
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39294222
71463
10.1038/s41598-024-71463-7
Article
New insights into the phylogeny of Carasobarbus Karaman, 1971 (Actinopterygii, Cyprinidae) with the description of three new species
http://orcid.org/0000-0002-2680-6016
Jouladeh-Roudbar Arash 1
http://orcid.org/0000-0002-4531-798X
Kaya Cüneyt 2
http://orcid.org/0000-0002-0457-6758
Vatandoust Saber 3
http://orcid.org/0000-0003-1029-4236
Ghanavi Hamid Reza hamid.ghanavi@biol.lu.se

4
1 https://ror.org/052d1a351 grid.422371.1 0000 0001 2293 9957 Museum für Naturkunde, Leibniz Institute for Evolution and Biodiversity Science, 10115 Berlin, Germany
2 https://ror.org/0468j1635 grid.412216.2 0000 0004 0386 4162 Faculty of Fisheries, Recep Tayyip Erdogan University, Rize, Turkey
3 grid.467532.1 0000 0004 4912 2930 Department of Fisheries, Babol Branch, Islamic Azad University, Babol, Iran
4 https://ror.org/012a77v79 grid.4514.4 0000 0001 0930 2361 Department of Biology, Lund University, Lund, Sweden
18 9 2024
18 9 2024
2024
14 2180124 4 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Fishes from the genus Carasobarbus, widely distributed throughout the river systems of North Africa and West Asia, are commonly referred to as Himris. In the Persian Gulf basin, they are widespread and are also found in fast-flowing rivers or the deeper regions of lakes. In this region, representation of these fishes in scientific collections is scarce, and except for C. luteus, the other species are very poorly documented and frequently misidentified due to their similarities. In this study we analysed the relationships among Carasobarbus species using mitochondrial genes (Cyt b, COI) and present morphological characters based on examinations. Our results revealed three new species which we describe here. Carasobarbus doadrioi, new species, is distinguished by 40–44 scales on the lateral line and a prominent black blotch on end of caudal peduncle in specimens < 85 mm SL. Carasobarbus hajhosseini, new species is distinguished by 32–34 scales on the lateral line and long head length (20–24% SL). Carasobarbus saadatii, new species, is distinguished by 38–40 scales on the lateral line and short head length (19–20% HL). In the Persian Gulf basin, Carasobarbus species exhibit uncorrected genetic distances of 1.6 to 5.5% in the COI barcode region and 2.6% to 9.9% in the Cyt b gene. This study highlights the importance of investigating the unexplored diversity that exists within poorly sampled and understudied freshwater fish group. Such investigations are essential for developing a comprehensive understanding of the true extent of biodiversity, which is critical for informing effective conservation and protection strategies.

Keywords

Himri
Freshwater fish
Morphology
Integrative taxonomy
Western Asia
Phylogeny
Subject terms

Ichthyology
Biodiversity
Phylogenetics
Taxonomy
Lund UniversityOpen access funding provided by Lund University.

issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Carasobarbus Karaman, 1971 is a small genus of Cyprinidae comprising 10 valid species distributed across Southwest Asia and Northwest Africa1–3. These fishes known as Himris and characterized by large scales and special forms of the lips4,5. Three species of Himris are currently known from the Persian Gulf basin: Carasobarbus luteus (Heckel, 1843), C. kosswigi (Ladiges, 1960), and C. sublimus (Coad & Najafpour, 1997), with the latter considered to be endemic to Iran. Initially, C. kosswigi was described as Cyclocheilichthys Bleeker, 1859, C. sublimus as Barbus Daudin 1805, and C. luteus as Systomus McClelland 1838. Bianco and Bănărescu6 considered luteus as Carasobarbus validating the genus. Karaman7 erected Kosswigobarbus and placed kosswigi in it. However, Borkenhagen et al.8 synonymized this genus with Carasobarbus. In the following, Borkenhagen and Krupp2 conducted a comprehensive taxonomic revision of the genus Carasobarbus, revealing three valid species inhabiting Iran: C. luteus, C. kosswigi, and C. sublimus. They mentioned that C. sublimus is present in Zohre and Karkheh drainages, and C. kosswigi is found in Karun and Tigris drainages.

The elusive nature of Carasobarbus species and the challenges associated with sampling them have rendered the study of these fishes extremely difficult. This is especially accentuated because some species are rare and easily misidentified with other species inhabiting the same habitats. After approximately 15 years of field expeditions across Iran, Iraq, and Türkiye, during which Carasobarbus specimens were collected from the type localities of C. kosswigi and C. sublimus, as well as other populations from the Tigris to Zohreh drainages, a comprehensive examination revealed significant morphological and genetic differences among them. Our findings provide evidence supporting the existence of three undescribed species in Iran, which we describe based on a combination of morphological and molecular genetic characters.

Materials and methods

Fish sampling and preservation

All fish specimens used in this study were sampled following local guidelines and rules. All experimental protocols are approved routine procedures by ethics committee in Lund University. All methods were carried out in accordance with relevant guidelines and regulations, and all methods are reported in accordance with ARRIVE guidelines. The sampling permits were issued by the local environment department. Fish were euthanized with an overdose of clove oil, fixed in 10% formalin for 24 h, and preserved in ethanol 70%. The samples used in molecular analyses were fixed in 99% EtOH (whole body or a fin clip).

Morphological examination

Measurements were made point-to-point with a digital calliper and recorded to 0.1 mm. Counts and measurements were made on the left side of specimens whenever possible, following Kottelat & Freyhof9. Head length and measurements of body parts are given as proportions of standard length (SL). Subunits of the head are presented as proportions of head length (HL). Standard length (SL) was measured from the tip of the snout to the posterior extremity of the hypural complex. The skin fold at the posterior part of the gill cover was included in the measurement of HL. The length of the caudal peduncle was measured from behind the base of the posterior anal-fin ray to the posterior extremity of the hypural complex, at mid-height of the caudal-fin base. The last two branched rays articulating on a single pterygiophore in the dorsal and anal-fins are noted as "11/2". The distribution map (Fig. 1) was created with QGIS v.3.18 software (http://qgis.org). In addition to examined specimens of C. sublimus, morphometric data were obtained from Coad and Najafpour1.Fig. 1 Distribution map of Carasobarbus species in Persian Gulf basin.

DNA extraction, PCR amplification and sequencing

Genomic DNA was extracted using Macherey & Nagel NucleoSpin® Tissue kits following the provided protocol. The barcode region of the COI (cytochrome c oxidase subunit 1) gene was amplified using FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′10, and the Cyt b genetic marker using GluF-5’AACCACCGTTGTATTCAACTACAA3’ and ThrR5’ ACCTCCGATCTTCGGATTACAAGACCG3’11. The T7Promoter (5’TAATACGACTCACTATAGGG3’) and T3 (5’ATTAACCCTCACTAAAGGG3’) standard sequences were added to the sequence of forward and reverse primers respectively, to simplify the sequencing of different PCR products on the same plate. Sequencing of the PCR products was performed at an external sequencing service provider.

Molecular data analysis

The obtained sequences and the ones downloaded from GenBank (Tables 1, 2), were aligned using MAFFT12,13 as implemented in Geneious v. 10.0.2 (Biomatters, http://www.geneious.com/). The obtained datasets were concatenated in Geneious to create three different datasets: COI dataset, Cyt b dataset, and the concatenated dataset. In the case of the concatenated dataset, in the ingroup, we only kept the samples with both genetic markers amplified from the same specimen. This was not possible for the outgroups as none of the sequences in Genbank, used for outgroups, came from the same specimen for both genes. In these cases, sequences from unrelated specimens were concatenated together. This does not affect the phylogenetic results of the ingroup. To determine intraspecific species uncorrected pairwise genetic distances (p-distances) (Tables 3, 4), we employed Mega 614.Table 1 GenBank accession numbers of the COI sequences downloaded for this study.

