
==== Front
Mol Neurobiol
Mol Neurobiol
Molecular Neurobiology
0893-7648
1559-1182
Springer US New York

38427212
4070
10.1007/s12035-024-04070-2
Original Article
An In Vitro Study for the Role of Schizophrenia-Related Potential miRNAs in the Regulation of COMT Gene
http://orcid.org/0000-0002-2296-3102
Tonk Onur 1
http://orcid.org/0000-0001-9025-4140
Tokgun Pervin Elvan parslan@pau.edu.tr
elvanars@gmail.com

2
http://orcid.org/0000-0001-9451-1300
Yılmaz Özge Sarıca 1
http://orcid.org/0000-0003-0537-9032
Tokgun Onur 23
http://orcid.org/0000-0001-9341-7945
Inci Kubilay 3
http://orcid.org/0000-0003-3939-3780
Çelikkaya Büşra 3
http://orcid.org/0000-0002-1994-455X
Altintas Nuray 1
1 Faculty of Medicine, Department of Medical Biology, Celal University, Manisa, Turkey
2 https://ror.org/01etz1309 grid.411742.5 0000 0001 1498 3798 Faculty of Medicine, Department of Medical Genetics, Pamukkale University, Kınıklı, Denizli, Turkey
3 https://ror.org/01etz1309 grid.411742.5 0000 0001 1498 3798 Department of Cancer Molecular Biology, Institute of Health Sciences, Pamukkale University, Denizli, Turkey
1 3 2024
1 3 2024
2024
61 10 76807690
16 10 2023
25 2 2024
© The Author(s) 2024, corrected publication 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
This study aimed to analyze the possible association of miR-30a-5p, miR-30e-5p, and miR-34a-5p identified as potential candidate miRNAs in schizophrenia, with the COMT gene. Candidate miRNAs were obtained from the TargetScan database. The SH-SY5Y human neuroblastoma cell line was used as a cellular model for schizophrenia. miR-30a-5p, miR-30e-5p, and miR-34a-5p mimics were transfected into the SH-SY5Y cell line. Total RNA was isolated from transfected cells and RNA-IP samples and reverse transcripted for miRNA and mRNA analysis. RT-qPCR and western blot were performed to observe changes in expression levels of COMT. RNA-ımmunoprecipitation was performed to determine RNA–protein interactions after mimic transfection. In the study, it was observed that COMT gene expression levels decreased significantly after miR-30a-5p and miR-34a-5p expressions, whereas increased significantly as a result of miR-30e-5p transfection. RNA-IP data have shown that the amount of COMT pulled down by Ago2 was increased after miR-30a-5p and miR-34a-5p transfections. RNA-IP results revealed that miR-30a-5p and miR-34a-5p are direct targets for the COMT gene.

Keywords

Schizophrenia
COMT gene
miR-30a-5p
miR-30e-5p
miR-34a-5p
Celal Bayar University Scientific Research Projects Coordinatorship BAP 2020-125 Pamukkale UniversityOpen access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK).

issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Schizophrenia (SCZ) is a hereditary (approximately 80%) and chronic neurodevelopmental brain disease with a genetic and neurobiological history resulting in premature death and a high prevalence of treatment resistance [1, 2]. Although schizophrenia is the most devastating psychiatric disease due to its early onset and chronicity, its pathomechanism is quite complex [3–6]. Schizophrenia affects approximately 0.5 to 0.7% of the human population [6, 7] and affects between four and seven per 1000 people worldwide [8, 9]. Due to its genomic location and its function in dopamine catabolism, COMT is considered to be a strong candidate gene that has received the most attention for schizophrenia and is promising for treatment response [10, 11]. COMT is an important enzyme that degrades catecholamines, including dopamine, and is one of the key factors involved in the regulation of dopamine levels [12–14]. Epigenetic modifications, including non-coding RNAs, play a role in many diseases such as neuropsychiatric disorders. Schizophrenia and other major psychiatric and neurodevelopmental disorders are associated with abnormalities in multiple epigenetic mechanisms [15]. miRNAs are widely distributed in different organisms and play a role in almost all life processes [16]. Through multiple mechanisms affecting transcription and translation, miRNAs can affect the expression of gene groups essential for development and lifetime cellular functioning [17]. miRNAs regulate many cell signaling pathways, can affect the physiological functioning of cells, and may, therefore, play a role in the development of schizophrenia [18]. As miRNAs are predominantly regulated transcriptionally and are greatly influenced by alterations in the biological pathway, miRNA abnormalities or mutations within the cell may cause neurological disorders, such as the pathophysiological changes observed in schizophrenia [19]. Functionally, miRNAs regulate gene expression by binding to the 3′ UTRs of mRNAs. In this way, it can inhibit the conversion of mRNA to protein due to steric inhibition of the protein synthesis mechanism or target mRNA for enzymatic degradation [20]. Mature miRNA can bind to target mRNA transcripts. As a result, it causes transcriptional repression or degradation of target mRNAs. Each miRNA can simultaneously affect the expression of hundreds of genes and synchronize multiple components of independent signaling pathways [17, 19, 21–23]. miRNAs act as a post-transcriptional gene regulator via RISC. It strengthens the interaction between the miRNA sequence and the target mRNA, forming a triple miRNA:AGO:mRNA complex. Argonaute (AGO) acts as the main protein in this regulatory complex. This complex results in a suppression of gene expression through mRNA cleavage or translational repression. The initial inhibition of protein synthesis through reduced translation is a result of the miRNA binding to its target. This is followed by degradation of the mRNA [24, 25]. Approximately 70% of human miRNAs are expressed in the nervous system, where they play various roles in regulating neural structure and function. Studies have shown that they are also involved in the development of neuropsychiatric disorders and that abnormal expression of them can be used as potential biomarkers for treatment [16].

Variations in miRNA target genes may also play a role in the development of schizophrenia, particularly in the biological pathways of miRNA [19]. Although the causes of schizophrenia are still unclear, miRNAs are fully expressed in the brain tissue of patients with schizophrenia [26].

