
==== Front
J Pathog
J Pathog
JPATH
Journal of Pathogens
2090-3057
2090-3065
Wiley

10.1155/2024/9615181
Research Article
Establishment of a STING-Deficient HepG2 Cell Line through CRISPR/Cas9 System and Evaluation of Its Effects on Salmonella Replication
https://orcid.org/0000-0002-6314-7347
Sun Lanqing lanqingsun@foxmail.com
1
https://orcid.org/0000-0002-5838-1489
Huang Kai 2
Huang Xuan 1
1 Department of Laboratory Medicine Affiliated Hospital of Jiangnan University, Wuxi, Jiangsu, China
2 Orthopaedic Institute Wuxi Ninth People's Hospital Affiliated to Soochow University, Wuxi, Jiangsu, China
Academic Editor: Arghya Das

2024
12 9 2024
2024 961518124 1 2024
29 7 2024
24 8 2024
Copyright © 2024 Lanqing Sun et al.
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Background

Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) is a common food-borne pathogen that causes gastroenteritis and can lead to life-threatening systemic disease when it spreads to vital organs, such as the liver. Stimulator of interferon genes (STING) is a crucial regulator of the host's innate immune response to viral infections, while its role in bacterial infections remains controversial. This study aims to establish a STING-deficient HepG2 cell line through the CRISPR/Cas9 system and evaluate its effects on Salmonella replication.

Methods

In this study, a STING knockout HepG2 cell line was constructed through the application of CRISPR/Cas9 technology. We assessed cell viability and proliferation using the CCK-8 assay. Subsequently, we investigated the effect of STING deletion on Salmonella replication and the expression of type I interferon-related genes.

Results

The STING knockout HepG2 cell line was successfully constructed using the CRISPR/Cas9 system. The proliferation capability was diminished in STING-deficient HepG2 cells, while Salmonella Typhimurium replication in these cells was augmented compared to the wild-type (WT) group. Following Salmonella infection, the transcriptional responses of type I interferon-related genes, such as IFNB1 and ISG15, were inhibited in STING-deficient HepG2 cells.

Conclusions

We successfully constructed a STING-deficient cell line. Our finding of increased Salmonella Typhimurium replication in STING-deficient HepG2 cells provides the basis for further studies on pathogen-host interactions.

Youth Project of Wuxi Health CommissionQ202356
==== Body
pmc1. Introduction

Salmonella infections are prevalent globally and continue to pose significant public health challenges in many developing nations. Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) is a Gram-negative, facultative intracellular bacterial pathogen that can lead to severe gastroenteritis and systemic inflammation in humans and animals [1]. Additionally, it serves as a widely used model organism to investigate the molecular mechanisms involved in bacterial pathogenesis and pathogen-host interactions. As one of the most widespread pathogens transmitted through food and water, Salmonella Typhimurium often infiltrates the gastrointestinal barrier, resulting in symptoms like diarrhea and acute inflammation. Later in the infection process, it can disseminate to the mesenteric lymph nodes and may even spread to extraintestinal tissues, such as the liver [2]. Severe hepatic involvement with an acute hepatitis-like clinical appearance has been reported as a possible consequence of Salmonella infection [3, 4]. However, the molecular mechanisms of how hepatocytes respond to Salmonella infection remain incompletely defined.

Type I interferons (IFNs) are involved in the host response to Salmonella infection. Autophagy is a significant antimicrobial response that inhibits Salmonella growth [5]. IFN-β can be induced by autophagy through Toll-like receptors (TLRs) and the TRIF pathway, providing a protective effect on the host [6]. However, another study found that IFN-β increased host susceptibility to infection by restricting innate immune responses [7]. Besides autophagy, stimulator of interferon genes (STING) is one of the main activators of IFN-β production. The rapid detection of microbial agents is crucial to effectively trigger the host's defense mechanisms against infection. STING is an endoplasmic reticulum (ER)-associated membrane protein known to trigger type I IFN and proinflammatory responses upon the detection of cytosolic DNA by cyclic GMP-AMP synthase (cGAS) [8]. The cGAS-STING pathway is an important cytosolic surveillance pathway (CSP), and increasing evidence demonstrates its essential role in host defense against a variety of bacterial pathogens [9–12]. Moreover, STING is also a direct sensor of cyclic dinucleotides (CDNs) generated by numerous intracellular bacteria [13]. Although the cGAS-STING pathway has been extensively studied for its role in promoting the antiviral innate immune response, its function in bacterial infections remains debatable. Therefore, constructing STING knockout cell lines is helpful for clarifying the role of STING in Salmonella infection.

