
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

39298333
92774
10.7554/eLife.92774
version of record
Research Article
Cancer Biology
Mutant mice lacking alternatively spliced p53 isoforms unveil Ackr4 as a male-specific prognostic factor in Myc-driven B-cell lymphomas
Fajac Anne 1234
Simeonova Iva 1234
Leemput Julia 1234
Gabriel Marc 2345
Morin Aurélie 1234
Lejour Vincent https://orcid.org/0000-0002-2797-1507
1234
Hamon Annaïg 1234
Rakotopare Jeanne 1234
Vaysse-Zinkhöfer Wilhelm 1234
Eldawra Eliana 1234
Pinskaya Marina 2345
Morillon Antonin https://orcid.org/0000-0002-0575-5264
2346
Bourdon Jean-Christophe https://orcid.org/0000-0003-4623-9386
5
Bardot Boris https://orcid.org/0000-0003-4976-9593
boris.bardot@curie.fr
1234
Toledo Franck https://orcid.org/0000-0003-3798-4106
Franck.Toledo@curie.fr
1234
1 https://ror.org/04t0gwh46 Genetics of Tumor Suppression, Institut Curie Paris France
2 https://ror.org/02feahw73 CNRS UMR3244 Paris France
3 https://ror.org/02en5vm52 Sorbonne University Paris France
4 https://ror.org/013cjyk83 PSL Research University Paris France
5 https://ror.org/04t0gwh46 Non Coding RNA, Epigenetic and Genome Fluidity, Institut Curie Paris France
6 https://ror.org/039c6rk82 School of Medicine, Ninewells Hospital, University of Dundee Dundee United Kingdom
Dalal Yamini Reviewing Editor https://ror.org/040gcmg81 National Cancer Institute United States

Dalal Yamini Senior Editor https://ror.org/040gcmg81 National Cancer Institute United States

19 9 2024
2024
13 RP9277413 10 2023
This manuscript was published as a preprint.18 10 2023

This manuscript was published as a reviewed preprint.10 1 2024

The reviewed preprint was revised.27 8 2024

© 2024, Fajac et al
2024
Fajac et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

The Trp53 gene encodes several isoforms of elusive biological significance. Here, we show that mice lacking the Trp53 alternatively spliced (AS) exon, thereby expressing the canonical p53 protein but not isoforms with the AS C-terminus, have unexpectedly lost a male-specific protection against Myc-induced B-cell lymphomas. Lymphomagenesis was delayed in Trp53+/+Eμ-Myc males compared to Trp53ΔAS/ΔAS Eμ-Myc males, but also compared to Trp53+/+Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc females. Pre-tumoral splenic cells from Trp53+/+Eμ-Myc males exhibited a higher expression of Ackr4, encoding an atypical chemokine receptor with tumor suppressive effects. We identified Ackr4 as a p53 target gene whose p53-mediated transactivation is inhibited by estrogens, and as a male-specific factor of good prognosis relevant for murine Eμ-Myc-induced and human Burkitt lymphomas. Furthermore, the knockout of ACKR4 increased the chemokine-guided migration of Burkitt lymphoma cells. These data demonstrate the functional relevance of alternatively spliced p53 isoforms and reveal sex disparities in Myc-driven lymphomagenesis.

eLife digest

Human cells divide many times during a lifetime, a process that requires careful regulation to avoid uncontrolled cell division, which can lead to various disorders, including cancer. For example, TP53, which encodes multiple proteins, is the most commonly mutated gene in cancers.

TP53 carries the instructions to make a tumor suppressor protein, known as p53, which can stop cancers from forming and spreading. In humans and mice, TP53 (and the mouse analogue Trp53) can also be read by the cell to make several slightly different versions of the p53 protein, known as isoforms. The p53 isoforms are much less studied and their role in an organism is still unclear.

To address this, Fajac et al. used genome editing to make mouse strains that were still able to express p53, but were only able to create a specific subset of p53 isoforms. In these mice, part of the Trp53 gene had been mutated to remove the cell’s ability to make isoforms with an alternative C-terminal end.

Fajac et al. then allowed these mice to breed with mice that were model organisms for a cancer called B-cell lymphoma. This revealed that male offspring that lacked alternative p53 isoforms were more susceptible to B-cell lymphoma and that they had decreased levels of the protein ACKR4, a receptor for signaling proteins that regulate cellular movement. Human datasets showed that having higher levels of ACKR4 could be linked to a better disease prognosis in male patients with Burkitt lymphoma, a rare but aggressive form of B-cell lymphoma. The same effect was not observed in females, suggesting that measuring ACKR4 gene expression in male patients with Burkitt lymphoma might be useful to identify the patients at higher risk.

The study from Fajac et al. provides a new perspective on p53 – one of the most studied proteins. It highlights specific p53 isoforms and the ACKR4 protein as a potential way to identify male patients at higher risk from a type of B-cell lymphoma.

p53
Ackr4
Myc
Burkitt lymphoma
sex disparity in cancer
Ccl21
Research organism

Mouse
Human
http://dx.doi.org/10.13039/501100004431 Fondation de France Comité tumeurs Toledo Franck http://dx.doi.org/10.13039/501100004099 Ligue Contre le Cancer Labellisation Toledo Franck http://dx.doi.org/10.13039/501100004099 Ligue Contre le Cancer Comité Ile de France Toledo Franck http://dx.doi.org/10.13039/501100004097 Fondation ARC pour la Recherche sur le Cancer Toledo Franck http://dx.doi.org/10.13039/501100000781 European Research Council 875532-Prostator-ERC-2019-PoC Morillon Antonin The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementThe male-specific tumor-suppressive effects of minor p53 isoforms were correlated with higher Ackr4 expression levels, which have implications for sex-specific cancer prognosis in humans.
publishing-routeprc
==== Body
pmcIntroduction

TP53, the human gene for tumor suppressor p53, encodes several isoforms owing to distinct promoters, alternative splicing, and multiple translation initiation sites (Bourdon et al., 2005; Courtois et al., 2002; Flaman et al., 1996; Yin et al., 2002). p53 alternative isoforms can be abnormally expressed in cancer cells and some may regulate the canonical p53 protein (Anbarasan and Bourdon, 2019; Bourdon et al., 2005; Mondal et al., 2013; Senturk et al., 2014). However, aberrant RNA splicing is a common feature of cancer cells (Graubert et al., 2012; Martin et al., 2013; Pajares et al., 2007; Sette and Paronetto, 2022) and to which extent alternative splicing generates functionally relevant proteins is controversial (Abascal et al., 2015; Bardot and Toledo, 2015; Blencowe, 2017; Tress et al., 2017a; Tress et al., 2017b; Ule and Blencowe, 2019; Weatheritt et al., 2016). Thus, the biological importance of many p53 isoforms remains elusive.

Like its human TP53 homolog, the murine Trp53 gene encodes multiple isoforms differing in their N- or C-termini (Arai et al., 1986; Marcel et al., 2011). Mouse models to evaluate the role of p53 isoforms differing in their N-terminus revealed that Δ40-p53 overexpression leads to accelerated ageing (Maier et al., 2004; Steffens Reinhardt et al., 2020). However, the potential role of p53 isoforms with an alternative C-terminus was not analyzed in vivo. p53 isoforms with distinct C-termini result from the splicing of two mutually exclusive final exons: exon 11, encoding the canonical ‘α’ C-terminal domain, and the alternatively spliced (AS) exon, encoding another C-terminus (Arai et al., 1986). In adult mice, isoforms with the canonical C-terminus are predominant in all tissues (Figure 1—figure supplement 1A). Two models (Trp53Δ31 and Trp53ΔCTD), designed to study the consequences of a loss of the canonical p53 C-terminus, exhibited signs of increased p53 activity, leading to a rapidly lethal anemia (Hamard et al., 2013; Simeonova et al., 2013). To determine the role of p53-AS isoforms in vivo, we created Trp53ΔAS, a mouse model with a specific deletion of the AS exon (Figure 1—figure supplement 1B). In mouse embryonic fibroblasts (MEFs), the Trp53ΔAS allele prevented the expression of isoforms with the AS C-terminus, whereas it did not affect RNA levels for p53 isoforms with the canonical C-terminus (Figure 1—figure supplement 1C). We previously used this model to show that p53-AS isoforms had no role in the anemia affecting Trp53Δ31/Δ31 mice (Simeonova et al., 2013). However, a detailed phenotyping of Trp53ΔAS/ΔAS mice remained to be performed. The detailed phenotyping, presented here, yielded surprising information on lymphomagenesis.

Results

Stress responses in WT and Trp53ΔAS/ΔAS cells

We analyzed cellular stress responses in thymocytes, known to undergo a p53-dependent apoptosis upon irradiation (Lowe et al., 1993), and in primary fibroblasts, known to undergo a p53-dependent cell cycle arrest in response to various stresses; for example, DNA damage caused by irradiation or doxorubicin (Kastan et al., 1992), and the Nutlin-mediated inhibition of Mdm2, a negative regulator of p53 (Vassilev et al., 2004). We first compared thymocytes from irradiated wild-type (WT) and Trp53ΔAS/ΔAS mice. In WT thymocytes, isoforms with the AS C-terminus were five times less abundant than isoforms with the α C-terminus at the RNA level (Figure 1A), and in western blots the p53-AS protein appeared as a faint band running just ahead of, and often hard to separate from, the band specific for p53-α, the canonical full-length p53 (Figure 1B). In Trp53ΔAS/ΔAS thymocytes, mRNA levels for α isoforms were slightly decreased, if at all (Figure 1A), whereas p53-α protein levels appeared markedly decreased (Figure 1B), raising the possibility that p53-AS isoforms might contribute to p53-α abundance. Nevertheless, the transactivation of classical p53 target genes (Figure 1C) and apoptotic response (Figure 1D, Figure 1—figure supplement 1D) were not significantly altered by the loss of AS isoforms. Likewise, no significant difference was observed between WT and Trp53ΔAS/ΔAS fibroblasts in assays for cell cycle control (Figure 1E, Figure 1—figure supplement 1E), expression of well-known p53 target genes (Figure 1F, Figure 1—figure supplement 1F and G), proliferation under hyperoxic conditions (Figure 1G), or the growth of tumor xenografts (Figure 1H).

Figure 1. The loss of p53-AS isoforms does not alter cellular stress responses or survival to spontaneous tumors.

(A) mRNAs for p53-α and p53-AS isoforms from thymocytes of irradiated mice were quantified by RT-qPCR, and p53-α levels in Trp53+/+ mice were assigned a value of 1. Means ± SEM (n = 3). (B) Protein extracts from thymocytes of Trp53+/+ (WT) or Trp53ΔAS/ΔAS (ΔAS) irradiated mice were immunoblotted with p53 or actin antibodies. After normalization to actin, full-length (FL) p53-α levels in WT thymocytes were assigned a value of 1. (C) mRNA levels of p53 target genes in thymocytes, before or after γ-irradiation. Means ± SEM (n = 3). (D) Thymocyte apoptotic response to γ-irradiation. Means ± SEM (n = 6). (E) Cell cycle control in mouse embryonic fibroblasts (MEFs) after γ-irradiation. Asynchronous MEFs were exposed to 0–10 Gy γ-irradiation, and after 24 hr, cells were labeled with BrdU for 1 hr and analyzed by FACS. Means ± SEM from >3 independent experiments with at least two independent MEF clones per genotype. (F) mRNA levels of p53 target genes in MEFs untreated or treated with 0.5 μg/ml of clastogenic doxorubicin (Doxo) or 10 μM of the Mdm2 antagonist Nutlin. Means ± SEM from >3 experiments with ≥2 independent MEF clones. (G) MEFs proliferation under hyperoxic conditions. Cells were grown according to a 3T3 protocol. Each point is the mean from four independent MEF clones, the value for each clone resulting from triplicates. (H) Growth of tumor xenografts. E1A+Ras-expressing MEFs were injected into the flanks of nude mice and tumor volumes were determined after 1–25 days. Means ± SD (n = 4 per timepoint and genotype). (I) Tumor-free survival of Trp53+/+ and Trp53ΔAS/ΔAS mice (n = cohort size). (J) Incidence of the indicated tumor types, determined at death after macroscopic examination and histological analysis of Trp53+/+ (WT) and Trp53ΔAS/ΔAS (ΔAS) mice. In (A, D, E), ns = non-significant in Student’s t-test.

Figure 1—source data 1. Raw unedited gels and blots for Figure 1B.

Figure 1—source data 2. Uncropped and labeled gels and blots for Figure 1B.

Figure 1—figure supplement 1. Description of the Trp53ΔAS mouse model and analysis of Trp53ΔAS/ΔAS thymocytes and fibroblasts.