In short, considerable research has been carried out on the functional significance of miRNA regulatory networks in neural development and brain function. Recent studies have shown that these networks play an important role in SCZ, suggesting that miRNAs may be used as potential biomarkers and targets for therapeutic intervention [27]. Studies have reported that the COMT gene, which metabolizes dopamine, epinephrine, and norepinephrine, is associated with SCZ. COMT transfers a methyl group to catecholamine due to the breakdown of neurotransmitters including dopamine, adrenaline, and noradrenaline. Studies have also shown that alterations in dopamine signaling and structural cortical maturation are associated with a genetic predisposition to SCZ.

COMT Val158Met is the genotype that has been most widely studied in psychosis. However, the association of the functional SNPs with the phenotype of schizophrenia is still unclear. Some studies suggest that patients who carry the COMT Val allele tend to have an increased risk of psychotic disorders compared to ones who carry the Met allele [28]; on the other hand, some studies have reported no association [29, 30]. Although genetic and developmental factors are generally thought to play a critical role in the pathogenesis of schizophrenia, single-nucleotide polymorphisms (SNPs) have also been suggested to affect the regulation of target gene mRNA by miRNAs. Limited studies have shown that miR-30a, miR-30e, and miR-34a are important in the pathogenesis of SCZ, and the miR-30 family is the predicted target of COMT. However, their association with the COMT gene is still a gap in the field of research. From this standpoint, we aimed to investigate whether the three miRNAs (miR-30a-5p, miR-30e-5p, and miR-34a-5p) may be involved in the targeting of the COMT gene.

Materıals and Methods

Bioinformatics Tools Used for miRNA–mRNA Target Prediction

Current online databases (Diana-MicroT, miRanda, PicTar, RNA22, TargetScan, miRDB, miRTarbase) for miRNA–mRNA interactions were used for evaluating possible COMT targets.

Cellular Model of Schizophrenia

SH-SY5Y neuroblastoma cells are the most popular in vitro model used in neuropsychiatric research due to their dopaminergic and adrenergic properties. In this study, SH-SY5Y cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM-low glucose, Capricorn) supplemented with 10% FBS (Gibco, USA), 1% penicillin/streptomycin (Gibco, USA), and 1% L-glutamine incubated at 37 °C in 5% CO2.

miRNA Mimic Transfection

When SH-SY5Y cells reached 60–70% density, cells were plated in 6-well plate wells (1 × 105 cells/well). Lipofectamine 2000 transfection reagent (Invitrogen, USA) was used to transfect cells with hsa-miR-30a-5p mimic, hsa-miR-30e-5p mimic, hsa-miR-34a-5p mimic, and their negative control (NC) mimics (A.B.T. Laboratory Industry, Turkey). The transfection was carried out at a concentration of 10 nM and 20 nM for both the sense and the antisense strands. After the 20-min incubation period, the cells were transfected using a drip method into the wells of the 6-well plate. The cells were incubated for 48 h prior to collection for RT-qPCR analysis. Sense and antisense sequences of each negative control mimic and miRNA mimics are given in Table 1. Table 1 Oligonucleotide sequences (5′ → 3′) of NC and miRNA mimics

hsa-miR-30a-5p sense	TGTAAACATCCTCGACTGGAAG	
hsa-miR-30a-5p antisense	CTTCCAGTCGAGGATGTTTACA	
hsa-miR-30a-5p NC sense	TCACAACCTCCTAGAAAGAGTAGA	
hsa-miR-30a-5p NC antisense	TACTCTTTCTAGGAGGTTGTGATT	
hsa-miR-30e-5p sense	TGTAAACATCCTTGACTGGAAG	
hsa-miR-30e-5p antisense	CTTCCAGTCAAGGATGTTTACA	
hsa-miR-30e-5p NC sense	TCACAACCTCCTAGAAAGAGTAGA	
hsa-miR-30e-5p NC antisense	TCTACTCTTTCTAGGAGGTTGTGA	
hsa-miR-34a-5p sense	TGGCAGTGTCTTAGCTGGTTGT	
hsa-miR-34a-5p antisense	ACAACCAGCTAAGACACTGCC	
hsa-miR-34a-5p NC sense	GGTTCGTACGTACACTGTTCA	
hsa-miR-34a-5p NC antisense	TGAACAGTGTACGTACGAACC	

RNA Extraction and qRT-PCR Analysis

Total RNA was isolated to evaluate transfection efficiency using TRizol LS Reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA concentration was quantified using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, USA). Total RNA is extracted from cell lysates and RNA immunoprecipitation samples. For miRNA quantification analysis, A.B.T miRNA cDNA synthesis kit and 2 × qPCR master mix are used.

For the quantification of COMT from cell lysates and RNA-IP samples, cDNA was synthesized from total RNA using iScriptTM cDNA Synthesis kit (BioRAD). qRT-PCR was performed using the iTaq 2XSYBR Mix kit (BioRAD). β-tubulin was used as an internal control. The primer pairs of mRNAs used in the current study were as follows: COMT (forward, 5′-TGGACGCCGTGATTCAGGAG-3′; reverse, 5′-GCCAGCGAAATCCACCATCC-3′) and β-tubulin (forward, 5′-GGTAACCAAATCGGTGCTGCTTTC-3′; reverse, 5′ ACCCTCAGTGTGTGACCCT-3′).

Relative changes in COMT gene expressions were determined using the comparative threshold conversion (2−ΔΔCt) method.

Western Blotting

Pellets correspond to SH-SY5Y cells transfected with miRNA mimics and negative control mimics were lysed with ClearBand RIPA buffer (EcoTech Biotechnology). Protein concentrations were determined using the Bradford Protein Assay (Bioshop). A total of 50 µg of protein was analyzed by 10% SDS–polyacrylamide gel electrophoresis (SDS-PAGE; Bio-RAD) and transferred onto the polyvinylidene fluoride (PVDF) membrane using the Trans-Blot Turbo transfer system (Bio-Rad, USA). The resolved proteins were transferred to membranes and blocked with 5% nonfat milk (BioShop) for 1 h at room temperature. Membranes were incubated with antibodies against COMT (1:500; FineTest) and GAPDH (1:2000; CloudClone) at 4 °C for 2 h. Membranes underwent TBST washing and were then incubated with an anti-rabbit secondary antibody (Booster, 1:1000). The Odyssey® Fc Imaging System (LI-COR Biosciences) was used for capturing the protein band images. Quantitative analysis of target protein bands calculated according to the gray value ratio of the target band to GAPDH bands.