HEK293T and Vero-E6 cells are known to have deficiencies in cGAS-STING signaling [14]. We aimed to investigate the cellular response to Salmonella infection in both STING-containing and STING-deficient systems, focusing on hepatocytes. Therefore, we set out to delete STING in cells that have demonstrated STING activation through gene knockout. As previously reported, STING is not expressed in primary human hepatocytes and Huh7 cells [15]. However, researchers have detected STING expression and cGAS-STING signaling activation in another human hepatocyte-derived cell line, HepG2 [15, 16].

The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system is a recently developed and highly efficient genome editing technology [17]. Guided by gRNA, Cas nucleases orchestrate the precise cleavage of DNA double strands, playing a crucial role in gene editing. This method offers benefits such as convenience, efficiency, cost-effectiveness, and ease of use [18]. In this study, we constructed a STING knockout HepG2 cell line using CRISPR/Cas9 technology. Subsequently, we investigated the effect of STING deletion on Salmonella replication. The generated knockout cell line represents an optimal resource for subsequent investigations into Salmonella infection.

2. Materials and Methods

2.1. Cell Culture

The wild-type (WT) HepG2 cell line was kindly provided by Professor Qiaoming Long (Medical College of Soochow University, Suzhou, China) [19]. Cells were incubated at 37°C with 5% CO2 in Dulbecco's Modified Eagle's medium (DMEM) (SH30243.01B; Hyclone) supplemented with 10% fetal bovine serum (FBS; 04-001-1ACS; Biological Industries) and 1% Penicillin-Streptomycin Solution (C0222; Beyotime Biotechnology).

2.2. Bacterial Strain and Infection

Salmonella Typhimurium strain SL1344 in this study was kindly provided by Professor Qian Yang (Nanjing Agricultural University, Nanjing, China). Salmonella Typhimurium strain was grown in Luria Bertani (LB) medium at 37°C with shaking overnight. The following day, it was diluted at a ratio of 1 : 100 with fresh LB medium and then cultured until it reached the logarithmic phase of growth. Upon washing 3 times with sterile PBS, bacterial numbers were estimated and adjusted based on the optical density at 600 nm absorbance and ready for the further experiments. For infection, bacteria were washed in PBS and subsequently resuspended in DMEM at a multiplicity of infection (MOI) of 10.

2.3. Design sgRNA

The STING gene sequence was determined by GRCh38 human reference genome. sgRNAs were designed using an online tool named Wellcome Sanger Institute Genome Editing (WGE) (https://wge.stemcell.sanger.ac.uk/search_by_seq). The CRISPR/Cas9 system specifically targeted exon 6 of the STING genome. After screening by specificity and efficiency score, sgRNAs were chosen as Table 1.

2.4. Construction of sgRNA Plasmid

DNA fragment containing the U6 promoter and sgRNAs was amplified by polymerase chain reaction (PCR) using PUC57-sgRNA-U6 plasmid as a template with the primers in Table 2. Then, PCR products and primary pGL3-U6-2sgRNAs plasmids were digested with Esp3I enzyme (ER0451; Thermo Scientific) and ligated with T4 DNA ligase (2011A; Takara) according to manufacturer's instructions.

2.5. Construction of STING Knockout Monoclonal Cell Line

Cells were transfected with constructed pGL3-U6-2 sgRNAs together with pSt1374-N-NLS-Flag-Cas9 plasmids using the Lipofectamine™ 3000 Transfection System (L3000001; Thermo Scientific) according to manufacturer's instructions. After 48 hours of transfection, cell screening was conducted using a puromycin concentration of 2 μg/mL. The residual cell population was subjected to single-cell separation using a limited dilution method and transferred into a 96-well plate. Monoclonal identification was performed after 2 weeks of cell culture.