(A) Relative expression of p53 isoforms with an α or AS C-terminus in tissues of wild-type mice. RNAs were prepared from the indicated tissues of wild-type mice, then p53-AS and p53-α mRNAs were quantified by RT-qPCR. Results are expressed as mean AS/α ratios ± SD, from three independent experiments. (B) Comparative maps of the wild-type (WT) and ΔAS Trp53 alleles. Left, top: the 3’ end of the WT Trp53 gene is shown; black line: intron 10; boxes are for exons, with graytones for translated regions from exon 10 (light gray), exon 11 (dark gray), and exon AS (black). Left, below: the WT Trp53 allele encodes proteins with two different C-termini. (4D: tetramerization domain; CTD: C-terminal domain). Right, top: the 3’ end of the Trp53ΔAS allele is shown; the AS exon was deleted and replaced by a SpeI restriction site. Right, below: the Trp53ΔAS allele only enables the synthesis of proteins with the ‘canonical’ α C-terminus. (C) Quantifications of p53 isoforms with an AS or an α C-terminus, in mouse embryonic fibroblasts (MEFs) of the indicated genotypes, that were either untreated, or treated for 24 hr with 0.5 μg/ml doxorubicin (Doxo) or 10 μM Nutlin. Means ± SEM from >3 experiments with ≥2 independent MEF clones of each genotype are shown. ***p<0.001, *p<0.05, °p=0.07 by Student’s t-test. (D) Apoptotic responses of Trp53+/+ and Trp53ΔAS/ΔAS thymocytes. Trp53+/+ and Trp53ΔAS/ΔAS mice were irradiated and their thymocytes were recovered and analyzed by FACS after annexin V-FITC staining. A typical experiment for cells of each genotype and condition is shown. Numbers indicate % cells, apopt.: apoptotic cells. (E) Cell cycle control of Trp53-/-, Trp53+/+, and Trp53ΔAS/ΔAS fibroblasts. Asynchronous MEFs were exposed to 0–10 Gy γ-irradiation, then after 24 hr cells were labeled with BrdU for 1 hr and analyzed by FACS. A typical experiment for cells of each genotype and condition is shown, with % of cells in G1, S, and G2/M mentioned in each panel. (F) mRNA levels of the indicated genes were quantified in MEFs of the indicated genotypes left untreated or treated for 24 hr with 0.5 μg/ml Doxo or 10 μM Nutlin-3 (Nutlin). Means ± SEM from at least three experiments with two independent MEF clones of Trp53+/+ and Trp53ΔAS/ΔAS genotypes are shown. (G) mRNA levels of the indicated genes were quantified in MEFs of the indicated genotypes left untreated or treated for 24 hr with 15 μM etoposide (Eto). Means ± SEM from at least three experiments with two independent MEF clones per genotype.

Lymphomagenesis in WT and Trp53ΔAS/ΔAS mice

We compared spontaneous tumor onset in WT and Trp53ΔAS/ΔAS littermates for over 2 years and observed no significant difference in tumor-free survival (Figure 1I). Because lymphoma is a common neoplasm in C57Bl/6J WT mice (Brayton et al., 2012) and our mouse cohorts resulted from >10 generations of backcrosses with C57Bl/6J mice, we searched for evidence of lymphoma in the lymph nodes and spleen, by macroscopic examination at autopsy and histological analyses. B-cell lymphomas were observed in about 30% of mice of either genotype (Figure 1J). In WT mice, a higher incidence of B-cell lymphomas was observed in females, in agreement with previous observations (Brayton et al., 2012). By contrast, no obvious sex-specific bias was observed for B-cell lymphomas in Trp53ΔAS/ΔAS mice (Figure 1J), raising the possibility that the loss of p53-AS isoforms affected B-cell lymphomagenesis. However, the numbers of lymphoma-bearing mice were too small to be conclusive.

We next used Eμ-Myc transgenic mice, prone to highly penetrant B-cell lymphomas (Adams et al., 1985). Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice developed B-cell lymphomas (Figure 2—figure supplement 1A) with similar survival curves when sexes were not considered (Figure 2—figure supplement 1B). Importantly, however, death was accelerated, and tumor lymph nodes were larger, in Trp53ΔAS/ΔAS Eμ-Myc males compared to their Trp53+/+ Eμ-Myc male counterparts, whereas no difference in lymphomagenesis was noticeable between Trp53ΔAS/ΔAS Eμ-Myc and Trp53+/+ Eμ-Myc female mice (Figure 2A and B). Our data (Figure 2A and B, Figure 2—figure supplement 1C), together with the fact that B-cell lymphomas occur with a higher incidence in WT C57Bl/6J female mice (Brayton et al., 2012), suggested that Trp53+/+ Eμ-Myc male mice are more refractory to B-cell lymphomas, and that p53-AS isoforms might confer this male-specific protection against lymphomagenesis.

Figure 2. Male-specific acceleration of Myc-induced B-cell lymphomagenesis in mice lacking p53-AS isoforms.

(A) Tumor-free survival of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice, classified according to sex (n = cohort size). (B) Tumor volumes upon dissection of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice, classified according to sex. Means ± SEM from 100 lymph nodes from Trp53+/+ Eμ-Myc males, 96 from Trp53+/+ Eμ-Myc females, 148 from Trp53ΔAS/ΔAS Eμ-Myc males, and 124 from Trp53ΔAS/ΔAS Eμ-Myc females. (C) Myc mRNA and protein levels in lymph node tumors. (D) Levels of p53-α and p53-AS transcripts and p53 protein levels in lymph node tumors. (E) Transcript levels of the indicated p53 target genes. Means ± SEM (n = 6 per genotype). (F, G) Apoptosis (F) and cell proliferation (G) in tumor lymph nodes from Eμ-Myc males were determined by immunohistochemistry with antibodies against cleaved caspase-3 and ki67, respectively. Positive cells were counted and normalized to the analyzed areas. Means ± SEM (n = 6 mice per assay and genotype). In (F, G) scale bars = 50 μm. Statistical analyses with Mantel–Cox (A) and Student’s t (B–G) tests. ***p<0.001, *p<0.05, ns: nonsignificant.

Figure 2—source data 1. Raw unedited gels and blots for Figure 2C.

Figure 2—source data 2. Raw unedited gels and blots for Figure 2D.

Figure 2—source data 3. Uncropped and labeled gels and blots for Figure 2C.

Figure 2—source data 4. Uncropped and labeled gels and blots for Figure 2D.

Figure 2—figure supplement 1. Analysis of tumors from Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc mice.

(A) Histological analyses of Eμ-Myc-induced tumor lymph nodes. Tumor lymph nodes were analyzed by hematoxilin-eosin staining (H&E), or antibodies against B220 (a B-cell-specific marker) or CD3 (a T-cell-specific marker). Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice developed similar B-cell lymphomas, characterized by massive tissue homogenization of the lymph node by B cells. Scale bars = 50 μM. (B) Tumor-free survival of Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc mice are similar when sexes are not considered (n = cohort size). (C) Increased tumor-free survival of Trp53+/+ Eμ-myc males compared to Trp53ΔAS/ΔAS Eμ-Myc males, Trp53+/+ Eμ-Myc females and Trp53ΔAS/ΔAS Eμ-Myc females (n = cohort size). Statistical analysis with Mantel–Cox test. (D) Trp53 DNA sequencing of Trp53+/+ Eμ-myc and Trp53ΔAS/ΔAS Eμ-Myc tumors. The portion of the Trp53 gene encoding the DNA Binding domain (DBD), most frequently mutated in cancers, was sequenced for 14 tumors from Trp53+/+ (WT) Eμ-myc males and 18 tumors from Trp53ΔAS/ΔAS (ΔAS) Eμ-myc males, and Trp53 mutations were found in 3/14 and 1/18 tumors, respectively. (E) Details on the four p53 mutations identified in (D).

Cause for accelerated lymphomagenesis in Trp53ΔAS/ΔAS Eμ-Myc males

We next aimed to determine the mechanisms underlying the accelerated lymphomagenesis in Trp53ΔAS/ΔAS Eμ-Myc males. Inactivating p53 mutations were not more frequent in tumors from Trp53ΔAS/ΔAS Eμ-Myc males than in those from Trp53+/+ Eμ-Myc males, ruling out additional mutations at the Trp53 locus as potential causes for accelerated lymphomagenesis in Trp53ΔAS/ΔAS Eμ-Myc males (Figure 2—figure supplement 1D and E). We next analyzed a subset of tumors with no detectable Trp53 mutation in males of both genotypes and found that Myc was expressed at similar RNA and protein levels in all tumors (Figure 2C). No difference in p53-α mRNA levels was observed in tumors from both genotypes, although a decrease at the protein level was detected in most tumors from Trp53ΔAS/ΔAS Eμ-Myc males (Figure 2D). Nevertheless, similar transcript levels for classical p53 target genes were observed in tumor cells of both genotypes (Figure 2E). To test whether a higher tumor volume in Trp53ΔAS/ΔAS Eμ-myc males might result from lower apoptosis and/or higher cell proliferation, we next analyzed tumors by immunohistochemistry with antibodies against cleaved caspase-3 or ki-67, respectively. Similar apoptotic and proliferation indexes were observed for both genotypes (Figure 2F and G). In sum, classical assays for p53 activity in tumors failed to account for differences between the two male genotypes.

The speed of lymphomagenesis in Eμ-Myc mice correlates with the extent of B-cell expansion in the first stages of B-cell differentiation (Langdon et al., 1986) and p53 was proposed to control the pool of early B cells (Slatter et al., 2010). Therefore, we determined the levels of the early pre-B/ immature B cells in 6-week-old mice, before any sign of tumor. We analyzed the spleen, a preferential site of B-cell expansion (Langdon et al., 1986) with a relatively high AS/α isoform ratio (Figure 1—figure supplement 1A). Flow cytometry with a combination of markers was used to discriminate the pre-B, immature, transitional, and mature B subpopulations. As expected (Langdon et al., 1986), we observed high numbers of pre-B and immature B cells in Eμ-Myc mice. In males, pre-B and immature B cells were more abundant in Trp53ΔAS/ΔAS Eμ-Myc animals, while no difference was observed for transitional and mature B cells (Figure 3A, Figure 3—figure supplement 1A). By contrast, in the spleen of Trp53+/+ and Trp53ΔAS/ΔAS 6-week-old male mice without the Eμ-Myc transgene, most B cells were mature B cells (Figure 3—figure supplement 1B). In Eμ-Myc females, the numbers of pre-B and immature B cells were similar between genotypes, as were the numbers of transitional and mature B cells (Figure 3A). Interestingly, Trp53+/+ Eμ-myc males, which develop lymphomas less rapidly, exhibited the lowest number of immature B cells (Figure 3A), suggesting a direct correlation between the level of immature B cell expansion and the speed of lymphomagenesis. Together, these data suggested that p53-AS isoforms may not be required to control the pool of early B cells under normal conditions, but that in an Eμ-Myc context they would limit the expansion of pre-tumor early B cells, specifically in males.

Figure 3. The loss of p53-AS isoforms affects Ackr4 expression in Eμ-Myc male mice.

(A) B-cell subpopulations in spleens of 6-week-old Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice. Means ± SEM (n = 6 per genotype). (B, C) RNAseq analysis of spleens from Trp53+/+ Eμ-Myc (n = 3) and Trp53ΔAS/ΔAS Eμ-Myc (n = 4) 4–6-week-old male mice. Volcano plot (B), with differentially expressed genes (DEGs) in red. Unsupervised clustering heatmap plot (C), with DEGs ranked according to mean fold changes, and protein-coding genes in bold. (D) RT-qPCR analysis of candidate DEGs from spleens of Trp53+/+ (p53WT) Eμ-Myc males and Trp53ΔAS/ΔAS (p53ΔAS) Eμ-Myc males. Means ± SEM (n = 3–4 per genotype). (E) RT-qPCR analysis of indicated DEGs from spleens of 4–6-week-old Trp53+/+ Eμ-Myc males, Trp53ΔAS/ΔAS Eμ-Myc males, Trp53+/+ Eμ-Myc females, and Trp53ΔAS/ΔAS Eμ-Myc females. Means ± SEM (n = 3–4 per sex and genotype). (F) Ackr4 is transactivated by p53 in response to stress. Ackr4 mRNAs in untreated or doxorubicin-treated WT and Trp53-/- mouse embryonic fibroblasts (MEFs). Data from 2 to 3 MEFs per genotype (Younger et al., 2015). (G) A putative p53 response element in Ackr4 intron 1. Top: map of the Ackr4 gene. (boxes: exons [brown box: translated region]; black line: intron 1); middle: p53 ChIP in doxorubicin-treated MEFs according to ChIP-Atlas (SRX270554) (Oki et al., 2018); bottom: p53 Response Element (p53RE) consensus sequence (R = G or A, W = A or T, Y = C or T), the putative p53RE and its mutated counterpart. (H) Luciferase assays of the candidate p53RE. A 1.5 kb fragment containing the WT or mutant p53RE was cloned upstream a luciferase reporter, then transfected into Trp53-/- MEFs together with an expression plasmid for full length p53 (FL), p53-AS or the DNA-binding mutant p53R270H (RH). Means ± SEM (n = 4–6). (I) In MEFs, p53 activation leads to an increased Ackr4 expression attenuated by estradiol. Ackr4 and Cdkn1a mRNAs were quantified by RT-qPCR from Trp53+/+ and Trp53ΔAS/ΔAS MEFs, untreated or treated with 10 μM Nutlin and/or 5 μg/ml 17-β estradiol (E2). Means ± SEM from four independent experiments. (J) Evidence for Myc binding at the Mt2 promoter in B cells. ChIP-Atlas reports Myc binding to Mt2 promoter sequences in primary B cells from the lymph nodes of Eμ-Myc mice (SRX353785, SRX353783) and in Eμ-Myc-induced lymphoma cells (SRX522383). Chr: chromosome. (K) Gene set enrichment analysis (GSEA). GSEA, performed in Trp53+/+ Eμ-Myc (WT_Myc) and Trp53ΔAS/ΔAS Eμ-Myc (p53DAS_Myc) male splenic cells, indicated an enrichment of hallmark Myc targets in Trp53ΔAS/ΔAS Eμ-Myc cells. In (A, D, E, F, H, I) **p<0.001, **p<0.01, *p<0.05, °p≤0.057, ns: nonsignificant in Student’s t or Mann–Whitney tests.

Figure 3—figure supplement 1. Analysis of pre-tumoral spleens.