GenBank	Species	GenBank	Species	
KJ552897	C. canis	KJ552960	C. fritschii	
KJ552760	C. canis	KJ553111	C. fritschii	
KJ552827	C. canis	KJ553144	C. fritschii	
KJ553264	C. chantrei	KJ553161	C. fritschii	
KJ553201	C. chantrei	KJ553212	C. fritschii	
KJ553098	C. chantrei	KJ553240	C. fritschii	
KJ553228	C. chantrei	KJ552291	C. fritschii	
KJ552821	C. chantrei	KM590427	C. hajhosseini	
KJ552958	C. chantrei	KM590426	C. luteus	
KM590423	C. doadrioi	KM590424	C. luteus	
MW250390	C. doadrioi	KM590425	C. luteus	
KM590428	C. kosswigi	MW250388	C. luteus	
KJ552798	C. harterti	OR038182	C. luteus	
KJ552803	C. harterti	OR038183	C. luteus	
KJ552814	C. harterti	OR038192	C. luteus	
KJ552851	C. harterti	OR038193	C. luteus	
KJ552906	C. harterti	OP456596	Mesopotamichthys sharpeyi	
KJ552966	C. harterti	OP456597	M. sharpeyi	
KJ552780	C. fritschii	OP456598	M. sharpeyi	
KJ552819	C. fritschii	KM590450	Arabibarbus grypus	
KJ552951	C. fritschii	KM590451	A. grypus	
KJ552959	C. fritschii			

Table 2 GenBank accession numbers of the Cyt b sequences downloaded for this study.

GenBank	Species	GenBank	Species	
KU525007	C apoensis	KU524970	C. fritschii	
KU525008	C apoensis	KU524973	C. fritschii	
KU525009	C apoensis	KU524974	C. fritschii	
KU525006	C apoensis	KU524969	C. fritschii	
AF145947	C. canis	KU524971	C. fritschii	
KU524924	C. canis	MN961175	C. fritschii	
KU524925	C. canis	KU525005	C. fritschii	
KU524926	C. canis	AF287430	C. fritschii	
AF180852	C. chantrei	KU524978	C. fritschii	
HQ167605	C. chantrei	KU524979	C. fritschii	
KU524913	C. chantrei	KU524980	C. fritschii	
KU524921	C. chantrei	KU524981	C. fritschii	
KU524922	C. chantrei	KU524982	C. fritschii	
KU524923	C. chantrei	KU524983	C. fritschii	
KU524958	C. chantrei	KU524984	C. fritschii	
KU524959	C. chantrei	KU524985	C. fritschii	
KU524914	C. chantrei	KU524986	C. fritschii	
KU524934	C. doadrioi	KU524935	C. hajhosseini	
KU524901	C. exulatus	AF180855	C. harterti	
KU524902	C. exulatus	KU524975	C. harterti	
KU524904	C. exulatus	KU524976	C. harterti	
KU524907	C. exulatus	KU524977	C. harterti	
KU524908	C. exulatus	KP712261	C. kosswigi	
KU524903	C. exulatus	AF180853	C. kosswigi	
KU524905	C. exulatus	KU524915	C. luteus	
AF180856	C. fritschii	KU524964	C. luteus	
MN961176	C. fritschii	KU524965	C. luteus	
KU524990	C. fritschii	KU524912	C. luteus	
KU524993	C. fritschii	KU524920	C. luteus	
KU524987	C. fritschii	KU524928	C. luteus	
KU524988	C. fritschii	KU524963	C. luteus	
KU524989	C. fritschii	KP712262	C. luteus	
KU524991	C. fritschii	KU524933	C. luteus	
KU524992	C. fritschii	KU524927	C. luteus	
KU524995	C. fritschii	KU524929	C. luteus	
KU524999	C. fritschii	KU524909	C. sublimus	
MN961177	C. fritschii	KU524931	C. sublimus	
KU524994	C. fritschii	KU524930	C. sublimus	
AF287429	C. fritschii	KU524910	C. sublimus	
KU524968	C. fritschii	KU524911	C. sublimus	
KU524996	C. fritschii	KU524932	C. sublimus	
KU524997	C. fritschii	KF876032	Mesopotamichthys sharpeyi	
KU525000	C. fritschii	KF876033	M. sharpeyi	
KU525001	C. fritschii	KF876031	M. sharpeyi	
KU525002	C. fritschii	KF876029	Arabibarbus grypus	
KU525004	C. fritschii	KF876028	A. grypus	
KU524966	C. fritschii	KF876021	A. arabicus	
KU524967	C. fritschii	KF876022	A. arabicus	
KU525003	C. fritschii	KF876023	A. adharami	
KU524998	C. fritschii	KF876024	A. adharami	
KU524972	C. fritschii			

Table 3 Uncorrected-p genetic distances (%) in COI gene between different species of Carasobarbus (I.: intraspecific distance).

N	Species	I	1	2	3	4	5	6	7	8	9	
1	C. doadrioi sp. n	0.06										
2	C. hajhosseini sp. n	0.00	4.1									
3	C. saadatii sp. n	0.09	2.5	4.7								
4	C. canis	0.00	5.0	5.3	4.7							
5	C. chantrei	0.21	4.9	5.3	5.0	2.0						
6	C. kosswigi	0.00	1.6	3.8	1.6	4.1	4.2					
7	C. luteus	0.19	5.3	5.3	5.4	2.8	1.6	4.7				
8	C. sublimus	0.16	3.9	3.3	5.1	5.3	5.5	4.2	5.4			
9	C. harterti/fritschii 1	0.72	4.2	4.2	4.2	4.7	4.0	3.8	4.9	5.3		
10	C. harterti/fritschii 2	0.55	5.2	5.1	4.8	4.4	4.1	4.5	4.8	5.4	2.6	

Table 4 Uncorrected-p genetic distances (%) in Cyt b gene between different species of Carasobarbus (I.: intraspecific distance).

N	Species	I	1	2	3	4	5	6	7	8	9	10	
1	C. doadrioi sp. n	0.32											
2	C. hajhosseini sp. n	0.20	8.5										
3	C. saadatii sp. n	0.32	4.6	7.6									
4	C. canis	0.04	7.6	8.2	6.5								
5	C. chantrei	0.10	7.1	8.0	6.4	3.2							
6	C. exulatus	0.10	7.2	7.9	6.5	3.0	2.6						
7	C. fritschii	0.66	8.3	9.9	8.8	6.6	7.1	6.9					
8	C. harterti	0.04	8.7	9.9	8.3	5.7	6.2	6.0	3.1				
9	C. luteus/apoensis	0.59	7.6	8.1	6.9	3.4	2.6	3.2	7.0	6.2			
10	C. kosswigi	0.56	4.2	7.1	3.8	6.3	5.6	5.6	8.3	8.5	6.0		
11	C. sublimus	0.34	9.0	5.0	8.8	9.2	9.2	8.6	9.4	9.7	8.8	7.9	

Both maximum likelihood (ML) and Bayesian (BI) methods have been used to construct phylogenetic relationships of the group. In the case of ML approach, IQ-TREE 1.6.1215,16 were used. In this case, the optimal substitution model and the best partitioning scheme based on the codon information, was investigated using ModelFinder17 with the Bayesian information criterion (BIC). In the case of single marker datasets, the codon position information was provided, and in the concatenated dataset both codon position and gene separation were provided to the program. The bootstrap (− b 500) approximations was used to calculate support values18. FigTree 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/) was used to visualize the resulting trees. In the case of the BI approach, MrBayes 3.2.719 were used with two parallel simultaneous analyses for 2 × 107 generations, each with four MCMC chains, and sampling every 2000 generations. The initial 25% of generations were discarded as the burn-in. An rjMCMC20 approach was implemented using the nst = mixed command. The proper convergence of the runs was verified using Tracer 1.721.

Three distance-based molecular species delimitation methods were used: automatic barcode gap discovery (ABGD)22, assemble species by automatic partitioning (ASAP)23, and Bayesian Poisson Tree Processes model (bPTP)24. The ABGD analysis were performed on its online webserver (https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html), exploring a range of ABGD settings with a parameter range of Pmin = 0.001, Pmax = 0.1, and a gap width of 1.5 over ten steps. The ASAP analysis was also made, using Simple Distance (p-distances), via its web interface (https://bioinfo.mnhn.fr/abi/public/asap/asapweb.html). The bPTP analysis was run only on the in-group on the online implementation of it (https://species.h-its.org/) using default settings.