2.6. PCR and Sanger Sequencing of STING Knockout Cell Line

Monoclonal cells were validated through PCR followed by Sanger sequencing. Total cellular DNA was extracted using FastPure Cell/Tissue DNA Isolation Mini Kit (DC102; Vazyme). PCR reaction was performed according to the protocol of 2 × Phanta Max Master Mix (P515; Vazyme) with the primers in Table 3. Then, the PCR reaction settings were set up as follows: initial denaturation 95°C for 3 min, 30 cycles of denaturation 95°C for 15 s, annealing 55°C for 15 s, 72°C extension for 1 min, and 72°C extension for 5 min. Next, the PCR product was purified using electrophoresis and FastPure Gel DNA Extraction Mini Kit (DC301; Vazyme). Sanger sequencing was performed at GENEWIZ Co., Ltd. (Suzhou, China).

2.7. Western Blotting Analysis

The total protein of WT or STING knockout HepG2 cells were extracted using RIPA Lysis Buffer (R0278; Sigma Aldrich) containing the Protease Inhibitor Cocktail (4693132001; Roche). Protein concentrations were measured with BCA Protein Assay Kit (P0010; Beyotime Biotechnology). Protein sample was separated by SDS-PAGE electrophoresis and then transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked and incubated with STING antibody (19851-1-AP; Proteintech) and β-actin (SAB1305554; Sigma-Aldrich) at 4°C overnight. Then, membranes were incubated with the HRP-conjugated antibody at room temperature for 1 h. Finally, the blots were visualized with an ECL luminescence reagent (ma0186; Meilunbio).

2.8. Cell Proliferation Analysis

CCK-8 Cell Counting Kit (A311; Vazyme) was used to perform cell proliferation assays. In this procedure, 2 × 104 HepG2 WT or STING knockout cells were seeded in 96 well plates and added with 10 μL of the CCK-8 reagent for another 1 h, 2 h, 3 h, and 4 h. Optical density was measured at 450 nm.

2.9. Bacterial Replication Analysis

For the assessment of bacterial replication, 4 × 105 HepG2 cells were initially seeded into 12 well plates and then infected with SL1344 at an MOI of 10 the next day. The amount of bacterial suspension added to the cell cultures was calculated from growth curves measured in the laboratory before. After a 0.5 h infection, the cells were washed with PBS and subsequently cultured for an additional 0.5 h in DMEM-FBS (10%) supplemented with 100 μg/mL gentamicin (A620217; Sangon Biotech) to remove extracellular bacteria. Then, cells were lysed with 0.3% Triton X-100 (V900502; Sigma-Aldrich), diluted cell lysates were plated onto SS agar culture plates, and the cultures were incubated at 37°C overnight to enumerate the internalized bacteria [20].

2.10. RNA Isolation and Quantitative Real-Time PCR (qPCR)

Cells were lysed, and total RNA was extracted using TRIzol reagent. RNA was reverse transcribed by RT Reagent Kit (RR047A; Takara). qPCR was performed using SYBR Green Supermix kit (1725121; BIO-RAD) on CFX96 Touch Real-Time PCR Detection System (BIO-RAD). Primers are shown in Table 4.

2.11. Statistical Analysis

The analysis of experimental data was carried out by GraphPad Prism software (La Jolla, CA, USA) and IBM SPSS Statistics for Windows (Armonk, NY, USA). Statistical comparisons between two datasets were executed utilizing the unpaired Student's t-test. One representative dataset of at least three independent experiments was shown as the mean ± standard error of the mean (SEM).