(A) Cell sorting of B-cell subpopulations by FACS. Splenic cells were incubated with DAPI and the following antibodies: APC rat anti-mouse CD45R/B220, FITC rat anti-mouse CD43, PE rat anti-mouse IgM, and BV605 rat anti-mouse IgD. First, the B220+ CD43 cells were selected from DAPI-negative living cells, subsequently yielding four different B subpopulations based on IgM and IgD labeling: IgM-/IgD- pre-B cells (box 1), IgM low/IgD- immature B cells (box 2), IgM high/IgD- transitional B cells (box 3), and IgM+/IgD + mature B cells (box 4). Typical results with a Trp53+/+ Eμ-Myc male mouse and a Trp53ΔAS/ΔAS Eμ-Myc male mouse are shown. (B) The loss of p53-AS isoforms does not impair B-cell differentiation in 6-week-old non-transgenic male mice. Means ± SEM from four mice per genotype. ns: nonsignificant by Student’s t-test. (C) Control for expression of p53-FL, p53-AS, and p53R270H in luciferase assays. As a control to luciferase experiments reported in Figure 3H, protein extracts from Trp53-/- mouse embryonic fibroblasts (MEFs) transfected with expression plasmids for p53-FL, p53-AS, or p53R270H were immunoblotted with antibodies against p53, p21, and actin. Quantifications are relative to actin. p53-FL and p53-AS were expressed at similar levels and both transactivated p21, whereas the DNA-binding mutant p53R270H was expressed at higher amounts but failed to transactivate p21, as expected. nd: not determined.

Figure 3—figure supplement 1—source data 1. Raw unedited gels and blots for Figure 3—figure supplement 1C.

Figure 3—figure supplement 1—source data 2. Uncropped and labeled gels and blots for Figure 3—figure supplement 1C.

Transcriptomes from Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc male spleens

We next performed bulk RNA-seq and differential expression analyses comparing the spleens from 4- to 6-week-old Trp53ΔAS/ΔAS Eμ-Myc males to spleens from age-matched Trp53+/+ Eμ-Myc males. This revealed a limited number of significantly deregulated genes (Figure 3B), including 13 protein-coding genes and 11 pseudogenes (Figure 3C). Out of the 13 protein-coding genes, we focused on the 10 genes not encoding an immunoglobulin and analyzed the same samples by RT-qPCR (Figure 3D). For 6 of the 10 genes, expression levels were too low to be quantified (Tcstv3), or differences in expression were not statistically significant (Masp2, Akr1c19, Cd300lh, Il5ra, Slc26a1). Of note, Il5ra belonged to this group, although it is regulated by p53 (Zhu et al., 2022), which illustrates the difficulty to analyze subtle effects in our experiments. Taking this into account, we considered as potentially interesting the four remaining genes, exhibiting differences in mRNA levels with statistical significance (p<0.05) or borderline statistical significance (p=0.057): Ackr4, less expressed in Trp53ΔAS/ΔAS Eμ-Myc males, and Fam132a, Mt2, and Prss50, with an increased expression in Trp53ΔAS/ΔAS Eμ-Myc males (Figure 3D). Importantly, survival curves indicated that the Myc-induced lethality was delayed in Trp53+/+ Eμ-Myc males compared to Trp53ΔAS/ΔAS Eμ-Myc males, Trp53+/+ Eμ-Myc females, and Trp53ΔAS/ΔAS Eμ-Myc females (Figure 2—figure supplement 1C). Thus, we quantified transcripts for Ackr4, Fam132a, Mt2, and Prss50 in the spleen of 4–6-week-old Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc females, then compared mRNA levels in Trp53+/+ Eμ-Myc males versus the three other groups. Significantly higher expression of Ackr4 and lower expression of Mt2 were found in Trp53+/+ Eμ-Myc males (Figure 3E).

Ackr4 (also known as Ccrl1) encodes the atypical chemokine receptor 4, a decoy receptor promoting the degradation of chemokines that modulate cancer cell proliferation and metastasis (Chow and Luster, 2014; Marcuzzi et al., 2018; Müller et al., 2001). Our data suggested that Ackr4 might be a gene transactivated by p53-α and/or p53-AS isoforms. Consistent with this, by extracting data from a transcriptome-wide study in MEFs (Younger et al., 2015), we found evidence for a p53-dependent transactivation of Ackr4 in response to doxorubicin (Figure 3F). Furthermore, ChIP-Atlas, the database of chromatin immunoprecipitation experiments (Oki et al., 2018), indicated p53 binding to sequences within the intron 1 of Ackr4 in doxorubicin-treated MEFs, and we identified a candidate p53 responsive element in this intron (Figure 3G). We next used luciferase assays to show that this p53 responsive element can be bound and regulated by both p53-α and p53-AS (Figure 3G and H, Figure 3—figure supplement 1C). Together, these data show that Ackr4 is indeed a p53 target gene, although RNAseq data indicated that it is expressed at much lower levels than classical p53 targets like Cdkn1a or Mdm2 in the splenic cells of Eμ-Myc mice (Supplementary file 1). Furthermore, Ackr4 was shown to be regulated by Foxl2 and estrogen signaling in ovarian cells (Georges et al., 2014) and 17-β estradiol was recently found to regulate ACKR4 expression in meniscal cells from both sexes, albeit differentially (Knewtson et al., 2020). Accordingly, we observed, in both WT and Trp53ΔAS/ΔAS MEFs, that p53 activation with the Mdm2 antagonist Nutlin led to the transactivation of Ackr4, but that a concomitant treatment with 17-β estradiol markedly decreased, or completely abrogated, Ackr4 transactivation (Figure 3I). By contrast, Cdkn1a was efficiently transactivated under both conditions in mutant and WT cells (Figure 3I). These data indicate that Ackr4 is a p53 target gene whose p53-mediated transactivation can be inhibited by estrogens.

The Mt2 gene, encoding the potentially oncogenic metallothionein-2 (Si and Lang, 2018), was less expressed in Trp53+/+ Eμ-Myc male pre-tumoral splenic cells, which raised the possibility of its direct or indirect repression by p53, potentially through the binding of p53 or the DREAM complex at its promoter (Engeland, 2018; Peuget and Selivanova, 2021). However, ChIP-Atlas reported no binding of these proteins at the Mt2 promoter. Alternatively, evidence that Myc may impact on Mt2 expression was obtained previously (Qin et al., 2021), and ChIP-Atlas reported Myc binding at the Mt2 promoter in primary B cells from lymph nodes of Eμ-Myc mice as well as Eμ-Myc-induced lymphoma cells (Figure 3J). This may suggest that the lower expression of Mt2 in pre-tumoral splenic cells from Trp53+/+ Eμ-Myc males (Figure 3E) might result from a subtle difference in Myc signaling. Consistent with this, the comparison of transcriptomes of splenic cells from Trp53ΔAS/ΔAS Eμ-Myc males and Trp53+/+ Eμ-Myc males, when analyzed by gene set enrichment analysis (Subramanian et al., 2005), revealed an enrichment of hallmark Myc target genes in Trp53ΔAS/ΔAS Eμ-Myc male splenic cells (Figure 3K, Supplementary file 2).

Relevance of ACKR4 expression in Burkitt lymphomas

Murine and human alternatively spliced p53 isoforms exhibit structural differences (Marcel et al., 2011) and the ChIP-Atlas database (Oki et al., 2018) does not report p53 binding to the human ACKR4 intron 1. Nevertheless, we found that p53 activation in human cells also led to an increased ACKR4 expression abrogated by 17-β estradiol, whereas 17-β estradiol had no significant effect on the p53-mediated transactivation of CDKN1A (Figure 4A). This led us to investigate the potential relevance of ACKR4 expression in human B-cell lymphomas. We analyzed public databases of B-cell lymphomas patients with clinical and gene expression information. We first analyzed #GSE4475 (Hummel et al., 2006), a dataset of mature aggressive B-cell lymphomas previously used to define Burkitt lymphoma-like specific transcriptomes, comprising 159 patients (91 men, 68 women) with clinical follow-up. Overall, ACKR4 gene expression was not significantly different between male and female patients (Figure 4B, left). However, average mRNA levels appeared higher in males when we considered the 30% patients of each sex with the highest ACKR4 expression (Figure 4B, right). Strikingly, when we compared the survival of 30% patients with the highest ACKR4 mRNA levels to the survival of the 30% patients with the lowest ACKR4 mRNA levels, high ACKR4 expression correlated with a better prognosis in men, but not in women (Figure 4C). By contrast, for MT2A, the human homolog of Mt2, differences in mRNA levels did not correlate with significant differences in survival for either sex (Figure 4—figure supplement 1A).

Figure 4. ACKR4 is a male-specific prognostic factor in Burkitt lymphoma.

(A) In human cells, p53 activation leads to an increased ACKR4 expression abrogated by estradiol. ACKR4 and CDKN1A mRNAs were quantified by RT-qPCR from p53-proficient (MRC5) and p53-deficient (MRC5-SV40) human fibroblasts, untreated or treated with Nutlin and/or estradiol (E2). Means ± SEM from four independent experiments. (B, C) Analysis of lymphoma dataset #GSE4475. ACKR4 gene expression was plotted for all lymphoma patients with clinical follow-up (91 men [M], 68 women [W]), classified according to sex (B, left). Gene expression (B, right) or survival curves (C) were plotted for the 30% patients (27 men, 20 women) with the highest or lowest ACKR4 expression, classified according to sex. (D, E) Analysis of Burkitt lymphoma-specific dataset #phs00235. ACKR4 gene expression was plotted for all patients with a Burkitt lymphoma diagnosed at age 0–17 (48 males, 29 females), classified according to sex (D, left). Gene expression (D, right) or survival curves (E) were plotted for the 30% patients (15 men, 9 women) with the highest or lowest ACKR4 expression, classified according to sex. (F) The knockout of ACKR4 in Burkitt lymphoma Raji cells increases their CCL21-guided migration. Chemotaxis was assayed by using Boyden chambers with bare polycarbonate membranes as previously described (Calpe et al., 2011). Equal number of cells were deposited on the membrane of a transwell insert, then migration was determined by counting cells in the lower compartment, after 15 hr of culture with or without CCL21 added to the lower chamber. Statistical analyses by Student’s t or Mann–Whitney tests (A, B, D, F) and Mantel–Cox (C, E) test. ***p<0.001, **p<0.01, *p<0.01, °p=0.054, ns: nonsignificant.

Figure 4—figure supplement 1. Further analyses of human B-cell lymphoma or multiple myeloma datasets.

(A) MT2A gene expression is not a prognostic marker in human B-cell lymphomas. Survival curves for the 30% patients with the highest MT2A mRNA levels and the 30% patients with the lowest MT2A mRNA levels according to sex (n = cohort sizes), for patients from dataset #GSE4475. (B) ACKR4 is a prognostic factor in Burkitt lymphomas but not in diffuse large B-cell lymphomas. Survival curves of patients from dataset #GSE181063, for the 30% patients with the highest ACKR4 mRNA levels and the 30% patients with the lowest ACKR4 mRNA levels, classified according to sex (n = cohort sizes), and diagnosed with either a diffuse large B-cell (top) or a Burkitt (bottom) lymphoma. (C) ACKR4 is not a prognostic factor in Multiple Myeloma. Survival curves of patients from dataset #GSE136337, for the 30% patients with the highest ACKR4 mRNA levels and the 30% patients with the lowest ACKR4 mRNA levels in malignant plasma cells, classified according to sex (n = cohort sizes). Statistical analyses in all panels by Mantel–Cox test.

Figure 4—figure supplement 2. Strategy to knockout ACKR4 in Burkitt lymphoma cells.

Burkitt lymphoma cells were transfected with a PX459 vector expressing Cas9, a puromycin resistance gene and either of two guide RNAs targeting ACKR4 (or no guide RNA for control), then puromycin-resistant cells were selected and recovered either as cellular pools or diluted to get one cell per five wells in a 96-well plate to isolate cellular clones. Individual clones were then expanded, and clonal cell populations were split for freezing and DNA extraction. DNA was analyzed by performing a PCR amplifying a fragment of ACKR4, then amplified products were cloned in a PGL3 plasmid for DNA sequencing. For each cellular clone, eight plasmid clones were sequenced to ensure information on both ACKR4 alleles.

Figure 4—figure supplement 3. Characterization of ACKR4 KO Burkitt lymphoma cell clones.

(A) Characterization of the ACKR4 KO 4.14 clone. Left, DNA sequences of the region targeted by the guide RNA g4. Compared to the WT ACKR4 DNA sequence from Burkitt lymphoma (BL) Raji control cells (center), the 4.14 clone has two mutated alleles: allele a, with a deletion of 17 nt (top) and allele b, with a deletion of 4 nt (bottom). Right, comparison of the ACKR4 proteins encoded by WT alleles from BL Raji control cells (center), or by the 4.14a (top) and 4.14b mutated alleles (bottom). The WT ACKR4 protein consists of 350 amino acids, including a DRY motif (at residues 136–138) essential for signal transduction. The protein region corresponding to the target of guide RNA g4 is indicated. Allele 4.14a encodes a putative protein with 59 N-terminal residues of ACKR4 and 34 amino acids of unrelated sequence due to the mutational frameshift. Allele 4.14b encodes a putative protein with 60 N-terminal residues of ACKR4. (B) Characterization of the ACKR4 KO 5.2 clone. DNA sequences of the region targeted by the guide RNA g5 (left) and comparison of the encoded ACKR4 proteins (right), are represented as in (A).

Figure 4—figure supplement 4. The knockout of ACKR4 in Burkitt lymphoma Raji cells does not impact their proliferation.

Equal numbers of cells of the indicated genotypes were seeded, then cultured for 15 hr with or without CCL21 and counted. Statistical analyses by Student’s t-test. ns: nonsignificant.