Results

We were able to generate 38 new sequences (22 COI + 16 Cyt b) for six species of Carasobarbus from Iran, Iraq and Türkiye, in addition to 173 sequences from NCBI GenBank (Tables 1 and 2). The final alignment for COI consisted of 770 base pairs, with 676 positions being constant, 88 being parsimony informative and 6 being singletons (calculated just between in-group species), and for Cyt b the alignment was 1143 base pairs, with 872 positions being constant, 240 being parsimony informative and 29 being singletons (calculated just between in-group species for both genes).

The COI gene of Carasobarbus displayed an interspecific uncorrected-p genetic distance of 1.6% between C. luteus and C. chantrei as well as C. doadrioi sp. n., C. saadatii sp. n. and C. chantrei to 5.5% between C. sublimus. Average intraspecific distance for Carasobarbus species was 0.20%, ranging from 0.0 in C. canis, C. hajhosseini, and C. kosswigi to 0.72% in clade 1 of C. fritschii/harterti species group (Table 3).

For the Cyt b gene, the genetic distances between species ranged from 2.6% between C. luteus/apoensis, C. chantrei and C. exulatus to 9.9% between C. harterti and C. chantrei as well as between C. hajhosseini, C. fritschi and C. harterti. Also, the average intraspecific distance was 0.30%, ranging from 0.04% in C. canis and C. harterti to 0.66% in C. fritschii. Table 4 shows the genetic distances between and within the Carasobarbus species for Cyt b gene.

The general topology of Cyt b, COI and concatenated dataset trees (Figs. 2, 3 and 4) were in agreement with previously published phylogenies that focused on the genus Carasobarbus8,25. The COI and Cyt b dataset both resulted in acceptable trees with some nodes which were harder to resolve (not well supported). The increased sampling size, in the case of individual gene datasets, appears to improve the result compared to the prior phylogenetic works. The concatenation of the two genetic markers resulted in the best resolved tree even though the number of represented species was reduced. In general, all species analysed in any of the datasets was recovered as monophyletic apart from C. harterti and C. fritschii in the COI dataset. In this case, the resolution of the COI dataset for this part seems to not be adequate, and some samples identified as C. harterti are placed with C. fritschii and vice versa.Fig. 2 Phylogenetic tree of Carasobarbus based on the maximum likelihood and Bayesian analyses of the mitochondrial COI barcode region. Numbers present at each node are bootstrap/posterior probability support values. The result of the three different species delimitation methods is shown using the vertical bars.

Fig. 3 Phylogenetic tree of Carasobarbus based on the maximum likelihood and Bayesian analyses of the Cyt b gene. Numbers present at each node are bootstrap/posterior probability support values. The result of the three different species delimitation methods is shown using the vertical bars.

Fig. 4 Phylogenetic tree of Carasobarbus based on the maximum likelihood and Bayesian analyses of the mitochondrial COI barcode region and the Cyt b markers concatenated. Numbers present at each node are bootstrap/posterior probability support values.

Key to species of Carasobarbus in Persian Gulf basin

1a - Lower lip without median lobe; one pair of barbels (two pair in the Makran population).

………………C. luteus

1b - Lower lip with median lobe; two pair barbels.

………………2

2a - 24 − 29 total lateral-line scales; lower lip lobe well-developed (Coad and Najafpour, (1) data included).

………………C. sublimus

2b – 32–44 total lateral-line scales; lower lip lobe slightly to relatively developed.

.………………3

3a - 32–37 total lateral-line scales.

………………4

3b - 38–44 total lateral-line scales.

………………5

4a – Lower lip lobe well-developed; 32–77 [mode 36] total lateral-line scales; head length 25–27% SL; posterior barbel 13–20% HL; snout length 36–44% HL.

………………C. kosswigi

4b - Lower lip lobe slightly developed; 32–34 [mode 33–34] total lateral-line scales; head length 20–24% SL; posterior barbel 21–38% HL; snout length 25–31% HL.

………………C. hajhosseini sp. n.

5a – A prominent black blotch on end of caudal peduncle in specimens < 85 mm SL; head length 22–25% SL; dorsal fin height 19–26% SL; distance between base of pelvic and anal fins 24–25% SL.

………………C. doadrioi sp. n.

5b – No black blotch on end of caudal peduncle in specimens < 85 mm SL; Head length 19–20% SL; dorsal fin height 26–30% SL; distance between base of pelvic and anal fins 26–28% SL.

………………C. saadatii sp. n.

Carasobarbus doadrioi , new species

(Figs. 5, 6, 7 and 8).Fig. 5 Carasobarbus doadrioi sp. n.; BIAUBM 6-H, holotype, 75 mm SL; Iran: Khersan River, Karun drainage.

Fig. 6 Carasobarbus doadrioi sp. n., AJRPC 17-P, paratypes, from top: 69 mm SL, 63 mm SL; Khersan River, Persian Gulf basin.

Fig. 7 Carasobarbus doadrioi sp. n.; uncatalogued, about 150 mm SL; Iran: Khersan River, Karun drainage.

Fig. 8 Carasobarbus doadrioi sp. n.; uncatalogued, about 150 mm SL; Iran: Khersan River, Karun drainage.

Holotype. BIAUBM 6-H, 75.3 mm SL; Iran: Chaharmahal and Bakhtiari prov., Khersan River at Atishgah, Karun River drainage, Persian Gulf Basin, 31.24358, 50.99075.

Paratypes. AJRPC 17-P, 7, 69.3–45.2 mm SL; data same as holotype.

New material used in molecular genetic analysis. AJRPC-DNA 198A (COI: PP515175, Cyt b: PP548209), 198B (COI: PP515176, Cyt b: PP548210), 198C (COI: PP515177, Cyt b: PP548211), same data as holotype; AJRPC-DNA 1715 (COI: PP515188, Cyt b: not sequenced), Iran: Lorestan prov., Sezar River at Absardeh, Karun River drainage, Persian Gulf Basin, 33.20562, 48.88326.

Diagnosis

Carasobarbus doadrioi is distinguished from C. sublimus, C. hajhosseini sp. n. and C. kosswigi by having more scales on lateral line (40–44 vs. 27–37). Carasobarbus doadrioi sp. n. is similar to C. saadatii sp. n. and is distinguished by having a prominent black blotch on end of caudal peduncle in specimens < 85 mm SL (vs. no black blotch), longer head length (22–25 vs. 19–20% SL), shorter dorsal fin height (19–26 vs. 26–30% SL) and shorter distance between base of pelvic and anal fins (24–25 v. 26–28% SL). It is distinguished from C. luteus by having two pair of barbels (vs. one pair), well-developed median lobe on the lower lip (vs. without median lobe) and more scales on the lateral line (40–44 vs. 25–30) (Table 5).Table 5 Lateral line scale count.

Species	25	26	27	28	29	30	31	32	33	34	35	36	37	38	39	40	41	42	43	44	
C. luteus	1	2	3		1	1															
C. hajhosseini sp. n								3	4	4											
C. kosswigi								1	2	3	3	6	1								
C. saadatii sp. n														1	2	2					
C. doadrioi sp. n																3	1	1		1	
C. sublimus			1	1	2																
Significant values are bold.

Description

See Figs. 5, 6, 7 and 8 for general appearance, Table 6 for morphometric data. Body moderately high, laterally compressed, without nuchal hump. The greatest body depth in front or at dorsal-fin origin. Ventral head profile straight, dorsal head profile with a slight to pronounced hump near nostrils. Head short and narrow. Maximum body depth larger than head length. Triangular axillary scale at pelvic-fin base present. Pelvic-fin origin below vertical of last unbranched or first branched dorsal-fin ray. Caudal fin forked. Pectoral fin reaching approximately 70–90% of distance between pectoral- to pelvic-fin origin. Pelvic fin not reaching anus. Eye large, markedly smaller than snout. Mouth inferior, lips thick and fleshy with a well-developed median lob. Two pairs of barbels, rostral barbel reaches to anterior part of eye and maxillary barbel reaching to posterior part of eye.Table 6 Morphometric data of C. hajhosseini sp. n. (holotype BIAUBM 7-H and paratypes AJRPC 18-P to 23-P; n = 11) and C. doadrioi sp. n. (holotype BIAUBM 6-H and paratypes AJRPC 17-P; n = 8).

