
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0310862
PONE-D-24-20220
Research Article
Medicine and Health Sciences
Medical Conditions
Infectious Diseases
Disease Vectors
Ticks
Biology and Life Sciences
Species Interactions
Disease Vectors
Ticks
Biology and Life Sciences
Organisms
Eukaryota
Animals
Invertebrates
Arthropoda
Arachnida
Ixodes
Ticks
Biology and Life Sciences
Zoology
Animals
Invertebrates
Arthropoda
Arachnida
Ixodes
Ticks
Biology and Life Sciences
Microbiology
Virology
Viral Replication
Biology and Life Sciences
Genetics
Genomics
Microbial Genomics
Viral Genomics
Biology and Life Sciences
Microbiology
Microbial Genomics
Viral Genomics
Biology and Life Sciences
Microbiology
Virology
Viral Genomics
Medicine and Health Sciences
Epidemiology
Medical Risk Factors
Biology and Life Sciences
Genetics
Genomics
Animal Genomics
Mammalian Genomics
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Viral Pathogens
Hemorrhagic Fever Viruses
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Viral Pathogens
Hemorrhagic Fever Viruses
Biology and Life Sciences
Organisms
Viruses
Viral Pathogens
Hemorrhagic Fever Viruses
Biology and Life Sciences
Organisms
Viruses
Hemorrhagic Fever Viruses
Biology and Life Sciences
Organisms
Eukaryota
Animals
Wildlife
Biology and Life Sciences
Zoology
Animals
Wildlife
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Viral Pathogens
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Viral Pathogens
Biology and Life Sciences
Organisms
Viruses
Viral Pathogens
Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya
Isolation of a novel Bandavirus closely related to Guertu virus
https://orcid.org/0000-0002-3884-2620
Koka Hellen Conceptualization Data curation Formal analysis Investigation Methodology Validation Visualization Writing – original draft Writing – review & editing 1 2 *
Langat Solomon Data curation Formal analysis Software Validation Visualization Writing – review & editing 1
Oyola Samuel Data curation Formal analysis Software Validation Writing – review & editing 3
Cherop Faith Investigation Methodology Writing – review & editing 4
Rotich Gilbert Investigation Methodology Writing – review & editing 4
Mutisya James Investigation Methodology Writing – review & editing 1
Ofula Victor Investigation Methodology Writing – review & editing 1
Limbaso Konongoi Investigation Methodology Writing – review & editing 1
Ongus Juliette R. Conceptualization Methodology Resources Supervision Writing – review & editing 2
Lutomiah Joel Conceptualization Methodology Resources Supervision Writing – review & editing 1
Sang Rosemary Conceptualization Methodology Resources Supervision Validation Writing – review & editing 4
1 Kenya Medical Research Institute, Centre for Virus Research, Nairobi, Kenya
2 Jomo Kenyatta University of Agriculture and Technology, Nairobi, Kenya
3 International Livestock Research Institute, Nairobi, Kenya
4 International Centre of Insect Physiology and Ecology, Nairobi, Kenya
Oluwayelu Daniel Oladimeji Editor
University of Ibadan Faculty of Veterinary Medicine, NIGERIA
Competing Interests: The authors declare that they have no competing interests.

* E-mail: hellenkoka@gmail.com
20 9 2024
2024
19 9 e031086227 5 2024
6 9 2024
© 2024 Koka et al
2024
Koka et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Introduction

Emerging tick-borne viruses of medical and veterinary importance are increasingly being reported globally. This resurgence emphasizes the need for sustained surveillance to provide insights into tick-borne viral diversity and associated potential public health risks. We report on a virus tentatively designated Kinna virus (KIV) in the family Phenuiviridae and genus Bandavirus. The virus was isolated from a pool of Amblyomma gemma ticks from Kinna in Isiolo County, Kenya. High throughput sequencing of the virus isolate revealed close relatedness to the Guertu virus. The virus genome is consistent with the described genomes of other members of the genus Bandavirus, with nucleotides lengths of 6403, 3332 and 1752 in the Large (L), Medium (M) and Small (S) segments respectively. Phylogenetic analysis showed that the virus clustered with Guertu virus although it formed a distinct and well supported branch. The RdRp amino acid sequence had a 93.3% identity to that of Guertu virus, an indication that the virus is possibly novel. Neutralizing antibodies were detected in 125 (38.6%, 95% CI 33.3–44.1%) of the human sera from the communities in this region. In vivo experiments showed that the virus was lethal to mice with death occurring 6–9 days post-infection. The virus infected mammalian cells (Vero cells) but had reduced infectivity in the mosquito cell line (C636) tested.

Conclusion

Isolation of this novel virus with the potential to cause disease in human and animal populations necessitates the need to evaluate its public health significance and contribution to disease burden in the affected regions. This also points to the need for continuous monitoring of vector and human populations in high-risk ecosystems to update pathogen diversity.

Mawazo Institute 2022-1-17 https://orcid.org/0000-0002-3884-2620
Koka Hellen This study was partially funded by a grant from Mawazo Institute (https://mawazoinstitute.org), grant number 2022-1-17 and support from the government of Kenya through the Kenya Medical Research Institute. The views expressed herein do not necessarily reflect the official opinion of the donors. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results. Data AvailabilityAll data generated or analyzed in this study are included in this published article and its supplementary files. Accession numbers for the L, M and S segments of the virus are PP580190-PP580192 respectively.
Data Availability

All data generated or analyzed in this study are included in this published article and its supplementary files. Accession numbers for the L, M and S segments of the virus are PP580190-PP580192 respectively.
==== Body
pmcIntroduction

The incidence of tick-borne diseases is increasing globally and has been attributed to multiple factors including climate change that have led to the expansion of tick vectors into new geographical habitats [1]. Tick-borne viruses belong to nine families: Asfaviridae, Flaviviridae, Reoviridae, Orthomoxyviridae, Rhabdoviridae, Nyamiviridae, Phenuiviridae, Nairoviridae and Peribunyaviridae [2] with over 160 viruses that affect humans and animals [3]. Some of the newly identified tick-borne viruses include Dabie bandavirus also known as Severe Fever Thrombocytopenia Syndrome Virus (SFTSV) in China, Heart land virus and the Deer tick Virus in North America, Kyasanur Forest Disease in India and Alkhurma Hemorrhagic Fever in Saudi Arabia [4]. The unprecedented number of novel tick-borne viruses being reported, can also be attributed to technological advances in molecular biology [5]. Most of the novel viruses have been placed in established genera although some of the viruses are yet to be assigned to a family or genus [6]. Currently, the genus Bandavirus as described in the International Committee on Taxonomy of Viruses (ICTV) 2021 release, consists of eight tick-borne bunyaviruses in the order Bunyavirales and family Phenuiviridae. These include Dabie bandavirus, Bhanja bandavirus, Guertu bandavirus, Heartland bandavirus, Hunter Island bandavirus, Kismaayo bandavirus, Lone Star bandavirus and Razdan bandavirus [7]. The representative species are Dabie bandavirus (SFTSV), Bhanja virus (BHAV), Guertu virus (GTV), Heartland virus (HRTV), Hunter Island virus (HUIV), Kismaayo Virus (KISV), Lone star virus (LSV) and Razdan virus [8].