We also analyzed dataset #GSE181063 (Lacy et al., 2020), comprising mostly diffuse large B-cell lymphomas (DLBCL; 613 men, 536 women) and a few Burkitt lymphomas (65 men, 18 women). We found no difference in survival curves of DLBCL patients with low versus high ACKR4 levels, neither in men nor in women. However, there was again an increased survival for Burkitt lymphoma male patients with high ACKR4 expression, but not for women (Figure 4—figure supplement 1B). Next, we analyzed #phs000235 (Morin et al., 2011), a Burkitt lymphoma-specific dataset (65 men, 37 women) comprising mostly patients diagnosed at 0–17 years of age, hence providing cohorts homogeneous for both tumor type and age of onset. Again, ACKR4 was expressed at higher levels in a subset of male patients (Figure 4D) and high ACKR4 expression correlated with a better prognosis only in males (Figure 4E). Finally, we analyzed dataset #GSE136337 (Danziger et al., 2020), comprising data from the malignant plasma cells of patients with multiple myeloma (260 men, 166 women), and found that ACKR4 is not a prognostic factor for this cancer type (Figure 4—figure supplement 1C). Altogether, these analyses led us to conclude that, as in Eμ-Myc mice, ACKR4 is a male-specific positive prognostic factor in Burkitt lymphoma, the archetype of MYC-driven B-cell lymphomas.

We next considered the possibility that ACKR4 might be more than a biomarker, if it acts as a suppressor of MYC-driven B-cell lymphomagenesis. In support of this hypothesis, ACKR4 scavenges the chemokine CCL21, a ligand of the chemokine receptor CCR7 (Bastow et al., 2021; Ulvmar et al., 2014), and the ACKR4-mediated sequestration of CCL21 may impair the CCR7 signaling cascade, which might lead to decreased MYC activity (Shi et al., 2015). Consistent with this, a Ccr7 deficiency was shown to delay the lymphomagenesis induced by Eμ-Myc in mice (Rehm et al., 2011). In addition, Ccr7 is required for lymphoma cell lodging to secondary lymphoid organs (Rehm et al., 2011) and ACKR4 expression was inversely correlated with the metastasis capacity of different types of cancer cells (Shi et al., 2015; Zhu et al., 2014). These data suggested that ACKR4 might regulate the behavior of Burkitt lymphoma cells. To test this hypothesis, we designed a CRISPR-Cas9 approach to perform the knockout of ACKR4 in Raji cells. Raji is a Burkitt lymphoma cell line isolated from a 11-year-old male patient (Pulvertaft, 1964). Although p53 is mutated in Raji cells (Duthu et al., 1992), these cells overexpress MYC (Hamlyn and Rabbitts, 1983) and express both ACKR4 and CCR7 (Ferreira et al., 2014), suggesting that they might be suitable to evaluate the impact of ACKR4 on Burkitt lymphoma cell behavior, particularly their migratory capacities. Raji cells were transfected with a vector expressing Cas9, a puromycin resistance gene and either of two guide RNAs targeting ACKR4 (or no guide RNA for control), then puromycin-resistant cells were selected and recovered as cellular pools or diluted to isolate cellular clones (Figure 4—figure supplement 2). Both guide RNAs targeted sequences in ACKR4 mapping upstream an encoded DRY motif essential for signal transduction (Watts et al., 2013), so that Cas9-induced DNA breaks would generate knockout alleles. With this strategy, we obtained puromycin-resistant clones from Raji cells, two of which were verified to be ACKR4 KO clones by DNA sequencing (Figure 4—figure supplement 3). We compared the proliferation and migration capacities of Raji control cells (transfected with the Cas9 expression vector without guide RNAs) and the two independent ACKR4 KO Raji clones identified, cultured for 15 hr in medium supplemented or not with the CCL21 chemokine. Under these conditions, Raji cells of all genotypes appeared to proliferate similarly (Figure 4—figure supplement 4). Strikingly however, the KO of ACKR4 led to a fourfold increase in CCL21-mediated cell migration, consistent with the hypothesis that ACKR4 may hinder MYC-driven B-cell lymphomagenesis (Figure 4F).

Discussion

Here, we analyzed a mouse model with a specific deletion of the AS exon of the Trp53 gene. Despite a subtle phenotype, this model revealed that a male-specific protective effect against Eμ-Myc-induced B-cell lymphomas is lost in the absence of p53-AS isoforms. Trp53ΔAS/ΔAS males also appeared more prone to develop spontaneous lymphomas, suggesting that the sex-specific protective effect conferred by p53-AS isoforms might not be restricted to the Eμ-Myc model.

Our transcriptomic data from splenic cells of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc males disclosed very few differentially expressed genes and highlighted Ackr4 as a male-specific positive prognostic factor in Eμ-Myc-induced lymphomas. Mechanistically, we identified Ackr4, expressed at low levels in splenic cells, as a p53 target gene that may be transactivated by p53-α and/or p53-AS according to luciferase assays. That Ackr4 might be regulated by both types of p53 isoforms was expected because their DNA binding domains are identical. In fact, if one considers that p53-α isoforms appear more abundant than p53-AS isoforms in wild-type cells, and that the loss of p53-AS isoforms correlated with a decrease in p53-α levels in the thymocytes and tumor lymph nodes of mutant mice, then it seems likely that the reduced transactivation of Ackr4 in the splenic cells of Trp53ΔAS/ΔAS Eμ-Myc males could mainly result from decreased p53-α levels, rather than the loss of p53-AS isoforms per se. In addition, we observed that 17-β estradiol can inhibit the p53-mediated transactivation of Ackr4. Together, our data suggest that Ackr4 may be regulated by p53-α, p53-AS, and estrogens, likely accounting for sex-specific and p53-status-dependent differences in gene expression.

Our analyses reveal that in both mice and humans Ackr4/ACKR4 is a male-specific prognostic factor in Burkitt-like lymphomas. Furthermore, several lines of evidence suggest that Ackr4 might act as a tumor suppressor of Myc-driven B-cell lymphomas. As mentioned before, the ACKR4-mediated sequestration of CCL21 may impair the CCR7 signaling cascade, which might lead to decreased MYC activity (Shi et al., 2015). In Trp53+/+ Eμ-Myc male splenic cells, the observed lower expression of Mt2, known to be regulated by Myc (Qin et al., 2021), and of many genes that are hallmark Myc targets (as revealed by GSEA), appear consistent with this hypothesis. In addition, Ccr7 is required for lymphoma cell lodging to secondary lymphoid organs (Rehm et al., 2011) and ACKR4 expression was inversely correlated with the metastasis capacity of different types of cancer cells (Shi et al., 2015; Zhu et al., 2014). Consistent with this, we found that the KO of ACKR4 in Raji Burkitt lymphoma cells led to a dramatic increase in CCL21-guided cell migration. Finally, Ackr4 regulates B cell differentiation (Kara et al., 2018), which raises the possibility that an alteration of the p53-Ackr4 pathway in Trp53ΔAS/ΔAS Eμ-Myc male splenic cells might contribute to increase the pools of pre-B and immature B cells that may be prone to lymphomagenesis. In sum, a decrease in Ackr4 expression might promote B-cell lymphomagenesis through several non-exclusive mechanisms. Importantly, ACKR4 was previously found to inhibit the growth and metastasis of breast, cervical, colorectal, hepatocellular, and nasopharyngeal cancer cells (Feng et al., 2009; Hou et al., 2013; Ju et al., 2019; Shi et al., 2015; Zhu et al., 2014), although no report mentioned any sex-specific bias for cancers occurring in both sexes. Our data provide evidence that sex-specific differences in Ackr4 expression may have prognostic value. This suggests that measuring ACKR4 gene expression in male patients with Burkitt lymphoma could be useful to identify the patients at higher risk, for whom specific therapeutic regimens might be required.

Interestingly, our data suggested that Mt2 might be a male-specific negative prognostic factor in murine Eμ-Myc-induced lymphomas, but MT2A expression levels had no prognostic value in human lymphomas. A possible explanation for this discrepancy is suggested by the fact that Mt2 is regulated by Myc. A translocation leading to MYC overexpression drives oncogenesis in all Burkitt lymphomas, but half of them exhibit additional missense MYC mutations enhancing its tumorigenicity (Chakraborty et al., 2015). The transcriptional program of a WT and two lymphoma-associated Myc mutants were recently compared, and we noticed that one of the mutants led to an alteration in Mt2 expression (Mahani et al., 2021), which would abrogate any potential prognostic value.

Finally, a polymorphism in the MDM2 gene promoter provided evidence that sex-specific hormones may affect p53 signaling and tumorigenesis (Bond and Levine, 2007). More recently, a higher frequency of TP53 mutations in men, together with an increased vulnerability to alterations of X-linked genes encoding p53 regulators, was proposed to explain a higher cancer incidence and death in male patients (Haupt et al., 2019). Here, on the contrary, male mice and a subset of male patients were more efficiently protected against Burkitt-like lymphomas, which adds another layer of complexity to sex-specific differences in tumorigenesis. The p53 pathway thus underlies cancer sex-disparities through multiple mechanisms, which may notably include variations in p53 isoforms or Ackr4 expression.

Materials and methods

Key resources table Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information	
Gene (Mus musculus)	Trp53	GenBank	ENSMUSG00000059552		
Gene (M. musculus)	Ackr4	GenBank	ENSMUSG00000079355		
Gene (M. musculus)	Mt2	GenBank	ENSMUSG00000031762		
Gene (Homo sapiens)	ACKR4	GenBank	ENSMUSG00000129048		
Strain, strain background (M. musculus, both sexes)	Trp53ΔAS, C57Bl/6J	Simeonova et al., 2013			
Strain, strain background (M. musculus, both sexes)	Eμ−Myc, C57Bl/6J	Jackson Labs	B6.Cg-Tg(IghMyc)22Bri/J		
Strain, strain background (M. musculus, females)	CD-1 Nude
CD-1	Charles River Labs	Crl:CD1-Foxn1nu		
Strain, strain background (M. musculus, both sexes)	C57Bl/6J	Charles River Labs			
Cell line (M. musculus, both sexes)	WT, Trp53+/ΔAS, Trp53ΔAS/ΔAS, Trp53+/-, Trp53-/- fibroblasts	This paper	Primary fibroblasts prepared from E13.5 days embryos	‘Cells and cell culture reagents’	
Cell line (H. sapiens, male)	MRC5	Sigma-Aldrich	MRC5 PD19 (#05072101)		
Cell line (H. sapiens, male)	MRC5-SV40	Sigma-Aldrich	MRC5-SV2 (#84100401)		
Cell line (H. sapiens, female)	HEK293T	ATCC	CRL-3216		
Cell line (H. sapiens, male)	Raji	ATCC	CCL-86		
Cell line (H. sapiens, male)	Raji ACKR4 KO	This paper	ACKR4 KO 4.14 & 5.2 Raji derivatives	Figure 4—figure supplement 3	
Transfected construct (Adenoviral E1A)	pWZL-E1A12S	Addgene	pWZL hygro 12S E1A (#18748)		
Transfected construct (human Ras)	pBabe-Hrasv12	Addgene	pBabe-puro Ras v12 (# 1768)		
Antibody	p53 (rabbit polyclonal)	Novocastra	Leica NCL-p53-CM5p	1/2000	
Antibody	Myc (mouse monoclonal)	Santa Cruz	9E-10 sc40	1/1000	
Antibody	p21 (mouse monoclonal)	Santa Cruz	F-5 sc6246	1/200	
Antibody	Actin (mouse monoclonal)	Santa Cruz	Actin-HRP sc47778	1/5000	
Antibody	CD45R/B220 APC (rat, monoclonal)	BD Biosciences	Anti-mouse CD45R/B220 APC (#561880)	1/200	
Antibody	IgD (rat, monoclonal)	BD Biosciences	Anti-mouse IgD BV 605 (#563003)	1/100	
Antibody	CD43 (rat, monoclonal)	BD Biosciences	Anti-mouse CD43 FITC (#561856)	1/200	
Antibody	IgM (rat, monoclonal)	BD Biosciences	Anti-mouse IgM PE (#562033)	1/50	
Recombinant DNA reagent	pSpCas9(BB)–2A-Puro	Addgene	PX459 (#48139)		
Sequence-based reagent	Trp53α-F	This paper	qPCR primer	AAAGGATGCCCATGCTACAGA; Figure 1—figure supplement 1	
Sequence-based reagent	Trp53α-R	This paper	qPCR primer	TCTTGGTCTTCAGGTAGCTGGAG; Figure 1—figure supplement 1	
Sequence-based reagent	Trp53AS-F	This paper	qPCR primer	AAAGGATGCCCATGCTACAGA; Figure 1—figure supplement 1	
Sequence-based reagent	Trp53AS-R	This paper	qPCR primer	TGAAGTGATGGGAGCTAGCAGTT; Figure 1—figure supplement 1	
Sequence-based reagent	Ackr4-F	This paper	qPCR primer	GCACCTCTCCCAGCTTAAACA; Figure 3	
Sequence-based reagent	Ackr4-R	This paper	qPCR primer	AATAGTATTCCGCTGACTGGTTCAG; Figure 3	
Sequence-based reagent	ACKR4-F	This paper	qPCR primer	ACTGCTCCTCTCTGCCGACTAC; Figure 4	
Sequence-based reagent	ACKR4-R	This paper	qPCR primer	GCCATTCATTTCATTTTCCTCAT; Figure 4	
Sequence-based reagent	ACKR4-g4	This paper	Guide for CRISPR #4	TGGTAGTGGCAATTTATGCC; Figure 4—figure supplement 3	
Sequence-based reagent	ACKR4-g5	This paper	Guide for CRISPR #5	GGGCTGTTAATGCAGTTCAT; Figure 4—figure supplement 3	
Peptide, recombinant protein	CCL21	Preprotech	#300-35A		
Peptide, recombinant protein	Superscript IV	Invitrogen	TF #18090010		
Commercial assay or kit	Nucleospin RNA II	Macherey-Nagel	FS #NZ74095520		
Commercial assay or kit	Power SYBR Green	Applied Biosystems	# 4367659		
Commercial assay or kit	Supersignal West Femto	Thermo Fisher	# 34096		
Commercial assay or kit	AnnexinV-FITC apoptosis staining/ detection kit	Abcam	# Ab14085		
Commercial assay or kit	Truseq stranded Total RNA	Illumina	#20020596		
Commercial assay or kit	Nucleofector Amaxa kit V	Lonza	# VCA-1003		
Chemical compound, drug	Doxorubicin	Sigma-Aldrich	# D1515		
Chemical compound, drug	Etoposide	Sigma-Aldrich	# E1383		
Chemical compound, drug	Nutlin 3a	Sigma-Aldrich	# SML-0580		
Chemical compound, drug	17β-estradiol	Sigma-Aldrich	# E2758		
Software, algorithm	FlowJo	Beckton-Dickinson	RRID:SCR_008520	v 10.10	
Software, algorithm	featureCounts	Liao et al., 2014			
Software, algorithm	DESeq2 R package	Love et al., 2014			
Software, algorithm	GSEA software	Subramanian et al., 2005			
Software, algorithm	PWMScan	Ambrosini et al., 2018			
Software, algorithm	CRISPOR	Haeussler et al., 2016			
Software, algorithm	Prism	GraphPad	RRID:SCR_002798	v 5.0	

