
==== Front
Orphanet J Rare Dis
Orphanet J Rare Dis
Orphanet Journal of Rare Diseases
1750-1172
BioMed Central London

39300538
3360
10.1186/s13023-024-03360-1
Research
Clinical and genetic characteristics of 100 consecutive patients with Birt-Hogg-Dubé syndrome in Eastern Chinese region
Hu Daiju 1
Wang Rui 12
Liu Jinli 3
Chen Xianmeng 14
Jiang Xianliang 5
Xiao Jun 6
Ryu Jay H. 7
http://orcid.org/0000-0002-3727-6049
Hu Xiaowen hu.xiaowen@ustc.edu.cn

14
1 Department of Pulmonary and Critical Care Medicine, Hefei, China
2 Department of Dermatology, Hefei, China
3 Center for Diagnosis and Management of Rare Diseases, Hefei, China
4 Department of Thoracic Surgery, Hefei, China
5 https://ror.org/04c4dkn09 grid.59053.3a 0000 0001 2167 9639 Department of Urology, Division of Life Sciences and Medicine, The First Affiliated Hospital of USTC, University of Science and Technology of China, Hefei, China
6 https://ror.org/037ejjy86 grid.443626.1 0000 0004 1798 4069 WanNan Medical College, Wuhu, China
7 https://ror.org/02qp3tb03 grid.66875.3a 0000 0004 0459 167X Division of Pulmonary and Critical Care Medicine, Mayo Clinic, Rochester, MN USA
19 9 2024
19 9 2024
2024
19 3483 4 2024
11 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Although an increasing number of patients with Birt-Hogg-Dubé syndrome (BHD) are being recognized in China, clinical and genetic characteristics are not well-defined. In addition, revised diagnostic criteria for the Chinese population was proposed in 2023, we aimed to explore their utility in clinical practice at a rare lung disease center.

Methods

We retrospectively analyzed the data of 100 consecutive patients with BHD diagnosed according to the revised Chinese BHD criteria, encountered at the First Affiliated Hospital of University of Science and Technology of China from Jan 2017 to June 2023.

Results

There were 100 patients (including 63 females) from 65 unrelated families in Eastern China, mostly Anhui Province. The common manifestations were pulmonary cysts (99%), pneumothorax (60%), and skin lesions (77%). Renal cancer and renal angiomyolipoma were detected in 5 patients each. 37% of patients had no family history of BHD. In total, 25 FLCN germline mutations were detected, including 6 novel mutations. In addition to hotspot mutation c.1285delC/dupC (17%), the most common mutations were c.1015 C > T (16%), c.1579_1580insA (14%), and exons 1–3 deletion (11%) in FLCN. Higher risk of pneumothorax was associated with exons 1–3 deletion mutation and c.1177-5_1177-3de1CTC compared to the hotspot mutation c.1285dupC (91% [95% CI: 0.31, 46.82, p = 0.015] and 67% [95% CI: 0.35, 71.9, p = 0.302] vs. 30%, respectively). The average delay in diagnosis was 7.6 years after initial symptoms. Chinese diagnostic criteria were mostly consistent with typical pulmonary presentations with supportive genetic evidence.

Conclusion

In the Eastern Chinese region, patients with BHD present most commonly with pulmonary cysts associated with pneumothorax and skin lesions. However, low incidence of renal cancer along with unexpected renal angiomyolipoma was observed. Genotypic spectrum differed from that reported from other global regions, and genotype association of pneumothorax warrants further research. The revised Chinese criteria for BHD seem more appropriate in diagnosing BHD in Chinese patients.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13023-024-03360-1.

Keywords

Birt-Hogg-Dubé syndrome
FLCN mutation
Diagnostic criteria
http://dx.doi.org/10.13039/501100019396 Anhui Province Key Laboratory of Medical Physics and Technology Grant No. 2021szdzk05 Hu Xiaowen http://dx.doi.org/10.13039/501100017668 Anhui Provincial Key Research and Development Plan Wan Health Dispatch (2022) No.7 Hu Xiaowen issue-copyright-statement© Institut National de la Santé et de la Recherche Médicale (INSERM) 2024
==== Body
pmcIntroduction

Birt-Hogg-Dubé syndrome (BHD) is a rare autosomal dominant disorder caused by germline mutations in the folliculin (FLCN) gene [1]. The main manifestations are multiple pulmonary cysts, fibrofolliculomas, recurrent pneumothorax, and renal cancers [2]. The FLCN gene, located on chromosome 17p11.2, was identified as a tumor suppressor gene in 2002 [3] and is responsible for BHD syndrome. To date, over 300 pathogenic variants have been reported worldwide, most of which are point mutations resulting in premature protein truncation [4]. In previous reports [5–8], FLCN gene mutations in BHD syndrome in China differed from those in Europe and the United States. For example, among 51 Chinese patients with suspected BHD, 27 had FLCN germline mutations including 14 novel mutations [8]. However, the limited number of cases in this study couldn’t reflect the whole profile of countrywide patients due to mostly from Northern China.

Although an increasing number of Chinese patients with BHD are being reported in recent years, failure in recognition and delay in diagnosis remains a challenge for patients with BHD. Recent reports suggest that Chinese patients with BHD manifest predominantly pulmonary abnormalities, with less frequent skin and kidney involvement [9]. Thus, BHD in the Caucasian population seems predominantly characterized by lung lesions combined with skin and renal malignancies, while the Asian patients manifest a lower incidence of skin lesions [10, 11].

The diagnostic criteria proposed by the European BHD Consortium in 2009 [12] which is mainly based on the presenting manifestations seen in Caucasian patients may not be appropriate for the Chinese population. Thus, a revised set of diagnostic criteria was proposed in 2023 by Chinese experts to improve the diagnosis of BHD (Table 1). This set of diagnostic criteria focuses firstly on the clinical presentation (multiple lung cysts, rash and renal cancer), then combined with genetic diagnostic criteria. Therefore, it is more in line with the low prevalence of skin and kidney lesions in Chinese patients with BHD, which would facilitate a timely diagnosis in this population.

