
==== Front
Cureus
Cureus
2168-8184
Cureus
2168-8184
Cureus Palo Alto (CA)

10.7759/cureus.67371
Genetics
Infectious Disease
Environmental Health
Antimicrobial Susceptibility and Molecular Identification of Antibiotic Resistance Enteric Bacteria Isolated From Pigeon Feces in the City of Jeddah, Saudi Arabia
Muacevic Alexander
Adler John R
Elsheikh Mohamed Elmutasim A 1
Alandiyjany Maher 23
El Said Manal 14
Abouelmagd Faten 15
Ikram Nadeem 1
Awais Muhammad 1
Khidir Elshiekh B 3
Abdulrahaman Wafaa M 1
Hag Elsafi Hassan Elsiddig 6
Salih Omeima 7
1 Department of Microbiology, General Medicine Practice, Batterjee Medical College, Jeddah, SAU
2 General Medicine Practice, Batterjee Medical College, Jeddah, SAU
3 Department of Clinical Laboratory Sciences, Faculty of Applied Medical Sciences, Umm Al-Qura University, Makkah, SAU
4 Department of Microbiology and Infection Prevention and Control Unit, Theodor Bilharz Research Institute, Giza, EGY
5 Department of Medical Parasitology, Faculty of Medicine, Sohag University, Sohag, EGY
6 Department Microbiology, Ahfad Centre for Science and Technology, Ahfad University for Women, Omdurman, SDN
7 Department of Public Health, School of Health Sciences, Ahfad University for Women, Omdurman, SDN
Mohamed Elmutasim A. Elsheikh medicine2.jed@bmc.edu.sa
21 8 2024
8 2024
16 8 e6737121 8 2024
Copyright © 2024, Elsheikh et al.
2024
Elsheikh et al.
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License CC-BY 4.0., which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
This article is available from https://www.cureus.com/articles/280622-antimicrobial-susceptibility-and-molecular-identification-of-antibiotic-resistance-enteric-bacteria-isolated-from-pigeon-feces-in-the-city-of-jeddah-saudi-arabia
Background

Due to their potential to carry a wide range of bacteria, pigeon feces may contribute to the spreading of infectious diseases in urban settings. 

Objective

This study analyzed the presence of enteric bacteria from pigeon feces in Jeddah and their antimicrobial susceptibility and described the molecular characteristics of the carbapenem resistance genes it produced.

Method

Two hundred twenty-five pigeon feces specimens were collected from eight parks in Jeddah. Conventional microbiology techniques were employed to identify the isolated bacteria, and the automated Vitek2® system (bioMérieux, Marcy-l'Étoile, Lyon, France) provided additional confirmation. Kirby-Bauer disk diffusion method was utilized to screen for antimicrobial resistance. Only 50 antibiotic-resistance isolates further underwent molecular diagnosis for testing groups of carbapenems-encoding genes (blaNDM, blaSIM, and blaAIM), using multiplex polymerase chain reaction (PCR). 

Result

Of the 50 antibiotic-resistant isolates, 28% (14/50) were Klebsiella pneumoniae, 24% (12/50) were Enterobacter cloacae, and 48% (24/50) were Escherichia coli. Ninety percent (90%) of the isolates showed resistance to cefuroxime, 56% to gentamicin, 52% to amoxicillin/clavulanic acid, and 100% to meropenem. NDM beta-lactamase was the most often discovered gene (26%) and was followed by AIM beta-lactamase (5%)

Conclusion

According to this study, there may be a chance for resistant K. pneumoniae, E. cloacae, and E. coli to spread amongst several hosts within the same area. Consequently, to prevent the continued occurrence and dissemination of resistant strains among other hosts in the same location, it is essential to monitor the AMR (antimicrobial resistance) of E. coli, E. cloacae, and K. pneumoniae from pigeons. 

saudi arabia
jeddah
args
pigeon
enteric-bacteria
==== Body
pmcIntroduction

There are numerous pigeons throughout the world, in both countryside and cities, interacting closely with people and other animals [1-3]. Pigeon feces may contribute to the spread of infectious illnesses in the environment because they may contain various bacteria [1,4]. These could include resilient human pathogens such as strains of diarrheagenic Escherichia coli, creating the potential for exposure and human infection [1,2,5,6].