Mice

Design and construction of the Trp53ΔAS mouse model were previously described (Simeonova et al., 2013). A minimum of 10 backcrosses with C57Bl/6J mice of both sexes (Charles River Laboratories) were performed before establishing the cohorts of Trp53+/+ and Trp53ΔAS/ΔAS littermate mice used in this study. Mouse genotyping with multiple primer sets confirmed >99% C57Bl/6J genetic background after 10 backcrosses (primer sequences available upon request). Cohorts of Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc mice were established with identical parental origin of the Eμ-Myc transgene. For all experiments, mice housing and treatment were conducted according to the Institutional Animal Care and Use Committee of the Institut Curie (approved project #03769.02).

Cells and cell culture reagents

MEFs were isolated from 13.5 days post-coitum embryos and cultured in a 5% CO2 and 3% O2 incubator, in Dulbecco's Modified Eagle Medium (DMEM) GlutaMAX (Gibco), with 15% Fetal Bovine Serum (FBS) (PAN Biotech), 100 μM 2-mercaptoethanol (Millipore), 0.1 mM non-essential amino acids and penicillin/streptomycin (Gibco) for less than five passages, except for 3T3 experiments, performed in a 5% CO2 incubator for nine passages. Cells were treated for 24 hr with 0.5 μg/ml doxorubicin (Sigma-Aldrich), 15 μM etoposide (Sigma-Aldrich), 10 μM Nutlin 3a (Vassilev et al., 2004) (Sigma-Aldrich), and/or 5 μg/ml 17β-estradiol (Sigma-Aldrich). At least three independent experiments with at least two independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses. For estradiol assays, four independent experiments with three independent MEF male clones of each genotype were performed. Human lung fibroblast MRC5 and its SV40-transformed derivatives were cultured in a 5% CO2 and 3% O2-regulated incubator in Minimum Essential Medium (MEM) medium without Phenol Red (Gibco), completed with 10% FBS, 2 mM l-glutamine (Gibco), 1 mM pyruvate, 0.1 mM non-essential amino acids, and penicillin/streptomycin, and treated for 24 hr with 10 μM Nutlin 3a and/or 5 μg/ml 17β-estradiol (Merck). Four independent experiments were performed. Burkitt lymphoma cells (Raji or Raji ACKR4 KO derivatives) were cultured in a 5% CO2 incubator in RPMI GlutaMAX (Gibco) supplemented with 10% FBS, 2 mM l-glutamine, 1 mM pyruvate, 0.1 mM non-essential amino acids, 0.45% glucose (Sigma-Aldrich), and penicillin/streptomycin. In proliferation and migration assays, Raji control cells and two independent ACKR4 KO derivatives were treated or not for 15 hr with 1 μg/ml CCL21 (PreproTech) then counted in triplicates. For all cell lines, cell culture supernatants were found negative for mycoplasma contamination.

Quantitative RT-PCR

Total RNAs were extracted using nucleospin RNA II (Macherey-Nagel), reverse-transcribed using superscript IV (Invitrogen), and real-time quantitative PCRs were performed on an ABI PRISM 7500 using Power SYBR Green (Applied Biosystems) as previously described (Simeonova et al., 2012). For quantification of p53 isoforms in healthy tissues, a forward primer in exon 10 and a reverse primer encompassing the boundary between exons 10 and 11 were used for p53-α amplification, whereas the same forward primer and a reverse primer located in exon AS were used for p53-AS amplification (see Supplementary file 3 for primer sequences). To determine the AS/α mRNA ratios, expression levels were compared with a standard curve generated by serial dilutions of a plasmid containing both p53-AS and p53-α cDNAs.

Western blots

Thymocytes were lysed in RIPA buffer (50 mM Tris–HCl pH 8, 150  mM NaCl, 5  mM EDTA, 0.5% deoxycholic acid, 0.1% SDS, 1% NP-40) with a cocktail of protease inhibitors (Roche) and 1  mM PMSF (Sigma). Whole-cell extracts were sonicated three times for 10 s and centrifuged at 13,000  r.p.m. for 30  min to remove cell debris. MEFs or B-cell lymphomas were lysed in Giordano’s buffer (50  mM Tris–HCl pH 7.4, 250  mM NaCl, 5  mM EDTA, 0.1% Triton X-100) with a cocktail of protease inhibitors (Roche) and 1 mM PMSF (Sigma). Protein lysate concentration was determined by bicinchoninic acid (BCA) assay (Thermo Scientific) and 30  μg of each lysate was fractionated by SDS–PAGE on a 4–12% polyacrylamide gel and transferred onto polyvinylidene difluoride (PVDF) membrane (Amersham). Membranes were incubated with antibodies against p53 (CM5, Novocastra), myc (9E-10, Santa Cruz), p21 (F-5, Santa Cruz), and actin (actin-HRP sc47778, Santa Cruz) and revealed with SuperSignal West femto detection reagent (Thermo Scientific).

Apoptosis assays

Six-week-old Trp53+/+ and Trp53ΔAS/ΔAS male mice were whole-body irradiated with 5 Gy of γ-irradiation. Mice were sacrificed 4 hr later and thymocytes were recovered, stained with AnnexinV-FITC Apoptosis detection kit (Abcam), then analyzed by flow cytometry using FlowJo.

Cell-cycle assays

Log-phase MEFs were irradiated at room temperature with a CS γ-irradiator at doses of 3 or 10 Gy, incubated for 24 hr, then pulse-labeled for 1 hr with 10 μM BrdU, fixed in 70% ethanol, double-stained with FITC anti BrdU and propidium iodide, and sorted by flow cytometry using a BD FACSort. Data were analyzed using FlowJo.

Oncogene-induced tumor xenografts

MEFs with the indicated genotypes were sequentially infected with pWZL-E1A12S and pBABE-Hrasv12 viruses as previously described (Toledo et al., 2006). In total, 5 × 106 E1A- and Ras- (E1A+Ras) expressing MEFs of each genotype were injected subcutaneously into the flanks of 7-week-old female athymic nude mice (at least four mice per genotype) and tumor volumes were determined 1, 8, 15, 21, and 25 days after injection. Importantly, populations of (E1A+Ras)-expressing cells were used to minimize potential differences in expression levels that could result from independent viral insertion sites.

Cell sorting of B-cell subpopulations

Splenic cells were recovered from 6-week-old asymptomatic mice and incubated with DAPI and the following antibodies: APC rat anti-mouse CD45R/B220, FITC rat anti-mouse CD43, PE rat anti-mouse IgM, and BV605 rat anti-mouse IgD (BD Pharmingen). First, the B220+ CD43 cells were selected by flow cytometry from DAPI-negative living cells, yielding subsequently four different B subpopulations based on IgM and IgD labeling: IgM-/IgD- preB lymphocytes, IgM low/IgD- immature B lymphocytes, IgM high/IgD- transitional B lymphocytes, and IgM+/IgD+ mature B lymphocytes.

RNA-seq analysis

Total RNA was extracted from the spleen of 4–6-week--old asymptomatic mice using nucleospin RNA II (Macherey-Nagel). The quality of RNA was checked with Bioanalyzer Agilent 2100 and RNAs with a RIN (RNA integrity number) > 6 were retained for further analysis. RNA was depleted from ribosomal RNA, then converted into cDNA libraries using a TruSeq Stranded Total Library preparation kit (Illumina). Paired-end sequencing was performed on an Illumina MiSeq platform. Reads were mapped to the mouse genome version GRCm38 and counted on gene annotation gencode.vM18 with featureCounts (Liao et al., 2014). Differentially expressed genes of C57Bl/6J genetic background with an adjusted p-value<0.05 were identified using the DESeq2 R package (Love et al., 2014). Gene set enrichment analysis was performed using the GSEA software with canonical pathway gene sets from the Mouse Molecular Signature Database (Subramanian et al., 2005).

Luciferase assays

The candidate p53 responsive element (p53 RE) in the Ackr4 promoter was identified using the JASPAR database of binding profiles (Fornes et al., 2020) with the position weight matrix scanner PWMscan (Ambrosini et al., 2018). A 1.5 kb fragment from Ackr4 intron 1, containing a WT or mutant p53 RE at its center, was cloned upstream an SV40 minimal promoter and a luciferase reporter gene in the backbone of a PGL3 plasmid (Promega). We used lipofectamine 2000 to transfect Trp53-/- MEFs with 2 μg of either luciferase expression vector, 2 μg of an expression vector for p53WT, p53AS or the DNA-binding mutant p53R270H, and 30 ng of a renilla luciferase expression plasmid (pGL4.73, Promega) for normalization. Transfected cells were incubated for 24 hr, then trypsinized, resuspended in 75 μl culture medium with 7.5% FBS, and transferred into a well of an optical 96-well plate (Nunc). The dual-glo luciferase assay system (Promega) was used according to the manufacturer’s protocol to lyse the cells and read firefly and renilla luciferase signals. Results were normalized, then the average luciferase activity in cells transfected with the WT p53RE luciferase reporter and the p53R270H expression plasmid was assigned a value of 1.

Generation of ACKR4 knockout Burkitt lymphoma cells

Six guide RNAs (gRNAs) were designed to target the human ACKR4 gene using the web tool CRISPOR (Haeussler et al., 2016). For each gRNA, two reverse complementary oligonucleotides were designed (with added backbone sequences, including a 5′ G nucleotide for gRNA sequences without a 5′ G to improve transcription efficiency from a U6 promoter), annealed, and cloned in the Cas9 expression vector pSpCas9(BB)–2A-Puro (PX459) (Addgene). Preliminary tests for efficiency to induce cleavage in the targeted DNA regions were performed in HEK293T cells, which led to select the gRNAs #4 (5′-TGGTAGTGGCAATTTATGCC-3′) and #5 (5′-GGGCTGTTAATGCAGTTCAT-3′) for further experiments. Raji Burkitt lymphoma cells were transfected with a PX459 vector expressing gRNA #4 or #5 (or no gRNA for control) using Nucleofector Amaxa kit V (Lonza), and selection was carried out with 1 μg/ml puromycin for 3 weeks to obtain stably transfected cells. Clones were obtained by seeding cells at low density (1 cell/5 wells) in 96-well plates, expanded, then subdivided into two parts, half for storage in liquid nitrogen and half for ACKR4 genotyping by Sanger DNA sequencing (see Supplementary file 3 for primer sequences). For each cell clone, the ACKR4 target DNA regions were amplified by PCR, PCR products were cloned in a PGL3 plasmid, and eight transformed bacteria colonies were sequenced (Figure 4—figure supplement 2). This led to identify two homozygous ACKR4 KO clones, one (clone 4.14) obtained using gRNA #4 and one (clone 5.2) using gRNA #5 (Figure 4—figure supplement 3).

Cell migration assay

Cell migration assays toward the chemokine CCL21 were performed with Boyden chambers essentially as described (Calpe et al., 2011) by measuring transwell migration across bare polycarbonate membranes with a pore size of 5 μm (Corning). A total of 100 μl of culture medium (RPMI GlutaMAX, 10% FBS, 2 mM l-glutamine, 1 mM pyruvate, 0.1 mM non-essential amino acids, 0.45% glucose, and penicillin/streptomycin) containing 5 × 105 cells was added to a 6.5 mm diameter transwell insert, and 600 μl of culture medium with or without 1 μg/ml CCL21 were added to the lower compartment. After 15 hr at 37°C in 5% CO2, the number of migrated cells in the lower chamber was determined using a Coulter Counter.

Statistical analyses

Student’s unpaired t-tests were used in most figures to analyze the differences between WT vs. ΔAS values. Log-rank (Mantel–Cox) tests were used to analyze Kaplan–Meier tumor-free survival curves. Analyses were performed using GraphPad Prism 5, and values of p<0.05 were considered significant.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/501100004431 Fondation de France Comité tumeurs to Franck Toledo.

http://dx.doi.org/10.13039/501100004099 Ligue Contre le Cancer Labellisation to Franck Toledo.

http://dx.doi.org/10.13039/501100004099 Ligue Contre le Cancer Comité Ile de France to Franck Toledo.

http://dx.doi.org/10.13039/501100004097 Fondation ARC pour la Recherche sur le Cancer to Franck Toledo.

http://dx.doi.org/10.13039/501100000781 European Research Council 875532-Prostator-ERC-2019-PoC to Antonin Morillon.