Characters	C. hajhosseini	C. doadrioi	
Holotype and paratypes	Holotype and paratypes	
H	Min	Max	Mean	SD	H	Min	Max	Mean	SD	
Standard length (SL)	191	86	184			75	45	69			
In percent of standard length	
 Head length	22.5	19.8	24.1	22.3	1.4	22.1	22.1	24.7	23.5	1.2	
 Body depth at dorsal fin origin	30.8	26.6	32.9	30.2	1.6	29.9	26.2	30.3	28.3	1.6	
 Body depth at anal fin origin	21.0	19.0	22.4	20.9	1.1	20.8	16.7	20.8	19.2	1.5	
 Pre-dorsal length	53.5	50.4	57.1	53.4	2.1	50.0	50.0	52.3	51.1	0.9	
 Pre-pelvic length	53.2	49.4	53.6	51.2	1.3	51.3	49.1	53.4	51.4	1.7	
 Pre-anal length	78.5	74.6	78.7	76.6	1.6	76.0	73.7	76.0	75.2	0.9	
 Dis. betw. pectoral and anal fins	56.3	50.8	58.9	54.2	2.3	55.8	49.2	55.8	52.0	2.2	
 Dis. betw. pectoral and pelvic fins	30.2	25.5	31.0	28.6	1.7	31.4	25.6	31.4	28.0	2.0	
 Dis. betw. pelvic and anal fins	27.2	23.9	28.4	25.9	1.3	24.2	24.1	25.2	24.6	0.5	
 Dorsal fin height	23.3	22.1	28.2	24.8	1.9	18.8	18.8	25.6	23.1	2.3	
 Anal fin height	23.9	19.1	27.2	23.0	2.6	20.6	19.7	25.4	21.8	2.2	
 Pectoral fin length	20.7	19.9	25.6	22.7	1.9	24.0	20.8	24.0	22.1	1.3	
 Pelvic fin length	18.1	18.1	22.5	20.1	1.6	18.0	17.0	21.1	18.9	1.4	
 Upper caudal fin lobe	28.8	28.6	36.2	31.4	2.4	28.7	28.7	32.8	30.9	1.6	
 Length of middle caudal fin	12.0	11.3	14.4	12.9	1.0	13.8	12.0	16.1	14.0	1.6	
 Caudal peduncle length	15.7	14.7	18.0	15.9	1.2	15.5	14.8	16.4	15.4	0.6	
 Caudal peduncle depth	11.7	11.1	13.5	12.4	0.8	12.3	10.8	12.3	11.4	0.6	
In percent of head length	
 Snout length	31	25	31	27.4	2.2	26	22	29	25.5	2.2	
 Eye diameter	21	21	26	23.1	1.3	24	20	28	24.2	3.0	
 Head depth at pupil	78	56	79	65.5	8.7	59	54	59	56.2	2.1	
 Head depth at nape	88	81	96	87.0	4.2	85	72	85	78.9	4.8	
 Posterior barbel	25	21	38	27.7	5.4	17	17	24	21.3	2.2	
 Anterior barbel	13	13	19	16.9	2.3	20	13	20	15.2	2.9	

Dorsal fin with 4 (n = 8) unbranched rays and 11½ (n = 8) branched rays, outer margin deeply concave. Anal fin with 3 (n = 8) unbranched and 6½ (n = 8) branched rays, outer margin straight. Pectoral fin with 14 (n = 5), 15 (n = 3) rays. Pelvic fin with 7 (n = 1)–8 (n = 7) rays. Lateral line with 40 (n = 3), 41 (n = 2), 42 (n = 1), 43 (n = 1), 44 (n = 1) scales. Scale rows between dorsal-fin origin and lateral line 7 (n = 8). Scale rows between anal-fin origin and lateral line 6 (n = 11).

Coloration

In life: Body silverish or cream-white. Back darker than belly. Series of scales over the lateral line outlined by dark pigmentation, evident in anterior and fade in posterior. Fins with scattered dark melanophores on rays and membranes. In formalin: Cream-brown, back darker than belly. Series of scales over the lateral line with dark anterior pigmentation, fading posteriorly. Fins with scattered dark melanophores on rays and membranes.

Distribution

Known from the lower Dez and Karun drainages.

Etymology

This species name derives from the name of the Spanish ichthyologist Ignacio Doadrio Villarejo, in honour of his invaluable contribution to the study of the fishes of the world.

Habitat

Carasobarbus doadrioi sp. n. is found in the deep, slow current of large rivers (Fig. 9). It typically favours areas with abundant vegetation with rocky substrates during the summer. Generally, the species is most abundant in the middle and lower Karun drainage. Luciobarbus esocinus Heckel, 1843, Garra rufa (Heckel, 1843), Acanthobrama marmid Heckel, 1843, Alburnus sellal Heckel, 1843, Chondrostoma regium (Heckel, 1843), Squalius berak Heckel, 1843, Oxynoemacheilus euphraticus, Glyptothorax cous (Linnaeus 1766) and G. alidaei Mousavi-Sabet, Eagderi, Vatandoust & Freyhof, 2021 were found coexisting with the new species.Fig. 9 Khersan River at Atishgah, Karun drainage, type locality of Carasobarbus doadrioi sp. n.

Carasobarbus hajhosseini , new species

(Figs. 10, 11, 12 and 13).Fig. 10 Carasobarbus hajhosseini sp. n.; BIAUBM 7-H, holotype, 191 mm SL; Iran: Seymareh River, Karkheh drainage.

Fig. 11 Carasobarbus hajhosseini sp. n., paratypes; from top: AJRPC 19-P, 109 mm SL; AJRPC 22-P, 113 mm SL; AJRPC 23-P, 94 mm SL; Iran: Karkheh drainage.

Fig. 12 Carasobarbus hajhosseini sp. n.; BIAUBM 7-H, holotype, 191 mm SL; Iran: Seymareh River, Karkheh drainage.

Fig. 13 Carasobarbus hajhosseini sp. n.; AJRPC 19-P, paratype, 109 mm SL; Iran: Kahman River, Karkheh drainage.

Holotype. BIAUBM 7-H, 190.6 mm SL; Iran: Ilam prov. Seymareh River at Talkhab, Karkheh drainage, Persian Gulf basin, 33.27771, 47.21252.

Paratypes. AJRPC 18-P, 4, 85.8–184.3 mm SL; same data as holotype. AJRPC 19-P, 2, 95.0–108.9 mm SL; Iran: Lorestan prov. Kahman River at Doab, Karkheh drainage, Persian Gulf basin, 33.78557, 48.20640. AJRPC 20-P, 1, 117.5 mm SL; Iran: Lorestan prov. Karkheh River at Pa Alam, Karkheh drainage, Persian Gulf basin, 32.83141, 48.03337. AJRPC 21-P, 1, 136.9 mm SL; Iran: Lorestan prov. Karkheh River at Mamulan, Karkheh drainage, Persian Gulf basin, 33.37823, 47.95654. AJRPC 22-P, 1, 113.2 mm SL; Iran: Lorestan prov. Karkheh River at Kal Sefid, Karkheh drainage, Persian Gulf basin, 33.08346, 47.53871. AJRPC 23-P, 1, 93.7 mm SL; Iran: Ilam prov. Karkheh River at Pol Zaal, Karkheh drainage, Persian Gulf basin, 32.98729, 47.76504.

New material used in molecular genetic analysis. AJRPC-DNA 225 (COI: PP515178, Cyt b: PP548212), Iran: Lorestan prov. Kahman River at Doab, Karkheh drainage, Persian Gulf basin, 33.78557, 48.20640; AJRPC-DNA 571A (COI: PP515182, Cyt b: PP548215), 571B (COI: PP515183, Cyt b: PP548216) same data as holotype.

Diagnosis

Carasobarbus hajhosseini sp. n. is distinguished from C. sublimus, C. saadatii sp. n. and C. doadrioi sp. n. by having more scales on lateral line (32–34 vs. 24–29 in C. sublimus; 40–44 in C. doadrioi sp. n.; 38–40 in C. saadatii sp. n.).