Humans and other animals have been documented to develop digestive disorders because of diarrheagenic E. coli strains [2,7]. However, animals may also be a source of antimicrobial resistance determinants, which can then spread to humans [3,8,9]. It is commonly recognized that commensal and pathogenic strains of E. coli can have several genetic markers associated with microbial resistance and exhibit varying rates of resistance [1,10]. 

The emergence of antibiotic resistance in Gram-negative bacteria presents a significant risk to human and animal treatment, both clinically and financially. Environmental species include Pseudomonas, Stenotrophomonas, Aeromonas, and Enterobacteriaceae spp. are multi-resistant opportunistic pathogens linked to devastating illnesses in both humans and animals. The widespread Enterobacteriaceae family of Gram-negative bacteria often colonizes the gastrointestinal environment. They are a major cause of contamination in food and water and one of the most important opportunistic pathogenic organisms in the therapeutic setting. They are connected to numerous hospital- and community-acquired diseases, and they can interchange genetic data via horizontal gene transfer in addition to acquiring antibiotic resistance genes (ARGs) [8-10]. 

Antibiotic molecules can be found outside of medical facilities in soil and water sources thus they are created by ambient microbes or eliminated by people and animals [11]. Furthermore, it is well known that co-selection by heavy metals utilized in animal husbandry and aquaculture encourages the emergence of antibiotic resistance in bacteria [12]. Several studies have demonstrated that MDR (multidrug resistance) bacteria can be found in natural environments as reservoirs and that the environmental metagenome, often known as the environmental "resistome," is home to a wide variety of ARGs that can spread horizontally to new hosts [13].

The most well-known property of carbapenemases, which are β-lactamases that inactivate carbapenems and the majority of β-lactam antibiotics, is that they can impart resistance to β-lactams. These include metallo-β-lactamases, such as the SIM (Seoul imipenemase), NDM (New Delhi metalo-beta-lactamase), AIM (Adelaide imipenemase), and VIM (Verona integron-encoded metallo-β-lactamase) enzyme families, which Gram-negative bacteria have gained through transferable elements, and serine carbapenemases, such as the widely distributed KPC (Klebsiella pneumoniae carbapenemase) family of enzymes [13].

Serious health issues are raised by the environmental co-contamination that occurs with the rise of MDR bacteria in humans, animals, and birds [14,15]. Wild birds can act as reservoirs for coliform bacteria that carry antibiotic-resistance genes, such as E. coli. These birds have yielded several hazardous kinds of bacteria that have been isolated. Water contact and food acquisition are the ways that resistant bacteria spread from people or veterinary sources to wild animals [16,17]. 

Drug resistance in infected pigeons in Jeddah, western Saudi Arabia is not known. The effects of antibiotic sensitivity testing from potential pathogenic bacteria isolated from pigeons on human health, even when considering different ecological habitats of the world, are unknown. To assess the likelihood that these pigeons are home to possible human intestinal drug-resistant pathogens, this study analyzes the presence of enteric bacteria isolated from pigeons' feces in Jeddah and their antimicrobial sensitivity patterns and describes the molecular characteristics of the carbapenems resistance genes it produced. 

Materials and methods

Study design 

This was a cross-sectional, descriptive, laboratory-based study.

Sampling

Using sterile cotton swabs, 225 pigeon feces samples were collected from different sites in eight parks of the city of Jeddah, Saudi Arabia, between May 2021 and March 2022. 

The inclusion criteria were isolated Gram-negative rods bacteria, while the exclusion criteria were non-glucose fermenter and oxidase-positive Gram-negative rods bacterial isolates.

Microbiological identification

All swab samples were enriched in buffered peptone water at 37 °C for 24 h. Subsequently, they were sub-cultured on MacConkey agar and incubated at 37 °C overnight. The plates were examined for lactose fermenting or non-lactose fermenting bacteria. Then purified isolates were morphologically characterized by the Gram stain method. Presumptive identification was done using biochemical tests including oxidase, indole, citrate, catalase, urea hydrolysis, and sugar fermentation, and then confirmed by Vitek2 automated system (bioMérieux, Marcy-l'Étoile, Lyon, France). 