RNA Immunoprecipitation Assay (RNA-IP)

Dynabeads Protein G (Invitrogen, USA) was used to conduct RNA-IP experiments according to the manufacturer’s instructions. SHSY5 cells transfected with miRNA mimics and NC mimics were grown in T25 flasks and when they reached approximately 90% confluence lysed in NP40 buffer supplemented with protease inhibitor. Overall, 5 µg of each antibody was diluted in 200 µl PBS with 0.1% Tween 20. Then, magnetic beads were pre-incubated with rabbit anti-AGO2 (Finetest, China) and normal rabbit IgG (Cell Signaling, UK) antibodies for 10 min at 4 °C. Pre-cleared samples were added to Dynabeads-Ab complex and incubated for 2 h at 4 °C with a rotator. Dynabeads-Ab-Ag complexes were washed 5 times. Before RNA purification, beads were pelleted using a magnetic stand (Invitrogen, USA) and treated with proteinase K (Qiagen, Germany) for degrading the Argonaute proteins, disrupting the antibody binding, and eluting the RNA from the beads. Thereafter, the RNA was purified with a Trizol reagent (GeneAll, USA).

Pathway Enrichment Analysis

DIANA-miRPath Tool v3.0 (https://dianalab.e-ce.uth.gr/html/mirpathv3/index.php?r=mirpath) was applied for conducting GO and KEGG pathway enrichment analyses of miRNAs selected in our study.

Statistical Analysis

The graphs, calculations, and statistical analyses were performed using the GraphPad Prism software version 8.0.1 (GraphPad Software, USA). One-way ANOVA, two-way ANOVA, and unpaired Student’s t-test were used for comparisons of differential expressions of genes and cytotoxicity assessment. Statistical results with *p < 0.05, **p < 0.01, ***p < 0.001, or ****p < 0.0001 were considered statistically significant.

Results

Bioinformatics Tools Used for miRNA–mRNA Target Prediction

Before performing high-throughput experiments, it is crucial to identify miRNA targets by computational methods. The complementarity between miRNA and target mRNA was the fundamental advantage for computational analysis. In order to identify potential miRNAs that directly regulate COMT expression, a thorough search was conducted on miRNA databases for putative binding sites in the 3′UTR of human COMT mRNA (Fig. 1a–b). Utilizing advancements in bioinformatic databases, we discovered that the miR-30 family is a potential target for COMT gene (Fig. 1c).Fig. 1 a Venn diagram of putative miRNA targeting to COMT using miRDB, miRWalk, and TargetScan target prediction software; b COMT network for predicted miRNAs using miRWalk software; and c miRNA-target complementarity of miR-30 family using TargetscanHuman database Release 8.0

Evaluation of miRNA Expression Levels After Mimic Transfections in SH-SY5Y Cells

SH-SY5Y neuroblastoma cells were transfected with hsa-miR-30a-5p mimic, hsa-miR-30e-5p, hsa-miR-34a-5p mimics, and their NC mimic oligonucleotides at concentrations of 10 nM and 20 nM for 48 h. No morphological changes were observed as a result of transfection (Fig. 2a–c). The expression levels of hsa-miR-30a-5p, hsa-miR-30e-5p, and hsa-miR-34a-5p increased significantly after transfection compared to their negative control mimics. Figure 3a–c displays the expressions of miRNAs at different concentrations of mimics.Fig. 2 Microscopic images of SH-SY5Y cells (20 ×). a Typical cell morphology in the untreated control. b Microscopic images of SH-SY5Y cell morphology at 24 and 48 h at the stage of mimic transfection at 10 nM concentrations. c Microscopic images of SH-SY5Y cell morphology at 24 and 48 h at the stage of mimic transfection at 20 nM concentrations

Fig. 3 a–c miR-30a-5p, miR-30e-5p, miR-34a-5p, and their negative control mimics were transfected to SH-SY5Y cells using Lipofectamine 2000 reagent. Expression levels of miRNAs after miRNA mimic transfection were evaluated by RT-qPCR. Relative changes in the miRNA expressions were determined using the comparative threshold conversion (2−ΔΔCt) method. Statistical significance was determined using unpaired Student’s t-test (***p < 0.001; ****p < 0.0001)

COMT Expressions Were Deregulated in SH-SY5Y Cells Following the miRNA Mimic Transfections

After the mimic transfection of each miRNA, the expression levels of COMT were evaluated as a function of the mimic transfection both on mRNA and protein levels. The qRT-PCR and western blot results indicate a decrease in the expression levels of COMT after hsa-miR-30a-5p and hsa-miR-34a-5p transfection and an increase following hsa-miR-30e-5p transfection compared to the samples transfected with negative control mimic (Fig. 4a–d).Fig. 4 a–c COMT gene expression levels were evaluated after miRNA mimic transfection by RT-qPCR. d Western blot of COMT after miRNA mimic transfection. Statistical significance was determined using unpaired Student’s t-test (*p < 0.05; **p < 0.01; ***p < 0.001)

hsa-miR-30a-5p and hsa-miR-34a-5p Are Direct Targets for COMT Gene

Several miRNA databases were consulted for the identification of possible miRNAs that could be involved in the regulation of COMT expression. Three miRNAs, two belonging to the miR-30 family and miR-34a, were selected for the study. COMT is predicted to be a target of miR-30a-5p and miR-30e-5 as shown in Fig. 4, whereas there is no evidence in any database that miR-34a-5p is a target of COMT.

After transfections of mimics based on AGO2 enrichment of miRNA-bound targets on SH-SY5Y cell lysates, we performed RNA immunoprecipitation (RIP) experiments using an antibody against AGO2 to assess whether selected miRNAs bind to the COMT gene. RNA samples were prepared from cell lysates that were immunoprecipitated with Ago2 and IgG antibodies. The results showed that in SH-SY5Y cells transfected with selected miRNA mimics, the enrichment of the COMT transcript pulled down by AGO2 was increased after miR-30a-5p and miR-34a-5p compared to the negative control mimics by RNA-IP assay. These findings provide evidence that hsa-miR-30a-5p and hsa-miR-34a-5p associate with AGO2 protein to form an RNA-induced silencing complex (RISC) in SH-SY5Y cells (Fig. 5a–c).Fig. 5 a–c The RNA-IP assay was performed to estimate the enrichment of COMT in SH-SY5Y cells transfected with miRNA mimics and negative control mimics. d RNA-IP samples were subjected to qPCR amplification using specific primer pairs for COMT. Statistical significance was determined using two-way ANOVA (**p < 0.01; ****p < 0.0001)

Following washing and dissociation of miRNA mimic and NC mimic-transfected RNA-IP samples which were incubated with rabbit anti-Ago2 antibody and normal rabbit IgG, the samples were also subjected to RT-PCR with primers specific for COMT. Amplification products were assessed by electrophoresis on 1% agarose gels (Fig. 5d).