Dabie bandavirus (SFTSV), an emerging tick-borne hemorrhagic fever virus, was first isolated in patients from rural China in 2009 [9] and has since been reported in several Asian countries including Japan, South Korea and Vietnam [10–12]. This virus is associated with high fatality rates of 12–50% with clinical symptoms that include fever, myalgia, gastrointestinal symptoms and laboratory abnormalities such as regional lymphadenopathy, thrombocytopenia, leucopenia and elevated serum hepatic enzymes [13]. Severe cases progress to hemorrhagic manifestations, neurologic symptoms followed by multiple organ failure and death, with the most vulnerable being the elderly and immunocompromised individuals [14]. Although nosocomial infections were reported in China through contact with infected blood or mucus, the virus is mainly transmitted by ticks [15, 16]. In China, the virus was detected in Rhipicephalus microplus and Haemaphysalis longicornis ticks, while transtadial as well as transovarial transmission has been documented [17]. Various wild and domestic animals such as deer, rodents, boars, cattle, goats, pigs, dogs and birds are also implicated in the transmission cycle of this virus with goats and sheep showing high sero-prevalence rates [18, 19]. In the United States, Amblyomma americanum have been implicated in the transmission of this virus [20]. Another novel virus, Heartland Virus, that is genetically related to SFTSV was also reported in the United States in 2009, in patients hospitalized with fever, fatigue, anorexia and diarrhea with laboratory abnormalities similar to those of SFTSV [21]. Guertu virus, also a novel highly pathogenic bunyavirus, was first isolated in 2014 from Demarcentor nuttalli ticks in the Guertu mountain region of Wusu Xinjiang in China [22, 23]. It is genetically related to the SFTSV and Heartland virus, with up to 90% sequence identity to SFTSV. Guertu virus infects animal and human cell lines and is pathogenic to mice [23]. Antibodies with neutralizing activity against Guertu virus were detected in human serum samples in the Wusu region indicating the viruses’ potential to infect humans [23]. Guertu virus, like all Bandaviruses, has a tripartite RNA genome consisting of the large (L), Medium (M) and Small (S) segments. The L segment contains one large open reading frame (ORF) which encodes for the RNA-dependent RNA polymerase (RdRp) gene. The M segment also contains a single ORF that encodes for the glycoprotein precursor (comprising Gn and Gc genes), while the S segment contains two ORFs that encodes for the nucleocapsid (N) and nonstructural proteins (NSs) which exhibits an ambisense gene organization [24]. Several tick-borne viruses including Guertu, were reported in Hyalomma ticks from Saudi Arabia [25]. Neutralizing antibodies to Guertu virus were also reported in human samples from Pakistan [26]. Recent reports of Jingmen tick virus in Kenya, underscore the need for continued surveillance of tick-borne viruses and an assessment of the risk they pose to the public health in pastoralist communities [27, 28]. Pastoralist communities live in dry land systems and the livestock interface with wildlife in search of pasture [29] posing a risk for disease transmission [30]. This study describes a virus that was isolated from Amblyomma gemma ticks collected from domestic animals in pastoralist communities in Isiolo County, Kenya. Full genome sequence analysis determined the virus to be closely related to Guertu virus and herein we provide data on its phylogeny and sero-prevalence in humans in this dry land ecosystem.

Materials and methods

Study site

Isiolo County is an arid and semi-arid area with annual rainfall ranges of 150–600 mm and temperatures range of 24°C to 30°C. The land is covered by bushlands, scrubs and shrubs that are utilized as pastoral grazing land and managed by conservancies in the community led by a board of local trustees. Wildlife and tourism are fundamental to this county as it has many wildlife reserves such as Shaba, Buffalo springs, and Bisanadi. On the border of Isiolo and Meru county is Meru national park that is close to some of these villages in this study [31]. Farming is limited to areas around Isiolo central and Kinna that are close to the Ewaso Nyiro River and other tributaries such as the Ngare Mara and Kinna among others.

Study populations

Ticks were sampled from four sites in Isiolo County, namely Kinna, Kulamawe, Garbartula and Merti from 2015–2017. Ticks were collected from different domestic animal hosts in September 2015, April 2016 and December 2017. All ticks from one animal per site were stored in 50 ml centrifuge tubes and preserved in liquid nitrogen shippers for transportation to the laboratory. The archived serum samples used in this study were collected in 2015 during a community-based surveillance study targeting healthy individuals from five villages namely:—Kinna, Garfasa, Dadachabasa, Korbesa and Bulesa in Merti and Garbatula districts. The study sought to determine human exposure to arboviruses such as Rift Valley fever virus in nomadic populations along animal migratory routes at points of human-livestock and wildlife convergence (KEMRI SSC No.2346) [32]. The samples are being used retrospectively in this study and were accessed on 11th November 2022. The data had been de-identified and thus authors could not identify individual participants during or after data collection. The explanatory variables for the human samples were sex, age, occupation, contact with animals such as cows, goats, donkeys, camels and previous illness that was severe and/or hemorrhagic (Fig 1). This study was approved by the Kenya Medical Research Institute ethics review board protocol number (KEMRI/SERU/CVR/007/4514).

10.1371/journal.pone.0310862.g001 Fig 1 Map of Isiolo County showing the sites where tick and human samples were collected in this study.

Base maps, boundaries and shape files of Kenyan map and administrative boundaries of the county and Sub-county were derived from GADM data version 4.1 (https://gadm.org) and the maps were generated using ArcGIS Version 10.2.2 (http://desktop.arcgis.com/en/arcmap) advanced license) courtesy of Samuel Owaka.

Laboratory procedures

Tick identification

Ticks were identified to species using available morphological keys [33, 34] and pooled (1–8 ticks per pool). Several (10–12) 2 mm Zicornia beads were added to each tick pool in a 1.5 ml centrifuge tube. The centrifuge tubes were frozen before tick homogenization using the Omni bead ruptor-24 at a speed of 3.7 m/s for 1 minute. Homogenizing media prepared by supplementing Minimum Essential Medium (MEM) with 15% Fetal Bovine Serum (FBS), 2% L- glutamine, 2% antibiotic-antimycotic solution (100 units/ml penicillin, 100 μg/ml streptomycin and amphotericin) was added to the tubes of crushed ticks, vortexed, followed by centrifugation at 10,000 rpm for 5 minutes. The supernatants were transferred to cryovials for storage at -80°C until samples were assayed.

Virus isolation by cell culture and primer design

Vero CCL-81 (ATTC) cell lines maintained in an incubator at 37°C with 5% CO2 (Sanyo inCu safe, Japan) were used in virus isolation. The cell lines were seeded in 24-well plates and grown to 80–90% confluence in Minimum Essential Medium (MEM) supplemented with 10% Fetal Bovine Serum (FBS), 2% L- glutamine, 2% antibiotic-antimycotic solution (100 units/ml penicillin, 100 μg/ml streptomycin and amphotericin) and 2 ml of Non-Essential Amino Acid (NEAA). After inoculation with the tick supernatant, the cell lines were grown in MEM supplemented with 2% FBS, 2% L-glutamine, 2% antibiotic-antimycotic solution and 2 ml NEAA. Cells were observed daily for viral Cytopathic Effect (CPE) for a maximum of 14 days. Tick supernatants were harvested upon observation of CPE causing 50–70% cell destruction. All the harvested tick pools were passaged to improve chances of virus recovery [35]. The pooled minimum infection rate (Number of positive pooled samples/Total number of ticks tested per 100 ticks) was calculated for the tick species inoculated [36]. The harvested virus isolates were subjected to an RT- PCR using universal primers targeting flaviviruses, orthobunyaviruses and alphaviruses [37] as well as tick-borne viruses [38]. Virus isolates that could not be identified using available primers were sequenced and new primers were designed from the sequences of the novel virus using the PrimerQuest tool (IDT technologies). PCR products were separated on a 2% agarose gel using Diamond nucleic acid dye (Promega).

Sequencing and bioinformatics analysis

The tick supernatant with viral CPE was harvested, centrifuged and then filtered using a 2.0 μm filter to remove cell debris. RNA was extracted from the supernatant using the QIAamp Viral RNA mini kit (Qiagen, Germany), according to the manufacturer’s protocol. RNA was quantified using the Qubit 2.0 fluorometer with the Qubit RNA HS assay kit (Invitrogen, USA). RNA libraries were prepared using the TruSeq mRNA Library Prep kit (Illumina, San Diego, CA, USA), following the manufacturer’s recommended protocol which was modified to exclude the mRNA clean-up steps [39]. The libraries were sequenced on an Illumina Miseq platform (Illumina, San Diego, CA, USA) using a 2x300 base paired-end reads. Raw sequence reads were inspected for quality using FastQC and subsequently filtered with Prinseq Lite v0.20.4. Cleaned paired reads were assembled de novo using Megahit v1.1.2 and the generated contigs were compared to NCBI nucleotide database using a cut-off E-value < 10−5.