Table 1 Diagnostic criteria for Birt-Hogg-Dubé syndrome (China) [10]

Diagnosis criteria	
Clinical criteria

Multiple lung cysts: diffuse lung cysts with no other apparent cause, mainly at the basal and mediastinum with or without spontaneous pneumothorax

Rash: at least five fibrofolliculomas or trichodiscomas, mostly on face or neck

Renal cancer: early onset (age < 50 years), or multifocal or bilateral renal cancer, or renal cancer of mixed chromophobe and oncocytic histology

	
Genetic criteria	
Pathogenic FLCN germline mutation

A first-degree relative with BHD

	
Note BHD: Birt-Hogg-Dubé Syndrome. For diagnosis of BHD, one clinical criterion plus genetic criteria or two clinical criteria are required

Herein, we retrospectively analyzed the data of 100 consecutive patients with BHD encountered in Eastern Chinese region to provide additional data pertaining to this rare disease, and to validate the new Chinese criteria for the diagnosis of BHD in clinical practice at a rare lung disease center.

Subjects and methods

Study population

Approval was obtained from the ethics committee of the First Affiliated Hospital of the University of Science and Technology of China in Anhui Province (reference number 2023-RE-290). All the patients diagnosed with BHD were recruited from inpatient wards or Rare Lung Disease Clinic - supported by a multidisciplinary team, from January 1, 2017 to June 30, 2023. Informed consents were obtained from all patients, except for one deceased patient who was exempt from the informed consent requirements. The diagnosis of BHD was based on the Chinese criteria proposed by Expert Consensus on the Diagnosis and Management of BHD in 2023 [13]. Clinical data of all patients including gender, age at diagnosis, smoking history, prior medical history (pneumothorax, skin lesion, and renal cancer), family history, imaging studies and genetic testing were reviewed (Table 2).

Table 2 Demographic and clinical characteristics of 100 patients with Birt‑Hogg‑Dubé syndrome

Characteristics	Cases with available data, n	Value, n (%)	
Male	100	37 (37)	
Age at examination-yr	100	45.3 ± 13.7 (15–81)	
Average time to diagnosis-yr	100	7.6 ± 8.3	
Smoking history	100	11 (11)	
FLCN Genetic testing	86	85 (99)	
Point mutation	85	73 (86)	
Fragment deletion	85	12 (14)	
Family history of pneumothorax	100	63 (63)	
Cysts on chest CT	96	95 (99)	
Pneumothorax	100	60 (60)	
Skin manifestations	86	66 (77)	
Cancer	76	5 (7)	
AML	76	5 (7)	
Age was presented as mean ± standard deviation (range) and categorical variables were presented as percentages

Mutation analysis of the FLCN gene

Genomic DNA from 86 patients was extracted from peripheral blood leukocytes and assayed by polymerase chain reaction (PCR) and Sanger sequencing. Multiplex ligation-dependent probe amplification (MLPA) reactions carried out in accordance with the manufacturer’s guidelines. The PCR products were examined using an ABI 3130 Genetic Analyzer from Applied Biosystems. The data were analyzed with the Coffalyser software from MRC-Holland. The PCR amplification kit (Takara, China) was used to amplify the junction fragments adjacent to the deleted regions, using specially designed primers (F CTGAGGGACACCAAGCACTC, R TGGGAAAGATGTTAATGGCCTA). PCR products were separated by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed. FLCN mutations were numbered based on GenBank accession numbers NM_144997.7 according to the HGVS nomenclature guideline (http://www.hgvs.org/mutnomen).

Statistical analysis

Statistical analyses were conducted using SPSS version 26.0. Continuous variables were presented as means and standard deviations, and then compared using independent sample t-tests. Categorical variables were presented as frequencies and percentages, and were analyzed using the chi-square test and Fisher’s exact test for comparison. A P-value below 0.05 was deemed statistically significant.

Results

Clinical features

The 100 patients were all of Han ethnicity and from 65 different families. Ninety-three cases were original citizens of Anhui Province, Eastern area of China. The remaining 7 patients were from Jiangsu, Shandong, Fujian and Sichuan Provinces in China, respectively. The average age of the patients at diagnosis was 45.3 years (ranging from 15 to 81 years old). There were 37 males with a male to female ratio of 1:1.7. Eleven patients had a smoking history, while 63 cases had a familial history of pneumothorax(Table 2).

Of the 100 patients with BHD,60% had a history of pneumothorax.Forty-four patients with pneumothorax underwent surgery (including video-assisted thoracoscopic biopsy, thoracotomy with biopsy, and mechanical pleurodesis).The lung pathology in all patients was consistent with pulmonary cysts/bullae. In addition, there was adenocarcinoma of the lung in three of them.Chest CT examination was performed in 96 patients, and lung cysts were detected in 95 of them (99%).The number of cysts were not assessed in 12 patients due to chest CT study having been performed at other hospitals and not available for current review, and 4 cases were confirmed by family investigation without chest CT examination. Review of chest CT imaging available in 84 patients demonstrated multiple pulmonary cystic lesions in all. The number of lung cysts were found to be less than 10 (6 cases), 10–20 (25 cases), and over 20 (52 cases), respectively. All of these patients had cystic lesions bilaterally, except for 1 case (F5-2).The cysts were in the lower lungs in 67 cases (81%) and showed diffuse distribution in 15 cases (18%).In addition, three patients had pulmonary malignant tumors, from families 6 and 11, respectively.The pathological types were adenocarcinoma in 2 cases and sclerosing alveolar cell tumor in the remaining one. (Fig. 1-A).