Functional and Pathway Enrichment Analysis of Selected miRNAs

The DIANA-miRPath tool was utilized to pinpoint pathways that were enriched in genes that were considerably targeted by the three miRNAs of interest. The heatmap generated by Fisher’s exact test displays the significance (log p-value) of miRNA-pathway interactions (Fig. 6).Fig. 6 Heatmap of each miRNA (columns) and the target pathway (rows) interaction based on the significance (log p-value)

Dıscussıon

The neurodevelopment of schizophrenia is associated with genetic and environmental factors that lead to inappropriate connections of neurons in the perinatal period. Multiple effects such as infections or psychosocial trauma play a role in the pathophysiology of schizophrenia [31, 32]. Dopamine is a potent neurotransmitter that governs neuronal functions in the central nervous system. Studies have shown that non-coding RNAs modulate nearly all aspects of dopamine signaling. Targeting of dopamine receptor signaling is driven by selected miRNAs, and miRNAs have emerging roles for both short and long non-coding RNAs in synaptic transmission [33]. In addition, miRNAs play a crucial role in neural development, differentiation, and maturation. Therefore, it is probable that the dysregulation of these pathways is associated with schizophrenia as it affects the cellular pathways involved in the expression of related genes [34]. COMT is a crucial target for disease treatment as it functions as a susceptibility gene for schizophrenia [35]. The aim of this study was the identification of a specific miRNA that has a crucial regulatory role for COMT in schizophrenia. In order to find a predicted miRNA, we searched all databases specific to miRNA–mRNA regulatory networks. It has been observed in the Targetscan database that positions 2 to 8 of the seed sequence of the miR-30 family and the 3′ UTR region of COMT exhibit an exact match (Fig. 1). Therefore, the relationship of two members of this family, miR-30a-5p and miR-30e-5p, with COMT was investigated, on the assumption that they could be direct targets for COMT.

The miR-30 family comprises five members and six mature miRNA sequences as miR-30a, miR-30b,miR-30c-1,miR-30c-2,miR-30d, and miR-30e. All members have a shared common seed sequence near the 5′ end. Nevertheless, they display distinct compensatory sequences near the 3′ end, thus enabling them to target various genes and pathways [36]. Based on this, we investigated whether 3 miRNAs, miR-30a-5p, miR-30e-5p, and miR-34a-5p, target COMT in our study.

miR-30a-5p is a miRNA molecule with a regulatory role in neuroprotection associated with central nervous system function. Little is known about whether osteogenic errors in BMSCs are related to the abnormal expression level of miR-30a-5p [37]. Since microRNAs have the potential to silence hundreds of genes involved in neuropsychiatric disorders, changes in miR-30a-5p are thought to be related to other gene regulation pathways [38]. Studies have shown that miR-30 family members are reduced in the prefrontal cortex of patients with schizophrenia when compared to healthy individuals, and miR-30b expression is significantly decreased in the cerebral cortex of schizophrenic patients [39]. A study investigating the effects of miRNAs indicated that miR-181b, miR-30e, miR-346, miR-34a, and miR-7 contribute significantly to the molecular mechanism of schizophrenia. It is becoming increasingly recognized that the aberrant expression of a number of miRNAs is important in the pathophysiology underlying schizophrenia. There are few studies elucidating the correlation between changes in miRNA expression and symptom amelioration in individuals with schizophrenia. When comparing the younger and older age groups, miR-30e expression was found to be significantly higher in the younger age groups. This suggests that miR-30e is the only miRNA that shows a differential expression in patients with schizophrenia at an early stage of the disease [21]. In addition, recent studies still lack information on the exact miRNA and their gene targets that mediate glial functions in schizophrenia [27]. Microarray analyses showed that 33 miRNAs, including miR-30d and miR-30e, were decreased in peripheral blood mononuclear cells isolated from schizophrenia patients. It has been reported that the biogenesis of 17 miRNAs is tightly controlled by a variety of regulators, among which are transcription factors that have an effect at the transcriptional level [39]. Multiple studies have associated abnormal expression of miR-30e-5p with schizophrenia. miR-30e-5p levels were increased in plasma, peripheral leukocytes, and peripheral blood mononuclear cells, as well as in the prefrontal cortex of patients with schizophrenia. How miR-30e-5p is linked to the pathophysiology of schizophrenia is unclear [40]. The levels of miRNA expression assessed in PBMC were compared between the schizophrenia and control groups. The findings revealed that in the schizophrenia group, miR-212, miR-34a, and miR-30e were notably up-regulated in comparison to the control group [21]. Furthermore, another study identified seven miRNAs (hsa-miR-34a, miR-449a, miR-564, miR-432, miR-548d, miR-572 and miR-652) as potential schizophrenia biomarkers [40]. Among these miRNAs, hsa-miR-34a was most altered in the PBMCs of schizophrenia patients. The significance of miR-34a-5p is highlighted by the fact that it has been shown to be elevated in the dorsolateral prefrontal cortex and plasma of schizophrenia patients [41]. However, miR-34a-5p was not identified as a possible target of COMT in database searches. We therefore investigated whether miR-34a-5p also targets COMT, given its importance in studies of schizophrenia patients.

In this study, we first investigated the effect of increased expression of selected 3 miRNAs on COMT expression in SH-SY5Y cells, which are used as a model for schizophrenia and we observed that higher levels of miR-30a-5p and miR-34a-5p inhibited COMT expression both on mRNA and protein levels (Fig. 4a–d). In our knowledge, miRNAs elicit their effect by silencing the expression of target genes. However, in a manner similar to RNAs, miRNAs may also function to regulate gene expression positively. We observed that higher levels of miR-30e-5p led to an elevation in the levels of COMT.