Phylogenetic analysis was performed using MEGA7 [40]. Representative reference genomes were downloaded from GenBank through the NCBI Virus portal and combined with the sequence of the virus generated in this study. Alignment of the combined sequences was achieved with Muscle plugin embedded in MEGA7. Maximum Likelihood phylogenetic analysis was carried out with a bootstrap of 1000 replicates.

RNA extraction and RT-PCR

RNA was extracted from 200 tick pool samples from the different sites and the CPE-positive tick isolate was used as a control. Thereafter, the samples were screened for the novel virus using the new primers and superscript III One-step RT-PCR system with platinum taq High Fidelity DNA polymerase according to the manufacturer’s instruction (Invitrogen). The following cycling conditions were used with an initial cDNA pre-denaturation of 50°C for 20 minutes, followed by 94°C for 2 minutes and 40 cycles of 94°C for 15 seconds, 62°C for 30 seconds, 68°C for 1 minutes and a final extension of 68°C for 5 minutes. The PCR products were viewed on a 2% gel.

In vitro virus growth kinetics

Vero E6, Vero Biken (JCRB0111), Vero CCL-81 and C6/36 cells seeded at 2.8x106 cell/ml were infected with the virus (5.3 x106 PFU/ml) at a multiplicity of infection (MOI) of 1. After every 24 hours for 7 days, 200 μl of cell culture supernatant was harvested from every infected cell line. Viral titres in these supernatants were quantified by plaque assay and a one-step growth curve generated.

In vivo studies in mice

This study was carried out following the recommendations in the Guide for the Care and Use of Laboratory Animals. The protocol was approved by the KEMRI Animal Care and Use Committee (KEMRIACUC/02.07.2023). Three female lactating mice each with a litter of 6–10 Swiss Albino mice (1–2 day-old) per cage from the KEMRI animal house were used in this study to determine virus pathogenicity. A 10-fold dilution of the virus was done and 0.01 ml of the neat virus, 10−2 and 10−4 virus dilution were inoculated intracerebrally into the cranium of 1–2-day-old mice in a class II type A2 bio safety cabinet [41]. All the litters of one female were inoculated with the same virus dose. A second replicate of mouse brain inoculations was done with the three virus dilutions but with different batches of litters. A total of 22 suckling mice were used in the first replicate and 24 suckling mice in the second replicate with 6 negative controls for each replicate. Un-infected suckling mice of the same age were used as the negative control group. The virus dilutions of the neat virus, 10−2 and 10−4 used in the experimental infection were quantified by plaque assay as follows: - 5.0x106, 2.7x104 and 1x103 PFU/ml respectively. All animal welfare considerations were taken to minimize suffering or distress. Mice were fed adlibitum. All mice were observed twice daily until humane endpoint or the end of the 21-day monitoring period. Specific criteria (humane endpoint) included immobility or paralysis [42]. Any moribund mice were separated, euthanized by cervical dislocation and preserved at -80°C immediately. Brain samples were harvested and homogenized in 1 ml of cell culture media and a plaque assay test was done to confirm virus infection in the mice.

Plaque reduction neutralization test

The serological assay was done on 324 human sera. The serum samples were heat inactivated at 56°C for 30 minutes and ten -fold dilutions from 1:20 to 1:320 were tested for neutralizing antibodies by a 90% plaque reduction neutralization test (PRNT90) in Vero cells. The virus was diluted to a standard concentration that gave at least 50 plaques. The serum dilutions were mixed with the standard concentration of the diluted virus and incubated for 1 hour at 37°C. The virus–antibody mixture was inoculated on confluent Vero cells and incubated for 1 hour for virus adsorption. After the adsorption, 2.5% methylcellulose 4000 CV (Sigma) mixed with 2X MEM, was added into the wells [32]. At day 6 post-infection, the plaques were fixed using 3.7% formaldehyde (Sigma) and stained with 0.5% crystal violet (Sigma) in absolute ethanol. Serum samples were considered positive by PRNT 90 when serum dilution of 1:20 or greater reduced the viral formation of plaques by at least 90% [43].

Data management

All data was entered into an excel database. The sero-prevalence data was imported into Stata version 17.0 for analysis (Stata Corp, College Station, TX). Proportions positive for virus were compared with socio-demographic characteristics using Chi-square test. All tests were performed at 5% significance level.

Results

Tick abundance and virus characterization

A total of 2342 ticks were collected and pooled to 409 pools representing 9 species after identification. The most abundant species identified was Hyalomma marginatum (40%, 162/409), followed by Amblyomma gemma (26%, 105/409), Rhipicephalus pulchellus (22.4%, 92/409) and Hyalomma truncatum (9%, 38/409). Other species identified included Rhipicephalus appendiculatus, Hyalomma dromedarii, Amblyomma variegatum, Hyalomma albiparmatum and Boophilus spp. Ticks were predominantly collected from camels (73.1%, 299/409) and cattle (26.2%, 107/409). An isolate from a homogenate of A. gemma tick species, induced cytopathic effects between 3–7 days post-infection. The calculated virus pooled minimum infection rate for ticks at this site was 0.04. The isolate was negative by RT-PCR for flaviviruses, orthobunyaviruses and alphaviruses. It was also negative for Dhori, Thogoto, Dugbe and CCHFV tick-borne viruses. Primer sequences utilized for screening viruses in this study are provided (S1 Table).

Next generation sequencing

Full genome sequences for the virus indicated that the virus was related to Guertu virus with percent nucleotide identities of approximately 80.42% in the L segment, 76.54% in the M segment and 81.09% in the S segment. The genome architecture was a 3-segmented single stranded RNA and total size of 11847 bp with nucleotides lengths of 6403, 3332 and 1752 in the Large (L), Medium (M) and S (Small) segments respectively. The amino acid identity scores for the different genes encoded by the virus were 93.33% for RdRp, 87.36% in the glycoprotein, 83.86% for the nonstructural protein and 92.24% for the nucleocapsid gene. Phylogenetic analysis placed the isolated virus in the same, but unique cluster with Guertu virus, which further clusters in a similar clade with Dabie bandavirus (SFTSV). This observation was consistent across all the four different genes of the virus (Fig 2).

10.1371/journal.pone.0310862.g002 Fig 2 Phylogenetic analysis of viruses in the genus Bandavirus.

The phylogenies were inferred based on RdRp sequences (A), Glycoprotein (B), Nonstructural protein (C) and Nucleoprotein sequences (D). The virus isolated in the study is highlighted in red.

Prevalence of virus in ticks, cell growth tropism and pathogenicity in mice

The forward and reverse primers with an expected size of 560 bp were designed from the L segment of the virus isolate. The forward- CAAGGCTGAGGATTTGGTATCT and reverse –CTGACTGGGCCCTTTCTATTT sequences for this virus were used to screen more ticks from the region. Nevertheless, the virus was not detected in the additional ticks that were tested. However, in-vitro growth analysis showed that Vero E6, Vero CCL-81 and Vero Biken cells were susceptible to this virus. Peak titres of 1.07x106 PFU/ml were reported in Vero Biken at 72 hours, 7.4x105 PFU/ml at 48 hours for Vero CCL-81 and 3.4x105 PFU/ml at 48 hours for Vero E6 cells. In contrast, virus titres in C636 cells declined after inoculation from 2x104 PFU/ml to 1.3x103 PFU/ml over the 7 days (Fig 3). On the other hand, all the suckling mice (15/15) infected with the undiluted virus were euthanized within 6–9 days post-infection. The mice exhibited signs of sickness including being moribund, difficulty in breathing, decreased growth, loose skin and uncoordinated movement. Two of the mice were found cannibalized by the dam on day 7, probably due to onset of disease. Of the mice infected with 10−2 virus dilution, (10/14) were euthanized between 8–10 days post infection and two were cannibalized by the dam on day 8 and day 13. Two of the mice in the first group survived 21 days post-infection while two in the second replicate survived to day 13 and were euthanized accordingly. However, none of the suckling mice (7/7) infected with the 10−4 virus dilution in the first replicate died and were euthanized on day 21. Between 8–10 days post-infection, the mice appeared to be inactive and sickly with ruffled fur but seemed to recover after day 11. In the second replicate, the suckling mice (6/6) infected with the 10−4 virus dilution, were cannibalized by the dam between days 1–3 post-infections (Fig 4). Mouse brain samples that were harvested were quantified by plaques and titres ranged from 1.1 x106 PFU/ml from mice brains inoculated with neat virus to as low as 1x104 PFU/ml for mice brains inoculated with10-2 diluted virus.