3. Results

3.1. Construction of STING Knockout HepG2 Cell Strain

pGL3-U6-2sgRNAs plasmids and the PCR products containing the U6 promoter and sgRNAs were digested by Esp3I enzyme (Figures 1(a), 1(b)). After ligation, the combinant plasmid containing two sgRNAs targeting exon 6 of the STING gene was constructed (Figure 1(c)). The recombinant and Cas9 expression plasmids were cotransfected into HepG2 cells, followed by puromycin screening and single cell separation. After monoclonal cell formation, total DNA of the cells was isolated, and PCR reaction was performed with primers designed on the exon 6 of human STING (Table 3). Sanger sequencing of the PCR products revealed that 38 nucleotides of exon 6 were missing, leading to a frameshift mutation in human STING, indicating that STING gene was knocked out successfully (Figure 1(d)). When passaged at a proportion of 1 : 3, both STING knockout and WT cell lines achieved 90% confluence within 3 days. Western blotting analysis showed that protein levels were undetectable in the STING knockout cell line compared to the WT cell line, further confirming the efficiency of the gene knockout (Figure 1(e)).

3.2. STING Knockout Suppresses HepG2 Cell Proliferation

We then used the CCK-8 kit to examine how STING knockout affects the proliferation of the HepG2 cell line. Our results showed that the optical density (O.D.) values of the STING knockout group were significantly lower compared to the WT group at several time points after incubation with the CCK-8 reagent (Figure 2). This finding indicates that STING knockout inhibits the proliferation ability of HepG2 cells.

3.3. STING Knockout Promotes Salmonella Replication

To investigate the effect of STING knockout on Salmonella replication in the HepG2 cell line, internalized bacteria numbers was analyzed after infection at an MOI of 10 for 1 h. The results revealed that Salmonella replication in the HepG2 cells with STING knockout was significantly higher compared to the WT group (Figure 3). This finding indicates that STING plays a negative role in Salmonella replication.

3.4. STING Knockout Suppresses Type I IFN Response during Salmonella Infection

Salmonella induces a type I IFN response in macrophages, which depends on the cGAS-STING pathway [21]. To investigate the type I IFN response in hepatocytes following Salmonella infection, we examined the expression of IFNB1 and interferon-stimulated gene 15 (ISG15). Our results showed that in WT HepG2 cells, the mRNA levels of both IFNB1 and ISG15 increased following Salmonella infection but were significantly lower in the STING knockout group compared to the WT group (Figures 4(a), 4(b)). These findings, combined with the increased Salmonella replication observed in the STING knockout group, suggest that the type I IFN response plays a role in defending against Salmonella infection.

4. Discussion

Salmonella Typhimurium is a bacterial pathogen that causes various diseases in humans and animals. In severe cases of Salmonella Typhimurium infection, the bacteria can enter the bloodstream (bacteremia) and spread to various organs, including the liver. This can lead to disseminated infection and systemic symptoms [1]. STING is primarily known for its role in regulating the immune response against viral infections and certain intracellular pathogens. Some studies suggest that STING may also play a role in controlling bacterial infections by modulating inflammation and immune responses [8]. However, the interaction between Salmonella Typhimurium—a food-borne bacterial pathogen—and STING has not been studied as extensively as its interaction with viruses, particularly in nonphagocytic cells such as hepatocytes. Among common hepatic cell lines, HepG2 has been used as an in vitro model to investigate the cellular and molecular mechanisms involved in Salmonella infection and its impact on hepatocytes [22, 23]. Additionally, while STING expression is not detected in mouse and human primary hepatocytes, it is expressed and functional in HepG2 cells [15, 16]. In this study, we generated a STING-deficient HepG2 cell line using the CRISPR/Cas9 system, an efficient and widely used tool for generating knockout cell lines. We found that STING knockout cells are more susceptible to Salmonella infection, with increased bacterial growth. This indicates that STING exerts an antibacterial effect in HepG2 cells.