An interesting new biochemical approach to analyzing RISC-associated cellular mRNA has been reported in recent years. In human cells, AGO-immunoprecipitation (AGO-IP) has been associated with the overexpression of synthetic miRNAs. The use of AGO proteins can result in target genes that may not be physiologically relevant and may be subject to significant cell modulation. miRNAs bind members of the AGO protein family to form the RISC [42, 43] and methods based on AGO-IP have been used to reveal miRNA–mRNA network rearrangements [44]. Based on this, we performed RNA-IP to reveal the association of COMT with these predicted miRNAs in our study. Our data revealed that the enrichment of the COMT transcript pulled down by AGO2 was increased after miR-30a-5p and miR-34a-5p transfection providing important data that they could be binding directly to COMT. To date, no functional study has emerged for the association of miR-30a-5p and miR-34a-5p with COMT.

Conclusıon

No studies were discovered in the literature regarding the impact of miR-30a-5p, miR-30e-5p, and miR-34a-5p on the regulation of the COMT gene. Further research is necessary to demonstrate the binding of COMT-miRNA on a molecular level, but we consider our findings on the impact of these miRNAs on the COMT as a potential point of reference for future research.

Author Contribution

All authors contributed to the study’s conception and design. Material preparation, data collection, and analysis were performed by Onur Tonk, Pervin Elvan Tokgun, Onur Tokgun, Kubilay Inci, and Büşra Çelikkaya, Nuray Altıntas. The first draft of the manuscript was written by Onur Tonk and Pervin Elvan Tokgun, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK). This study is supported by the Celal Bayar University Scientific Research Projects Coordinatorship with project number BAP 2020–125.

Data Availability

All data supporting the findings of this study are available in the paper.

Declarations

Ethics Approval and Consent to Participate

All protocols used in this study were approved by The Ethics Committee of Celal Bayar University, Turkey. All procedures performed in this study involving human participants were in accordance with the ethical standards of the institutional committee. Informed consent was obtained from all individual participants included in the study.

Consent To Publish

Informed consent was obtained from study participants.

Competing Interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

3/19/2024

A Correction to this paper has been published: 10.1007/s12035-024-04112-9
==== Refs
References

