali D Jayawardena RS Wijayawardene NN Ekanayaka AH Jeewon R Lu YZ Phukhamsakda C Dissanayake AJ Zeng XY Luo ZL Tian Q Thambugala KM Dai D Samarakoon MC Chethana KWT Ertz D Doilom M Liu JK Pérez-Ortega S Suija A Senwanna C Wijesinghe SN Niranjan M Zhang SN Ariyawansa HA Jiang HB Zhang JF Norphanphoun C de Silva NI Thiyagaraja V Zhang H Bezerra JDP Miranda-González R Aptroot A Kashiwadani H Harishchandra D Sérusiaux E Abeywickrama PD Bao D-F Devadatha B Wu HX Moon KH Gueidan C Schumm F Bundhun D Mapook A Monkai J Bhunjun CS Chomnunti P Suetrong S Chaiwan N Dayarathne MC Yang J Rathnayaka AR Xu JC Zheng J Liu G Feng Y Xie N (2020) Refined families of Dothideomycetes: Orders and families incertae sedis in Dothideomycetes. Fungal Diversity 105 (1 ): 17–318. 10.1007/s13225-020-00462-6
Huelsenbeck JP Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17 (8 ): 754–755. 10.1093/bioinformatics/17.8.754 11524383
Hyde KD Hongsanan S Jeewon R Bhat DJ McKenzie EHC Jones EBG Phookamsak R Ariyawansa HA Boonmee S Zhao Q Abdel-Aziz FA Abdel-Wahab MA Banmai S Chomnunti P Cui BK Daranagama DA Das K Dayarathne MC de Silva NI Dissanayake AJ Doilom M Ekanayaka AH Gibertoni TB Góes-Neto A Huang SK Jayasiri SC Jayawardena RS Konta S Lee HB Li WJ Lin CG Liu JK Lu YZ Luo ZL Manawasinghe IS Manimohan P Mapook A Niskanen T Norphanphoun C Papizadeh M Perera RH Phukhamsakda C Richter C et al. ( (2016) Fungal diversity notes 367–490: Taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80 : 1–270. 10.1007/s13225-016-0373-x
Hyde KD Norphanphoun C Abreu VP Bazzicalupo A Thilini Chethana KW Clericuzio M Dayarathne MC Dissanayake AJ Ekanayaka AH He MQ Hongsanan S Huang SK Jayasiri SC Jayawardena RS Karunarathna A Konta S Kušan I Lee H Li J Lin CG Liu NG Lu YZ Luo ZL Manawasinghe IS Mapook A Perera RH Phookamsak R Phukhamsakda C Siedlecki I Soares AM Tennakoon DS Tian Q Tibpromma S Wanasinghe DN Xiao YP Yang J Zeng XY Abdel-Aziz FA Li WJ Senanayake IC Shang QJ Daranagama DA de Silva NI Thambugala KM Abdel-Wahab MA Bahkali AH Berbee ML Boonmee S Bhat DJ Bulgakov TS Buyck B Camporesi E Castañeda-Ruiz RF Chomnunti P Doilom M Dovana F Gibertoni TB Jadan M Jeewon R Jones EBG Kang JC Karunarathna SC Lim YW Liu JK Liu ZY Plautz Jr HL Lumyong S Maharachchikumbura SSN Matočec N McKenzie EHC Mešić A Miller D Pawłowska J Pereira OL Promputtha I Romero AI Ryvarden L Su HY Suetrong S Tkalčec Z Vizzini A Wen TC Wisitrassameewong K Wrzosek M Xu JC Zhao Q Zhao R-L Mortimer PE (2017) Fungal diversity notes 603–708: Taxonomic and phylogenetic notes on genera and species. Fungal Diversity 87 (1 ): 1–235. 10.1007/s13225-017-0391-3
Index Fungorum (2024) Index Fungorum. http://www.indexfungorum.org/Names/Nam es.asp [Retrieved 31 April 2024]
Jayasiri SC Hyde KD Ariyawansa HA Bhat J Buyck B Cai L Dai YC Abd-Elsalam KA Ertz D Hidayat I Jeewon R Jones EBG Bahkali AH Karunarathna SC Liu J-K Luangsa-ard JJ Lumbsch HT Maharachchikumbura SSN McKenzie EHC Moncalvo J-M Ghobad-Nejhad M Nilsson H Pang K-L Pereira OL Phillips AJL Raspé O Rollins AW Romero AI Etayo J Selçuk F Stephenson SL Suetrong S Taylor JE Tsui CKM Vizzini A Abdel-Wahab MA Wen T-C Boonmee S Dai DQ Daranagama DA Dissanayake AJ Ekanayaka AH Fryar SC Hongsanan S Jayawardena RS Li W-J Perera RH Phookamsak R de Silva NI Thambugala KM Tian Q Wijayawardene NN Zhao R-L Zhao Q Kang J-C Promputtha I (2015) The faces of fungi database: Fungal names linked with morphology, phylogeny and human impacts. Fungal Diversity 74 (1 ): 3–18. 10.1007/s13225-015-0351-8
Jayasiri SC Hyde KD Jones EBG Lu YZ (2017) Neohelicosporiumfusisporum sp. nov. (Tubeufiaceae) and a first record of a sexual morph within Neohelicosporium. Studies in Fungi 2(1): 210–217. 10.5943/sif/2/1/24
Kirk PM Cannon PF David JC Stalpers JA (2001) Ainsworth and Bisby’s dictionary of the fungi, 9th edn. CABI, Wallingford.