Fig. 1 A:CT of patient 1 (44-year-old female) of family 8 shows multiple cysts distributed in the lower lung. B: Patient 1 (35-year-old male) of family 52 had fibrofolliculomas on the face and neck. C, D, E: Magnetic resonance imaging of the kidneys showing angiomyolipoma (patient 1 of family 12):C, focal abnormally high signal in the right kidney. D, decreased signal in the out of phase lesion suggesting adipose tissue. E, no enhancement on enhanced scan also suggests adipose tissue

Eighty-six patients were examined by dermatologists and 66 patients (77%) were noted to have skin lesions. Histopathological confirmation of epidermoid cysts was seen in 6 patients, histopathological confirmation of fibrofolliculoma (FF)/trichodiscoma (TD) was achieved in 5 patients (Figs. 1-B and 2). The remaining patients were clinically diagnosed based on skin assessment as many individuals refused to undergo skin biopsy.

Fig. 2 Skin biopsy of patient 74 (66-year-old male) of family 45: Hematoxylin and eosin staining of skin biopsy showing histologic features consistent with fibrofolliculoma (×200)

Renal imaging examination was performed in 78 patients, and 10 patients were found to have renal tumors (13%), including 5 cases of renal cancer and 5 cases of renal angiomyolipoma (AML). Three of the five patients diagnosed with renal cancer underwent nephrectomy. The histopathologic types were chromophobe, clear cell, and low-grade eosinophilic renal cell carcinoma. The remaining two patients with renal cancer were diagnosed on imaging without histopathologic confirmation. One received renal artery chemoembolization, and the remaining patient is still being monitored. Five patients with renal angiomyolipoma (AML) came from family 6, family 8, family 12 and family 14, respectively. Two patients with AML from family 8 were siblings. The characteristics and genetic results of the five AML patients in our cohort are shown in Supplement Table 2; Fig. 1-C, D,E.

Germline mutation of the FLCN gene

Of the 100 patients with BHD, 85 cases were confirmed by genetic testing, 1 case diagnosed pathologically by skin biopsy, and the other 14 cases were diagnosed by clinical criteria alone. A total of 25 pathogenic gene mutations were detected. There were two significant gene fragment deletions (exon 1 and a heterozygous deletion spanning exons 1–3) and 23 point mutations detected.The 23 mutations included 9 frameshift mutations, 8 nonsense mutations, 2 splice site mutations, 2 missense mutations, 1 in-frame mutation, and 1 uncharacterized species (F59-1, exon11 c.1292_1300 + 4del). The most frequent mutations were c.1285dup/del C, c.1015 C> T, c.1579_1580insA, exon1-3 del and c.1177_5 1177_3de1CTC, respectively. In addition, 6 novel mutations were identified (Fig. 3).

Fig. 3 Mapping of FLCN variants for patients with Birt‑Hogg‑Dubé syndrome *25 FLCN mutations among 86 patients, including 6 novel mutations (marked in red). Numbers of patients shown within parentheses

Genotype–phenotype correlations

Pulmonary cysts were identified across all gene variants, with no statistically significant differences observed between the various genotypes. However, spontaneous pneumothorax was prevalent in those with exon1-3 del (91%), c.1285delC (85%), c.1177_51177_3de1CTC (67%), c.1579_1580insA (50%), and c.1015 C> T (44%). Furthermore, the exon1-3 deletion had a significantly higher risk of pneumothorax (91%) compared to c.1285dupC gene (30%) (95% CI: 0.31, 46.82, p = 0.015). The corresponding mutation types in the five renal cancer patients were exon 7 c.1364–1365 ins T, exon 12 c.1429 C> T, exon 1–3 deletion, and exon 11 c.1177-5_1177-3delCTC, respectively. Two patients with exon 1–3 deletion from family 34 were found to have both renal cancer and renal cyst lesions. The types of genetic variants of the 5 patients with renal angiomyolipoma were completely different including exon 14, c.1579_1580insA, exon 10, c.1177-5_1177-3delCTC, exon 7, c.T761C, and exon 1–3 deletion.

In 66 patients with skin lesions, the gene mutation sites were c.1015 C> T (10 patients), c.1285dupC (10 patients), c.1285delC (6 patients), c.1177_5 1177_3de1CTC (5 patients), exon1-3 deletion (9 patients), and c.1579_1580insA (8 patients), respectively. No association was found between genetic mutation sites in patients with kidney findings and skin lesions.

The average duration between the onset of symptoms and the diagnosis of BHD was 7.6 years. According to the European BHD diagnostic criteria, there were only 5 (6.4%) patients who met the major criterion of skin lesions, 85 (98.8%) cases met with major criterion of positive genetic testing. According to the revised Chinese BHD criteria, 95 lung lesions (99%), 5 kidney cancers (6.4%), and 5 (5.8%) skin lesions met the clinical diagnostic criteria, 85 (98.8%) pathogenic FLCN mutations met the genetic diagnostic criteria, and 35 (35%) had first-degree relatives with confirmed diagnosis. (Fig. 4; Table 3)

Fig. 4 Comparison of two different sets of diagnostic criteria for 100 Chinese patients with Birt‑Hogg‑Dubé syndrome. Note BHD: Birt-Hogg-Dubé Syndrome; Diagnosis condition 1.1 Pathogenic FLCN germline mutation; Diagnosis condition 1.2: A first-degree relative with BHD for Chinese criteria and histologically confirmed skin lesions for European criteria

Table 3 Comparison of Chinese and European diagnostic criteria for 100 patients with birt hogg dubé syndrome