Chronic inflammation resulting from persistent activation of the cGAS-STING pathway is strongly associated with cancer progression [24, 25]. In hepatocellular carcinoma tissues, the mRNA levels of genes involved in the cGAS-STING pathway are up-regulated [16]. HepG2 is an immortal cell line derived from a hepatocellular carcinoma patient, and chromosomal instability (CIN) is a hallmark of human cancer [26]. In our study, we found that STING knockout inhibited the proliferation ability of HepG2 cells. The reduced cellular viability observed in HepG2 cells following STING deletion aligns with recent research, which suggests that the cGAS-STING pathway drives the survival of chromosomally instable cancers [27]. One potential mechanism by which STING may suppress Salmonella Typhimurium replication is through the production of type I interferons and proinflammatory cytokines. The role of IFN-β in Salmonella infection remains ambiguous. In macrophages, IFN-β has been shown to both promote and inhibit innate immune responses, such as the release of inflammatory cytokines following Salmonella infection [6, 7]. Upon sensing bacterial DNA, STING can activate the production of interferons, which initiates an antiviral response [28, 29]. Although Salmonella Typhimurium is a bacterium, the antiviral response may still contribute to immune defense against pathogens. Our data showed that the mRNA level of IFNB1 was reduced in STING knockout cells, suggesting an antibacterial function of IFN-β in the HepG2 cell model of Salmonella infection. Further experiments are needed to manipulate IFN-β levels in this model to confirm its antibacterial role. ISG15 is an interferon-induced protein that aids in clearing invading bacteria [30]. We observed a significant decrease in ISG15 mRNA expression in the STING knockout group, combined with increased Salmonella replication, suggesting that ISG15 may have an anti-infective role in HepG2 cells. In addition to type I IFN signaling, bacterial infection can directly activate ISG15 expression through the STING pathway [31]. Therefore, STING deletion alone in Salmonella-infected HepG2 cells may significantly contribute to the downregulation of ISG15 expression. Another possible pathway involves the interaction between STING and pattern recognition receptors (PRRs), such as TLRs [32, 33]. Activation of TLR can enhance STING signaling pathway, potentially boosting host immune responses [34]. During Salmonella infection, autophagy plays a critical role in inhibiting bacterial survival [35]. STING has been reported to directly activate autophagy to regulate the innate immune response [36, 37]. Thus, autophagy may be involved in STING-mediated restriction of Salmonella survival in HepG2 cells. The detailed mechanisms underlying our findings warrant further investigation.

In conclusion, we constructed a STING knockout HepG2 cell line using the CRISPR/Cas9 system. Our findings reveal that STING deletion inhibited HepG2 cell proliferation and facilitated Salmonella Typhimurium replication. It is important to note that our understanding of STING's role in bacterial infections, including Salmonella, is still developing. The established cell line serves as an effective tool for further research on Salmonella infection.

Acknowledgments

This work was supported by the Youth Project of Wuxi Health Commission (Q202356).

Abbreviations

Salmonella Typhimurium: Salmonella enterica serovar Typhimurium

cGAS: Cyclic GMP-AMP synthase

CRISPR/Cas9: The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9

CSP: Cytosolic surveillance pathway

DMEM: Dulbecco's Modified Eagle's medium

ER: Endoplasmic reticulum

FBS: Fetal bovine serum

IFN: Interferon

ISG15: Interferon-stimulated gene 15

KO: Knockout

LB: Luria Bertani

MOI: Multiplicity of infection

PCR: Polymerase chain reaction

PRR: Pattern recognition receptor

SEM: Standard error of the mean

STING: Stimulator of interferon genes

TLR: Toll-like receptor

WGE: Wellcome Sanger Institute Genome Editing

WT: Wild-type.

Data Availability

All data are available in the paper.

Ethical Approval

This study did not involve human or animal subjects, and thus, no ethical approval was required.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors' Contributions

Conceptualization was done by L.S.; formal analysis was done by K.H.; investigation was done by L.S. and K.H.; writing was done by K.H., L.S., and X.H.; supervision was done by L.S.; funding acquisition was done by L.S. All authors reviewed the manuscript. Lanqing Sun and Kai Huang contributed equally to this work.

Figure 1 Construction of STING knockout HepG2 cell strain. (a) Agarose gel electrophoresis of isolated plasmids, including nondigested primary pGL3-U6-2sgRNAs plasmids (control) and plasmids digested by Esp3I restriction enzyme (digested). (b) Agarose gel electrophoresis of PCR products containing the U6 promoter and sgRNAs targeting exon 6 of human STING gene and digested by Esp3I restriction enzyme. (c) Constructed pGL3-U6-2sgRNAs plasmid, sgRNA, and scaffold sequence located downstream of the U6 promoter, and puromycin coding sequence located downstream of EF-1 alpha promoter. (d) DNA sequence analysis of WT and knockout cell line showing the STING mutation, the red box indicates the deleted 38 base pairs. (e) Western blotting analysis of STING protein in WT and STING knockout (KO) HepG2 cell lines.