Kodsueb R Jeewon R Vijaykrishna D McKenzie EHC Lumyong P Lumyong S Hyde KD (2006) Systematic revision of Tubeufiaceae based on morphological and molecular data. Fungal Diversity 21 : 105–130.
Konta S Tibpromma S Karunarathna SC Samarakoon MC Steven LS Mapook A Boonmee S Senwanna C Balasuriya A Eungwanichayapant PD Hyde KD (2023) Morphology and multigene phylogeny reveal ten novel taxa in Ascomycota from terrestrial palm substrates (Arecaceae) in Thailand. Mycosphere 14 (1 ): 107–152. 10.5943/mycosphere/14/1/2
Li LL Shen HW Bao DF Wanasinghe DN Lu YZ Feng Y Luo ZL (2022) The plethora of Tubeufiaceae in lakes of the northwestern Yunnan plateau, China. Frontiers in Microbiology 13: 1056669. 10.3389/fmicb.2022.1056669
Linder DH (1929) A monograph of the helicosporous Fungi Imperfecti. Annals of the Missouri Botanical Garden 16 (3 ): 22–388. 10.2307/2394038
Liu JK Lu YZ Cheewangkoon R To-Anun C (2018) Phylogeny and morphology of Helicotubeufia gen. nov., with three new species in Tubeufiaceae from aquatic habitats. Mycosphere 9 (3 ): 495–509. 10.5943/mycosphere/9/3/4
Liu NG Lu YZ Bhat DJ McKenzie EHC Lumyong S Jumpathong J Liu JK (2019) Kevinhydeabrevistipitata gen. et sp. nov. and Helicomahydei sp. nov., (Tubeufiaceae) from decaying wood habitats. Mycological Progress 18 (5 ): 671–682. 10.1007/s11557-019-01480-8
Lu YZ Boonmee S Bhat DJ Hyde KD Kang JC (2017a) Helicosporiumluteosporum sp. nov. and Acanthohelicosporaaurea (Tubeufiaceae, Tubeufiales) from terrestrial habitats. Phytotaxa 319 (3 ): 241–253. 10.11646/phytotaxa.319.3.3
Lu YZ Boonmee S Dai DQ Liu JK Hyde KD Bhat DJ Kang JC (2017b) Four new species of Tubeufia (Tubeufiaceae, Tubeufiales) from Thailand. Mycological Progress 16 (4 ): 403–417. 10.1007/s11557-017-1280-6
Lu YZ Boonmee S Liu JK Hyde KD Bhat DJ Eungwanichayapant PD Kang JC (2017c) Novel Neoacanthostigma species from aquatic habitats. Cryptogamie. Mycologie 38 (2 ): 169–190. 10.7872/crym/v38.iss2.2017.169
Lu YZ Boonmee S Liu JK Hyde KD McKenzie EHC Eungwanichayapant PD Kang JC (2018a) Multi-gene phylogenetic analyses reveals Neohelicosporium gen. nov. and five new species of helicosporous hyphomycetes from aquatic habitats. Mycological Progress 17 (5 ): 631–646. 10.1007/s11557-017-1366-1
Lu YZ Liu JK Hyde KD Jeewon R Kang JC Fan C Boonmee S Bhat DJ Luo ZL Lin CG Eungwanichayapant PD (2018b) A taxonomic reassessment of Tubeufiales based on multi-locus phylogeny and morphology. Fungal Diversity 92 (1 ): 131–344. 10.1007/s13225-018-0411-y
Lu YZ Ma J Xiao XJ Zhang LJ Xiao YP Kang JC (2022) Four new species and three new records of helicosporous hyphomycetes from China and their multi-gene phylogenies. Frontiers in Microbiology 13(no. 1053849): 1–23. 10.3389/fmicb.2022.1053849
Lu YZ Ma J Xiao XJ Zhang LJ Ma XY Xiao YP Kang JC (2023) Two novel species and one new record of Helicoma from tropical China. Mycosystema 42 (1 ): 263–277.