10.1371/journal.pone.0310862.g003 Fig 3 One-step growth curves of Kinna virus in Vero E6, Vero CCL-81 and C636 at MOI of 1, supernants were harvested at the indicated time points.

10.1371/journal.pone.0310862.g004 Fig 4 Survival curves of 1–2 day old Swiss Albino suckling mice inoculated intracerebrally with neat, 10−2 and 10−4 virus dilutions.

Sero-prevalence in humans

The plaque reduction neutralization test was carried out on 324 human samples. Participants were drawn from Garbatula (n = 158) and Merti (n = 166) sub-counties in Isiolo and their age varied from 14–90 years. Antibodies against the virus were detected in 125 (38.6%, 95% CI 33.3–44.1%) of the samples tested. The PRNT90 titres ranged from 125 for the virus at 1:20 dilution, 25 (1:40), 17(1:80), 10(1:160) and 3 (1:320). Notably, all the neutralizing titres at 1:320 were detected in serum samples from women aged 25, 60 and 70 years, the former two being farmers and the latter a housewife. The sero-prevalence of the virus was significantly higher in Garbatula (51.9%) than in Merti (25.9%; p<0.001). Most of the sero-positive samples were from people who had resided in the villages for most of their lives. The sero-positivity was significantly higher in those who had contact with cattle (p = 0.011) (Table 1). The sero-positivity also increased with age (Table 2) with a majority of those positive at dilutions 1:80 or higher being in the 55–90 years age bracket.

10.1371/journal.pone.0310862.t001 Table 1 Virus prevalence by socio-demographic characteristics.

Characteristic	Number of participants	Number positive	% positive (95% CI)	Chi square p-value	
Overall	324	125	38.6 (33.3–44.1)		
Sub county				<0.001	
 Garbatula	158	82	51.9 (43.8–59.9)		
 Merti	166	43	25.9 (19.4–33.3)		
Village				<0.001	
 Garfasa	68	40	58.8 (46.2–70.6)		
 Kinna	90	42	46.7 (36.1–57.5)		
 Bulesa	30	12	40.0 (22.7–59.4)		
 Dadachabasa	74	20	27.0 (17.4–38.6)		
 Korbesa	62	11	17.7 (9.2–29.5)		
Sex				0.337	
 Female	210	77	36.7 (30.1–43.6)		
 Male	114	48	42.1 (32.9–51.7)		
Age group in years				0.313	
 14–24	39	14	35.9 (21.2–52.8)		
 25–34	68	22	32.4 (21.5–44.8)		
 35–44	48	16	33.3 (20.4–48.4)		
 45–54	55	20	36.4 (23.8–50.4)		
 55–64	42	17	40.5 (25.6–56.7)		
 65–90	72	36	50.0 (38.0–62.0)		
Occupation				0.552	
 Farmer	201	83	41.3 (34.4–48.4)		
 Herdsman	95	31	32.6 (23.4–43.0)		
 Housewife	16	6	37.5 (15.2–64.6)		
 Other	12	5	41.7 (15.2–72.3)		
Contact with chicken				0.070	
 No	187	80	42.8 (35.6–50.2)		
 Yes	137	45	32.8 (25.1–41.4)		
Contact with goats				0.807	
 No	46	17	37.0 (23.2–52.5)		
 Yes	278	108	38.8 (33.1–44.9)		
Contact with cows				0.011	
 No	105	51	48.6 (38.7–58.5)		
 Yes	219	74	33.8 (27.6–40.5)		
Contact with donkeys				0.964	
 No	251	97	38.6 (32.6–45.0)		
 Yes	73	28	38.4 (27.2–50.5)		
Contact with camels				0.851	
 No	321	123	38.6 (33.3–44.2)		
 Yes	3	1	33.3 (1.0–90.6)		
Had previous severe illness with blood symptoms				0.315	
 No	321	123	38.3 (33–43.9)		
 Yes	3	2	66.7 (9.4–99.2)		

10.1371/journal.pone.0310862.t002 Table 2 Number of samples sero-positive for virus at different dilutions and ages.

PRNT result	Age in years	
14–24	25–34	35–44	45–54	55–64	65–90	Total	
Negative	25	46	32	35	25	36	199	
1:20	14	22	16	20	17	36	125	
1:40	0	4	0	3	6	12	25	
1:80	0	3	0	2	4	8	17	
1:160	0	2	0	0	2	6	10	
1:320	0	1	0	0	1	1	3	

Discussion

We report the isolation of a virus in the family Phenuiviridae and genus Bandavirus, tentatively named Kinna virus that is closely related to Guertu virus from a pool of A. gemma ticks from Isiolo County. The ICTV has various criteria for the classification of virus species and this differs depending on the virus group but includes data on genomic, biological and antigenic properties among other information [44]. The species and genus demarcation criteria for Bandaviruses requires novel species to have less than 95% sequence identity in the RdRp amino acid sequence [45]. Furthermore, based on revisions by Fauquet and Stanley, (2005) [46], tick-borne virus contigs showing greater than 10% difference were considered putative novel species while those with less than 10% difference were identified as strains of known viruses [47]. Since the virus isolate had a 93.3% RdRp amino acid sequence identity to Guertu virus while the contigs showed nucleotide similarity (<90%) to Guertu virus, we postulate that this could be a putative novel species.

A high sero-prevalence was reported in the human samples tested against this virus suggesting previous exposure and infection to this virus. Similar to SFTSV, age was a risk factor as those >55years of age reported higher antibodies titres [48]. Significant risk factors included sub-county of residence and contact with cattle, with farmers and herdsmen being more predisposed to infection. Herdsmen in particular were also shown to be greatly exposed to Guertu virus than farmers in the Xinjiang province, where the virus was first isolated [23]. Although, the sero-prevalence in our study was not significantly different in males and females, the highest dilution that neutralized this virus was reported in samples collected from women. It is speculated that women spend more time in caring for sick animals than their male counterparts, increasing the risk of exposure to diseases [49]. We also attributed exposure to high-risk activities such as milking, slaughtering, skinning of dead animals or handling aborting fetuses. Exposure may also have occurred inadvertently from the bite of an infected tick as the domestic animals were infested. Moreover, there could be a possible zoonotic risk associated with this virus due to the fact that the tick vectors reported in this study also prefer wild hosts [50]. The probability that this virus may have originated from wild animals is high since the villages in this study area are close to several game reserves that formed zones of human-livestock wildlife convergence.

Mice infected intracerebrally with a high dose of the novel virus did not survive. However, survival rates were high in mice infected with the low dilution of virus suggesting that a lower infectious dose might not be detrimental but may aid in maintaining transmission and thus these animals could act as reservoirs of infection. The dose-dependent effect was demonstrated in a study of mice infected with SFTSV that indicated the severity of infection was a factor of the viral load and that a low amount of virus could result in asymptomatic infection [51]. The mice in this study showed signs of clinical disease to Kinna virus and this suggests that the virus could cause disease in humans. The clinical presentation of Guertu virus in humans is not well documented but is believed to be similar to that of Dabie bandavirus [23]. We hypothesize that the clinical presentation of Kinna virus could be similar to that of Guertu virus as the two viruses share many characteristics including tick vector, ability to infect different cell lines and pathogenicity in mice. Since the symptoms of the related virus, Dabie bandavirus are known, we recommend that clinicians in this region look out for this clinical syndrome.