Antimicrobial susceptibility test

All bacteria isolates were investigated to antibiogram against eight commonly used antibiotics, i.e., meropenem (10 µg)(carbapenem), ceftazidime (30 µg) (third-generation cephalosporin), cefuroxime (30 µg) (second-generation cephalosporin), cefotaxime(30µg) (third-generation cephalosporin), trimethoprim/sulfamethoxazole (1.25/23.75 µg)( dihydrofolate reductase inhibitor/sulfonamide), amoxicillin + clavulanic acid (25/10 µg) (penicillin-like antibiotics/beta-lactamase inhibitors), ciprofloxacin (5 µg) (fluoroquinolone), and gentamicin (10 µg) (aminoglycosides ), utilizing the disk diffusion techniques developed by Bauer et al. [18]. To determine whether the isolates were resistant or sensitive to the tested antimicrobial agents, the zone of growth inhibition was lastly compared to standards given by the Clinical and Laboratory Standards Institute [19]. Resistance to three or more antimicrobial groups is considered multidrug resistance or MDR. Only 50 antibiotic-resistance isolates further underwent molecular diagnosis. 

DNA extraction

Following the manufacturer's instructions, 50 genomic DNA samples were extracted from resistant bacteria using the QIAamp DNA Microbiome Kit® (QIAGEN, Valencia, CA, USA). 

Multiplex PCR

Multiplex PCR was done by DreamTaq Green PCR Master Mix (2X) (cat# K1081) (Thermo Fisher Scientific Inc., Waltham, USA) using the following primers (Table 1): 

Table 1 Primers used in this study

a= Primers (F) forward and (R) reverse, b=sequence from 5 ends to 3 ends, c=beta lactamase genes, d=length or size of the genes in (bp) base pair unit, NDM=New Delhi metalo-beta-lactamase, AIM=Adelaide imipenemase, SIM=Seoul imipenemase

(a) Primer 	  (b) Sequence (5′–3′) 	(c) Gene Product     	(d) amplicon size (bp) 	
AIM-F	CTGAAGGTGTACGGAAACAC	blaAIM	322	
AIM-R	GTTCGGCCACCTCGAATTG	
SIM-F	TACAAGGGATTCGGCATCG	blaSIM	570	
SIM-R	TAATGGCCTGTTCCCATGTG	
NDM-F     	GGTTTGGCGATCTGGTTTTC	blaNDM	621	
NDM-R	CGGAATGGCTCATCACGATC	

The PCR protocol was performed according to manufacturer instructions with a total volume of 20 ul (Table 2). The PCR amplification for DNA samples was performed using Verti™ Thermal Cyclers (Applied Biosystems, Waltham, USA) under the following thermal cycling conditions: 10 min at 94°C and 36 cycles of amplification consisting of 30 s at 94°C (denaturation), 40 s at 52°C (annealing), and 50 s at 72°C, with 5 min at 72°C for the final extension [20]. 

Table 2 PCR Protocol

PCR=polymerase chain reaction

 	Reagent	Volume /Sample	
1	2X Master Mix	10 µl	
2	10 μM Primers (F & R) for AIM	2.0 µl	
3	10 μM Primers (F & R) for SIM	2.0 µl	
4	10 μM Primers (F & R) for NDM	2.0 µl	
5	DNA (50 ng / µl )	2.0 µl	
6	Nuclease Free Water	2.0 µl	
 	Total Volume	20 µl	

Gel electrophoresis

The size and quality of the PCR amplification products were confirmed using agarose gel electrophoresis. 2% gel stained with Cybersafe DNA dye (Invitrogen, Carlsbad, USA) after being prepared with Ultrapure Agarose(Cleaver Scientific, Thistle, Rugby, UK) and 1XTBE buffer. Each gel well was filled with 4 μl of the PCR product. The samples were run alongside a DNA ladder (100-1000) (GeneON, Ludwigshafen, Germany) that was run for 30 minutes at 100 mV. DNA fragments were visible with the Gel Doc system imager system UV transilluminator (Bio-Rad Laboratories, Hercules, USA). 