Lumbsch HT Huhndorf SM (2010) Outline of Ascomycota 2009. Myconet 14 : 1–64. 10.3158/1557.1
Luo ZL Bhat DJ Jeewon R Boonmee S Bao DF Zhao YC Chai HM Su HY Su XJ Hyde KD (2017) Molecular phylogeny and morphological characterization of asexual fungi (Tubeufiaceae) from freshwater habitats in Yunnan, China. Cryptogamie. Mycologie 38 (1 ): 27–53. 10.7872/crym/v38.iss1.2017.27
Ma J Xiao XJ Liu NG Boonmee S Xiao YP Lu YZ (2023) Morphological and multi-gene phylogenetic analyses reveal Pseudotubeufia gen. nov. and two new species in Tubeufiaceae from China. Journal of Fungi 9 (7 ): 742. 10.3390/jof9070742 37504731
Miller MA Pfeiffer W Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the 2010 gateway computing environments workshop (GCE), 8 pp. 10.1109/GCE.2010.5676129
Moore RT (1955) Index to the Helicosporae. Mycologia 47 (1 ): 90–103. 10.1080/00275514.1955.12024431
Nuin P (2007) MrMTgui. v 1.0. MrModelTest/ModelTest Graphical interface for Windows/Linux.
O’Donnell K Sarver BA Brandt M Chang DC Noble-Wang J Park BJ Sutton DA Benjamin L Lindsley M Padhye A Geiser DM Ward TJ (2007) Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated US keratitis outbreaks of 2005 and 2006. Journal of Clinical Microbiology 45 (7 ): 2235–2248. 10.1128/JCM.00533-07 17507522
Pem D Jeewon R Chethana KWT Hongsanan S Doilom M Suwannarach N Hyde KD (2021) Species concepts of Dothideomycetes: Classification, phylogenetic inconsistencies and taxonomic standardization. Fungal Diversity 109 (1 ): 283–319. 10.1007/s13225-021-00485-7
Peng H Xia H Chen H Zhi P Xu Z (2021) Spatial variation characteristics of vegetation phenology and its influencing factors in the subtropical monsoon climate region of southern China. PLoS ONE 16(4): e0250825. 10.1371/journal.pone.0250825
Pereira DS Phillips AJL (2023) Palm fungi and their key role in biodiversity surveys: A review. Journal of Fungi 9 (11 ): 1121. 10.3390/jof9111121 37998926
Pirozynski KA (1972) Microfungi of Tanzania. I. Miscellaneous fungi on oil palm. Commonwealth Mycological Institute, Kew.
Reichgelt T West CK Greenwood DR (2018) The relation between global palm distribution and climate. Scientific Reports 8 (1 ): 4721. 10.1038/s41598-018-23147-2 29549297
Rossman AY (1987) The Tubeufiaceae and similar Loculoascomycetes. Mycol Pap 157 : 1–71.
Senanayake IC Jeewon R Chomnunti P Wanasinghe DN Norphanphoun C Karunarathna A Pem D Perera RH Camporesi E McKenzie EHC Hyde KD Karunarathna SC (2018) Taxonomic circumscription of Diaporthales based on multigene phylogeny and morphology. Fungal Diversity 93 (1 ): 241–443. 10.1007/s13225-018-0410-z
Senanayake IC Rathnayaka AR Marasinghe DS Calabon MS Gentekaki E Lee HB Hurdeal VG Pem D Dissanayake LS Wijesinghe SN Bundhun D Nguyen TTT Goonasekara ID Abeywickrama PD Bhunjun CS Jayawardena RS Wanasinghe DN Jeewon R Bhat DJ Xiang MM (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere 11 (1 ): 2678–2754. 10.5943/mycosphere/11/1/20
Stamatakis A (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30 (9 ): 1312–1313. 10.1093/bioinformatics/btu033 24451623
Stamatakis A Hoover J Rougemint J (2008) A rapid Bootstrap algorithm for the RAxML Web Servers. Systematic Biology 75 (5 ): 558–771. 10.1080/10635150802429642
Swofford DL (2003) PAUP: Phylogenetic Analysis Using Parsimony (and Other Methods) Version 4.0b10. Sinauer Associates, Sunderland.