Diagnostic condition	1.1 (n = 86)	1.2 (n = 100)	2.1 (n = 96)	2.2 (n = 78)	2.3 (n = 86)	
Chinese criteria	98.8%	35.0%#	99.0%	6.4%	5.8%*	
European criteria	98.8%	5.8%*$	99.0%	6.4%	35.0%#&	
p-value	NA	<0.001	NA	NA	<0.001	
Note 1.1 Pathogenic FLCN germline mutation;1.2 At least five fibrofolliculomas or trichodiscomas / A first-degree relative with BHD (* Skin lesions and #A first-degree relative with BHD); 2.1 Multiple lung cysts; 2.2 Renal cancer; 2.3 is similar to1.2. $ 86 patients; &100patients. NA: not available

Discussion

BHD syndrome was first described in 1975 as a rare autosomal dominant disorder characterized by cutaneous fibrofolliculomas, pulmonary cysts, and renal tumors [14]. According to the BHD Foundation, over 600 families have been reported globally [4]. In the current report, we describe the clinical and genetic characteristics of 100 consecutive patients with BHD from Eastern China, which is the largest cohort reported from the Chinese population to date. Current study based on patients referred to a Rare Lung Disease Clinic with a multidisciplinary team of specialists, demonstrated that revised Chinese criteria can improve the diagnosis of BHD in China. The results of our study showed pulmonary cysts as the main manifestation with a high incidence of skin lesions, while the frequency of renal tumors was low. We also identified 5 patients with unexpected renal angiomyolipoma and 6 novel FLCN mutations. Furthermore, our study revealed that more than 90% of patients with exons 1–3 deletion experienced pneumothorax.

Pulmonary cysts are the most common presentation of BHD. Imaging findings of pulmonary cysts of variable size, irregular shape, and basal anterior distribution are considered important clues for the diagnosis of BHD [15]. Among Chinese patients with BHD, the most common manifestations were pulmonary including diffuse cysts and spontaneous pneumothorax. For example, lung cysts were noted in 92% of patients in prior report [16]. Due to the high prevalence of lung cysts in adult patients with BHD, spontaneous pneumothorax can also be a common presentation [17, 18]. In our study, almost all the patients had pulmonary cysts and 60% of them had a history of pneumothorax. This was consistent with BHD reported from other Asian countries [8]. Almost half of our patients underwent thoracic surgery for recurrent pneumothorax, which yielded pathologic result consistent with pulmonary cysts/bullae. In the setting of cystic lung disease, recurrent spontaneous pneumothorax in a non-smoker should alert the pathologist to the underlying lung pathology, which may be linked to FLCN gene mutation, in order to find further evidence of BHD.

In 2016, Furuya et al. reported 14 pulmonary neoplastic lesions in 7 patients with BHD, including adenocarcinoma in situ (n = 2), minimally invasive adenocarcinoma (n = 1), papillary adenocarcinoma (n = 1), micropapillary adenocarcinoma (n = 1), and atypical adenomatous hyperplasia (n = 8) [19]. We also found three cases of combined lung cancer, and all of them were pathologically suggestive of adenocarcinoma.Potential risk for colon cancer has also been reported in recent BHD studies [20, 21].However, none of these three patients underwent genetic profiling of lung cancer. Therefore, further studies clarifying the risk of malignant tumor in those with BHD seem warranted.

The incidence of characteristic skin lesions in BHD ranges from 75 to 90% in the Caucasian population [17, 20]. Prior studies had indicated that Asian patients have a notably lower incidence of skin lesions (30–48%) compared to Caucasian patients [22, 23]. However, our data showed that the incidence of skin lesions was 77%. This higher incidence may be explained by the input of experienced dermatology specialists within our multidisciplinary team, which improved the detection rate for skin lesions. As such, further investigation is needed to explore the prevalence of skin lesions in Asian patients with BHD, and it is important to encourage more patients with skin lesions to undergo skin biopsy to confirm the diagnosis.

Renal tumors occur in 25–35% of patients with BHD and are usually bilateral, multifocal, and slow-growing. Compared with the skin and lung manifestations of BHD, renal tumors are more important for the long-term prognosis of BHD patients.Thus, surveillance for early detection and diagnosis is essential for improving prognosis.Renal tumors associated with BHD consist predominantly of hybrid chromophobe/oncocytic tumors (67%), chromophobe renal cell tumors (23%), clear cell renal carcinoma (7%), and renal oncocytomas (3%) [24]. These pathological types are less common in the general population. Consequently, the possibility of BHD should be considered when the aforementioned pathological features are encountered. Previous studies indicate distinctive cytogenetic features in FLCN mutation related RCC compared to sporadic RCC [25].A study from Japan found that 34.8% of individuals carrying FLCN mutations aged over 40 had been diagnosed with renal cancers [16]. The occurrence of renal cancer in our cohort was exceptionally low compared to other reports from China. This could be explained by the limited follow-up duration. It’s noteworthy that 5 patients (6.4%) were detected with renal angiomyolipoma, which were only reported as individual cases. The incidence of AML in the general population is reported to be 0.1–0.22% [26]. Renal AMLs were found in 41% of patients diagnosed with sporadic LAM, and in 96% of individuals with TSC-LAM [27]. In 2012, Byrne et al. firstly described a 39-year-old woman diagnosed with BHD and a renal AML [28]. The reported clinical similarities between BHD and TSC may arise from the overlapping functions of FLCN (FNIP1 or FNIP2) and TSC (TSC1 or TSC2) proteins in the mTOR pathway, particularly in the assembly of the mTOR complex 1 [29]. Current guidelines recommend the use of sirolimus and other mTOR blockers in the treatment of AML, and therapeutic efficacy have been demonstrated [30, 31]. This strategy may also hold promise in the treatment of renal angiomyolipomas in patients with BHD.