Figure 2 STING knockout suppresses HepG2 cell proliferation. The proliferation ability of WT and STING knockout HepG2 cells. Cells were seeded in 96 well plates, and the optical density was assessed at the indicated time intervals subsequent to the addition of the CCK-8 reagent at 450 nm. Data are expressed as the mean ± SEM, and statistically significant differences are indicated. ∗∗∗P < 0.001.

Figure 3 STING knockout promotes Salmonella replication. The Salmonella replication in WT and STING knockout HepG2 cells. Cells were seeded in 12 well plates and infected with Salmonella Typhimurium at an MOI of 10 for 1 h. The internalized bacteria were enumerated by plating. Data are expressed as the mean ± SEM, and the statistically significant difference is indicated. ∗P < 0.05.

Figure 4 STING knockout suppresses type I IFN response during Salmonella infection. The qPCR analysis of IFNB1 (a) and ISG15 (b) gene expression. WT and STING knockout HepG2 cells were infected with SL1344 at an MOI of 10 for 1 or 4 h (n = 4). Data were normalized to the WT uninfected control group (set as 1). ACTIN was used as the housekeeping gene. Data are expressed as the mean ± SEM, and statistically significant difference is indicated. ∗P < 0.05; ∗∗∗P < 0.001.

Table 1 sgRNA sequence.

sgRNA	Sequence 5′-3′	
sgRNA-1	TATCCAGGAAGCGAATGTTGGGG	
sgRNA-2	CGGTGACCATGCTGGCATCAAGG	

Table 2 PCR primers.

Primer	Sequence 5′-3′	
F	ATGCGTCTCAACCGTATCCAGGAAGCGAATGTTGGTTTTAGAGCTAGAAATAGCAAG	
R	ATGCGTCTCGAAACTGATGCCAGCATGGTCACCGCGGTGTTTCGTCCTTTCCACAAG	

Table 3 PCR primers.

Primer	Sequence 5′-3′	
F	AAAGGGTGGTGCAGTAAGAGG	
R	GGGCAGCTTTATGGTCAAGAG	

Table 4 qPCR primers.