Previous studies have reported Isiolo county to be a high-risk area for zoonotic diseases such as Rift Valley fever virus, yellow fever virus and Brucella spp. [52, 53]. These diseases share the same non-specific clinical syndrome with many tick-borne viruses which can lead to misdiagnosis. Thus, the identification of this novel virus from ticks in this county is evidence of the existence of uncharacterized viruses at the human-livestock convergence zones which may be responsible for the burden of undiagnosed febrile illness reported during outbreaks. Our findings, thus underscore the need for increased surveillance to understand the pathology of this new virus, susceptible hosts and reservoirs, and development of appropriate point of care diagnostic tools.

This research is subject to some limitations. The novel virus was isolated from one pool of A. gemma ticks in this study. This is not unusual in vector studies as virus detection rates may be very low in the absence of outbreaks or during inter-epidemic periods thus the need to test many samples in order to increase chances of virus isolation [54]. Although, the tick samples tested were not collected from the exact locations as the human samples, the pastoralist system in this region, ensures the movement of animals and by extension the tick vectors which may facilitate transmission of infectious pathogens to human populations. The serological data reported indicates that the novel virus is circulating in this region, nevertheless, no other Bandaviruses have been reported locally thus cross-neutralization data could not be generated. Additionally, the participants of the sero-survey were healthy individuals, therefore symptoms of the infection could not be determined and thus further studies to identify the clinical manifestation associated with this novel virus may need to be undertaken. Lastly, animal hosts were not sampled due to logistical limitations. The study however, recommends incorporation in future studies to generate evidence of exposure or active infection and thus understand the implication of this virus on animal health.

Conclusions

We report the isolation of a novel Bandavirus from Isiolo County with a potential to cause disease in human and animal populations. A one-health approach should be considered in the evaluation of the public health significance of this virus and for development of appropriate control strategies. Detection of this new strain also points to the need for continuous monitoring of vector and human populations in high-risk ecosystems in order to provide an update on pathogen diversity.

Supporting information

S1 Table A list of conventional PCR primers used in this study.

(DOCX)

I thank Reuben Lugalia, John Gachoya, Francis Mulwa and Dunstone Beti for their participation in the collection and identification of the ticks used in this study. We are also grateful to Samuel Owaka and Bryson Kimemia for the graphics in this publication.

10.1371/journal.pone.0310862.r001
Decision Letter 0
Oluwayelu Daniel Oladimeji Academic Editor
© 2024 Daniel Oladimeji Oluwayelu
2024
Daniel Oladimeji Oluwayelu
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
24 Jun 2024

PONE-D-24-20220

Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya

PLOS ONE

Dear Dr.  Koka,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 08 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Daniel Oladimeji Oluwayelu, D.V.M., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. When completing the data availability statement of the submission form, you indicated that you will make your data available on acceptance. We strongly recommend all authors decide on a data sharing plan before acceptance, as the process can be lengthy and hold up publication timelines. Please note that, though access restrictions are acceptable now, your entire data will need to be made freely accessible if your manuscript is accepted for publication. This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If you are unable to adhere to our open data policy, please kindly revise your statement to explain your reasoning and we will seek the editor's input on an exemption. Please be assured that, once you have provided your new statement, the assessment of your exemption will not hold up the peer review process.

4. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well. 

5. We note that Figure 1 in your submission contain map/satellite images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (b) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.  

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Review of ‘Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya’

The study looked at the detection of a novel virus belonging to the Bandavirus genus in Amblyomma ticks and humans in Kenya. The study is interesting. The study however does not include its limitations.

I noted following limitations in the study. Although a large number of ticks were tested, only in one pool the novel virus was detected, whereas the in human population more than 38% has serological evidence of the virus. I found that the cut-off titre for seropositives was quite low. According to me, I would have only considered titres from 1:160. Little is also discussed about cross-reactivity with other viruses and false positives. I do not know what is the sensitivity and specificity of the plague reduction virus neutralization test. This information should have been included in the methods and limitations should have been discussed at the end of the manuscript. In addition, the study would have had more power if the samples from ticks came animals that were owned/herded by the humans that were samples. As far as I understood the samples were from same counties but tick and human samples were not linked to same location. In addition, it would have provided more insight if also animals were sampled. This should have been included as limitations of the study. Suggestion are made that the novel virus can cause the same symptoms of humans as the related Guertu virus but yet it seems although evidence of past infection was find in a high number of humans but yet those people were healthy at the time of sample. Although the sample size is small, I find it odd that the conclusion was made that the virus could cause serious disease in humans yet there was no evidence because people were health although had been infected previously based on serological evidence. The route of exposure is also not well understood yet. Are humans exposed through adult Amblyomma ticks from accidental close contact with cows or are do they acquire infection from the immature stages directly from environment. For example African tick bite fever is transmitted more likely from the immature stages of Amblyomma ticks.

I think above issues and limitations could be added and discussed in the paper.

For the remainder, I think this is a very interesting paper.

Reviewer #2: This study isolates and characterizes a type of novel Bandavirus. Experiments to determine its pathogenicity as well as prevalence in humans were performed. The virus could have potentially important health consequences in humans. Authors perform rigorous experimental methods and conclude that this virus is closely related to Guertu virus within the genus. This is an important paper that needs to be published. I have added minor comments in a marked up text.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment Submitted filename: PONE-D-24-20220_SBM.pdf

10.1371/journal.pone.0310862.r002
Author response to Decision Letter 0
Submission Version1
24 Jul 2024

PONE-D -24-20220

Dear Editor,

Thank you for the review comments. Please find below responses to the reviewers and editors comments.

Regards,

Hellen Koka

RESPONSES TO REVIEWER #1 COMMENTS

1. Review of ‘Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya’. The study looked at the detection of a novel virus belonging to the Bandavirus genus in Amblyomma ticks and humans in Kenya. The study is interesting. The study however does not include its limitations. I noted following limitations in the study. Although a large number of ticks were tested, only in one pool the novel virus was detected, whereas the in human population more than 38% has serological evidence of the virus.

Response: That we found one pool testing positive for the virus at the time, for us was exciting. The number of detections of a virus often depends on its level of circulation at the point of sampling, which is influenced by factors that are not known to us at this point in time, Line 363-366. Detection of one positive pool for us is a very important finding and evidence of circulation of this virus in our region. Serologic evidence of circulation represents possible cumulative exposure of the population over time, an important additional finding. This finding opens opportunity for further in-depth surveillance when funding is available. We also tested an additional pool of 200 tick from this region by PCR but did not detect the novel virus again, Line 184 and Line 267.

2. I found that the cut-off titre for sero-positives was quite low. According to me, I would have only considered titres from 1:160. Little is also discussed about cross-reactivity with other viruses and false positives. I do not know what is the sensitivity and specificity of the plaque reduction virus neutralization test. This information should have been included in the methods and limitations should have been discussed at the end of the manuscript.

Response: The cut-off titre for sero-positivity of this novel virus was retained at 1:20 and since the samples were not tested against other viruses in the Bandavirus genus, no cross-reactivity was reported. There are no known circulating Bandaviruses locally that we could consider for cross-neutralization, Line367-368. The sensitivity and specificity are above 70% and is the reason plaque reduction test is considered a gold standard.

3. In addition, the study would have had more power if the samples from ticks came from animals that were owned/herded by the humans that were samples. As far as I understood the samples were from same counties but tick and human samples were not linked to same location.