Statistical analysis 

Data were analyzed using multiple correspondence analysis (MCA) and the Chi-square test was used to obtain p-values to identify significant associations between each two variables using IBM SPSS software version 26 (IBM Corp., Armonk, USA). Statistics were deemed significant if p<0.05. 

Ethics statement 

The sites, activities, and field investigations that were detailed did not require any specific licenses. The field experiments did not involve endangered or protected animals, the sampled sites were not privately owned, and the researchers had no prior physical interaction with pigeons. 

Results

Isolated bacteria

Among 225 pigeon feces samples collected, only 22% (50/225) of isolates were confirmed antibiotic-resistant Enterobacteriaceae. The 50 antibiotic-resistance isolates were identified by biochemical tests and were confirmed by the Vitek2 automated system (Bio Merieux). Among these 50 isolates, 48% (24/50) were E. coli, 28% (14/50) were K. pneumoniae, and 24% (12/50) were E. cloacae (Figure 1). 

Figure 1 Percentage and numbers of bacterial isolates from 50 pigeon fecal samples

Antibiotic resistance

Among 50 species of E. coli, E. cloacae, and K. pneumoniae, not a single isolate was susceptible to all antibiotics, however, all isolates were meropenem-resistant (100%). 45 isolates (90%) were cefuroxime-resistant, 28 (56%) isolates were gentamicin-resistant, and 26 isolates (52%) were amoxicillin/clavulanic acid-resistant (Table 3). 

Seventeen (34%) isolates were not susceptible to one or two antibiotics. Additionally, multidrug resistance was recognized in 66% of isolates that included more than three antibiotic groups. In contrast, very few bacteria showed resistance to ceftazidime, cefotaxime, and ciprofloxacin in the studied bacterial species. The susceptibility and resistance characteristics of the tested isolates are summed up in Table 3. Regarding beta-lactams, the findings showed that the highest resistance rate was observed for carbapenems. Moderate levels were observed compared to other beta-lactams such as first and second-generation cephalosporins. The lowest resistance rates were observed for third-generation cephalosporins and fluoroquinolones (Table 3). 

Table 3 Susceptibility pattern on pigeon faces Bacterial isolates in Jeddah, KSA

The proportion comparison χ² test performed for a value of α=5%; * significant value 

MEM=meropenem, CAZ=ceftazidime, CXM=cefuroxime, CTX=cefotaxime, 

SXT=triméthoprim+sulfamethoxazole, CIP=ciprofloxacin, AMC=amoxicillin+clavulanic acid, CN= gentamicin 

Isolated bacteria  	No 	Susceptibility 	MEM 	CAZ 	CXM 	CTX 	SXT 	CIP 	AMC 	CN 	
Escherichia coli 	24 	Frequency of susceptibility 	0 	6 	0 	5 	19 	20 	8 	11 	
Frequency of   intermediate 	0 	16 	2 	17 	1 	1 	5 	0 	
Frequency of   resistance 	24 	2 	22 	2 	4 	3 	11 	13 	
Enterobacter cloacae 	12 	Frequency of susceptibility 	0 	2 	0 	3 	4 	12 	2 	2 	
Frequency of   intermediate 	0 	10 	0 	9 	0 	0 	0 	0 	
Frequency of   resistance 	12 	0 	12 	0 	8 	0 	10 	10 	
Klebsiella pneumoniae 	14 	Frequency of susceptibility 	0 	7 	0 	10 	10 	12 	5 	9 	
Frequency of   intermediate 	0 	7 	3 	4 	3 	2 	4 	0 	
Frequency of   resistance 	14 	0 	11 	0 	1 	0 	5 	5 	
                P. value  	- 	0.197 	0.179 	0.009* 	0.001* 	0.201 	0.124 	0.05* 	

There were statistically significant differences in cefotaxime sensitivity and resistance pattern for the three species of isolated bacteria as K. pneumoniae was found sensitive (P=.009) compared to E. coli and E. cloacae (resistant), another statistically significant difference was observed with triméthoprim+sulfamethoxazole ( P=.001) and gentamicin (P=.05) as K. pneumoniae and E. coli were sensitive while E. cloacae were found to be resistant (table 3). 