Taylor JE Hyde KD Jones EBG (1999) Endophytic fungi associated with the temperate palm, Trachycarpus fortunei, within and outside its natural geographic range. The New Phytologist 142 (2 ): 335–346. 10.1046/j.1469-8137.1999.00391.x
Tian X Karunarathna SC Xu R Lu Y Suwannarach N Mapook A Bao D Xu J Tibpromma S (2022) Three new species, two new records and four new collections of Tubeufiaceae from Thailand and China. Journal of Fungi 8 (2 ): 206. 10.3390/jof8020206 35205960
Tsui CK Sivichai S Berbee ML (2006) Molecular systematics of Helicoma, Helicomyces and Helicosporium and their teleomorphs inferred from rDNA sequences. Mycologia 98 (1 ): 94–104. 10.1080/15572536.2006.11832715 16800307
Vilgalys R Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172 (8 ): 4238–4246. 10.1128/jb.172.8.4238-4246.1990 2376561
Wang L Sarnthein M Erlenkeuser H Grimalt J Grootes P Heilig S Ivanova E Kienast M Pelejero C Pflaumann U (1999) East Asian monsoon climate during the Late Pleistocene: High-resolution sediment records from the South China Sea. Marine Geology 156 (1–4 ): 245–284. 10.1016/S0025-3227(98)00182-0
White TJ Bruns T Lee S Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18 (1 ): 315–322. 10.1016/B978-0-12-372180-8.50042-1
Wijayawardene NN Hyde KD Dai DQ Sánchez-García M Goto BT Saxena RK Erdoğdu M Selçuk F Rajeshkumar KC Aptroot A Błaszkowski J Boonyuen N da Silva GA de Souza FA Dong W Ertz D Haelewaters D Jones EBG Karunarathna SC Kirk PM Kukwa M Kumla J Leontyev DV Lumbsch HT Maharachchikumbura SSN Marguno F Martínez-Rodríguez P Mešić A Monteiro JS Oehl F Pawłowska J Pem D Pfliegler WP Phillips AJL Pošta A He MQ Li JX Raza M Sruthi OP Suetrong S Suwannarach N Tedersoo L Thiyagaraja V Tibpromma S Tkalčec Z Tokarev YS Wanasinghe DN Wijesundara DSA Wimalaseana S Madrid H Zhang GQ Gao Y Sánchez-Castro I Tang LZ Stadler M Yurkov A Thines M (2022) Outline of Fungi and fungus-like taxa – 2021. Mycosphere 13 (1 ): 53–453. 10.5943/mycosphere/13/1/2
Xiong YR Manawasinghe IS Hyde KD Taylor JE Phillips AJL Pereira DS Lu L Zhang SN Mapook A Xu B (2024) Introducing palmfungi.org, an integrated fungal-host data platform – on progress.
Yang J Liu LL Jones EBG Hyde KD Liu ZY Bao DF Liu NG Li WL Shen HW Yu XD Liu JK (2023) Freshwater fungi from karst landscapes in China and Thailand. Fungal Diversity 119 (1 ): 1–212. 10.1007/s13225-023-00514-7
Zhang L Ma J Ma X Feng X Bai X Huang Y Jayawardena RS Mapook A Kang J Lu Y (2023) A new record of Neohelicosporiumguangxiense and its secondary metabolites. Warasan Khana Witthayasat Maha Witthayalai Chiang Mai 50 (2 ): 1–12. 10.12982/CMJS.2023.010
Zhao GZ Liu X Wu W (2007) Helicosporous hyphomycetes from China. Fungal Diversity 26 : 313–524.
Zhu H (2016) A biogeographical comparison between Yunnan Southwest China, and Taiwan, Southeast China with implications for the evolutionary history of the East Asian Flora. Annals of the Missouri Botanical Garden 101 (4 ): 750–771. 10.3417/2011037
Zhu H (2017) Tropical flora of southern China. Shengwu Duoyangxing 25 (2 ): 72–79. 10.17520/biods.2016055