Primer	Sequence 5′-3′	
IFNB1-F	CTTGGATTCCTACAAAGAAGCAGC	
IFNB1-R	TCCTCCTTCTGGAACTGCTGCA	
ISG15-F	CTCTGAGCATCCTGGTGAGGAA	
ISG15-R	AAGGTCAGCCAGAACAGGTCGT	
ACTIN-F	CACCATTGGCAATGAGCGGTTC	
ACTIN-R	AGGTCTTTGCGGATGTCCACGT
==== Refs
1 Galan J. E. Salmonella Typhimurium and inflammation: a pathogen-centric affair Nature Reviews Microbiology 2021 19 11 716 725 10.1038/s41579-021-00561-4 34012042
2 Wang Y. Wu C. Gao J. Du X. Chen X. Zhang M. Host metabolic shift during systemic Salmonella infection revealed by comparative proteomics Emerging Microbes and Infections 2021 10 1 1849 1861 10.1080/22221751.2021.1974316 34461813
3 Albayrak A. Gunbey S. S. Aktas F. Cholestatic hepatitis due to Salmonella typhi Clinical Practice 2011 1 p. e13 10.4081/cp.2011.e13
4 Karoli R. Fatima J. Chandra A. Singh G. Salmonella hepatitis: an uncommon complication of a common disease Journal of Family Medicine and Primary Care 2012 1 2 160 162 10.4103/2249-4863.104992
5 Birmingham C. L. Smith A. C. Bakowski M. A. Yoshimori T. Brumell J. H. Autophagy controls Salmonella infection in response to damage to the Salmonella-containing vacuole Journal of Biological Chemistry 2006 281 16 11374 11383 10.1074/jbc.m509157200 2-s2.0-33744958258 16495224
6 Owen K. A. Anderson C. J. Casanova J. E. Salmonella suppresses the TRIF-dependent type I interferon response in macrophages mBio 2016 7 1 e02051 e02015 10.1128/mbio.02051-15 2-s2.0-84960156468 26884434
7 Perkins D. J. Rajaiah R. Tennant S. M. Salmonella Typhimurium Co-opts the host type I IFN system to restrict macrophage innate immune transcriptional responses selectively The Journal of Immunology 2015 195 5 2461 2471 10.4049/jimmunol.1500105 2-s2.0-84940121420 26202980
8 Barber G. N. STING: infection, inflammation and cancer Nature Reviews Immunology 2015 15 12 760 770 10.1038/nri3921 2-s2.0-84948670572
9 Collins A. C. Cai H. Li T. Cyclic GMP-AMP synthase is an innate immune DNA sensor for Mycobacterium tuberculosis Cell Host & Microbe 2015 17 6 820 828 10.1016/j.chom.2015.05.005 2-s2.0-84930260866 26048137
10 Jin L. Getahun A. Knowles H. M. STING/MPYS mediates host defense against Listeria monocytogenes infection by regulating Ly6C(hi) monocyte migration The Journal of Immunology 2013 190 6 2835 2843 10.4049/jimmunol.1201788 2-s2.0-84874892789 23378430
11 Liu Z. Z. Yang Y. J. Zhou C. K. STING contributes to host defense against Staphylococcus aureus pneumonia through suppressing necroptosis Frontiers in Immunology 2021 12 10.3389/fimmu.2021.636861 636861
12 Ahn J. Barber G. N. STING signaling and host defense against microbial infection Experimental and Molecular Medicine 2019 51 12 1 10 10.1038/s12276-019-0333-0
13 Witte C. E. Archer K. A. Rae C. S. Sauer J. D. Woodward J. J. Portnoy D. A. Innate immune pathways triggered by Listeria monocytogenes and their role in the induction of cell-mediated immunity Advances in Immunology 2012 113 135 156 10.1016/b978-0-12-394590-7.00002-6 2-s2.0-84855867681 22244582
14 Langereis M. A. Rabouw H. H. Holwerda M. Visser L. J. van Kuppeveld F. J. Knockout of cGAS and STING rescues virus infection of plasmid DNA-transfected cells Journal of Virology 2015 89 21 11169 11173 10.1128/jvi.01781-15 2-s2.0-84945218411 26311870
15 Thomsen M. K. Nandakumar R. Stadler D. Lack of immunological DNA sensing in hepatocytes facilitates hepatitis B virus infection Hepatology 2016 64 3 746 759 10.1002/hep.28685 2-s2.0-84987905490 27312012
16 Li H. Hu L. Wang L. Iron activates cGAS-STING signaling and promotes hepatic inflammation Journal of Agricultural and Food Chemistry 2022 70 7 2211 2220 10.1021/acs.jafc.1c06681 35133148
17 Gupta D. Bhattacharjee O. Mandal D. CRISPR-Cas9 system: a new-fangled dawn in gene editing Life Sciences 2019 232 10.1016/j.lfs.2019.116636 2-s2.0-85069946960 116636