Genotypic analysis

The carbapenem resistance determining genes were present in 14/50 (28%) of the 50 Gram-negative antibiotic-resistance rods that were isolated from pigeon feces. The most common gene, found in 13 of 50 (26%) bacterial isolates, was NDM. It was present in 14% (7/50), 10% (5/50), and 2% (1/50) of K. pneumoniae, E. cloacae, and E. coli respectively. AIM beta-lactamase was found in five isolates out of 50 (10%); however, 4/50 (8%) isolates had both NDM and AIM genes, while SIM was not found in the examined isolated bacteria (Figures 2, 3). 

Figure 2 2% gel electrophoresis PCR results using AIM, SIM, and NDM genes for bacteria isolated from pigeon faces

Ladder 100 bp, NDMC=NDM positive control, AIMC=AIM positive control, PCR=polymerase chain reaction, NDM=New Delhi metalo beta-lactamase, AIM=Adelaide imipenemase, SIM=Seoul imipenemase

Figure 3 Numbers of bacteria with three carbapenem resistance genes isolated from pigeon feces in Jeddah, Saudi Arabia

Metallo-β-lactamases genes: NDM=New Delhi metalo beta-lactamase, AIM=Adelaide imipenemase, SIM=Seoul imipenemase

Discussion

This study reports on a potential pathogen isolated from pigeon feces in Jeddah, Saudi Arabia. This finding demonstrates that the pigeons residing in various parks were carriers of Enterobacter cloacae, Escherichia coli, and Klebsiella pneumoniae. While there were no differences between the parks tested and the isolation and molecular recognition methodologies followed by previous studies [4-6], the determined prevalence depended on the samples collected; among other factors investigated, the sample size and area may vary. 

According to Tadesse DA et al. and Hur J et al., antibiotic drugs are essential for reducing the fatality and illness rate linked to communicable diseases in humans and animals. One of the most common animal contagious diseases treated with antibiotics is intestinal disease. Nevertheless, the extensive use of antibiotics in humans and animals has resulted in antibiotic-resistant bacteria [21,22]. While few antibiotics used in animal farming treat human infection and several animal pathogens are zoonotic, the development of resistant and multidrug-resistant pathogens among animal isolates is a medical issue [23]. Thus, we examined the sensitivity profile of E. cloacae, E. coli, and K. pneumoniae that were detected in pigeon feces in the current study. 

Urban pigeons may feed on trash or adjacent trash cans, which makes them susceptible to contamination by medically significant bacteria or by leftover antimicrobials and chemicals. When they interact with people in cities, they could also become contaminated [1,10]. Considering the location, it is difficult to pinpoint the roots of such pigeons in the city of Jeddah. Like any other major city, there are nosocomial areas, public parks, and plazas dispersed throughout Jeddah. Nonetheless, no open sewage networks or sewage plant treatments are located close to the city locations that were sampled, which may have contaminated the pigeons. 

Antimicrobial drugs provide selective pressure on microorganisms, which leads to the development of resistance determinants that can spread throughout different bacterial populations. According to our research, drug-resistant species of E. coli, E. cloacae, and K. pneumoniae have been recovered from pigeon feces, which may reflect the excessive usage of these chemicals in our community. 

Even though some authors have reported E. coli resistance to common bird medicine antibiotics groups like carbapenem, second-generation cephalosporin, third-generation cephalosporin, dihydrofolate reductase inhibitor/sulfonamide, penicillin-like antibiotics/beta-lactamase inhibitors, fluoroquinolone, and aminoglycosides, our findings have not been compared to any scientific publications in the literature [24,25]. 