Acknowledgements

This project was supported by grants from the Comité Tumeurs of Fondation de France (to FT), the Comité Ile-de-France and Comité national (Labellisation 2014–18) of the Ligue Nationale Contre le Cancer (to FT), and the Fondation ARC pour la recherche sur le Cancer (to FT). IS, JR, and EE were PhD fellows of the Ministère de la Recherche; JL and AMorin were postdoctoral fellows of Cancéropôle Ile-de-France and Institut National du Cancer. MG was paid by European the Research Council 875532-Prostator-ERC-2019-PoC attributed to AMoril; JCB was supported by Cancer Research-UK. We thank K Fernandes for his participation in making the ΔAS mutation, and members of the Institut Curie platforms: I Grandjean, H Gautier, C Daviaud, M Garcia, M Verlhac, A Fosse, and P Bureau (animal facility); S Baulande and S Lameiras (NGS); M Huerre, A Nicolas, and R Leclere (histopathology); Z Maciorowski, A Viguier, and S Grondin (flow cytometry).

Additional information

Competing interests

Author contributions

Ethics

Additional files

Supplementary file 1. Expression of Ackr4, Cdkn1a, and Mdm2 in Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc male splenic cells.

Read numbers for the indicated genes, obtained by Bulk RNA-seq from the spleens of three Trp53+/+ Eμ-Myc (WT_Myc) and four Trp53ΔAS/ΔAS Eμ-Myc (ΔAS_Myc) male mice.

Supplementary file 2. Details of the gene set enrichment analysis (GSEA) for hallmark Myc targets.

Datasets from Trp53+/+ Eμ-Myc and Trp53ΔAS/ΔAS Eμ-Myc male splenic cells were analyzed by GSEA. A normalized enrichment score of 2.4965038 was found for the gene set 'Hallmark_Myc_targets_V1' in Trp53ΔAS/ΔAS Eμ-Myc males. The table provides details on the profile represented in Figure 3K, with scores and positions of gene set members on the rank ordered list.

Supplementary file 3. Oligonucleotide sequences.

MDAR checklist

Data availability

RNA sequencing data have been deposited in the Gene Expression Omnibus (GEO) under the accession code GSE209708. All other data are available within the article and its supplementary information.

The following dataset was generated:

Fajac A Bardot B Toledo F Gabriel M 2024 Splenocyte mRNA profiles of 4-6 weeks-old p53+/+ Em-Myc and p53DAS/DAS Em-Myc mice NCBI Gene Expression Omnibus GSE209708

The following previously published datasets were used:

Hummel M Bentink S Berger H Klapper W Wessendorf S Barth TF Bernd H Cogliatti S Dierlamm J Feller AC Hansmann M Haralambieva E Harder L Hasenclever D Kuehn M Lenze D Lichter P Martin-Subero JI Moeller P Mueller-Hermelink H Ott G Parwaresch RM Pott C Rosenwald A Rosolowski M Schwaenen C Stuerzenhofecker B Szczepanowski M Trautmann H Wacker H Spang R Loeffler M Truemper L Stein H Siebert R 2006 A Biologic Definition of Burkitt's Lymphoma from Transcriptional and Genomic Profiling NCBI Gene Expression Omnibus GSE4475

Care MA Barrens SL 2021 Whole genome expression profiling based on paraffin embedded tissue of a large DLBCL cohort NCBI Gene Expression Omnibus GSE181063

Danziger SA McConnell M Gockley J Young MH Rosenthal A Schmitz F Reiss DJ Farmer P Alapat DV Singh A Ashby C Bauer M Ren Y Smith K Couto SS van Rhee F Davies F Zangari M Petty N Orlowski RZ Dhodapkar M Copeland W Fox B Hoering A Fitch A Newhall K Barlogie B Trotter MW Hershberg RM Walker BA Dervan A Ratushny AV Morgan G 2019 Identifying a high-risk cellular signature in the multiple myeloma bone marrow microenvironment_2 NCBI Gene Expression Omnibus GSE136337

Morin RD Mendez-Lago M Mungall AJ Goya R Mungall KL Corbett RD Johnson NA Severson TM Chiu R Field M Jackman S Krzywinski M Scott DW Trinh DL Tamura-Wells J Li S Firme MR Rogic S Griffith M Chan S Yakovenko O Meyer IM Zhao EY Smailus D Moksa M Chittaranjan S Rimsza L Brooks-Wilson A Spinelli JJ Ben-Neriah S Meissner B Woolcock B Boyle M McDonald H Tam A Zhao Y Delaney A Zeng T Tse K Butterfield Y Birol I Holt R Schein J Horsman DE Moore R Jones SJ Connors JM Hirst M Gascoyne RD Marra MA 2011 National Cancer Institute Cancer Genome Characterization Initiative NCBI dbGaP phs000235.v21.p6

10.7554/eLife.92774.3.sa0
eLife assessment
Dalal Yamini Reviewing Editor National Cancer Institute United States

Compelling
Important
This important study using engineered mouse models provides a first and compelling demonstration of a pathogenic phenotype associated with lack of expression of p53AS, an isoform of the p53 protein with a different C-terminus than canonical p53. The role of this isoform has been elusive so far and this first demonstration represents a substantial advance in our understanding of the complex role(s) of p53 isoforms. The revised article adequately addresses previous concerns.

10.7554/eLife.92774.3.sa1
Reviewer #1 (Public Review):
Reviewer
Summary:

The authors originally investigated the function of p53 isoforms with an alternative C-terminus encoded by the Alternatively Spliced (AS) exon in place of exon 11 encoding the canonical "α" C-terminal domain. For this purpose, the authors create a mouse model with a specific deletion of the AS exon.

Strengths:

Interestingly, wt or p53ΔAS/ΔAS mouse embryonic fibroblasts did not differ in cell cycle control, expression of well-known p53 target genes, proliferation under hyperoxic conditions, or the growth of tumor xenografts. However, p53-AS isoforms were shown to confer male-specific protection against lymphomagenesis in Eμ-Myc transgenic mice, prone to highly penetrant B-cell lymphomas. In fact, p53ΔAS/ΔAS Eμ-Myc mice were less protected from developing B-cell lymphomas compared to WT counterparts. The important difference that the authors find between WT and p53ΔAS/ΔAS Eμ-Myc males is a higher number of immature B cells in p53ΔAS/ΔAS vs WT mice. Higher expression of Ackr4 and lower expression of Mt2 was found in p53+/+ Eμ-Myc males compared to p53ΔAS/ΔAS counterparts, suggesting that these two transcripts are in part regulators of B-cell lymphomagenesis and enrichment for immature B cells.

The manuscript integrates an elegant genetic approach with in vivo analyses providing a robust set of data which strengthens the role of p53 isoforms in leukemogenesis.

10.7554/eLife.92774.3.sa2
Reviewer #2 (Public Review):
Reviewer
Summary:

This manuscript provides a detailed analysis of B-cell lymphomagenesis in mice lacking an alternative exon in region encoding the C-terminal (regulatory) domain of the p53 protein and thus enable to assemble the so-called p53AS isoform. This isoform differs from canonical p53 by the replacement of roughly 30 c-terminal residues by about 10 residues encoded by the alternative exon. There is biochemical and biological evidence that p53AS retains strong transcriptional and somewhat enhanced suppressive activities, with mouse models expressing protein constructs similar to p53AS showing signs of increased p53 activity leading to rapid and lethal anemia. However, the precise role of the alternative p53AS variant has not been addressed so far in a mouse model aimed at demonstrating whether the lack of this particular p53 isoform (trp53ΔAS/ΔAS mice) may cause a specific pathological phenotype.

Results show that lack of AS expression does not noticeably affect p53 the patterns of protein expression and transcriptional activity but reveals a subtle pathogenic phenotype, with trp53ΔAS/ΔAS males, but not females, tending to develop more frequently and earlier B-cell lymphoma than WT. Next, the authors then introduced ΔAS in transgenic Eμ-Myc mice that show accelerated lymphomagenesis. They show that lack of AS caused increased lethality and larger tumor lymph nodes in p53ΔAS Eμ-Myc males compared to their p53WT Eμ-Myc male counterparts, but not in females. Comparative transcriptomics identified a small set of candidate, differentially expressed gene, including Ackr4 (atypical chemokine receptor 4), which was significantly expressed in the spleens of ΔAS compared to WT controls. Ackr4 encodes a dummy receptor acting as an interceptor for multiple chemokines and thus may negatively regulate a chemokine/cytokine signalling axis involved in lymphomagenesis, which is down-regulated by estrogen signalling. Using in vitro cell models, the authors provide evidence that Ackr4 is a transcriptional target for p53 and that its p53-dependent activation is repressed by 17b-oestradiol. Finally, seeking evidence for a relevance for this gene in human lymphomagenesis, the authors analyse Burkitt lymphoma transcriptomic datasets and show that high ACKR4 expression correlated with better survival in males, but not in females

10.7554/eLife.92774.3.sa3
Author response
Fajac Anne Author Institut Curie Paris France

Simeonova Iva Author Institut Curie Paris France

Leemput Julia Author Institut Curie Paris France

Gabriel Marc Author Institut Curie Paris France

Morin Aurélie Author Institut Curie Paris France

Lejour Vincent Author Institut Curie Paris France

Hamon Annaïg Author Institut Curie Paris France

Rakotopare Jeanne Author Institut Curie Paris France

Vaysse-Zinkhöfer Wilhelm Author Institut Curie Paris France

Eldawra Eliana Author Institut Curie Paris France

Pinskaya Marina Author Institut Curie Paris France

Morillon Antonin Author Institut Curie Paris France

Bourdon Jean-Christophe Author University of Dundee Dundee United Kingdom

Bardot Boris Author Institut Curie Paris France

Toledo Franck Author Institut Curie Paris France

The following is the authors’ response to the original reviews.

Reviewer #1 (Recommendations For The Authors):

(1) In the first paragraph of the result section it is not clear why the authors introduce the function of p53ΔAS/ΔAS in thymocyte and then they mention fibroblasts. The authors should clarify this point. The authors should also explain based on what rationale they use doxorubicin and nutlin to analyze p53 activity (Figure 1 and figure S1).

We thank the reviewer for this comment. In the revised manuscript, we corrected this by mentioning, at the beginning of the Results section: “We analyzed cellular stress responses in thymocytes, known to undergo a p53-dependent apoptosis upon irradiation (Lowe et al., 1993), and in primary fibroblasts, known to undergo a p53-dependent cell cycle arrest in response to various stresses - e.g. DNA damage caused by irradiation or doxorubicin (Kastan et al., 1992), and the Nutlin-mediated inhibition of Mdm2, a negative regulator of p53 (Vassilev et al., 2004).”

(2) The authors should provide quantification for the western blot in figure 2D because the reduction of p53 protein level in mutant vs wt tumors is not striking.

In the previous version of the manuscript, the quantification of p53 bands had been included, but quantification results were mentioned below the actin bands, rather than the p53 bands, and this was probably confusing. We have corrected this in the revised version of the manuscript. The quantification results are now provided just below the p53 bands in Figs. 1B and 2D, which should clarify this point. For Figure 2D, the quantifications show a strong decrease in p53 levels for 3 out of 4 analyzed mutant tumors. For consistency purposes, in the revised manuscript the quantification results also appear below Myc bands in Fig. 2C.

(3) In the discussion section, the authors propose that a difference in Ackr4 expression may have prognostic value and that measuring ACKR4 gene expression in male patients with Burkitt lymphoma could be useful to identify the patients at higher risk. However the authors perform a lot of correlative analysis, both in mice and in patients, but the manuscript lacks of functional experiments that could help to functionally characterize Ackr4 and Mt2 in the etiology of B-cell lymphomas in males (both in mouse and in human models).

In the previous version of the manuscript, we proposed that Ackr4 might act as a suppressor of B-cell lymphomagenesis by attenuating Myc signaling. This hypothesis relied on studies showing that Ackr4 impairs the Ccr7 signaling cascade, which may lead to decreased Myc activity (Ulvmar et al., 2014; Shi et al., 2015; Bastow et al., 2021) and that the loss of Ccr7 may delay Myc-driven lymphomagenesis (Rehm et al., 2011). Furthermore, we proposed that the increased expression of Mt2 in p53ΔAS/ΔAS Em-Myc male splenic cells reflected an increase in Myc activity, because Mt2 is known to be regulated by Myc (Qin et al., 2021) and because the Mt2 promoter is bound by Myc in B cells according to experiments reported in the ChIP-Atlas database. However, in the first version of the manuscript this hypothesis might have appeared only partially supported by our data because an increase in Myc activity could be expected to have a more general impact, i.e. an impact not only on the expression of Mt2, but also on the expression of many canonical Myc target genes. In the revised manuscript, we show that this is indeed the case. We performed a gene set enrichment analysis (GSEA) comparing the RNAseq data from p53ΔAS/ΔAS Eμ-Myc and p53+/+ Eμ-Myc male splenic cells and found an enrichment of hallmark Myc targets in p53ΔAS/ΔAS Eμ-Myc cells. These new data, which strengthen our hypothesis of differences in Myc signaling intensity, are presented in Fig. 3K and Table S2.