FLCN mutation profiles have been reported with some variations in different populations. In the Caucasian populations, a cytosine insertion/deletion in a C8 tract in exon 11 is a mutation hotspot for BHD. Most BHD mutations are expected to result in truncation of the BHD protein, folliculin [32].In Japanese populations, the common mutations were c.1285dupC, c.1533_1536delGATG, and c.1347_1353dupCCACCCT [11]. By the end of 2021, there were 287 patients with BHD from 143 families reported in China. As reported in previous studies, the most frequent mutation was the single deletion, duplication of cytosine in codon 1285 of exon 11 (25%), following by the mutation of c.1579_1580ins in exon 14 (4.2%), and c.1015 C > T in exon 6 was the third most common mutation (3.3%) [14]. In total, 25 FLCN mutations were detected in the present study, and one-quarter of FLCN mutations were novel. Except for hotspot mutation c.1285delC/dupC, the other frequent mutations in our cohort were different from other areas in China. For example, the mutations percentage of c.1015 C > T, c.1579 and 1580insA were higher than that of previous report [9].

The relationship between gene mutation sites and clinical phenotypes has always been a focus of attention in various studies. A recent study from Germany found mutation c.924_926del to be associated with a 39% risk for pneumothorax, which increased to 60% for mutation c.1285dup, and 73% for mutation c. 1579_1580ins [33]. Our results showed that c.1285delC, c.1177_5 1177_3de1CTC and exon 1–3 deletion were associated with a high incidence of pneumothorax. In particular, the incidence of pneumothorax in exon 1–3 deletion patients was significantly higher than that in mutation hotspot c.1285dup patients reported in previous study [34]. Thus, BHD in Eastern China presented different genotypic characteristics from other areas and its association of pneumothorax phenotype warrants further research.

The delay in diagnosis remains a challenge both in China and in the rest of the world. The average time of diagnostic delay was 7.6 years in this study and almost 10 years in China overall [35]. In 2009, the European BHD Syndrome Consortium introduced the diagnostic criteria for BHD, which have since become widely utilized in clinical settings [12]. The European BHD diagnostic criteria suggest that a minimum of five fibrofolliculomas or trichodiscomas (with at least one confirmed histologically, occurring in adulthood) and the presence of a pathogenic FLCN germline mutation to be major criteria. Minor diagnostic criteria include multiple pulmonary cysts, renal cancer, and first-degree relatives diagnosed with BHD. Currently, Chinese patients with BHD have a lower frequency of positive family history and a low biopsy rate of skin lesions, plus low incidence of renal cancer. According to the European BHD diagnostic criteria, only few Chinese cases met the major criterion of skin lesions, which is not conductive to early diagnosis of BHD in China. Therefore, in 2023, a revised criterion for BHD proposed by China Alliance for the Rare Lung Disease and experts from the related disciplines in China [13]. Considering the clinical characteristics and realities of BHD in China, it optimized the diagnostic criteria by adding family history of first-degree relatives as a genetic criterion and adjusting skin lesion as a clinical criterion. In general, the diagnosis of hereditary diseases is usually based on the clinical phenotype and ultimately supported by the positive genetic mutation. Therefore, as a hereditary disease, BHD could also be characterized in this fashion. The Chinese diagnostic criteria summarize the clinical and genetic manifestations, which is more in line with the characteristics of hereditary diseases and is suitable for Chinese patients with low skin biopsy rate. Our study also confirmed the revised diagnostic criteria might be more applicable for Chinese patients with BHD (Table 3), the difference was statistically significant when skin pathology was used as a main diagnostic criterion (95%CI: 3.48, 27.85, p < 0.001).

Nevertheless, we acknowledge the limits of the present study, such as its retrospective design and the significant number of patients who did not undergo skin lesion biopsy. In addition, there may have been selection bias associated with most of our patients being diagnosed through referral to the Rare Lung Disease Clinic. A more accurate assessment of this issue could be performed in a multi-center prospective study using a standard protocol in family screening and systemic follow-up evaluation for this rare disease. Nonetheless, considering the rarity of BHD disease, we have collected the largest number of cases up to date. Therefore, our findings offer valuable insights to improve the understanding and diagnosis of this rare disease in China.

Conclusion

In Eastern China, patients with BHD commonly exhibit pulmonary cysts, pneumothorax, and skin lesions. However, rather low incidence of kidney cancer along with unexpected renal angiomyolipomas were noted in this cohort. Our cohort manifested different genotypic characteristics from other populations, and the association of pneumothorax with genotypes warrant further investigations. The revised Chinese criteria might be more useful in diagnosing BHD in the Chinese population, compared the traditional criteria.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplement Table 1. Genetic Characterization and Clinical Phenotypes of 100 patients with Birt‑Hogg‑Dubé syndrome

Supplement Table 2.Clinical Characteristics of the five patients with Birt‑Hogg‑Dubé syndrome and Renal AML

Acknowledgements

We thank all the patients and families for their contribution to this work.

Author contributions

Daiju Hu contributed to the study design, data analysis and and the writing of the manuscript.Rui Wang and Xianmeng Chen contributed to data analysis.Jinli Liu contributed to identification of skin lesions.Xianliang Jiang contributed to surgical management of pneumothorax.Jun Xiao contributed to differential diagnosis and management of renal lesions.Jay H. Ryu and Xiaowen Hu contributed substantially to the study design, data analysis and interpretation, and the writing of the manuscript.All authors read and approved the final manuscript.

Funding

This work was supported by grants from Key medical and health specialty construction project of Anhui Province (Grant No. 2021szdzk05) and Anhui Province Program for Distinguished Medical Talents. [Wan Health Dispatch (2022) No.7].