1. Perkovic MN Erjavec GN Strac DS Uzun S Kozumplik O Pivac N Theranostic biomarkers for schizophrenia Int J Mol Sci 2017 18 4 733 10.3390/ijms18040733 28358316
Perkovic MN, Erjavec GN, Strac DS, Uzun S, Kozumplik O, Pivac N (2017) Theranostic biomarkers for schizophrenia. Int J Mol Sci 18(4):733. 10.3390/ijms1804073328358316
2. Wysokiński A Kozłowska E Szczepocka E Expression of dopamine D1–4 and serotonin 5-HT1A-3A receptors in blood mononuclear cells in schizophrenia Front Psychiatry 2021 12 645081 10.3389/fpsyt.2021.645081 33776821
Wysokiński A, Kozłowska E, Szczepocka E et al (2021) Expression of dopamine D1–4 and serotonin 5-HT1A-3A receptors in blood mononuclear cells in schizophrenia. Front Psychiatry 12:645081. 10.3389/fpsyt.2021.64508133776821
3. Swathy B Banerjee M Understanding epigenetics of schizophrenia in the backdrop of its antipsychotic drug therapy Epigenomics 2017 9 5 721 736 10.2217/epi-2016-0106 28470099
Swathy B, Banerjee M (2017) Understanding epigenetics of schizophrenia in the backdrop of its antipsychotic drug therapy. Epigenomics 9(5):721–736. 10.2217/epi-2016-010628470099
4. Obi-Nagata K Temma Y Hayashi-Takagi A Synaptic functions and their disruption in schizophrenia: From clinical evidence to synaptic optogenetics in an animal model Proc Jpn Acad Ser B Phys Biol Sci 2019 95 5 179 197 10.2183/pjab.95.014 31080187
Obi-Nagata K, Temma Y, Hayashi-Takagi A (2019) Synaptic functions and their disruption in schizophrenia: From clinical evidence to synaptic optogenetics in an animal model. Proc Jpn Acad Ser B Phys Biol Sci 95(5):179–197. 10.2183/pjab.95.01431080187
5. Koszła O Targowska-Duda KM Kędzierska E Kaczor AA In vitro and ın vivo models for the ınvestigation of potential drugs against schizophrenia Biomolecules 2020 10 1 160 10.3390/biom10010160 31963851
Koszła O, Targowska-Duda KM, Kędzierska E, Kaczor AA (2020) In vitro and ın vivo models for the ınvestigation of potential drugs against schizophrenia. Biomolecules 10(1):160. 10.3390/biom1001016031963851
6. Golov AK Kondratyev NV Kostyuk GP Golimbet AVE Novel approaches for ıdentifying the molecular background of schizophrenia Cells 2020 9 1 246 10.3390/cells9010246 31963710
Golov AK, Kondratyev NV, Kostyuk GP, Golimbet AVE (2020) Novel approaches for ıdentifying the molecular background of schizophrenia. Cells 9(1):246. 10.3390/cells901024631963710
7. Girdler SJ Confino JE Woesner ME Exercise as a treatment for schizophrenia: a review Psychopharmacol Bull 2019 49 1 56 69 30858639
Girdler SJ, Confino JE, Woesner ME (2019) Exercise as a treatment for schizophrenia: a review. Psychopharmacol Bull 49(1):56–6930858639
8. Acar C Kartalcı S The Role of Catechol-O-Methyltransferase (COMT) Gene in the etiopathogenesis of schizophrenia Curr Approaches Psychiatry 2014 6 3 217
Acar C, Kartalcı S (2014) The Role of Catechol-O-Methyltransferase (COMT) Gene in the etiopathogenesis of schizophrenia. Curr Approaches Psychiatry 6(3):217
9. Matsuzaka CT Christofolini D Ota VK Gadelha A Berberian AA Noto C Mazzotti DR Spindola LM Catechol-O-methyltransferase (COMT) polymorphisms modulate working memory in individuals with schizophrenia and healthy controls Braz J Psychiatry 2017 39 4 302 308 10.1590/1516-4446-2016-1987 28273278
Matsuzaka CT, Christofolini D, Ota VK, Gadelha A, Berberian AA, Noto C, Mazzotti DR, Spindola LM et al (2017) Catechol-O-methyltransferase (COMT) polymorphisms modulate working memory in individuals with schizophrenia and healthy controls. Braz J Psychiatry 39(4):302–308. 10.1590/1516-4446-2016-198728273278
10. Gozukara Bag HG Association between COMT gene rs165599 SNP and schizophrenia: a meta-analysis of case-control studies Mol Genet Genomic Med 2018 6 5 845 854 10.1002/mgg3.468 30165727
Gozukara Bag HG (2018) Association between COMT gene rs165599 SNP and schizophrenia: a meta-analysis of case-control studies. Mol Genet Genomic Med 6(5):845–854. 10.1002/mgg3.46830165727
11. Li Z He Y Han H COMT, 5-HTR2A, and SLC6A4 mRNA expressions in first-episode antipsychotic-naïve schizophrenia and association with treatment outcomes Front Psychiatry 2018 9 577 10.3389/fpsyt.2018.00577 30483162
Li Z, He Y, Han H et al (2018) COMT, 5-HTR2A, and SLC6A4 mRNA expressions in first-episode antipsychotic-naïve schizophrenia and association with treatment outcomes. Front Psychiatry 9:57730483162
12. Tang X Jin J Tang Y Cao J Huang J Risk assessment of aggressive behavior in Chinese patients with schizophrenia by fMRI and COMT gene Neuropsychiatr Dis Treat 2017 13 387 395 10.2147/NDT.S126356 28223811
Tang X, Jin J, Tang Y, Cao J, Huang J (2017) Risk assessment of aggressive behavior in Chinese patients with schizophrenia by fMRI and COMT gene. Neuropsychiatr Dis Treat 13:387–395. 10.2147/NDT.S12635628223811
13. Kirenskaya AV Storozheva ZI Gruden MA COMT and GAD1 gene polymorphisms are associated with impaired antisaccade task performance in schizophrenic patients Eur Arch Psychiatry Clin Neurosci 2018 268 571 584 10.1007/s00406-018-0881-7 29429137
Kirenskaya AV, Storozheva ZI, Gruden MA et al (2018) COMT and GAD1 gene polymorphisms are associated with impaired antisaccade task performance in schizophrenic patients. Eur Arch Psychiatry Clin Neurosci 268:571–584. 10.1007/s00406-018-0881-729429137
14. Sagud M Tudor L Uzun S Haplotypic and genotypic association of catechol-o-methyltransferase rs4680 and rs4818 polymorphisms and treatment resistance in schizophrenia Front Pharmacol 2018 9 705 10.3389/fphar.2018.00705 30018555
Sagud M, Tudor L, Uzun S et al (2018) Haplotypic and genotypic association of catechol-o-methyltransferase rs4680 and rs4818 polymorphisms and treatment resistance in schizophrenia. Front Pharmacol 9:705. 10.3389/fphar.2018.0070530018555
15. Shorter KR Miller BH Epigenetic mechanisms in schizophrenia Prog Biophys Mol Biol 2015 118 1–2 1 7 10.1016/j.pbiomolbio.2015.04.008 25958205
Shorter KR, Miller BH (2015) Epigenetic mechanisms in schizophrenia. Prog Biophys Mol Biol 118(1–2):1–7. 10.1016/j.pbiomolbio.2015.04.00825958205
16. He K Guo C He L Shi Y MiRNAs of peripheral blood as the biomarker of schizophrenia Hereditas 2017 155 9 10.1186/s41065-017-0044-2 28860957