Importantly, we now go beyond correlative analyses by providing direct experimental evidence that ACKR4 impacts on the behavior of Burkitt lymphoma cells. We used a CRISPR-Cas9 approach to knock-out ACKR4 in Raji Burkitt lymphoma cells and found that ACKR4 KO cells exhibited a 4-fold increase in chemokine-guided cell migration. These new data are presented in Figure 4F and the supplemental Figures S5-S7.

Finally, following a suggestion of Reviewer#2, we now also point out that “Ackr4 regulates B cell differentiation (Kara et al., 2018), which raises the possibility that an altered p53-Ackr4 pathway in p53ΔAS/ΔAS Eμ-Myc male splenic cells might contribute to increase the pools of pre-B and immature B cells that may be prone to lymphomagenesis.”

In sum, we now mention in the Discussion that a decrease in Ackr4 expression might promote B-cell lymphomagenesis through three non-exclusive mechanisms.

Reviewer #2 (Recommendations For The Authors):

(1) A great addition would be to demonstrate how p53AS specifically contributes to the regulation of Ackr4. In particular, is there evidence that p53AS might be preferentially recruited on p53 RE within that gene as compared to WT? The availability of specific antibodies that distinguish between AS and WT p53 might help to address this (experimentally complex) question. As a note, usage of such antibodies would also strengthen Fig 1B, in which the AS isoform appears as a mere faint shadow under p53, thus making its "disappearance" in trp53ΔAS/ΔAS difficult to evaluate.

We agree with the referee that efficient antibodies against p53-AS isoforms would have been useful. In fact, we tried a non-commercial antibody developed for that purpose, but it led to many unspecific bands in western blots and appeared not reliable. Importantly however, our luciferase assays clearly show that both p53-a and p53-AS can transactivate Ackr4, a result that might be expected because these isoforms share the same DNA binding domain. Furthermore, because p53-a isoforms appear more abundant than p53-AS isoforms at the protein and RNA levels (Figs. 1B and S1A), and because the loss of p53-AS isoforms leads to a significant decrease in p53-a protein levels (Figs. 1B and 2D), we think that in p53ΔAS/ΔAS cells the reduction in p53-a levels might be the main reason for a decreased transactivation of Ackr4. This is now more clearly discussed in the revised manuscript.

(2) A most interesting observation is in Fig3 A and Fig S3, showing that spleen cells of p53ΔAS Eμ-Myc males (but not females) were enriched in pre-B and immature B cells as compared to WT counterparts. This observation points to a possible defect in B cell maturation process. It would be most interesting to determine whether this particular defect is directly mediated by a p53AS-Ackr4 axis. The hypothesis raised by the authors in the Discussion section is that increased Ackr4 expression may delay lymphomatogenesis, but data in Fig 3A and 3S actually suggest that ΔAS increases the pool of immature B-cell that may be prone to lymphomagenesis.

We thank the reviewer for this useful comment, which we integrated in the Discussion of the revised manuscript. Ackr4 was shown to regulate B cell differentiation (Kara at al. (2018) J Exp Med 215, 801–813), so this is indeed one of the possible mechanisms by which a deregulation of the p53-Ackr4 axis might promote lymphomagenesis. We now mention: “Ackr4 regulates B cell differentiation (Kara et al., 2018), which raises the possibility that an altered p53-Ackr4 pathway in p53ΔAS/ΔAS Eμ-Myc male splenic cells might contribute to increase the pools of pre-B and immature B cells that may be prone to lymphomagenesis.” This is presented as one of three possible mechanisms by which decreased Ackr4 levels may promote tumorigenesis, the two others being the impact of Ackr4 on the chemokine-guided migration of lymphoma cells and its apparent effect on Myc signalling.

(3) The concordance with a male-specific prognostic effect of Ackr4 is most interesting in itself but is only of correlative evidence with respect to the study. Is there any information on whether p53AS expression is also a prognostic factor in BL? And is there evidence that Ackr4 may also be a male-specific prognostic factor in other B-cell malignancies, e.g. Multiple Myeloma?

We have now performed the CRISPR-mediated knock-out of ACKR4 in Burkitt lymphoma cells and found that it leads to a dramatic increase in chemokine-guided cell migration, which goes beyond correlation. This significant new result is mentioned in the revised abstract and presented in detail in Figures 4F and S5-S7.

Regarding p53-AS isoforms, they are murine-specific isoforms (Marcel et al. (2011) Cell Death Diff 18, 1815-1824), so there is no information on p53-AS expression in Burkitt lymphoma. Human p53 isoforms with alternative C-terminal domains are p53b and p53g isoforms, but the datasets we analyzed did not provide any information on the relative levels of p53a (the canonical isoform), p53b or p53g isoforms. We agree with the referee that this is an interesting question, but that cannot be answered with currently available datasets.

Regarding the different types of B-cell malignancies, we had already shown that Ackr4 is a male-specific prognostic factor in Burkitt lymphomas but not in Diffuse Large B cell lymphomas, which indicated that it is not a prognostic factor in all types of B cell lymphomas. For this revision, we also searched for its potential prognostic value in multiple myeloma, and found that, as for DLBCL, it is not a prognostic factor in this cancer type. This new analysis is presented in Figure S4C.

No competing interests declared.

Conceptualization, Formal analysis, Investigation, Visualization, Writing – original draft, Writing – review and editing.

Investigation, Initiated the project.

Investigation.

Formal analysis.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Formal analysis.

Formal analysis.

Resources, Initiated the project.

Conceptualization, Formal analysis, Supervision, Investigation, Visualization, Writing – original draft, Writing – review and editing.

Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Writing – original draft, Project administration, Writing – review and editing, Initiated the project.

For all experiments, mice housing and treatment were conducted according to Institutional Animal Care and Use Committee of the Institut Curie (approved project #03769.02).
==== Refs
References