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Declarations

Ethics approval and consent to participate

The protocol of this study was approved by the ethics committee of the First Affiliated Hospital of the University of Science and Technology of China in Anhui Province (reference number 2023-RE-290). Signed informed consent was obtained from the patients for the molecular genetic study.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Schmidt L Warren M Nickerson M Birt-Hogg-Dubé syndrome, a genodermatosis associated with spontaneous pneumothorax and kidney neoplasia, maps to chromosome 17p11.2 Am J Hum Genet 2001 69 4 876 82 10.1086/323744 11533913
Schmidt L, Warren M, Nickerson M, et al. Birt-Hogg-Dubé syndrome, a genodermatosis associated with spontaneous pneumothorax and kidney neoplasia, maps to chromosome 17p11.2. Am J Hum Genet. 2001;69(4):876–82.11533913
2. Zbar B Alvord W Glenn G Risk of renal and colonic neoplasms and spontaneous pneumothorax in the Birt-Hogg-Dubé syndrome Cancer Epidemiol Biomarkers Prev 2002 11 4 393 400 11927500
Zbar B, Alvord W, Glenn G, et al. Risk of renal and colonic neoplasms and spontaneous pneumothorax in the Birt-Hogg-Dubé syndrome. Cancer Epidemiol Biomarkers Prev. 2002;11(4):393–400.11927500
3. Nickerson M Warren M Toro J Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dubé syndrome Cancer Cell 2002 2 2 157 64 10.1016/S1535-6108(02)00104-6 12204536
Nickerson M, Warren M, Toro J, et al. Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dubé syndrome. Cancer Cell. 2002;2(2):157–64.12204536
4. https://databases.lovd.nl/shared/genes/FLCN.Accessed February 29, 2024.
5. Pan HH Ruan DD Wu M Clinical phenotype and genetic function analysis of a rare family with hereditary leiomyomatosis and renal cell carcinoma complicated with Birt-Hogg-Dubé syndrome J Med Genet 2023 60 12 1210 4 10.1136/jmg-2023-109328 37468236
Pan HH, Ruan DD, Wu M, et al. Clinical phenotype and genetic function analysis of a rare family with hereditary leiomyomatosis and renal cell carcinoma complicated with Birt-Hogg-Dubé syndrome. J Med Genet. 2023;60(12):1210–4. 10.1136/jmg-2023-109328.37468236
6. Zong D Li J Liu X Identification of a novel pathogenic folliculin variant in a Chinese Family with Birt-Hogg-Dubé Syndrome (Hornstein-Knickenberg syndrome) Front Genet 2020 11 565566 10.3389/fgene.2020.565566 33240319
Zong D, Li J, Liu X, et al. Identification of a novel pathogenic folliculin variant in a Chinese Family with Birt-Hogg-Dubé Syndrome (Hornstein-Knickenberg syndrome). Front Genet. 2020;11:565566. 10.3389/fgene.2020.565566.33240319
7. Zheng CM Hu XX Gao YL Recurrent primary spontaneous pneumothorax in a large Chinese family: a clinical and genetic investigation Chin Med Jour 2019 132 20 2402 7 10.1097/CM9.0000000000000442 31567476
Zheng CM, Hu XX, Gao YL, et al. Recurrent primary spontaneous pneumothorax in a large Chinese family: a clinical and genetic investigation. Chin Med Jour. 2019;132(20):2402–7. 10.1097/CM9.0000000000000442.31567476
8. Liu Y Xu Z Feng R Clinical and genetic characteristics of Chinese patients with Birt-Hogg-Dubé syndrome Orphanet J Rare Dis 2017 12 1 104 10.1186/s13023-017-0656-7 28558743
Liu Y, Xu Z, Feng R, et al. Clinical and genetic characteristics of Chinese patients with Birt-Hogg-Dubé syndrome. Orphanet J Rare Dis. 2017;12(1):104. 10.1186/s13023-017-0656-7.28558743
9. Zhou W Liu K Xu KF Clinical and genetic comparison of Birt-Hogg-Dubé Syndrome (Hornstein-Knickenberg syndrome) in Chinese: a systemic review of reported cases Int J Gen Med 2022 15 5111 21 10.2147/IJGM.S359660 35637701
Zhou W, Liu K, Xu KF, et al. Clinical and genetic comparison of Birt-Hogg-Dubé Syndrome (Hornstein-Knickenberg syndrome) in Chinese: a systemic review of reported cases. Int J Gen Med. 2022;15:5111–21. 10.2147/IJGM.S359660.35637701
10. 10Bruinsma FJ Dowty JG Win AK Goddard LC Agrawal P Attina D Update of penetrance estimates in Birt-Hogg- Dubé syndrome J Med Genet 2023 60 4 317 26 10.1136/jmg-2022-109104 36849229
10, Bruinsma FJ, Dowty JG, Win AK, Goddard LC, Agrawal P, Attina D, et al. Update of penetrance estimates in Birt-Hogg- Dubé syndrome. J Med Genet. 2023;60(4):317–26.36849229
11. Furuya M Yao M Tanaka R Genetic, epidemiologic and clinicopathologic studies of Japanese Asian patients with Birt-Hogg-Dubé syndrome Clinc Genet 2016 90 5 403 12 10.1111/cge.12807
Furuya M, Yao M, Tanaka R, et al. Genetic, epidemiologic and clinicopathologic studies of Japanese Asian patients with Birt-Hogg-Dubé syndrome. Clinc Genet. 2016;90(5):403–12. 10.1111/cge.12807.
12. Menko F van Steensel M Giraud S Birt-Hogg-Dubé syndrome: diagnosis and management Lancet Oncol 2009 10 12 1199 206 10.1016/S1470-2045(09)70188-3 19959076