Carasobarbus hajhosseini sp. n. is similar to C. kosswigi but can be distinguished by slightly developed lower lip lobe (vs. well-developed), shorter head (20–24 vs. 24–27% SL), shorter posterior barbel (13–20 vs. 21–38% HL) and shorter snout (25–31 vs. 36–44% HL).

Also, the new species can be distinguished from C. luteus by having two pair of barbels (vs. one pair), well-developed median lobe on the lower lip (vs. without median lobe) and more scales on the lateral line (32–34 vs. 25–30).

Description

See Figs. 10, 11, 12 and 13 for general appearance, Table 6 for morphometric data. Body moderately high, laterally compressed, without nuchal hump. The greatest body depth at a level in front of or point of dorsal fin origin. Ventral head profile straight, dorsal profile has a slight to pronounced hump near nostrils. Head short and narrow. Maximum body depth larger than head length. Triangular axillary scale at pelvic-fin base. Pelvic-fin origin below vertical of last unbranched dorsal fin ray. Caudal fin forked. Tip of anal fin, when pressed to body, reaching to hypural complex. Pectoral fin reaching approximately 70–90% distance from pectoral-fin origin to pelvic-fin origin. Pelvic fin not reaching anus. Eye large, but smaller than snout. Mouth inferior, lips thick and fleshy with a small median lob. Two pairs of barbels, rostral not/or reaches to anterior part of eye and maxillary reaching to the posterior part of eye.

Dorsal fin with 4 unbranched rays and 10½ (n = 6)–11½ (n = 5) branched rays, outer margin deeply concave. Anal fin with 3 (n = 11) unbranched and 6½ (n = 11) branched rays, outer margin straight. Pectoral fin with 13 (n = 4), 14 (n = 6), 15 (n = 1) rays. Pelvic fin with 8 (n = 7)–9 (n = 4) rays. Lateral line with 32 (n = 3), 33 (n = 4), 34 (n = 4) scales. Scale rows between dorsal-fin origin and lateral line 6 (n = 11). Scale rows between anal-fin origin and lateral line 5 (n = 11).

Coloration

In fresh: Body silverish or cream-white. The back darker than the belly. Upper lateral line scales outlined by dark pigmentation, evident in anterior and fade in posterior. Fins with scattered dark melanophores on rays and membranes. In formalin: Body cream-brown, back darker than belly. Upper lateral line scales outlined by dark pigmentation, prominent in anterior section, fades towards posterior.

Distribution

The new species is known from the Gamasiab, Kahman, Kashkan and Seymareh in Karkheh drainage.

Etymology

The species is named in honour of Haj Hossein Javadi Pour (HHJP), who is the father of the first author of this study (AJR).

Habitat

Carasobarbus hajhosseini is commonly found in the deep, swiftly flowing sections of rivers and dam reservoirs (Fig. 14). It typically favours areas with abundant vegetation, and during the summer, it can also be observed in shallower waters. Generally, the species is most abundant in the middle and lower Karkheh drainage. Luciobarbus esocinus, Capoeta shajariani Jouladeh-Roudbar, Eagderi, Murillo-Ramos, Ghanavi & Doadrio, 2017, Garra gymnothorax Berg, 1949, Chondrostoma regium, Alburnus sellal, Squalius lepidus Heckel, 1843, Squalius berak, Turcinoemacheilus saadii Esmaeili, Sayyadzadeh, Özuluğ, Geiger & Freyhof, 2014, Glyptothorax cous and G. alidaei were found coexisting with the new species.Fig. 14 Seymareh River at Talkhab, Karkheh drainage, type locality of Carasobarbus hajhosseini sp. n.

Carasobarbus saadatii , new species

(Figs. 15, 16 and 17).Fig. 15 Carasobarbus saadatii sp. n.; BIAUBM 8-H, holotype, 188 mm SL; Iran: Karun River, Persian Gulf basin.

Fig. 16 Carasobarbus saadatii sp. n., AJRPC 24-P, paratypes, from top: 174 mm SL; 177 mm SL; 188 mm SL; 123 mm SL; Karun River, Persian Gulf basin.

Fig. 17 Carasobarbus saadatii sp. n.; uncatalogued, 175 mm SL; Iran: Karun River, Persian Gulf basin.

Holotype. BIAUBM 8-H, 187.6 mm SL; Iran: Khuzestan prov., Karun River at Gotvand, Persian Gulf Basin, 32.27319, 48.83521.

Paratypes. AJRPC 24-P, 4, 122.9–179.4 mm SL; data same as holotype.

New material used in molecular genetic analysis. AJRPC-DNA 1860 (COI: PP515189, Cyt b: PP548217), 1861 (COI: PP515190, Cyt b: PP548218), 1862 (COI: PP515191, Cyt b: PP548219), 1863 (COI: PP515192, Cyt b: PP548220) same data as holotype.

Diagnosis. Carasobarbus saadatii sp. n. is distinguished from C. sublimus (Fig. 18), C. hajhosseini sp. n. and C. kosswigi (Figs. 19, 20 and 21) by having more scales on lateral line (38–40 vs. 27–37).Fig. 18 Carasobarbus sublimus; VPFC Fahlian 1400.10., 132 mm SL; Iran: Fahlian River.

Fig. 19 Carasobarbus kosswigi; VPFC NeypahnSeyfolah 1400.7., 85 mm SL; Iran: Alvand River, Tigris drainage.

Fig. 20 Carasobarbus kosswigi; uncatalogued, about 175 mm SL; Türkiye: Tigris River.

Fig. 21 Carasobarbus kosswigi; VPFC Hajij 1394.4., 114 mm SL; Iran: Sivan River.

The new species can be distinguished from C. luteus (Fig. 22) by having two pair of barbels (vs. one pair), well-developed median lobe on the lower lip (vs. without median lobe) (Fig. 23) and more scales on the lateral line (38–40 vs. 25–30).Fig. 22 Carasobarbus luteus; VPFC SiyahGav 1400.9., 81 mm SL; Iran: Siyah Gav Lake.

Fig. 23 The ventral view of the head. From left to right: Carasobarbus kosswigi, VPFC NeypahnSeyfolah 1400.7., 85 mm SL; C. sublimus, VPFC Fahlian 1400.10., 132 mm SL; C. doadrioi sp. n., uncatalogued, about 150 mm SL; C. hajhosseini sp. n., AJRPC 21-P, 137 mm SL.

Description

See Figs. 15, 16 and 17 for general appearance, Table 7 for morphometric data. Body moderately high, laterally compressed, without nuchal hump. The greatest body depth at point of origin of dorsal fin. Ventral head profile straight, dorsal profile has a slight to pronounced hump near the nostrils. A rounded keel on back in front of dorsal fin. Head short and narrow. Maximum body depth larger than head length. Triangular axillary scale at pelvic-fin base. Pelvic-fin origin below vertical of last unbranched dorsal fin ray. Caudal fin forked. Tip of anal fin, when pressed to body, reaching to hypural complex. Pectoral fin reaching approximately 70–80% distance from pectoral-fin origin to pelvic-fin origin. Pelvic fin not reaching anus. Eye large, but smaller than snout. Mouth inferior, lips thick and fleshy with a well-developed median lob. Two pairs of barbels, rostral reaches to eye and maxillary reaching to the posterior part of eye.Table 7 Morphometric data of C. saadatii sp. n. (holotype BIAUBM 8-H and paratypes AJRPC 24-P; n = 5) and C. sublimus (VPFC Zard 1400.9., VPFC Fahlian 1400.10; n = 8) and C. kosswigi (FFR 416, FFR 417, FFR 421; n = 17).