18 Shojaei Baghini S. Gardanova Z. R. Zekiy A. O. Shomali N. Tosan F. Jarahian M. Optimizing sgRNA to improve CRISPR/Cas9 knockout efficiency: special focus on human and animal cell Frontiers in Bioengineering and Biotechnology 2021 9 10.3389/fbioe.2021.775309 775309
19 Liu Q. Yang X. Long G. ERAD deficiency promotes mitochondrial dysfunction and transcriptional rewiring in human hepatic cells Journal of Biological Chemistry 2020 295 49 16743 16753 10.1074/jbc.ra120.013987 32978261
20 Lin Z. Zhang Y. G. Xia Y. Xu X. Jiao X. Sun J. Salmonella enteritidis effector AvrA stabilizes intestinal tight junctions via the JNK pathway Journal of Biological Chemistry 2016 291 52 26837 26849 10.1074/jbc.m116.757393 2-s2.0-85007410040 27875307
21 Xu L. Li M. Yang Y. Salmonella induces the cGAS-STING-dependent type I interferon response in murine macrophages by triggering mtDNA release mBio 2022 13 3 10.1128/mbio.03632-21 e0363221
22 Hannemann S. Gao B. Galan J. E. Salmonella modulation of host cell gene expression promotes its intracellular growth PLoS Pathogens 2013 9 10 10.1371/journal.ppat.1003668 2-s2.0-84887270879 e1003668
23 Deng Q. Yang S. Sun L. Salmonella effector SpvB aggravates dysregulation of systemic iron metabolism via modulating the hepcidin-ferroportin axis Gut Microbes 2021 13 1 18 10.1080/19490976.2020.1849996
24 Ahn J. Xia T. Konno H. Konno K. Ruiz P. Barber G. N. Inflammation-driven carcinogenesis is mediated through STING Nature Communications 2014 5 1 p. 5166 10.1038/ncomms6166 2-s2.0-84910031744
25 Barbie D. A. Tamayo P. Boehm J. S. Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1 Nature 2009 462 7269 108 112 10.1038/nature08460 2-s2.0-70449091786 19847166
26 Bakhoum S. F. Cantley L. C. The multifaceted role of chromosomal instability in cancer and its microenvironment Cell. 2018 174 6 1347 1360 10.1016/j.cell.2018.08.027 2-s2.0-85052746903 30193109
27 Hong C. Schubert M. Tijhuis A. E. cGAS-STING drives the IL-6-dependent survival of chromosomally instable cancers Nature 2022 607 7918 366 373 10.1038/s41586-022-04847-2 35705809
28 Liu S. Cai X. Wu J. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation Science. 2015 347 6227 aaa2630 10.1126/science.aaa2630 2-s2.0-84924778328
29 Erttmann S. F. Swacha P. Aung K. M. The gut microbiota prime systemic antiviral immunity via the cGAS-STING-IFN-I axis Immunity 2022 55 5 847 861.e10 10.1016/j.immuni.2022.04.006 35545033
30 Radoshevich L. Impens F. Ribet D. ISG15 counteracts Listeria monocytogenes infection Elife 2015 4 e06848 10.7554/elife.06848 2-s2.0-84940544077
31 Perng Y. C. Lenschow D. J. ISG15 in antiviral immunity and beyond Nature Reviews Microbiology 2018 16 7 423 439 10.1038/s41579-018-0020-5 2-s2.0-85047016016 29769653
32 Manes N. P. Nita-Lazar A. Molecular mechanisms of the toll-like receptor, STING, MAVS, inflammasome, and interferon pathways mSystems 2021 6 3 10.1128/msystems.00336-21 e0033621
33 Li K. Qu S. Chen X. Wu Q. Shi M. Promising targets for cancer immunotherapy: TLRs, RLRs, and STING-mediated innate immune pathways International Journal of Molecular Sciences 2017 18 2 p. 404 10.3390/ijms18020404 2-s2.0-85012992223
34 Zhang L. Wei X. Wang Z. NF-κB activation enhances STING signaling by altering microtubule-mediated STING trafficking Cell Reports 2023 42 3 10.1016/j.celrep.2023.112185 112185
35 Gomes L. C. Dikic I. Autophagy in antimicrobial immunity Molecular Cell 2014 54 2 224 233 10.1016/j.molcel.2014.03.009 2-s2.0-84899131967 24766886
36 Liu D. Wu H. Wang C. STING directly activates autophagy to tune the innate immune response Cell Death & Differentiation 2019 26 9 1735 1749 10.1038/s41418-018-0251-z 2-s2.0-85058972690 30568238
37 Gui X. Yang H. Li T. Autophagy induction via STING trafficking is a primordial function of the cGAS pathway Nature 2019 567 7747 262 266 10.1038/s41586-019-1006-9 2-s2.0-85062871501 30842662