Menko F, van Steensel M, Giraud S, et al. Birt-Hogg-Dubé syndrome: diagnosis and management. Lancet Oncol. 2009;10(12):1199–206.19959076
13. Expert Consensus Group of the Expert Consensus on the Diagnosis and Management of Birt-Hogg-Dubé Syndrome China Alliance for the Rare Lung Disease; Chinese Thoracic Society, Chinese Medical Association; Southern China Rare Lung Disease Committee of China Primary Health Care Foundation Expert consensus on the diagnosis and management of Birt-Hogg-Dubé syndrome Zhonghua Jie He He Hu Xi Za Zhi 2023 46 9 897 908 10.3760/cma.j.cn112147-20230705-00362 37670643
Expert Consensus Group of the Expert Consensus on the Diagnosis and Management of Birt-Hogg-Dubé Syndrome, China Alliance for the Rare Lung Disease; Chinese Thoracic Society, Chinese Medical Association; Southern China Rare Lung Disease Committee of China Primary Health Care Foundation. Expert consensus on the diagnosis and management of Birt-Hogg-Dubé syndrome. Zhonghua Jie He He Hu Xi Za Zhi. 2023;46(9):897–908. 10.3760/cma.j.cn112147-20230705-00362. [in Chinese].37670643
14. Hornstein OP Knickenberg M Perifollicular fibromatosis cutis with polyps of the colon–a cutaneo-intestinal syndrome Sui Generis Arch Dermatol Res 1975 253 2 161 759 10.1007/BF00582068 1200700
Hornstein OP, Knickenberg M. Perifollicular fibromatosis cutis with polyps of the colon–a cutaneo-intestinal syndrome Sui Generis. Arch Dermatol Res. 1975;253(2):161–759.1200700
15. Xu W Xu Z Liu Y Zhan Y Sui X Feng R Characterization of CT scans of patients with Birt-Hogg-Dubé syndrome compared with those of Chinese patients with non-BHD diffuse cyst lung diseases Orphanet J Rare Dis 2020 15 1 176 10.1186/s13023-020-01448-y 32631372
Xu W, Xu Z, Liu Y, Zhan Y, Sui X, Feng R, et al. Characterization of CT scans of patients with Birt-Hogg-Dubé syndrome compared with those of Chinese patients with non-BHD diffuse cyst lung diseases. Orphanet J Rare Dis. 2020;15(1):176.32631372
16. Hu X Zhang G Chen X Birt-Hogg-Dubé syndrome in Chinese patients: a literature review of 120 families Orphanet J Rare Dis 2021 16 1 223 10.1186/s13023-021-01848-8 34001170
Hu X, Zhang G, Chen X, et al. Birt-Hogg-Dubé syndrome in Chinese patients: a literature review of 120 families. Orphanet J Rare Dis. 2021;16(1):223.34001170
17. Daccord C Good JM Morren MA Bonny O Hohl D Lazor R Birt–Hogg-Dubé syndrome Eur Respir Rev 2020 29 157 200042 10.1183/16000617.0042-2020 32943413
Daccord C, Good JM, Morren MA, Bonny O, Hohl D, Lazor R. Birt–Hogg-Dubé syndrome. Eur Respir Rev. 2020;29(157):200042.32943413
18. Yang J Hu X Li J Zhang G Ge Y Wei W Correlative analysis of lung CT findings in patients with Birt-Hogg-Dubé syndrome and the occurrence of spontaneous pneumothorax: a preliminary study BMC Med Imaging 2022 22 1 22 10.1186/s12880-022-00743-3 35125098
Yang J, Hu X, Li J, Zhang G, Ge Y, Wei W. Correlative analysis of lung CT findings in patients with Birt-Hogg-Dubé syndrome and the occurrence of spontaneous pneumothorax: a preliminary study. BMC Med Imaging. 2022;22(1):22.35125098
19. Furuya M Tanaka R Okudela K Nakamura S Yoshioka H Tsuzuki T Pulmonary neoplasms in patients with Birt-Hogg-Dubé Syndrome: histopathological features and genetic and somatic events PLoS ONE 2016 11 3 e0151476 10.1371/journal.pone.0151476 26974543
Furuya M, Tanaka R, Okudela K, Nakamura S, Yoshioka H, Tsuzuki T, et al. Pulmonary neoplasms in patients with Birt-Hogg-Dubé Syndrome: histopathological features and genetic and somatic events. PLoS ONE. 2016;11(3):e0151476.26974543
20. Sattler EC Syunyaeva Z Reithmair M Dempke W Steinlein OK Colorectal cancer risk in families with Birt-Hogg- Dubé syndrome increased Eur J Cancer 2021 151 168 74 10.1016/j.ejca.2021.04.013 34000505
Sattler EC, Syunyaeva Z, Reithmair M, Dempke W, Steinlein OK. Colorectal cancer risk in families with Birt-Hogg- Dubé syndrome increased. Eur J Cancer. 2021;151:168–74.34000505
21. Van de Beek I Glykofridis IE Wolthuis RMF Gille H Johannesma PC No evidence for increased prevalence of colorectal carcinoma in 399 Dutch patients with Birt-Hogg- Dubé syndrome Br J Cancer 2020 122 4 590 4 10.1038/s41416-019-0693-1 31857718
Van de Beek I, Glykofridis IE, Wolthuis RMF, Gille H, Johannesma PC, et al. No evidence for increased prevalence of colorectal carcinoma in 399 Dutch patients with Birt-Hogg- Dubé syndrome. Br J Cancer. 2020;122(4):590–4.31857718
22. Schmidt L Linehan W Molecular genetics and clinical features of Birt-Hogg-Dubé syndrome. Nature reviews Urology 2015 12 10 558 69 26334087
Schmidt L, Linehan W. Molecular genetics and clinical features of Birt-Hogg-Dubé syndrome. Nature reviews. Urology. 2015;12(10):558–69.26334087