Response: This suggested sampling plan would have been ideal. The limitation is addressed, Line 366-369. It was after the virus was detected, isolated and characterized that the serologic analysis was considered. For this reason, the human samples were not linked directly to the exact location/herd where the tick samples had been collected. However, some of the human samples were collected from the general locality where the ticks were collected, Fig 1, Line 118 and Line 124. Further, the target communities are largely nomadic and often move through wide areas in search of pasture and water creating potential for movement of animals and ticks over a wider space. This pastoral system thus increases the potential for pathogen transmission in the region. This is also supported by the fact that; the human samples had been collected along the animal migratory routes used by the pastoralists in this region.

4. In addition, it would have provided more insight if also animals were sampled. This should have been included as limitations of the study.

Response: Due to the scope of the research and level of funding for the work, no animals were sampled, and this has been captured as a limitation of the study. This initial funding opens opportunity for seeking more funding for such additional studies as suggested by the reviewers, Line 374-377.

5. Suggestion are made that the novel virus can cause the same symptoms of humans as the related Guertu virus but yet it seems although evidence of past infection was found in a high number of humans but yet those people were healthy at the time of sample.

Response: The symptoms caused by this virus are not known. There is need for further studies to determine symptoms associated with acute infection of this virus. At this time, we can only speculate that this novel virus may cause similar course of infection as Guertu or Dabie bandavirus (SFTSV), Line 371-374. The suggestion has been made to promote awareness among clinicians in our region to enhance the index of suspicion as they review patients, Line 352-353.

6. Although the sample size is small, I find it odd that the conclusion was made that the virus could cause serious disease in humans yet there was no evidence because people were healthy although had been infected previously based on serological evidence.

Response: Please refer to the response in point 5. Although, the symptoms are not known, the virus was also shown to infect mice and thus we speculate that the virus may have potential to cause disease in humans, Line 346-348.

7. The route of exposure is also not well understood yet. Are humans exposed through adult Amblyomma ticks from accidental close contact with cows or are do they acquire infection from the immature stages directly from environment. For example, African tick bite fever is transmitted more likely from the immature stages of Amblyomma ticks.

I think above issues and limitations could be added and discussed in the paper.

Response: The route of exposure is not well understood, it could be through the bite of the tick or through handling of infectious materials from infected animal, Line 334-338.

8. For the remainder, I think this is a very interesting paper.

Response: We appreciate the review comments and the concerns raised which we have used to improve the manuscript. Thank you.

RESPONSE TO REVIEWER #2 COMMENTS

1. This study isolates and characterizes a type of novel Bandavirus. Experiments to determine its pathogenicity as well as prevalence in humans were performed. The virus could have potentially important health consequences in humans. Authors perform rigorous experimental methods and conclude that this virus is closely related to Guertu virus within the genus. This is an important paper that needs to be published.

I have added minor comments in a marked-up text.

Response: We thank reviewer number 2 for the specific comments on the document that were very valuable in improving the manuscript. We have done our best to respond to all of them. Thank you.

RESPONSES TO EDITORS COMMENTS

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: These guidelines have been met

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

Response: Additional information has been provided for experiments involving animals. Line 214-217

3. When completing the data availability statement of the submission form, you indicated that you will make your data available on acceptance. We strongly recommend all authors decide on a data sharing plan before acceptance, as the process can be lengthy and hold up publication timelines. Please note that, though access restrictions are acceptable now, your entire data will need to be made freely accessible if your manuscript is accepted for publication. This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If you are unable to adhere to our open data policy, please kindly revise your statement to explain your reasoning and we will seek the editor's input on an exemption. Please be assured that, once you have provided your new statement, the assessment of your exemption will not hold up the peer review process

Response: Data sharing plan revised

4. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

Response: Ethics statement was added, Line 131-133.

5. We note that Figure 1 in your submission contain map/satellite images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

Response: The map was created from the ARC GIS software by Samuel Owaka and details are provided under the figure caption for Fig 1.

6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction

Response: The references were formatted and checked for completeness. One reference was added, Line 482.

Attachment Submitted filename: Responses to reviewers comments Plos one July 2024 .docx

10.1371/journal.pone.0310862.r003
Decision Letter 1
Oluwayelu Daniel Oladimeji Academic Editor
© 2024 Daniel Oladimeji Oluwayelu
2024
Daniel Oladimeji Oluwayelu
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
19 Aug 2024

PONE-D-24-20220R1

Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, KenyaPLOS ONE

Dear Dr. Koka,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Oct 03 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Daniel Oladimeji Oluwayelu, D.V.M., M.Sc., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Authors should address the issue raised by Reviewer #1 in Section 6. Review Comments to the Author (below).

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thanks for addressing the comments I had diligently and adding a limitations section.

I have just one small comment re: line 305-307, I recommend to use seroprevalence/seropositivity instead of prevalence because the humans were tested by serology.

Thanks for this interesting study. I accepted the revised manuscript for publication.

Reviewer #3: I reviewed the revisions and noted that all of them have been addressed satisfactorily. The paper presents novel information required to be published.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: Yes: Samoel Ashimosi Khamadi

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0310862.r004
Author response to Decision Letter 1
Submission Version2
30 Aug 2024

Editor in Chief

PLOS One

26th August 2024.

Thank you for the review of the manuscript entitled: “Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya.” The issues raised by the editor has been addressed and below is the responses to the comments.

RESPONSES TO EDITORS COMMENTS

1. We note that Figure 1 in your submission contain map/satellite images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (b) remove the figures from your submission:

Response: Thank you for this comment. The maps were not copyrighted. I have edited the caption to Figure 1 as follows;

These maps were generated courtesy of Samuel Owaka using ArcGIS Version 10.2.2 (http://desktop.arcgis.com/en/arcmap) advanced license.

Attachment Submitted filename: Responses to reviewers comments Plos one 30 Aug 2024 .docx

10.1371/journal.pone.0310862.r005
Decision Letter 2
Oluwayelu Daniel Oladimeji Academic Editor
© 2024 Daniel Oladimeji Oluwayelu
2024
Daniel Oladimeji Oluwayelu
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
4 Sep 2024

PONE-D-24-20220R2

Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya

PLOS ONE

Dear Dr. Koka,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR: Kindly address the issue raised by Reviewer 1 concerning the use of the word "prevalence" on Lines 305 - 307 of the revised manuscript: "I recommend to use seroprevalence/seropositivity instead of prevalence because the humans were tested by serology". I recommend that you replace "prevalence" with "seroprevalence" on Line 305 and in the title of Table 1.

 ==============================

Please submit your revised manuscript by Oct 19 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Daniel Oladimeji Oluwayelu, D.V.M., M.Sc., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0310862.r006
Author response to Decision Letter 2
Submission Version3
5 Sep 2024

5th September 2024

Editor in Chief

PLOS One

Thank you for the review of the manuscript entitled: “Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya.” The issues raised by the editor have been addressed and below is the responses to comments.

RESPONSES TO REVIEWER #1 COMMENTS

1. Thanks for addressing the comments I had diligently and adding a limitations section. I have just one small comment re: line 305-307, I recommend to use sero-prevalence/sero-positivity instead of prevalence because the humans were tested by serology.

Thanks for this interesting study. I accepted the revised manuscript for publication.

Response: The revision of the word prevalence to sero-prevalence / sero-positivity was done, Line 305-307. We appreciate your review comments as they greatly improved this manuscript. Thank you.

RESPONSES TO EDITORS COMMENTS

1. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript.