He K, Guo C, He L, Shi Y (2017) MiRNAs of peripheral blood as the biomarker of schizophrenia. Hereditas 155:9. 10.1186/s41065-017-0044-228860957
17. Warnica W Merico D Costain G Copy number variable microRNAs in schizophrenia and their neurodevelopmental gene targets Biol Psychiatry 2015 77 2 158 166 10.1016/j.biopsych.2014.05.011 25034949
Warnica W, Merico D, Costain G et al (2015) Copy number variable microRNAs in schizophrenia and their neurodevelopmental gene targets. Biol Psychiatry 77(2):158–166. 10.1016/j.biopsych.2014.05.01125034949
18. Wang J Wang Y Yang J Huang Y microRNAs as novel biomarkers of schizophrenia (review) Exp Ther Med 2014 8 6 1671 1676 10.1016/10.3892/etm.2014.2014 25371713
Wang J, Wang Y, Yang J, Huang Y (2014) microRNAs as novel biomarkers of schizophrenia (review). Exp Ther Med 8(6):1671–1676. 10.1016/10.3892/etm.2014.201425371713
19 Khavari B Cairns MJ Epigenomic dysregulation in schizophrenia: ın search of disease etiology and biomarkers Cells 2020 9 8 1837 10.3390/cells9081837 32764320
Khavari B, Cairns MJ (2020) Epigenomic dysregulation in schizophrenia: ın search of disease etiology and biomarkers. Cells 9(8):1837. 10.3390/cells908183732764320
20. Rey R Suaud-Chagny MF Dorey JM Teyssier JR d'Amato T Widespread transcriptional disruption of the microRNA biogenesis machinery in brain and peripheral tissues of individuals with schizophrenia Transl Psychiatry 2020 10 1 376 10.1038/s41398-020-01052-5 33149139
Rey R, Suaud-Chagny MF, Dorey JM, Teyssier JR, d’Amato T (2020) Widespread transcriptional disruption of the microRNA biogenesis machinery in brain and peripheral tissues of individuals with schizophrenia. Transl Psychiatry 10(1):376. 10.1038/s41398-020-01052-533149139
21. Sun X Zhang J Identification of putative pathogenic SNPs implied in schizophrenia-associated miRNAs BMC Bioinforma 2014 15 194 10.1186/1471-2105-15-194
Sun X, Zhang J (2014) Identification of putative pathogenic SNPs implied in schizophrenia-associated miRNAs. BMC Bioinforma 15:194
22. Cao T Zhen XC Dysregulation of miRNA and its potential therapeutic application in schizophrenia CNS Neurosci Ther 2018 24 7 586 597 10.1111/cns.12840 29529357
Cao T, Zhen XC (2018) Dysregulation of miRNA and its potential therapeutic application in schizophrenia. CNS Neurosci Ther 24(7):586–597. 10.1111/cns.1284029529357
23. Gibbons A Udawela M Dean B Non-coding rna as novel players in the pathophysiology of schizophrenia Noncoding RNA 2018 4 2 11 10.3390/ncrna4020011 29657307
Gibbons A, Udawela M, Dean B (2018) Non-coding rna as novel players in the pathophysiology of schizophrenia. Noncoding RNA 4(2):11. 10.3390/ncrna402001129657307
24. Ayoubian H Ludwig N Fehlmann T Menegatti J Gröger L Anastasiadou E Trivedi P Keller A Epstein-Barr virus ınfection of cell lines derived from diffuse large B-cell lymphomas alters microRNA loading of the Ago2 complex J Virol 2019 93 3 e01297 e1318 10.1128/JVI.01297-18 30429351
Ayoubian H, Ludwig N, Fehlmann T, Menegatti J, Gröger L, Anastasiadou E, Trivedi P, Keller A et al (2019) Epstein-Barr virus ınfection of cell lines derived from diffuse large B-cell lymphomas alters microRNA loading of the Ago2 complex. J Virol 93(3):e01297-e1318. 10.1128/JVI.01297-1830429351
25. Frydrych Capelari É da Fonseca GC Guzman F Margis R Circular and micro RNAs from arabidopsis thaliana flowers are simultaneously ısolated from AGO-IP libraries Plants (Basel) 2019 8 9 302 10.3390/plants8090302 31454955
Frydrych Capelari É, da Fonseca GC, Guzman F, Margis R (2019) Circular and micro RNAs from arabidopsis thaliana flowers are simultaneously ısolated from AGO-IP libraries. Plants (Basel) 8(9):302. 10.3390/plants809030231454955
26. He K Guo C Guo M Identification of serum microRNAs as diagnostic biomarkers for schizophrenia Hereditas 2019 156 23 10.1186/s41065-019-0099-3 31297041
He K, Guo C, Guo M et al (2019) Identification of serum microRNAs as diagnostic biomarkers for schizophrenia. Hereditas 156:23. 10.1186/s41065-019-0099-331297041
27. Akkouh IA Hughes T Steen VM Glover JC Andreassen OA Djurovic S Szabo A Transcriptome analysis reveals disparate expression of inflammation-related miRNAs and their gene targets in iPSC-astrocytes from people with schizophrenia Brain Behav Immun 2021 94 235 244 10.1016/j.bbi.2021.01.037 33571628
Akkouh IA, Hughes T, Steen VM, Glover JC, Andreassen OA, Djurovic S, Szabo A (2021) Transcriptome analysis reveals disparate expression of inflammation-related miRNAs and their gene targets in iPSC-astrocytes from people with schizophrenia. Brain Behav Immun 94:235–244. 10.1016/j.bbi.2021.01.03733571628
28. Gothelf D Eliez S Thompson T Hinard C Penniman L Feinstein C Kwon H Jin S COMT genotype predicts longitudinal cognitive decline and psychosis in 22q11.2 deletion syndrome Nat Neurosci 2005 8 1500 1502 10.1038/nn1572 16234808
Gothelf D, Eliez S, Thompson T, Hinard C, Penniman L, Feinstein C, Kwon H, Jin S et al (2005) COMT genotype predicts longitudinal cognitive decline and psychosis in 22q11.2 deletion syndrome. Nat Neurosci 8:1500–1502. 10.1038/nn157216234808
29. Altinyazar V Gunderici A Tinaz E Kirci C No association of catechol-o-methyltransferase (COMT) gene haplotypes in patients with schizophrenia in a Turkish sample Klin Psikofarmakol Bül-Bull Clin Psychopharmacol 2015 25 2 129 135
Altinyazar V, Gunderici A, Tinaz E, Kirci C (2015) No association of catechol-o-methyltransferase (COMT) gene haplotypes in patients with schizophrenia in a Turkish sample. Klin Psikofarmakol Bül-Bull Clin Psychopharmacol 25(2):129–135
30. Bassett AS Caluseriu O Weksberg R Young DA Chow EW Catechol-o-methyl transferase and expression of schizophrenia in 73 adults with 22q11 deletion syndrome Biol Psychiatry 2007 61 1135 1140 10.1016/j.biopsych.2006.07.038 17217925
Bassett AS, Caluseriu O, Weksberg R, Young DA, Chow EW (2007) Catechol-o-methyl transferase and expression of schizophrenia in 73 adults with 22q11 deletion syndrome. Biol Psychiatry 61:1135–114017217925
31. Noto C Ota VK Santoro ML Gouvea ES Silva PN Spindola LM Cordeiro Q Bressan RA Depression, cytokine, and cytokine by treatment ınteractions modulate gene expression in antipsychotic naïve first episode psychosis Mol Neurobiol 2016 53 8 5701 5709 10.1007/s12035-015-9489-3 26491028