23. Lee JH Jeon MJ Song JS Birt-Hogg-Dubé syndrome in Korean: clinicoradiologic features and long term follow-up Korean J Intern Med 2018 34 4 830 40 10.3904/kjim.2018.119 30360018
Lee JH, Jeon MJ, Song JS, et al. Birt-Hogg-Dubé syndrome in Korean: clinicoradiologic features and long term follow-up. Korean J Intern Med. 2018;34(4):830–40. 10.3904/kjim.2018.119.30360018
24. Pavlovich CP Grubb RL 3rd Hurley K Evaluation and management of renal tumors in the Birt-Hogg-Dubé syndrome J Urol 2005 173 5 1482 6 10.1097/01.ju.0000154629.45832.30 15821464
Pavlovich CP, Grubb RL 3rd, Hurley K, et al. Evaluation and management of renal tumors in the Birt-Hogg-Dubé syndrome. J Urol. 2005;173(5):1482–6.15821464
25. Wu J, Lu J, Wu CL et al. Birt-Hogg-Dubé syndrome in an overall view: Focus on the clinicopathological prospects in renal tumors. Semin Diagn Pathol. 2024; 10.1053/j.semdp.2024.01.008.
26. Fujii Y Ajima J Oka K Tosaka A Takehara Y Benign renal tumors detected among healthy adults by abdominal ultrasonography Eur Urol 1995 27 124 7 10.1159/000475142 7744154
Fujii Y, Ajima J, Oka K, Tosaka A, Takehara Y. Benign renal tumors detected among healthy adults by abdominal ultrasonography. Eur Urol. 1995;27:124–7.7744154
27. Ryu J Moss J Beck G The NHLBI lymphangioleiomyomatosis registry: characteristics of 230 patients at enrollment Am J Respir Crit Care Med 2006 173 1 105 11 10.1164/rccm.200409-1298OC 16210669
Ryu J, Moss J, Beck G, et al. The NHLBI lymphangioleiomyomatosis registry: characteristics of 230 patients at enrollment. Am J Respir Crit Care Med. 2006;173(1):105–11.16210669
28. Byrne M Mallipeddi R Pichert G Whittaker S Birt-Hogg-Dubé syndrome with a renal angiomyolipoma: further evidence of a relationship between Birt-Hogg-Dubé syndrome and tuberous sclerosis complex Australas J Dermatol 2012 53 2 151 4 10.1111/j.1440-0960.2011.00738.x 22571569
Byrne M, Mallipeddi R, Pichert G, Whittaker S. Birt-Hogg-Dubé syndrome with a renal angiomyolipoma: further evidence of a relationship between Birt-Hogg-Dubé syndrome and tuberous sclerosis complex. Australas J Dermatol. 2012;53(2):151–4.22571569
29. Woodford M Backe S Sager R The role of heat shock Protein-90 in the pathogenesis of Birt-Hogg-Dubé and Tuberous Sclerosis Complex syndromes Urol Oncol 2021 39 6 322 6 10.1016/j.urolonc.2020.03.016 32327294
Woodford M, Backe S, Sager R, et al. The role of heat shock Protein-90 in the pathogenesis of Birt-Hogg-Dubé and Tuberous Sclerosis Complex syndromes. Urol Oncol. 2021;39(6):322–6.32327294
30. Ariceta G Buj M Furlano M Recommendations for the management of renal involvement in the tuberous sclerosis complex Nefrologia 2020 40 2 142 51 10.1016/j.nefro.2019.07.002 31722796
Ariceta G, Buj M, Furlano M, et al. Recommendations for the management of renal involvement in the tuberous sclerosis complex. Nefrologia. 2020;40(2):142–51.31722796
31. Rouvière O Nivet H Grenier N Kidney damage due to tuberous sclerosis complex: management recommendations Diagn Interv Imaging 2013 94 3 225 37 10.1016/j.diii.2013.01.003 23415464
Rouvière O, Nivet H, Grenier N, et al. Kidney damage due to tuberous sclerosis complex: management recommendations. Diagn Interv Imaging. 2013;94(3):225–37.23415464
32. Schmidt LS Nickerson ML Warren MB Germline BHD-mutation spectrum and phenotype analysis of a large cohort of families with Birt-Hogg-Dubé syndrome Am J Hum Genet 2005 76 6 1023 33 10.1086/430842 15852235
Schmidt LS, Nickerson ML, Warren MB, et al. Germline BHD-mutation spectrum and phenotype analysis of a large cohort of families with Birt-Hogg-Dubé syndrome. Am J Hum Genet. 2005;76(6):1023–33. 10.1086/430842.15852235
33. Sattler E Syunyaeva Z MansmannU Genetic risk factors for spontaneous pneumothorax in Birt-Hogg-Dubé syndrome Chest 2020 157 5 1199 206 10.1016/j.chest.2019.12.019 31958439
Sattler E, Syunyaeva Z, MansmannU, et al. Genetic risk factors for spontaneous pneumothorax in Birt-Hogg-Dubé syndrome. Chest. 2020;157(5):1199–206.31958439
34. Wang Y Cai M Jiang X Exons 1–3 deletion in FLCN is associated with increased risk of pneumothorax in Chinese patients with Birt-Hogg-Dubé syndrome Orphanet J Rare Dis 2023 18 1 115 10.1186/s13023-023-02710-9 37170274
Wang Y, Cai M, Jiang X, et al. Exons 1–3 deletion in FLCN is associated with increased risk of pneumothorax in Chinese patients with Birt-Hogg-Dubé syndrome. Orphanet J Rare Dis. 2023;18(1):115.37170274
35. Zhang G Liu J Wang Y Birt-Hogg-Dubé syndrome encountered at rare lung disease clinic in Anhui province, China Orphanet J Rare Dis 2022 17 1 203 10.1186/s13023-022-02362-1 35578266
Zhang G, Liu J, Wang Y, et al. Birt-Hogg-Dubé syndrome encountered at rare lung disease clinic in Anhui province, China. Orphanet J Rare Dis. 2022;17(1):203. 10.1186/s13023-022-02362-1.35578266