Abascal F Ezkurdia I Rodriguez-Rivas J Rodriguez JM del Pozo A Vázquez J Valencia A Tress ML 2015 Alternatively spliced homologous exons have ancient origins and are highly expressed at the protein level PLOS Computational Biology 11 e1004325 10.1371/journal.pcbi.1004325 26061177
Adams JM Harris AW Pinkert CA Corcoran LM Alexander WS Cory S Palmiter RD Brinster RL 1985 The c-myc oncogene driven by immunoglobulin enhancers induces lymphoid malignancy in transgenic mice Nature 318 533 538 10.1038/318533a0 3906410
Ambrosini G Groux R Bucher P 2018 PWMScan: A fast tool for scanning entire genomes with a position-specific weight matrix Bioinformatics 34 2483 2484 10.1093/bioinformatics/bty127 29514181
Anbarasan T Bourdon JC 2019 The emerging landscape of p53 isoforms in physiology, cancer and degenerative diseases International Journal of Molecular Sciences 20 E6257 10.3390/ijms20246257 31835844
Arai N Nomura D Yokota K Wolf D Brill E Shohat O Rotter V 1986 Immunologically distinct p53 molecules generated by alternative splicing Molecular and Cellular Biology 6 3232 3239 10.1128/mcb.6.9.3232-3239.1986 3023970
Bardot B Toledo F 2015 Mdm4: Don’t judge an isoform by its mRNA levels! Aging 7 744 745 10.18632/aging.100826 26525060
Bastow CR Bunting MD Kara EE McKenzie DR Caon A Devi S Tolley L Mueller SN Frazer IH Harvey N Condina MR Young C Hoffmann P McColl SR Comerford I 2021 Scavenging of soluble and immobilized CCL21 by ACKR4 regulates peripheral dendritic cell emigration PNAS 118 e2025763118 10.1073/pnas.2025763118 33875601
Blencowe BJ 2017 The relationship between alternative splicing and proteomic complexity Trends in Biochemical Sciences 42 407 408 10.1016/j.tibs.2017.04.001 28483376
Bond GL Levine AJ 2007 A single nucleotide polymorphism in the p53 pathway interacts with gender, environmental stresses and tumor genetics to influence cancer in humans Oncogene 26 1317 1323 10.1038/sj.onc.1210199 17322917
Bourdon JC Fernandes K Murray-Zmijewski F Liu G Diot A Xirodimas DP Saville MK Lane DP 2005 p53 isoforms can regulate p53 transcriptional activity Genes & Development 19 2122 2137 10.1101/gad.1339905 16131611
Brayton CF Treuting PM Ward JM 2012 Pathobiology of aging mice and GEM: Background strains and experimental design Veterinary Pathology 49 85 105 10.1177/0300985811430696 22215684
Calpe E Codony C Baptista MJ Abrisqueta P Carpio C Purroy N Bosch F Crespo M 2011 ZAP-70 enhances migration of malignant B lymphocytes toward CCL21 by inducing CCR7 expression via IgM-ERK1/2 activation Blood 118 4401 4410 10.1182/blood-2011-01-333682 21865343
Chakraborty AA Scuoppo C Dey S Thomas LR Lorey SL Lowe SW Tansey WP 2015 A common functional consequence of tumor-derived mutations within c-MYC Oncogene 34 2406 2409 10.1038/onc.2014.186 24998853
Chow MT Luster AD 2014 Chemokines in cancer Cancer Immunology Research 2 1125 1131 10.1158/2326-6066.CIR-14-0160 25480554
Courtois S Verhaegh G North S Luciani MG Lassus P Hibner U Oren M Hainaut P 2002 DeltaN-p53, a natural isoform of p53 lacking the first transactivation domain, counteracts growth suppression by wild-type p53 Oncogene 21 6722 6728 10.1038/sj.onc.1205874 12360399
Danziger SA McConnell M Gockley J Young MH Rosenthal A Schmitz F Reiss DJ Farmer P Alapat DV Singh A Ashby C Bauer M Ren Y Smith K Couto SS van Rhee F Davies F Zangari M Petty N Orlowski RZ Dhodapkar MV Copeland WB Fox B Hoering A Fitch A Newhall K Barlogie B Trotter MWB Hershberg RM Walker BA Dervan AP Ratushny AV Morgan GJ 2020 Bone marrow microenvironments that contribute to patient outcomes in newly diagnosed multiple myeloma: A cohort study of patients in the total therapy clinical trials PLOS Medicine 17 e1003323 10.1371/journal.pmed.1003323 33147277
Duthu A Debuire B Romano J Ehrhart JC Fiscella M May E Appella E May P 1992 p53 mutations in Raji cells: Characterization and localization relative to other Burkitt’s lymphomas Oncogene 7 2161 2167 1437144
Engeland K 2018 Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM Cell Death and Differentiation 25 114 132 10.1038/cdd.2017.172 29125603
Feng LY Ou ZL Wu FY Shen ZZ Shao ZM 2009 Involvement of a novel chemokine decoy receptor CCX-CKR in breast cancer growth, metastasis and patient survival Clinical Cancer Research 15 2962 2970 10.1158/1078-0432.CCR-08-2495 19383822
Ferreira A Robaina MC de Rezende L Severino P Klumb CE 2014 Histone deacetylase inhibitor prevents cell growth in Burkitt’s lymphoma by regulating PI3K/Akt pathways and leads to upregulation of miR-143, miR-145, and miR-101 Annals of Hematology 93 983 993 10.1007/s00277-014-2021-4 24577510
Flaman JM Waridel F Estreicher A Vannier A Limacher JM Gilbert D Iggo R Frebourg T 1996 The human tumour suppressor gene p53 is alternatively spliced in normal cells Oncogene 12 813 818 8632903
Fornes O Castro-Mondragon JA Khan A van der Lee R Zhang X Richmond PA Modi BP Correard S Gheorghe M Baranašić D Santana-Garcia W Tan G Chèneby J Ballester B Parcy F Sandelin A Lenhard B Wasserman WW Mathelier A 2020 JASPAR 2020: update of the open-access database of transcription factor binding profiles Nucleic Acids Research 48 D87 D92 10.1093/nar/gkz1001 31701148
Georges A L’Hôte D Todeschini AL Auguste A Legois B Zider A Veitia RA 2014 The transcription factor FOXL2 mobilizes estrogen signaling to maintain the identity of ovarian granulosa cells eLife 3 e04207 10.7554/eLife.04207 25369636
Graubert TA Shen D Ding L Okeyo-Owuor T Lunn CL Shao J Krysiak K Harris CC Koboldt DC Larson DE McLellan MD Dooling DJ Abbott RM Fulton RS Schmidt H Kalicki-Veizer J O’Laughlin M Grillot M Baty J Heath S Frater JL Nasim T Link DC Tomasson MH Westervelt P DiPersio JF Mardis ER Ley TJ Wilson RK Walter MJ 2012 Recurrent mutations in the U2AF1 splicing factor in myelodysplastic syndromes Nature Genetics 44 53 57 10.1038/ng.1031
Haeussler M Schönig K Eckert H Eschstruth A Mianné J Renaud JB Schneider-Maunoury S Shkumatava A Teboul L Kent J Joly JS Concordet JP 2016 Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR Genome Biology 17 148 10.1186/s13059-016-1012-2 27380939
Hamard PJ Barthelery N Hogstad B Mungamuri SK Tonnessen CA Carvajal LA Senturk E Gillespie V Aaronson SA Merad M Manfredi JJ 2013 The C terminus of p53 regulates gene expression by multiple mechanisms in a target- and tissue-specific manner in vivo Genes & Development 27 1868 1885 10.1101/gad.224386.113 24013501
Hamlyn PH Rabbitts TH 1983 Translocation joins c-myc and immunoglobulin gamma 1 genes in a Burkitt lymphoma revealing a third exon in the c-myc oncogene Nature 304 135 139 10.1038/304135a0 6306472
Haupt S Caramia F Herschtal A Soussi T Lozano G Chen H Liang H Speed TP Haupt Y 2019 Identification of cancer sex-disparity in the functional integrity of p53 and its X chromosome network Nature Communications 10 5385 10.1038/s41467-019-13266-3 31772231
Hou T Liang D Xu L Huang X Huang Y Zhang Y 2013 Atypical chemokine receptors predict lymph node metastasis and prognosis in patients with cervical squamous cell cancer Gynecologic Oncology 130 181 187 10.1016/j.ygyno.2013.04.015 23603371
Hummel M Bentink S Berger H Klapper W Wessendorf S Barth TFE Bernd HW Cogliatti SB Dierlamm J Feller AC Hansmann ML Haralambieva E Harder L Hasenclever D Kühn M Lenze D Lichter P Martin-Subero JI Möller P Müller-Hermelink HK Ott G Parwaresch RM Pott C Rosenwald A Rosolowski M Schwaenen C Stürzenhofecker B Szczepanowski M Trautmann H Wacker HH Spang R Loeffler M Trümper L Stein H Siebert R Molecular Mechanisms in Malignant Lymphomas Network Project of the Deutsche Krebshilfe 2006 A biologic definition of Burkitt’s lymphoma from transcriptional and genomic profiling The New England Journal of Medicine 354 2419 2430 10.1056/NEJMoa055351 16760442
Ju Y Sun C Wang X 2019 Loss of atypical chemokine receptor 4 facilitates C-C motif chemokine ligand 21-mediated tumor growth and invasion in nasopharyngeal carcinoma Experimental and Therapeutic Medicine 17 613 620 10.3892/etm.2018.7007 30651842
Kara EE Bastow CR McKenzie DR Gregor CE Fenix KA Babb R Norton TS Zotos D Rodda LB Hermes JR Bourne K Gilchrist DS Nibbs RJ Alsharifi M Vinuesa CG Tarlinton DM Brink R Hill GR Cyster JG Comerford I McColl SR 2018 Atypical chemokine receptor 4 shapes activated B cell fate The Journal of Experimental Medicine 215 801 813 10.1084/jem.20171067 29386231
Kastan MB Zhan Q el-Deiry WS Carrier F Jacks T Walsh WV Plunkett BS Vogelstein B Fornace AJ 1992 A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia Cell 71 587 597 10.1016/0092-8674(92)90593-2 1423616
Knewtson KE Gonzalez Flores JG Pacicca DM Robinson JL 2020 Transcriptome Sequencing Reveals Sex Differences in Human Meniscal Cell Response to Estrogen Based on Dosing Kinetics bioRxiv 10.1101/2020.04.27.064451
Lacy SE Barrans SL Beer PA Painter D Smith AG Roman E Cooke SL Ruiz C Glover P Van Hoppe SJL Webster N Campbell PJ Tooze RM Patmore R Burton C Crouch S Hodson DJ 2020 Targeted sequencing in DLBCL, molecular subtypes, and outcomes: A Haematological Malignancy Research Network report Blood 135 1759 1771 10.1182/blood.2019003535 32187361
Langdon WY Harris AW Cory S Adams JM 1986 The c-myc oncogene perturbs B lymphocyte development in E-mu-myc transgenic mice Cell 47 11 18 10.1016/0092-8674(86)90361-2 3093082
Liao Y Smyth GK Shi W 2014 FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features Bioinformatics 30 923 930 10.1093/bioinformatics/btt656 24227677
Love MI Huber W Anders S 2014 Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genome Biology 15 550 10.1186/s13059-014-0550-8 25516281
Lowe SW Schmitt EM Smith SW Osborne BA Jacks T 1993 p53 is required for radiation-induced apoptosis in mouse thymocytes Nature 362 847 849 10.1038/362847a0 8479522
Mahani A Arvidsson G Sadeghi L Grandien A Wright APH 2021 Differential transcriptional reprogramming by wild type and lymphoma-associated mutant MYC proteins as B-cells convert to a lymphoma phenotype Cancers 13 6093 10.3390/cancers13236093 34885204
Maier B Gluba W Bernier B Turner T Mohammad K Guise T Sutherland A Thorner M Scrable H 2004 Modulation of mammalian life span by the short isoform of p53 Genes & Development 18 306 319 10.1101/gad.1162404 14871929
Marcel V Dichtel-Danjoy ML Sagne C Hafsi H Ma D Ortiz-Cuaran S Olivier M Hall J Mollereau B Hainaut P Bourdon JC 2011 Biological functions of p53 isoforms through evolution: Lessons from animal and cellular models Cell Death and Differentiation 18 1815 1824 10.1038/cdd.2011.120 21941372
Marcuzzi E Angioni R Molon B Calì B 2018 Chemokines and chemokine receptors: Orchestrating tumor metastasization International Journal of Molecular Sciences 20 E96 10.3390/ijms20010096 30591657
Martin M Maßhöfer L Temming P Rahmann S Metz C Bornfeld N van de Nes J Klein-Hitpass L Hinnebusch AG Horsthemke B Lohmann DR Zeschnigk M 2013 Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3 Nature Genetics 45 933 936 10.1038/ng.2674 23793026
Mondal AM Horikawa I Pine SR Fujita K Morgan KM Vera E Mazur SJ Appella E Vojtesek B Blasco MA Lane DP Harris CC 2013 p53 isoforms regulate aging- and tumor-associated replicative senescence in T lymphocytes Journal of Clinical Investigation 123 5247 5257 10.1172/JCI70355 24231352
Morin RD Mendez-Lago M Mungall AJ Goya R Mungall KL Corbett RD Johnson NA Severson TM Chiu R Field M Jackman S Krzywinski M Scott DW Trinh DL Tamura-Wells J Li S Firme MR Rogic S Griffith M Chan S Yakovenko O Meyer IM Zhao EY Smailus D Moksa M Chittaranjan S Rimsza L Brooks-Wilson A Spinelli JJ Ben-Neriah S Meissner B Woolcock B Boyle M McDonald H Tam A Zhao Y Delaney A Zeng T Tse K Butterfield Y Birol I Holt R Schein J Horsman DE Moore R Jones SJM Connors JM Hirst M Gascoyne RD Marra MA 2011 Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma Nature 476 298 303 10.1038/nature10351 21796119
Müller A Homey B Soto H Ge N Catron D Buchanan ME McClanahan T Murphy E Yuan W Wagner SN Barrera JL Mohar A Verástegui E Zlotnik A 2001 Involvement of chemokine receptors in breast cancer metastasis Nature 410 50 56 10.1038/35065016 11242036
Oki S Ohta T Shioi G Hatanaka H Ogasawara O Okuda Y Kawaji H Nakaki R Sese J Meno C 2018 ChIP-Atlas: a data-mining suite powered by full integration of public ChIP-seq data EMBO Reports 19 e46255 10.15252/embr.201846255 30413482
Pajares MJ Ezponda T Catena R Calvo A Pio R Montuenga LM 2007 Alternative splicing: An emerging topic in molecular and clinical oncology The Lancet. Oncology 8 349 357 10.1016/S1470-2045(07)70104-3 17395108
Peuget S Selivanova G 2021 p53-dependent repression: Dream or Reality? Cancers 13 4850 10.3390/cancers13194850 34638334
Pulvertaft RJV 1964 Cytology of Burkitt’s tumour (African lymphoma) The Lancet 283 238 240 10.1016/S0140-6736(64)92345-1
Qin S Li B Li R Cai Y Zheng K Huang H Xiao F Zeng M Xu X 2021 Proteomic characteristics and identification of PM2.5-induced differentially expressed proteins in hepatocytes and c-Myc silenced hepatocytes Ecotoxicology and Environmental Safety 209 111838 10.1016/j.ecoenv.2020.111838 33387776
Rehm A Mensen A Schradi K Gerlach K Wittstock S Winter S Büchner G Dörken B Lipp M Höpken UE 2011 Cooperative function of CCR7 and lymphotoxin in the formation of a lymphoma-permissive niche within murine secondary lymphoid organs Blood 118 1020 1033 10.1182/blood-2010-11-321265 21586747
Senturk S Yao Z Camiolo M Stiles B Rathod T Walsh AM Nemajerova A Lazzara MJ Altorki NK Krainer A Moll UM Lowe SW Cartegni L Sordella R 2014 p53Ψ is a transcriptionally inactive p53 isoform able to reprogram cells toward a metastatic-like state PNAS 111 E3287 E3296 10.1073/pnas.1321640111 25074920
Sette C Paronetto MP 2022 Somatic mutations in core spliceosome components promote tumorigenesis and generate an exploitable vulnerability in human cancer Cancers 14 1827 10.3390/cancers14071827 35406598
Shi JY Yang LX Wang ZC Wang LY Zhou J Wang XY Shi GM Ding ZB Ke AW Dai Z Qiu SJ Tang QQ Gao Q Fan J 2015 CC chemokine receptor-like 1 functions as a tumour suppressor by impairing CCR7-related chemotaxis in hepatocellular carcinoma The Journal of Pathology 235 546 558 10.1002/path.4450 25255875
Si M Lang J 2018 The roles of metallothioneins in carcinogenesis Journal of Hematology & Oncology 11 107 10.1186/s13045-018-0645-x 30139373
Simeonova I Lejour V Bardot B Bouarich-Bourimi R Morin A Fang M Charbonnier L Toledo F 2012 Fuzzy tandem repeats containing p53 response elements may define species-specific p53 target genes PLOS Genetics 8 e1002731 10.1371/journal.pgen.1002731 22761580
Simeonova I Jaber S Draskovic I Bardot B Fang M Bouarich-Bourimi R Lejour V Charbonnier L Soudais C Bourdon JC Huerre M Londono-Vallejo A Toledo F 2013 Mutant mice lacking the p53 C-terminal domain model telomere syndromes Cell Reports 3 2046 2058 10.1016/j.celrep.2013.05.028 23770245
Slatter TL Ganesan P Holzhauer C Mehta R Rubio C Williams G Wilson M Royds JA Baird MA Braithwaite AW 2010 p53-mediated apoptosis prevents the accumulation of progenitor B cells and B-cell tumors Cell Death and Differentiation 17 540 550 10.1038/cdd.2009.136 19779492
Steffens Reinhardt L Zhang X Wawruszak A Groen K De Iuliis GN Avery-Kiejda KA 2020 Good cop, bad cop: Defining the roles of Δ40p53 in cancer and aging Cancers 12 1659 10.3390/cancers12061659 32585821
Subramanian A Tamayo P Mootha VK Mukherjee S Ebert BL Gillette MA Paulovich A Pomeroy SL Golub TR Lander ES Mesirov JP 2005 Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles PNAS 102 15545 15550 10.1073/pnas.0506580102 16199517
Toledo F Krummel KA Lee CJ Liu CW Rodewald LW Tang M Wahl GM 2006 A mouse p53 mutant lacking the proline-rich domain rescues Mdm4 deficiency and provides insight into the Mdm2-Mdm4-p53 regulatory network Cancer Cell 9 273 285 10.1016/j.ccr.2006.03.014 16616333
Tress ML Abascal F Valencia A 2017a Alternative splicing may not be the key to proteome complexity Trends in Biochemical Sciences 42 98 110 10.1016/j.tibs.2016.08.008 27712956
Tress ML Abascal F Valencia A 2017b Most alternative isoforms are not functionally important Trends in Biochemical Sciences 42 408 410 10.1016/j.tibs.2017.04.002 28483377
Ule J Blencowe BJ 2019 Alternative splicing regulatory networks: Functions, mechanisms, and evolution Molecular Cell 76 329 345 10.1016/j.molcel.2019.09.017 31626751
Ulvmar MH Werth K Braun A Kelay P Hub E Eller K Chan L Lucas B Novitzky-Basso I Nakamura K Rülicke T Nibbs RJB Worbs T Förster R Rot A 2014 The atypical chemokine receptor CCRL1 shapes functional CCL21 gradients in lymph nodes Nature Immunology 15 623 630 10.1038/ni.2889 24813163
Vassilev LT Vu BT Graves B Carvajal D Podlaski F Filipovic Z Kong N Kammlott U Lukacs C Klein C Fotouhi N Liu EA 2004 In vivo activation of the p53 pathway by small-molecule antagonists of MDM2 Science 303 844 848 10.1126/science.1092472 14704432
Watts AO Verkaar F van der Lee MMC Timmerman CAW Kuijer M van Offenbeek J van Lith LHCJ Smit MJ Leurs R Zaman GJR Vischer HF 2013 β-Arrestin recruitment and G protein signaling by the atypical human chemokine decoy receptor CCX-CKR The Journal of Biological Chemistry 288 7169 7181 10.1074/jbc.M112.406108 23341447
Weatheritt RJ Sterne-Weiler T Blencowe BJ 2016 The ribosome-engaged landscape of alternative splicing Nature Structural & Molecular Biology 23 1117 1123 10.1038/nsmb.3317 27820807
Yin Y Stephen CW Luciani MG Fåhraeus R 2002 p53 Stability and activity is regulated by Mdm2-mediated induction of alternative p53 translation products Nature Cell Biology 4 462 467 10.1038/ncb801 12032546
Younger ST Kenzelmann-Broz D Jung H Attardi LD Rinn JL 2015 Integrative genomic analysis reveals widespread enhancer regulation by p53 in response to DNA damage Nucleic Acids Research 43 4447 4462 10.1093/nar/gkv284 25883152
Zhu Y Tang W Liu Y Wang G Liang Z Cui L 2014 CCX-CKR expression in colorectal cancer and patient survival The International Journal of Biological Markers 29 e40 e48 10.5301/jbm.5000057 24338720
Zhu Q Chen H Li X Wang X Yan H 2022 JMJD2C mediates the MDM2/p53/IL5RA axis to promote CDDP resistance in uveal melanoma Cell Death Discovery 8 227 10.1038/s41420-022-00949-y 35468881