Response: The references were checked for completeness

Attachment Submitted filename: Responses to reviewers comments Plos one 5 Sep 2024 (1).docx

10.1371/journal.pone.0310862.r007
Decision Letter 3
Oluwayelu Daniel Oladimeji Academic Editor
© 2024 Daniel Oladimeji Oluwayelu
2024
Daniel Oladimeji Oluwayelu
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version3
8 Sep 2024

Detection and prevalence of a novel Bandavirus related to Guertu virus in Amblyomma gemma ticks and human populations in Isiolo County, Kenya

PONE-D-24-20220R3

Dear Dr. Hellen Koka,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Daniel Oladimeji Oluwayelu, D.V.M., M.Sc., Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

10.1371/journal.pone.0310862.r008
Acceptance letter
Oluwayelu Daniel Oladimeji Academic Editor
© 2024 Daniel Oladimeji Oluwayelu
2024
Daniel Oladimeji Oluwayelu
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
12 Sep 2024

PONE-D-24-20220R3

PLOS ONE

Dear Dr. Koka,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Daniel Oladimeji Oluwayelu

Academic Editor

PLOS ONE
==== Refs
References

1 Shah T , Li Q , Wang B , Baloch Z , Xia X . Geographical distribution and pathogenesis of ticks and tick-borne viral diseases. Front Microbiol. 2023;14 :1185829. Epub 2023/06/09. doi: 10.3389/fmicb.2023.1185829 .37293222
2 Kazimírová M , Thangamani S , Bartíková P , Hermance M , Holíková V , Štibrániová I , et al . Tick-borne viruses and biological processes at the tick-host-virus interface. Frontiers in Cellular and Infection Microbiology. 2017;7 (339 ). doi: 10.3389/fcimb.2017.00339 28798904
3 Bartíková P , Holíková V , Kazimírová M , Štibrániová I . Tick-borne viruses. Acta virologica. 2017;61 (4 ):413–27. Epub 2017/12/01. doi: 10.4149/av_2017_403 .29186958
4 Mansfield KL , Jizhou L , Phipps LP , Johnson N . Emerging Tick-borne viruses in the twenty-first century. Frontiers in Cellular and Infection Microbiology. 2017;7 :298-. doi: 10.3389/fcimb.2017.00298 .28744449
5 Zhou H , Xu L , Shi W . The human-infection potential of emerging tick-borne viruses is a global public health concern. Nature Reviews Microbiology. 2023;21 (4 ):215–7. doi: 10.1038/s41579-022-00845-3 36526809
6 Shi J , Hu Z , Deng F , Shen S . Tick-borne viruses. Virologica Sinica. 2018;33 (1 ):21–43. doi: 10.1007/s12250-018-0019-0 .29536246
7 Kuhn JH, Adkins S, Agwanda BR, Al Kubrusli R, Alkhovsky SV, Amarasinghe GK, et al. 2021 Taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. 2021.
8 Zhou CM , Yu XJ . Unraveling the underlying interaction mechanism between Dabie bandavirus and innate immune response. Frontiers in immunology. 2021;12 :676861. Epub 2021/06/15. doi: 10.3389/fimmu.2021.676861 .34122440
9 Yu X-J , Liang M-F , Zhang S-Y , Liu Y , Li J-D , Sun Y-L , et al . Fever with thrombocytopenia associated with a novel Bunyavirus in China. New England Journal of Medicine. 2011;364 (16 ):1523–32. doi: 10.1056/NEJMoa1010095 .21410387
10 Saito T , Fukushima K , Umeki K , Nakajima K . Severe fever with thrombocytopenia syndrome in Japan and public health communication. Emerg Infect Dis. 2015;21 (3 ):487–9. Epub 2015/02/20. doi: 10.3201/eid2103.140831 .25695132
11 Kim KH , Yi J , Kim G , Choi SJ , Jun KI , Kim NH , et al . Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg Infect Dis. 2013;19 (11 ):1892–4. Epub 2013/11/12. doi: 10.3201/eid1911.130792 .24206586
12 Tran XC , Yun Y , Van An L , Kim SH , Thao NTP , Man PKC , et al . Endemic severe fever with thrombocytopenia syndrome, Vietnam. Emerg Infect Dis. 2019;25 (5 ):1029–31. Epub 2019/04/20. doi: 10.3201/eid2505.181463 .31002059
13 Liu J-W , Zhao L , Luo L-M , Liu M-M , Sun Y , Su X , et al . Molecular evolution and spatial transmission of severe fever with thrombocytopenia syndrome virus based on complete genome sequences. PLoS One. 2016;11 (3 ):e0151677. doi: 10.1371/journal.pone.0151677 26999664
14 Casel MA , Park SJ , Choi YK . Severe fever with thrombocytopenia syndrome virus: emerging novel phlebovirus and their control strategy. Experimental & Molecular Medicine. 2021;53 (5 ):713–22. doi: 10.1038/s12276-021-00610-1 33953322
15 Fang X , Hu J , Peng Z , Dai Q , Liu W , Liang S , et al . Epidemiological and clinical characteristics of severe fever with thrombocytopenia syndrome bunyavirus human-to-human transmission. PLOS Neglected Tropical Diseases. 2021;15 (4 ):e0009037. doi: 10.1371/journal.pntd.0009037 33930022
16 Ye C , Qi R . Risk factors for person-to-person transmission of severe fever with thrombocytopenia syndrome. Infection Control & Hospital Epidemiology. 2020;42 (5 ):582–5. Epub 11/09. doi: 10.1017/ice.2020.1258 33161921
17 Zhuang L , Sun Y , Cui XM , Tang F , Hu JG , Wang LY , et al . Transmission of Severe fever with thrombocytopenia syndrome virus by Haemaphysalis longicornis ticks, China. Emerg Infect Dis. 2018;24 (5 ):868–71. Epub 2018/04/18. doi: 10.3201/eid2405.151435 .29664718
18 Chen C , Li P , Li K-F , Wang H-L , Dai Y-X , Cheng X , et al . Animals as amplification hosts in the spread of severe fever with thrombocytopenia syndrome virus: A systematic review and meta-analysis. International Journal of Infectious Diseases. 2019;79 :77–84. doi: 10.1016/j.ijid.2018.11.017 30500443
19 Niu G , Li J , Liang M , Jiang X , Jiang M , Yin H , et al . Severe fever with thrombocytopenia syndrome virus among domesticated animals, China. Emerg Infect Dis. 2013;19 (5 ):756–63. Epub 2013/05/08. doi: 10.3201/eid1905.120245 .23648209
20 Wang S , Li J , Niu G , Wang X , Ding S , Jiang X , et al . SFTS virus in ticks in an endemic area of China. The American journal of tropical medicine and hygiene. 2015;92 (4 ):684–9. Epub 2015/02/26. doi: 10.4269/ajtmh.14-0008 .25711611
21 Esguerra EM . Heartland Virus: A new virus discovered in Missouri. Missouri medicine. 2016;113 (4 ):256–7. Epub 2016/07/01. doi: 10.1056/NEJMMoa1203378 .30228464
22 Yusufu M , Abula A , Jiang B , Zhumabai J , Deng F , Li Y , et al . Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus. PLoS One. 2022;17 (7 ):e0271878. doi: 10.1371/journal.pone.0271878 35881569
23 Shen S , Duan X , Wang B , Zhu L , Zhang Y , Zhang J , et al . A novel tick-borne phlebovirus, closely related to severe fever with thrombocytopenia syndrome virus and Heartland virus, is a potential pathogen. Emerging Microbes & Infections. 2018;7 (1 ):1–14. doi: 10.1038/s41426-018-0093-2 29323102
24 Matsuno K , Weisend C , Travassos da Rosa APA , Anzick SL , Dahlstrom E , Porcella SF , et al . Characterization of the Bhanja serogroup viruses (Bunyaviridae): A novel species of the genus Phlebovirus and its relationship with other emerging tick-borne phleboviruses. Journal of virology. 2013;87 (7 ):3719–28. Epub 01/16. doi: 10.1128/JVI.02845-12 .23325688
25 Zakham F , Albalawi AE , Alanazi AD , Truong Nguyen P , Alouffi AS , Alaoui A , et al . Viral RNA Metagenomics of Hyalomma ticks collected from dromedary camels in Makkah Province, Saudi Arabia. Viruses. 2021;13 (7 ):1396. doi: 10.3390/v13071396 34372602