It is noteworthy that the pigeons under investigation were not examined because of any disease, but rather because of the possibility that they harbor microorganisms that could be dangerous to people. Consequently, it is concerning to discover multiple antibiotic-resistance in infectious or commensal E. coli, E. cloacae, and K. pneumoniae from pigeons, especially if the genetic coding for these phenotypes can spread to other microbes or if people or other animals encounter these antibiotic-resistant bacteria. We did not investigate the possible factors that could be linked to the selective pressure that produced multiple resistances, but phenotypic evidence from other studies suggests that one of them could be co-selection [8,25,26]. 

Although there is inadequate information on antibiotic sensitivity patterns of human assumed pathogens detected from pigeons, previous regional studies displayed higher resistance percentages of E. coli isolated from infected humans to antimicrobials such as sulfamethoxazole-trimethoprim, quinolones, and cephalosporins [27,28]. Nonetheless, in this investigation, every isolate exhibited 100% resistance to meropenem, 90% resistance to cefuroxime, 56% resistance to gentamicin, and 52% resistance to amoxicillin/clavulanic acid. 

A higher percentage of ampicillin resistance (76%) was found in E. coli isolates of human origin that were in studies published between 1996 and 2007, considering other developing countries in other geographic locations, such as Asia and Africa. There have also been reports of emerging third-generation cephalosporin resistance (19%) and gentamycin resistance (13%) [4]. Other international data have indicated elevated levels of resistance in E. coli to quinolones such as nalidixic acid, ampicillin, trimethoprim, sulfamethoxazole, and the combination of sulfamethoxazole-trimethoprim [29]. 

Antimicrobial resistance has been noted for a few antibiotics crucial for human medication, particularly in exposed hosts. This behavior raises the prospect that E. coli, E. cloacae, and K. pneumoniae discovered from recent pigeon feces could act as a reservoir of antibiotic-resistant bacteria and/or resistance genes that could be transferred to pathogens through the environmental chain. 

NDM beta-lactamase was the most frequently found gene in this study (26%), followed by AIM beta-lactamase gene (5%). The results of Wang A, Hu C showed Extended-Spectrum β-Lactamase (ESBL)-producing Escherichia coli strains from pigeons carrying blaCTX-M-1G genes were in line with this study [30]. The strains of K. pneumoniae, E. cloacae, and E.coli in this investigation that carried these two-beta lactamase (NDM and AIM) genes were resistant to amoxicillin/clavulanic acid, cefuroxime, gentamicin, and meropenem. According to this data, there may be a chance for resistant K. pneumoniae, E. cloacae, and E. coli to spread between several hosts within the same area. Thus, it's essential to keep an eye on the AMR of K. pneumoniae, E. cloacae, and E. coli from pigeons to prevent the spread of resistance strains among various hosts in the same area and prevent their continued occurrence. 

AMR is a process that happens naturally and helps microorganisms survive. Nonetheless, this development has been influenced by human actions such as the overprescription of inappropriate drugs, the overuse of antibiotics as animal growth supplements, and the lack of new medicines [3]. In areas like ours with high rates of antimicrobial resistance, there is a need to watch these individuals more closely. It is advisable to schedule a follow-up for 72 hours following treatment in order to evaluate their therapeutic response [25]. 

According to this study, pigeon feces are a source of many zoonotic agents. Therefore, continuous surveys can evaluate the danger of human disease transmission from pigeons and contribute to its reduction.

Our study is still limited by the difficulty of utilizing the term "molecular characterization" for even a single class of antibiotics when employing PCR-based identification of resistant indicators in resistant isolates. Therefore, the potential of whole genome sequencing to investigate the likely origins and characteristics of resistant strains should be the focus of our future research project. 

Conclusions

This study suggests that resistant K. pneumoniae, E. cloacae, and E. coli could spread to several hosts in the same location. Thus, it is crucial to keep an eye on the AMR of E. coli, E. cloacae, and K. pneumoniae from pigeons to stop the recurrence and spread of resistant strains among other hosts in the same area. Proper infection control measures and precautions should be taken immediately.

This study was funded by Batterjee Medical College, Jeddah, Saudi Arabia (Project No. RES-2021-0002).