Characters	C. saadatii	C. sublimus	C. kosswigi	
Holotype and paratypes	
H	Min	Max	Mean	SD	Min	Max	Mean	SD	Min	Max	Mean	SD	
Standard length (SL)	188	123	179			72				85	176			
In percent of standard length	
 Head length	20.1	18.7	20.1	19.1	0.6	23.1	26.8	25.5	1.7	24.5	27.4	25.7	0.8	
 Maximum body depth at dorsal fin origin	27.2	27.0	29.9	28.1	1.2	27.1	32.2	29.0	2.5	25.4	29.9	27.8	1.3	
 Body depth at anal fin origin	18.2	18.0	20.3	19.3	1.0	19.1	22.4	20.8	1.5	17.0	19.9	18.4	1.0	
 Pre-dorsal length	54.1	48.9	54.1	51.9	2.2	51.7	56.6	54.3	2.1	47.0	53.1	50.5	1.7	
 Pre-pelvic length	53.1	47.6	53.1	49.6	2.2	51.5	55.5	53.6	1.9	49.2	52.6	51.1	0.9	
 Pre-anal length	75.1	74.2	76.3	75.1	0.8	74.5	77.8	75.8	1.6	73.9	78.9	75.9	1.4	
 Dis. betw. pectoral and anal fins	55.1	55.0	57.6	56.4	1.2	46.3	51.4	49.0	2.1	50.2	56.4	53.4	1.4	
 Dis. betw. pectoral and pelvic fins	29.8	29.5	30.6	29.9	0.4	25.0	28.5	27.2	1.5	25.0	29.7	27.6	1.1	
 Dis. betw. pelvic and anal fins	25.6	25.6	28.1	26.9	1.1	21.1	23.8	22.6	1.2	18.6	30.1	26.0	2.4	
 Dorsal fin height	28.2	26.2	29.7	27.9	1.4	21.1	26.1	23.2	2.2	25.3	30.5	27.5	1.2	
 Anal fin height	22.0	20.4	22.9	21.3	1.1	20.4	27.2	23.5	3.0	17.5	27.4	22.2	3.3	
 Pectoral fin length	22.1	21.7	24.0	22.6	1.0	20.6	22.3	21.4	0.7	20.2	22.4	21.0	0.5	
 Pelvic fin length	19.1	18.8	21.3	19.8	1.0	19.1	21.0	20.1	0.8	18.6	20.1	19.3	0.5	
 Upper caudal fin lobe	29.7	29.7	33.7	31.6	1.7	29.5	34.9	32.8	2.5	27.8	32.0	29.9	1.2	
 Length of middle caudal fin	9.7	9.7	13.3	11.2	1.4	13.0	16.6	15.2	1.6	11.6	14.1	12.9	0.8	
 Caudal peduncle length	16.3	15.3	17.1	16.3	0.7	13.3	14.9	14.0	0.7	15.2	17.6	16.5	0.7	
 Caudal peduncle depth	10.2	10.2	12.1	11.0	0.7	10.9	13.1	11.8	1.1	9.3	10.9	10.2	0.4	
In percent of head length	
 Snout length	28	26	28	26.6	0.8	29	34	30.6	2.2	36	44	39.8	2.2	
 Eye diameter	23	20	24	22.2	1.7	22	30	25.3	3.1	16	26	19.2	2.5	
 Head depth at pupil	60	56	62	59.9	2.2	55	61	57.6	2.5	53	61	57.0	2.3	
 Head depth at nape	88	88	95	90.8	3.0	78	81	80.0	1.6	65	76	70.7	2.9	
 Posterior barbel	16	16	21	19.4	2.4	24	35	29.1	4.9	13	20	16.5	1.5	
 Anterior barbel	19	17	21	19.1	1.9	12	20	17.0	3.4	18	25	20.8	2.0	

Dorsal fin with 4 (n = 5) unbranched rays and 10½ (n = 5) branched rays, outer margin deeply concave. Anal fin with 3 (n = 5) unbranched and 6½ (n = 5) branched rays, outer margin straight. Pectoral fin with 14 (n = 2)–15 (n = 3) rays. Pelvic fin with 8 (5) rays. Lateral line with 38 (n = 1), 39 (n = 2), 40 (n = 2) scales. Scale rows between dorsal-fin origin and lateral line 6 (n = 4)–7 (n = 1). Scale rows between anal-fin origin and lateral line 5 (n = 6).

Coloration

In fresh: Body silverish or cream-white. The back darker than the belly. Upper lateral line scales outlined by dark pigmentation, evident in anterior and fade in posterior. Fins with scattered dark melanophores on rays and membranes. In formalin: Body cream-brown, back darker than belly. No dark pigmentation on anterior and posterior section of scales.

Distribution

The new species distributed in the lower Karun drainage as well as the Great Zab in the Tigris drainage.

Etymology

The species is named in honour of Mohamadali Saadati (Mashhad), acknowledging his significant contributions to the taxonomy of freshwater fishes in Iran. He holds the distinction of being the first Iranian Ichthyologist, conducting a systematic study on the taxonomy and distribution of freshwater fishes in Iran in 1977. To this day, his findings continue to be utilized by several Ichthyologists in Iran.

Habitat

The new species is usually found in the deeper parts of rivers and dam reservoirs, where water flows are slower and there is ample vegetation and cover (Fig. 24). During the summer months, it disperses into faster-flowing waters as well, likely due to warming water temperatures in their typical habitat. It prefers areas along the banks and around islands where tree roots and aquatic plants are accessible. This allows it to forage while remaining hidden among the vegetation to avoid predators. The species appears to be most abundant in the middle and lower Karun. Luciobarbus barbulus (Heckel, 1847), Capoeta aculeate (Valenciennes, 1844), Garra rufa, Chondrostoma regium, Alburnus sellal, Squalius lepidus, Squalius berak and Glyptothorax cous, were found coexisting with the new species.Fig. 24 Karun River, between Gotvand and Shushtar, Persian Gulf basin, type locality of Carasobarbus saadatii sp. n.

Discussion

In general, fishes of the genus Carasobarbus are bottom feeders, with morphological characters specialised for such behaviour. This is especially visible in the differences in the development of their mouth structure and lips. Similar developments have been observed in other species of barbs26,27. The lips development in Carasobarbus fishes, seems to be a suitable character to separate species28. In the newly described species, the C. hajhosseini species present the smaller lips (less developed). On the other hand, C. doadrioi species, appear to show the most developed lips among them. Check the ventral head view figure (Fig. 23) to compare these differences and observe that both latter mentioned species show both ends of the spectrum. Carasobarbus saadatii species also present intermediate lips development similar to C. sublimus for example, but we do not have an acceptable picture to show in this work.

Borkenhagen and Krupp2 questioned the locality data of the C. sublimus specimen (CMNFI 1979-0277), as the morphometric and meristic characters (scales in the lateral line, above the lateral line, and around the least circumference of the caudal peduncle; length of the dorsal, pectoral, ventral, and anal fins) of this specimen are within the range of C. sublimus and outside the range of C. kosswigi. This discrepancy is unsurprising because the Karkheh population belongs to C. hajhosseini, and the range of these characters matches the locality mentioned for this voucher specimen. However, they considered C. hajhosseini populations as C. sublimus, and C. doadrioi and C. saadati as C. kosswigi, which caused the range of morphometric characters to expand and positioned C. kosswigi and C. sublimus as paraphyletic in the phylogenetic trees.

In general, nearly all the internal nodes are well resolved in all three datasets (COI, Cyt b and concatenated datasets) used in molecular phylogenetic analyses. But as expected, the concatenated dataset resulted in the best resolved tree. Both genetic markers used in the concatenated dataset are mitochondrial markers, i.e. they sare the same evolutionary history. This point out that the improvement in the phylogenetic resolution is most probably due to the increment in the phylogenetic signal coded in a longer sequence fragment. This point underlines the importance of including multiple markers to be able to resolve remaining obscure relationships within the genus. On the other hand, being hexaploid, complicates the inclusion of any nuclear marker in any genetic study in near future29. This point is important as some species of the genus (for example C. luteus) is widespread in a variety of habitats and therefore will not be surprising to find that different populations does not share the same evolutionary history. This will not be visible without analysing both mitochondrial and nuclear genomic markers.