26 Zohaib A , Zhang J , Saqib M , Athar MA , Hussain MH , Chen J , et al . Serologic evidence of severe fever with thrombocytopenia syndrome virus and related viruses in Pakistan. Emerg Infect Dis. 2020;26 (7 ):1513–6. Epub 2020/06/23. doi: 10.3201/eid2607.190611 .32568060
27 Ergunay K , Mutinda M , Bourke B , Justi SA , Caicedo-Quiroga L , Kamau J , et al . Metagenomic investigation of ticks from Kenyan wildlife reveals diverse microbial pathogens and new country pathogen records. Frontiers in Microbiology. 2022;13 . doi: 10.3389/fmicb.2022.932224 35847110
28 Ogola EO , Kopp A , Bastos ADS , Slothouwer I , Marklewitz M , Omoga D , et al . Jingmen Tick virus in ticks from Kenya. Viruses. 2022;14 (5 ):1041. doi: 10.3390/v14051041 35632782
29 Mkutu K. Security dynamics in conservancies in Kenya:The case of Isiolo County: BICC Bonn International Centre for Conflict Studies; 2020 [updated 17 Jun 2020; cited 2023 03 Nov 2023]. 13]. https://www.bicc.de/uploads/tx_bicctools/BICC_Working_Paper_3_2020_01.pdf.
30 Karesh WB , Dobson A , Lloyd-Smith JO , Lubroth J , Dixon MA , Bennett M , et al . Ecology of zoonoses: natural and unnatural histories. The Lancet. 2012;380 (9857 ):1936–45. doi: 10.1016/S0140-6736(12)61678-X 23200502
31 Mati BM, Muchiri JM, Njenga K, de Vries FP, Merrey DJ. Assessing water availability under pastoral livestock systems in drought-prone Isiolo District, Kenya: IWMI; 2006.
32 Tigoi C , Sang R , Chepkorir E , Orindi B , Arum SO , Mulwa F , et al . High risk for human exposure to Rift Valley fever virus in communities living along livestock movement routes: A cross-sectional survey in Kenya. PLOS Neglected Tropical Diseases. 2020;14 (2 ):e0007979. doi: 10.1371/journal.pntd.0007979 32084127
33 Okello-Onen J, Hassan, SM, Essuman, S. Taxonomy of African ticks.: Icipe Science Press, Nairobi; 1999.
34 Matthysse J, Colbo, MH. The Ixodid ticks of Uganda together with species pertinent to Uganda because of their present known distribution. College Park, MD: Entomological Society of America; 1987.
35 Lwande OW , Lutomiah J , Obanda V , Gakuya F , Mutisya J , Mulwa F , et al . Isolation of tick and mosquito-borne arboviruses from ticks sampled from livestock and wild animal hosts in Ijara District, Kenya. Vector Borne Zoonotic Dis. 2013;13 (9 ):637–42. Epub 2013/06/29. doi: 10.1089/vbz.2012.1190 .23805790
36 Fracasso G , Grillini M GL , Gradoni F , Rold GD , Bertola M . Effective Methods of estimation of pathogen prevalence in pooled ticks. Pathogens (Basel, Switzerland). 2023;12 (4 ). Epub 2023/04/28. doi: 10.3390/pathogens12040557 .37111443
37 Ochieng C , Lutomiah J , Makio A , Koka H , Chepkorir E , Yalwala S , et al . Mosquito-borne arbovirus surveillance at selected sites in diverse ecological zones of Kenya; 2007–2012. Virol J. 2013;10 (1 ):140. Epub 2013/05/15. doi: 10.1186/1743-422X-10-140 .23663381
38 Sang R , Onyango C , Gachoya J , Mabinda E , Konongoi S , Ofula V , et al . Tick-borne arbovirus surveillance in market livestock, Nairobi, Kenya. Emerg Infect Dis. 2006;12 (7 ):1074–80. doi: 10.3201/eid1207.060253 .16836823
39 Clark JJ , Gilray J , Orton RJ , Baird M , Wilkie G , Filipe AdS , et al . Population genomics of louping ill virus provide new insights into the evolution of tick-borne flaviviruses. PLOS Neglected Tropical Diseases. 2020;14 (9 ):e0008133. doi: 10.1371/journal.pntd.0008133 32925939
40 Kumar S , Stecher G , Tamura K . MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution. 2016;33 (7 ):1870–4. doi: 10.1093/molbev/msw054 27004904
41 Mims CA . Intracerebral injections and the growth of viruses in the mouse brain. British journal of experimental pathology. 1960;41 (1 ):52–9. Epub 1960/02/01. .14422710
42 Lim SM , Koraka P , van Boheemen S , Roose JM , Jaarsma D , van de Vijver DA , et al . Characterization of the mouse neuroinvasiveness of selected European strains of West Nile virus. PLoS One. 2013;8 (9 ):e74575. Epub 2013/09/24. doi: 10.1371/journal.pone.0074575 .24058590
43 Gomes FA , Jansen AM , Machado RZ , Jesus Pena HF , Fumagalli MJ , Silva A , et al . Serological evidence of arboviruses and coccidia infecting horses in the Amazonian region of Brazil. PLoS One. 2019;14 (12 ):e0225895. doi: 10.1371/journal.pone.0225895 31830142
44 Fauquet CM . Taxonomy, classification and nomenclature of viruses. Encyclopedia of Virology. 1999:1730–56. doi: 10.1006/rwvi.1999.0277
45 ICTV-Reports. The ICTV report on virus classification and taxon nomenclature: Family Phenuiviridae, genus Bandavirus [cited 2024 3 Aprol 2024]. https://ictv.global/report/chapter/phenuiviridae/phenuiviridae/bandavirus.
46 Fauquet CM , Stanley J . Revising the way we conceive and name viruses below the species level: A review of geminivirus taxonomy calls for new standardized isolate descriptors. Archives of virology. 2005;150 (10 ):2151–79. doi: 10.1007/s00705-005-0583-0 16132185
47 Lin Y , Pascall DJ . Characterisation of putative novel tick viruses and zoonotic risk prediction. 2024;14 (1 ):e10814. doi: 10.1002/ece3.10814 .38259958
48 Park S-J , Kim Y-I , Park A , Kwon H-I , Kim E-H , Si Y-J , et al . Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis. Nature Microbiology. 2019;4 (3 ):438–46. doi: 10.1038/s41564-018-0317-1 30531978
49 Affognon H , Mburu P , Hassan OA , Kingori S , Ahlm C , Sang R , et al . Ethnic groups’ knowledge, attitude and practices and Rift Valley fever exposure in Isiolo County of Kenya. PLOS Neglected Tropical Diseases. 2017;11 (3 ):e0005405. doi: 10.1371/journal.pntd.0005405 28273071
50 Walker AR, Bouattour A, Camicas J-L, Estrada-Peña A, Horak IG, Latif AA, et al. Ticks of domestic animals in Africa: A guide to identification of species: Bioscience Reports, Edinburgh Scotland,U.K.; 2003.
51 Jin C , Liang M , Ning J , Gu W , Jiang H , Wu W , et al . Pathogenesis of emerging severe fever with thrombocytopenia syndrome virus in C57/BL6 mouse model. Proceedings of the National Academy of Sciences of the United States of America. 2012;109 (25 ):10053–8. Epub 2012/06/06. doi: 10.1073/pnas.1120246109 .22665769
52 WHO. Disease outbreak news; Yellow Fever—Kenya 25 March 2022. https://www.who.int/emergencies/disease-outbreak-news/item/yellow-fever-kenya.
53 Nyamota R , Maina J , Akoko J , Nthiwa D , Mwatondo A , Muturi M , et al . Seroprevalence of Brucella spp. and Rift Valley fever virus among slaughterhouse workers in Isiolo County, northern Kenya. PLoS Negl Trop Dis. 2023;17 (10 ):e0011677. Epub 2023/10/05. doi: 10.1371/journal.pntd.0011677 .37797043
54 Tchouassi DP , Marklewitz M , Chepkorir E , Zirkel F , Agha SB , Tigoi CC , et al . Sand fly–associated Phlebovirus with evidence of neutralizing antibodies in humans, Kenya. Emerg Infect Dis. 2019;25 (4 ):681. doi: 10.3201/eid2504.180750 30882303