Disclosures

Author Contributions

Human subjects: All authors have confirmed that this study did not involve human participants or tissue.

Animal subjects: All authors have confirmed that this study did not involve animal subjects or tissue.

Conflicts of interest: In compliance with the ICMJE uniform disclosure form, all authors declare the following:

Payment/services info: All authors have declared that no financial support was received from any organization for the submitted work.

Financial relationships: All authors have declared that they have no financial relationships at present or within the previous three years with any organizations that might have an interest in the submitted work.

Other relationships: All authors have declared that there are no other relationships or activities that could appear to have influenced the submitted work.

Concept and design:  Mohamed Elmutasim A. Elsheikh, Maher Alandiyjany, Manal El Said, Faten Abouelmagd, Muhammad Awais, Elshiekh B. Khidir, Hassan Elsiddig Hag Elsafi, Omeima Salih

Acquisition, analysis, or interpretation of data:  Mohamed Elmutasim A. Elsheikh, Maher Alandiyjany, Faten Abouelmagd, Nadeem Ikram, Muhammad Awais, Elshiekh B. Khidir, Wafaa M. Abdulrahaman

Drafting of the manuscript:  Mohamed Elmutasim A. Elsheikh, Manal El Said, Nadeem Ikram

Critical review of the manuscript for important intellectual content:  Mohamed Elmutasim A. Elsheikh, Maher Alandiyjany, Manal El Said, Faten Abouelmagd, Nadeem Ikram, Muhammad Awais, Elshiekh B. Khidir, Wafaa M. Abdulrahaman, Hassan Elsiddig Hag Elsafi, Omeima Salih