In the obtained mitochondrial phylogenetic results in the actual study, the only unresolved relationship, is the one between C. doadrioi, C. hajhosseini and C. saadatii. The very short internal branch at this level, when present, shows a potential rapid speciation event, resulting in small number of conserved changes to resolve this relationship. In our results, based on the partial COI gene, two clearly separate clades are formed with both containing sequences identified as C. harterti and C. fritschii. This is most probably the result of misidentification, or also it can be due to introgression events. As we do not have access ourselves to the material used in this case (genetic material was retrieved from GenBank), we cannot further develop on this and corroborate the identity of each of the clades. On the other hand, using other individuals identified as these two species, they do separate well in the results of the cyt b gene dataset, with no further issues. Another possible issue which will need further investigation is the inclusion of samples identified as C. apoensis within the C. luteus clade, with practically no genetic difference with them. This point was also mentioned in Borkenhagen28. Based on this observation we recommend a systematic revision of both C. apoensis and C. luteus in further studies.

Comparative materials examined

Carasobarbus kosswigi. Iran: – VPFC NeypahnSeyfolah 1400.7., 1, 85 mm SL; Iran: Kermanshah prov.: Alvand River at Neypahn Seyfolah, Karkheh, 34.408611, 45.586944. – VPFC Hajij 1394.4., 1, 114 mm SL; Iran: Kermanshah prov.: Sirvan River at Hajij, Tigris drainage, 35.15678, 46.32132 (now under dam).

Türkiye: – FFR 416, 17, 124–176 mm SL; FFR 417, 1, 170 mm SL; FFR 421, 4, 129–168 mm SL; Siirt prov.: Botan River at 8 km southwest of Siirt, Tigris drainage, 37.85268, 41.88749.

Carasobarbus sublimus. Iran: – VPFC Zard 1400.9., 2, 72–132 mm SL; Iran: Fars prov., Zard River at Zard Mashin, Marun drainage, 31.37633, 49.72072. – VPFC Fahlian 1400.10., 2, 111–92 mm SL; Iran: Fars prov., Fahlian River at Fahlian bridge, Zohre drainage, 30.18520, 51.52443.

Carasobarbus luteus. Iran: – VPFC Siyahgav 1400.9., 7, 65–95 mm SL; Iran: Ilam prov., Siyah Gav Lake, near Abdanan, Tigris drainage, 32.86564, 47.70155. – VPFC Golabi 1400.10., 1, 130 mm SL; Iran: Fars prov., Golabi spring, near Darab, Kol drainage, 28.78766, 54.37183.

New material used in molecular genetic analysis

Carasobarbus kosswigi. Türkiye: AJRPC-DNA 1882 (COI: PP515193, Cyt b: PP548221), 1883 (COI: PP515194, Cyt b: PP548222), Şırnak prov.: Tigris River at 4 km north of Cizre, 37.375610 42.147106; 1884 (COI: PP515195, Cyt b: PP548223), Şırnak prov.: Tigris River at Damlarca, 37.404131 42.070865. Iran: AJRPC-DNA 45 (COI: PP515174, Cyt b: PP548208), Kermanshah prov.: Alvand River at Neypahn Seyfolah, Karkheh, 34.408611, 45.586944.

Carasobarbus sublimus. Iran: AJRPC-DNA 400A (COI: PP515179, Cyt b: PP548213), 400B (COI: PP515180, Cyt b: PP548214), Iran: Fars prov., Zard River at Zard Mashin, Marun drainage, 31.37633, 49.72072.

Carasobarbus luteus. Iran: AJRPC-DNA 554B (COI: PP515181) Kermanshah prov.: Alvand River at Neypahn Seyfolah, Karkheh, 34.408611, 45.586944; 707 (COI: PP515184) Khuzestan prov., Karun River at Gotvand, Persian Gulf Basin, 32.27319, 48.83521; Iraq: AJRPC-DNA 1465 (COI: PP515187), Al Najaf prov.: Euphrates River at Kafal, Persian Gulf Basin, 32.22339, 44.36113; 1376 (COI: PP515185), 1377 (COI: PP515186), Maysan prov.: Tigris River at Amareh, Persian Gulf Basin, 31.85783, 47.13605.

Abbreviations

SL Standard length

HL Lateral head length

BIAUBM Babol Islamic Azad University Biological Museum, Babol, Iran

AJRPC A. Jouladeh-Roudbar personal fish collection, Tehran, Iran

VPFC S. Vatandoust Personal Fish collection, Qaem Shahr, Iran

FFR Faculty of Fisheries, Recep Tayyip Erdogan University, Rize, Turkey

Author contributions

A.J.R. and H.R.G. designed the experiment. A.J.R., S.V. and C.K. sampled the individuals. A.J.R. performed the wet laboratory experiments and morphological analyses. A.J.R. and H.R.G. performed the molecular analyses, and wrote the manuscript with inputs from all authors. S.V. and C.K. helped obtain permits for sampling. H.R.G. secured the funding and supervised the work.

Funding

Open access funding provided by Lund University.