Noto C, Ota VK, Santoro ML, Gouvea ES, Silva PN, Spindola LM, Cordeiro Q, Bressan RA et al (2016) Depression, cytokine, and cytokine by treatment ınteractions modulate gene expression in antipsychotic naïve first episode psychosis. Mol Neurobiol 53(8):5701–5709. 10.1007/s12035-015-9489-326491028
32. Alural B Genc S Haggarty SJ Diagnostic and therapeutic potential of microRNAs in neuropsychiatric disorders: past, present, and future Prog Neuropsychopharmacol Biol Psychiatry 2017 6 73 87 103 10.1016/j.pnpbp.2016.03.010
Alural B, Genc S, Haggarty SJ (2017) Diagnostic and therapeutic potential of microRNAs in neuropsychiatric disorders: past, present, and future. Prog Neuropsychopharmacol Biol Psychiatry 6(73):87–103. 10.1016/j.pnpbp.2016.03.010
33. Carrick WT Burks B Cairns MJ Kocerha J Noncoding RNA regulation of dopamine signaling in diseases of the central nervous system Front Mol Biosci 2016 25 3 69 10.3389/fmolb.2016.00069
Carrick WT, Burks B, Cairns MJ, Kocerha J (2016) Noncoding RNA regulation of dopamine signaling in diseases of the central nervous system. Front Mol Biosci 25(3):69. 10.3389/fmolb.2016.00069
34. Rizos E Siafakas N Skourti E Papageorgiou C Tsoporis J Parker TH Christodoulou DI Spandidos DA miRNAs and their role in the correlation between schizophrenia and cancer (review) Mol Med Rep 2016 14 6 4942 4946 10.3892/mmr.2016.5853 27748930
Rizos E, Siafakas N, Skourti E, Papageorgiou C, Tsoporis J, Parker TH, Christodoulou DI, Spandidos DA et al (2016) miRNAs and their role in the correlation between schizophrenia and cancer (review). Mol Med Rep 14(6):4942–4946. 10.3892/mmr.2016.585327748930
35. Wu S Wang P Tao R Yang P Yu X Li Y Ma J Schizophrenia-associated microRNA-148b-3p regulates COMT and PRSS16 expression by targeting the ZNF804A gene in human neuroblastoma cells Mol Med Rep 2020 22 1429 1439 10.3892/mmr.2020.11230 32626976
Wu S, Wang P, Tao R, Yang P, Yu X, Li Y, Ma J (2020) Schizophrenia-associated microRNA-148b-3p regulates COMT and PRSS16 expression by targeting the ZNF804A gene in human neuroblastoma cells. Mol Med Rep 22:1429–1439. 10.3892/mmr.2020.1123032626976
36. Mao L Liu S Hu L Jia L Wang H Guo M Chen C Liu Y miR-30family: a promising regulator in development and disease Biomed Res Int 2018 2018 9623412 10.1155/2018/9623412 30003109
Mao L, Liu S, Hu L, Jia L, Wang H, Guo M, Chen C, Liu Y et al (2018) miR-30family: a promising regulator in development and disease. Biomed Res Int 2018:962341230003109
37. Che M Gong W Zhao Y Liu M Long noncoding RNA HCG18 inhibits the differentiation of human bone marrow-derived mesenchymal stem cells in osteoporosis by targeting miR-30a-5p/NOTCH1 axis Mol Med 2020 26 1 106 10.1186/s10020-020-00219-6 33176682
Che M, Gong W, Zhao Y, Liu M (2020) Long noncoding RNA HCG18 inhibits the differentiation of human bone marrow-derived mesenchymal stem cells in osteoporosis by targeting miR-30a-5p/NOTCH1 axis. Mol Med 26(1):106. 10.1186/s10020-020-00219-633176682
38. Croce N Bernardini S Caltagirone C Angelucci F Lithium/valproic acid combination and L-glutamate induce similar pattern of changes in the expression of miR-30a-5p in SH-SY5Y neuroblastoma cells Neuromolecular Med 2014 16 4 872 877 10.1007/s12017-014-8325-7 25149854
Croce N, Bernardini S, Caltagirone C, Angelucci F (2014) Lithium/valproic acid combination and L-glutamate induce similar pattern of changes in the expression of miR-30a-5p in SH-SY5Y neuroblastoma cells. Neuromolecular Med 16(4):872–877. 10.1007/s12017-014-8325-725149854
39. Liu S Zhang F Shugart YY Yang L Li X Liu Z Sun N Yang C The early growth response protein 1-miR-30a-5p-neurogenic differentiation factor 1 axis as a novel biomarker for schizophrenia diagnosis and treatment monitoring Transl Psychiatry 2017 7 1 e998 10.1038/tp.2016.268 28072411
Liu S, Zhang F, Shugart YY, Yang L, Li X, Liu Z, Sun N, Yang C et al (2017) The early growth response protein 1-miR-30a-5p-neurogenic differentiation factor 1 axis as a novel biomarker for schizophrenia diagnosis and treatment monitoring. Transl Psychiatry 7(1):e998. 10.1038/tp.2016.26828072411
40. Lai CY Yu SL Hsieh MH Chen CH Chen HY Wen CC MicroRNA expression aberration as potential peripheral blood biomarkers for schizophrenia PLoS One 2011 6 e21635 10.1371/journal.pone.0021635 21738743
Lai CY, Yu SL, Hsieh MH, Chen CH, Chen HY, Wen CC et al (2011) MicroRNA expression aberration as potential peripheral blood biomarkers for schizophrenia. PLoS One 6:e2163521738743
41. Kim AH Reimers M Maher B Williamson V McMichael O McClay JL MicroRNA expression profiling in the prefrontal cortex of individuals affected with schizophrenia and bipolar disorders Schizophr Res 2010 124 183 191 10.1016/j.schres.2010.07.002 20675101
Kim AH, Reimers M, Maher B, Williamson V, McMichael O, McClay JL et al (2010) MicroRNA expression profiling in the prefrontal cortex of individuals affected with schizophrenia and bipolar disorders. Schizophr Res 124:183–19120675101
42. Tan LP (2009) miRNAs and their target genes in B cell lymphomas. Unıversıty of Groningen. https://research.rug.nl/files/14651155/cthesis.pdf. Accessed 15 Feb 2024
43. Beitzinger M Meister G Experimental identification of microRNA targets by immunoprecipitation of Argonaute protein complexes Methods Mol Biol 2011 732 153 167 10.1007/978-1-61779-083-6_12 21431712
Beitzinger M, Meister G (2011) Experimental identification of microRNA targets by immunoprecipitation of Argonaute protein complexes. Methods Mol Biol 732:153–167. 10.1007/978-1-61779-083-6_1221431712
44. Mato Prado M Frampton AE Giovannetti E Stebbing J Castellano L Krell J Investigating miRNA-mRNA regulatory networks using crosslinking immunoprecipitation methods for biomarker and target discovery in cancer Expert Rev Mol Diagn 2016 16 11 1155 1162 10.1080/14737159.2016.1239532 27784183
Mato Prado M, Frampton AE, Giovannetti E, Stebbing J, Castellano L, Krell J (2016) Investigating miRNA-mRNA regulatory networks using crosslinking immunoprecipitation methods for biomarker and target discovery in cancer. Expert Rev Mol Diagn 16(11):1155–1162. 10.1080/14737159.2016.123953227784183