Supervision:  Mohamed Elmutasim A. Elsheikh
==== Refs
References

1 Health hazards posed by feral pigeons J Infect Haag-Wackernagel D Moch H 307 313 48 2004 https://pubmed.ncbi.nlm.nih.gov/15066331/ 15066331
2 Prevalence and characteristics of intimin- and Shiga toxin-producing Escherichia coli from gulls, pigeons and broilers in Finland J Vet Med Sci Kobayashi H Pohjanvirta T Pelkonen S 1071 1073 64 2002 https://www.sciencedirect.com/science/article/pii/S0032579119397445?via%3Dihub 12499699
3 Investigation of shiga toxin-producing Escherichia coli in avian species in India Lett Appl Microbiol Wani SA Samanta I Bhat MA Nishikawa Y 389 394 39 2004 15482427
4 Bacteriological survey of feces from feral pigeons in Japan J Vet Med Sci Tanaka C Miyazawa T Watarai M Ishiguro N 951 953 67 2005 16210811
5 Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons Vet Microbiol Morabito S Dell'Omo G Agrimi U 275 283 82 2001 11470548
6 Prevalence of shiga toxin-producing Escherichia coli and Salmonella enterica in rock pigeons captured in Fort Collins, Colorado J Wildl Dis Pedersen K Clark L Andelt WF Salman MD 46 55 42 2006 16699148
7 Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp J Clin Microbiol Aranda KR Fagundes-Neto U Scaletsky IC 5849 5853 42 2004 15583323
8 Intestinal microflora in 45 crows in Ueno Zoo and the in vitro susceptibilities of 29 Escherichia coli isolates to 14 antimicrobial agents J Vet Med Sci Aruji Y Tamura K Sugita S Adachi Y 1283 1286 66 2004 15528866
9 Antimicrobial resistance among neonatal pathogens in developing countries Pediatr Infect Dis J Thaver D Ali SA Zaidi AK 0 21 28 2009
10 Associations between antimicrobial resistance phenotypes, antimicrobial resistance genes, and virulence genes of fecal Escherichia coli isolates from healthy grow-finish pigs Appl Environ Microbiol Rosengren LB Waldner CL Reid-Smith RJ 1373 1380 75 2009 19139228
11 Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes Environ Int Czekalski N Sigdel R Birtel J Matthews B Bürgmann H 45 55 81 2015 25913323
12 Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern Lancet Infect Dis Pitout JD Laupland KB 159 166 8 2008 18291338
13 Carbapenemases: partners in crime J Glob Antimicrob Resist Bush K 7 16 1 2013 27873609
14 Antimicrobial susceptibility of Pseudomonas aeruginosa from dogs and cats as well as Arcanobacterium pyogenes from cattle and swine as determined in the BfT-GermVet monitoring program 2004-2006 Berl Munch Tierarztl Wochenschr Werckenthin C Alesík E Grobbel M Lübke-Becker A Schwarz S Wieler LH Wallmann J 412 422 120 2007 https://pubmed.ncbi.nlm.nih.gov/17939456/ 17939456
15 The role of natural environments in the evolution of resistance traits in pathogenic bacteria Proc Biol Sci Martinez JL 2521 2530 276 2009 19364732
16 Free-living Canada geese and antimicrobial resistance Emerg Infect Dis Cole D Drum DJ Stalknecht DE 935 938 11 2005 15963291
17 Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada Appl Environ Microbiol Kozak GK Boerlin P Janecko N Reid-Smith RJ Jardine C 559 566 75 2009 19047381
18 Antibiotic susceptibility testing by a standardized single disk method Am J Clin Pathol Bauer AW Kirby WM Sherris JC Turck M 493 496 45 1966 https://doi.org/10.1093/ajcp/45.4_ts.493 5325707
19 CLSI M39: Analysis and Presentation of Cumulative Antimicrobial Susceptibility Test Data, 5th Edition Clinical and Laboratory Standard Institute Wayne Clinical and Laboratory Standard Institute 2014 https://clsi.org/standards/products/microbiology/documents/m39/
20 Multiplex PCR for detection of acquired carbapenemase genes Diagn Microbiol Infect Dis Poirel L Walsh TR Cuvillier V Nordmann P 119 123 70 2011 21398074
21 Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950-2002 Emerg Infect Dis Tadesse DA Zhao S Tong E Ayers S Singh A Bartholomew MJ McDermott PF 741 749 18 2012 22515968
22 Antimicrobial resistance of Salmonella isolated from food animals: a review Food Res Int Hur J Jawale C Lee JH 819 830 45 2012
23 A review of antibiotic use in food animals: perspective, policy, and potential Public Health Rep Landers TF Cohen B Wittum TE Larson EL 4 22 127 2012 22298919
24 Escherichia coli infections in pigeons: characteristics of the disease and its etiological agent Proc IX DVG-Tagung über Vogelkrankheiten München Duitsland De Herdt P Van Ginneken C Haesebrouck F Devriese L Ducatelle R 211 214 Ghent Ghent University 1994 https://biblio.ugent.be/publication/246803
25 Prevalence of antimicrobial resistance among pigeon isolates of Streptococcus gallolyticus, Escherichia coli and Salmonella enterica serotype Typhimurium Avian Pathol Kimpe A Decostere A Martel A Haesebrouck F Devriese LA 393 397 31 2002 12396341
26 Prevalence and patterns of antimicrobial resistance of fecal Escherichia coli among pigs on 47 farrow-to-finish farms with different in-feed medication policies in Ontario and British Columbia Can J Vet Res Akwar HT Poppe C Wilson J 195 201 72 2008 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2276906/ 18505210
27 A 10-year prospective surveillance of nosocomial infections in neonatal intensive care units Am J Infect Control Couto RC Carvalho EA Pedrosa TM Pedroso ER Neto MC Biscione FM 183 189 35 2007 17433942
28 [Antimicrobial resistance of uropathogens among outpatients, 2000-2004] Rev Soc Bras Med Tropic Koch CR Ribeiro JC Schnor OH 277 281 41 2008 https://europepmc.org/article/MED/18719808
29 An international survey of the antimicrobial susceptibility of pathogens from uncomplicated urinary tract infections: the ECO.SENS Project J Antimicrob Chemother Kahlmeter G 69 76 51 2003 12493789
30 Antimicrobial resistance analysis of Escherichia coli isolated from pigeons in Qingdao, Shandong province, China Genes (Basel) Wang A Hu C 13 2022