Data availability

All the specimens obtained in this study are deposited in local publicly accessible (upon request) zoological collections. The genetic data obtained in this study is deposited in NCBI’s GenBank, the accession numbers for each gene marker is mentioned after each specimen’s voucher code.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Coad BW Najafpour N Barbus sublimus, a new species of cyprinid fish from Khuzestan province, Iran Ichthyol. Explor. Freshw. 1997 7 273 278
Coad, B. W. & Najafpour, N. Barbus sublimus, a new species of cyprinid fish from Khuzestan province, Iran. Ichthyol. Explor. Freshw. 7, 273–278 (1997).
2. Borkenhagen K Krupp F Taxonomic revision of the genus Carasobarbus Karaman, 1971 (Actinopterygii, Cyprinidae) ZooKeys 2013 339 1 53 10.3897/zookeys.339.4903
Borkenhagen, K. & Krupp, F. Taxonomic revision of the genus Carasobarbus Karaman, 1971 (Actinopterygii, Cyprinidae). ZooKeys 339, 1–53. 10.3897/zookeys.339.4903 (2013).
3. Coad BW Carps and Minnows of Iran (Families Cyprinidae and Leuciscidae) Volume I: General Introduction and Carps (Family Cyprinidae) 2021 Canadian Museum of Nature
Coad, B. W. Carps and Minnows of Iran (Families Cyprinidae and Leuciscidae) Volume I: General Introduction and Carps (Family Cyprinidae) (Canadian Museum of Nature, 2021).
4. Kaya C Turan D Unlu E The latest status and distribution of fishes in upper Tigris River and two new records for Turkish freshwaters Turk. J. Fish. Aquat. Sci. 2016 16 3 545 562 10.4194/1303-2712-v16_3_07
Kaya, C., Turan, D. & Unlu, E. The latest status and distribution of fishes in upper Tigris River and two new records for Turkish freshwaters. Turk. J. Fish. Aquat. Sci. 16(3), 545–562. 10.4194/1303-2712-v16_3_07 (2016).
5. Jouladeh-Roudbar A Ghanavi HR Doadrio I Ichthyofauna from Iranian freshwater: Annotated checklist, diagnosis, taxonomy, distribution and conservation assessment Zool. Stud. 2020 59 e21 10.6620/ZS.2020.59-21 33456548
Jouladeh-Roudbar, A., Ghanavi, H. R. & Doadrio, I. Ichthyofauna from Iranian freshwater: Annotated checklist, diagnosis, taxonomy, distribution and conservation assessment. Zool. Stud. 59, e21. 10.6620/ZS.2020.59-21 (2020).33456548
6. Bianco PG Bănărescu PM A contribution to the knowledge of the Cyprinidae of Iran (Pisces, Cypriniformes) Bull. Soc. Fr. Ichthyol. 1982 6 2 75 96
Bianco, P. G. & Bănărescu, P. M. A contribution to the knowledge of the Cyprinidae of Iran (Pisces, Cypriniformes). Bull. Soc. Fr. Ichthyol. 6(2), 75–96 (1982).
7. Karaman MS Süßwasserfische der Türkei. 8. Teil: Revision der Barben Europas, Vorderasiens und Nordafrikas Mitt. Hambg. Zool. Mus. Inst. 1971 67 175 254
Karaman, M. S. Süßwasserfische der Türkei. 8. Teil: Revision der Barben Europas, Vorderasiens und Nordafrikas. Mitt. Hambg. Zool. Mus. Inst. 67, 175–254 (1971).
8. Borkenhagen K Esmaeili HR Mohsenzadeh S Shahryari F Gholamifard A The molecular systematics of the Carasobarbus species from Iran and adjacent areas, with comments on Carasobarbus albus (Heckel, 1843) Environ. Biol. Fish. 2011 91 327 335 10.1007/s10641-011-9787-1
Borkenhagen, K., Esmaeili, H. R., Mohsenzadeh, S., Shahryari, F. & Gholamifard, A. The molecular systematics of the Carasobarbus species from Iran and adjacent areas, with comments on Carasobarbus albus (Heckel, 1843). Environ. Biol. Fish. 91, 327–335. 10.1007/s10641-011-9787-1 (2011).
9. Kottelat M Freyhof J Handbook of European Freshwater Fishes 2007 Kottelat, Cornol & Freyhof
Kottelat, M. & Freyhof, J. Handbook of European Freshwater Fishes (Kottelat, Cornol & Freyhof, 2007).
10. Ward RD DNA barcoding Australia's fish species Philos. Trans. R. Soc. Lond. B Biol. Sci. 2005 360 1462 1847 1857 10.1098/rstb.2005.1716 16214743
Ward, R. D. et al. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360(1462), 1847–1857. 10.1098/rstb.2005.1716 (2005).16214743
11. Machordom A Doadrio I Evidence of a Cenozoic Betic-Kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae) Mol. Phylogenet. Evol. 2001 18 2 252 263 10.1006/mpev.2000.0876 11161760
Machordom, A. & Doadrio, I. Evidence of a Cenozoic Betic-Kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae). Mol. Phylogenet. Evol. 18(2), 252–263. 10.1006/mpev.2000.0876 (2001).11161760
12. Katoh K Misawa K Kuma KI Miyata T MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform Nucleic Acids Res. 2002 30 14 3059 3066 10.1093/nar/gkf436 12136088
Katoh, K., Misawa, K., Kuma, K. I. & Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30(14), 3059–3066. 10.1093/nar/gkf436 (2002).12136088
13. Katoh K Standley DM MAFFT multiple sequence alignment software version 7: Improvements in performance and usability Mol. Biol. Evol. 2013 30 4 772 780 10.1093/molbev/mst010 23329690
Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30(4), 772–780. 10.1093/molbev/mst010 (2013).23329690
14. Tamura K Stecher G Peterson D Filipski A Kumar S MEGA 6: Molecular evolutionary genetics analysis version 6.0 Mol. Biol. Evol. 2013 30 2725 2729 10.1093/molbev/mst197 24132122
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. MEGA 6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. 10.1093/molbev/mst197 (2013).24132122
15. Nguyen LT Schmidt HA Von Haeseler A Minh BQ IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies Mol. Biol. Evol. 2015 32 1 268 274 10.1093/molbev/msu300 25371430
Nguyen, L. T., Schmidt, H. A., Von Haeseler, A. & Minh, B. Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32(1), 268–274. 10.1093/molbev/msu300 (2015).25371430
16. Trifinopoulos J Nguyen LT von Haeseler A Minh BQ W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis Nucleic Acids Res. 2016 44 W1 W232 W235 10.1093/nar/gkw256 27084950
Trifinopoulos, J., Nguyen, L. T., von Haeseler, A. & Minh, B. Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 44(W1), W232–W235. 10.1093/nar/gkw256 (2016).27084950
17. Kalyaanamoorthy S Minh BQ Wong TK Von Haeseler A Jermiin LS ModelFinder: Fast model selection for accurate phylogenetic estimates Nat. Methods 2017 14 6 587 589 10.1038/nmeth.4285 28481363
Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K., Von Haeseler, A. & Jermiin, L. S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 14(6), 587–589. 10.1038/nmeth.4285 (2017).28481363
18. Guindon S Dufayard JF Lefort V Anisimova M Hordijk W Gascuel O New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0 Syst. Biol. 2010 59 3 307 321 10.1093/sysbio/syq010 20525638
Guindon, S. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 59(3), 307–321. 10.1093/sysbio/syq010 (2010).20525638
19. Ronquist F MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space Syst. Biol. 2012 61 3 539 542 10.1093/sysbio/sys029 22357727
Ronquist, F. et al. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61(3), 539–542. 10.1093/sysbio/sys029 (2012).22357727
20. Huelsenbeck JP Larget B Alfaro ME Bayesian phylogenetic model selection using reversible jump Markov chain Monte Carlo Mol. Biol. Evol. 2004 21 6 1123 1133 10.1093/molbev/msh123 15034130
Huelsenbeck, J. P., Larget, B. & Alfaro, M. E. Bayesian phylogenetic model selection using reversible jump Markov chain Monte Carlo. Mol. Biol. Evol. 21(6), 1123–1133. 10.1093/molbev/msh123 (2004).15034130
21. Rambaut A Drummond AJ Xie D Baele G Suchard MA Posterior summarisation in Bayesian phylogenetics using Tracer 1.7 Syst. Biol. 2018 67 5 901 904 10.1093/sysbio/syy032 29718447
Rambaut, A., Drummond, A. J., Xie, D., Baele, G. & Suchard, M. A. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 67(5), 901–904. 10.1093/sysbio/syy032 (2018).29718447
22. Puillandre N Lambert A Brouillet S Achaz G ABGD, automatic barcode gap discovery for primary species delimitation Mol. Ecol. 2012 21 8 1864 1877 10.1111/j.1365-294X.2011.05239.x 21883587
Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. ABGD, automatic barcode gap discovery for primary species delimitation. Mol. Ecol. 21(8), 1864–1877. 10.1111/j.1365-294X.2011.05239.x (2012).21883587
23. Puillandre N Brouillet S Achaz G ASAP: Assemble species by automatic partitioning Mol. Ecol. Resour. 2021 21 2 609 620 10.1111/1755-0998.13324 33058550
Puillandre, N., Brouillet, S. & Achaz, G. ASAP: Assemble species by automatic partitioning. Mol. Ecol. Resour. 21(2), 609–620. 10.1111/1755-0998.13324 (2021).33058550
24. Zhang J Kapli P Pavlidis P Stamatakis A A general species delimitation method with applications to phylogenetic placements Bioinformatics 2013 29 22 2869 2876 10.1093/bioinformatics/btt499 23990417
Zhang, J., Kapli, P., Pavlidis, P. & Stamatakis, A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 29(22), 2869–2876. 10.1093/bioinformatics/btt499 (2013).23990417
25. Borkenhagen K A new genus and species of cyprinid fish (Actinopterygii, Cyprinidae) from the Arabian Peninsula, and its phylogenetic and zoogeographic affinities Environ. Biol. Fish. 2014 97 1179 1195 10.1007/s10641-014-0315-y
Borkenhagen, K. A new genus and species of cyprinid fish (Actinopterygii, Cyprinidae) from the Arabian Peninsula, and its phylogenetic and zoogeographic affinities. Environ. Biol. Fish. 97, 1179–1195. 10.1007/s10641-014-0315-y (2014).
26. Nagelkerke, L.A.J. The barbs of Lake Tana, Ethiopia. Morphological diversity and its implications for taxonomy, trophic resource partitioning, and fisheries. Dissertation, Univ., Diss., 296 (1997).
27. Levin BA Casal-López M Simonov E Dgebuadze YY Mugue NS Tiunov AV Doadrio I Golubtsov AS Adaptive radiation of barbs of the genus Labeobarbus (Cyprinidae) in an East African river Freshw. Biol. 2019 64 1721 1736 10.1111/fwb.13364
Levin, B. A. et al. Adaptive radiation of barbs of the genus Labeobarbus (Cyprinidae) in an East African river. Freshw. Biol. 64, 1721–1736 (2019).
28. Borkenhagen, K. Taxonomy, phylogeny and zoogeography of the hexaploid Torini of the Middle East and North Africa. Dissertation, Frankfurt am Main, XIII, 148 (2017).
29. Yang L Sado T Vincent Hirt M Pasco-Viel E Arunachalam M Li J Wang X Freyhof J Saitoh K Simons AM Miya M He S Mayden RL Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes) Mol. Phylogenet. Evol. 2015 85 97 116 10.1016/j.ympev.2015.01.014 25698355
Yang, L. et al. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Mol. Phylogenet. Evol. 85, 97–116 (2015).25698355
