
==== Front
Vet Med Sci
Vet Med Sci
10.1002/(ISSN)2053-1095
VMS3
Veterinary Medicine and Science
2053-1095
John Wiley and Sons Inc. Hoboken

10.1002/vms3.70032
VMS370032
Original Article
Original Article
Detection and characterization of multidrug resistant Escherichia coli carrying virulence gene isolated from broilers in Bangladesh
ISLAM et al.
Islam Md. Sirazul https://orcid.org/0000-0002-0525-8401
1 6
Nath Chandan https://orcid.org/0000-0003-2040-0266
2 chandannath227@gmail.com

Hasib F. M. Yasir https://orcid.org/0000-0002-6662-7725
1
Logno Tahia Ahmed https://orcid.org/0000-0001-9644-6426
2
Uddin Md. Helal https://orcid.org/0000-0001-6140-7937
3
Hassan Mohammad Mahmudul https://orcid.org/0000-0001-6495-4637
4 5
Chowdhury Sharmin https://orcid.org/0000-0002-8031-5998
1
1 Department of Pathology and Parasitology Faculty of Veterinary Medicine Chattogram Veterinary and Animal Sciences University Chattogram Bangladesh
2 Department of Microbiology and Veterinary Public Health Faculty of Veterinary Medicine Chattogram Veterinary and Animal Sciences University Chattogram Bangladesh
3 Department of Medicine and Surgery Faculty of Veterinary Medicine Chattogram Veterinary and Animal Sciences University Chattogram Bangladesh
4 Queensland Alliance for One Health Sciences School of Veterinary Science The University of Queensland Gatton Queensland Australia
5 Department of Physiology Biochemistry and Pharmacology Chattogram Veterinary and Animal Sciences University Chattogram Bangladesh
6 Melbourne Veterinary School Faculty of Science University of Melbourne Parkville Australia
* Correspondence
Chandan Nath, Department of Microbiology and Veterinary Public Health, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University, Khulshi, Chattogram 4225, Bangladesh.
Email: chandannath227@gmail.com

18 9 2024
11 2024
10 6 10.1002/vms3.v10.6 e7003212 8 2024
29 3 2024
23 8 2024
© 2024 The Author(s). Veterinary Medicine and Science published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The emergence and dissemination of multidrug resistant (MDR) bacteria pose a severe threat to public health by limiting clinical treatment and prophylactic options.

Objectives

This study investigates the prevalence of Escherichia coli in broilers, their phenotypic antimicrobial resistance (AMR) profiles and the presence of virulence‐associated genes (VAGs) and antimicrobial resistance genes (ARGs) using polymerase chain reaction (PCR).

Materials and methods

A total of 216 pooled cloacal samples were collected from 1080 broilers across six districts of Bangladesh. Each pooled sample comprised randomly selected cloacal swabs from five birds per farm. E. coli isolates were identified using standard bacteriological approach, followed by biochemical assays and PCR. Antimicrobial susceptibility was assessed using the Kirby–Bauer disc diffusion method, and the presence of ARGs and VAGs was determined via PCR. Five selected isolates were partially sequenced for five VAGs using Sanger sequencing.

Results

A total of 177 E. coli isolates (81.94%, 95% confidence interval: 76.24%–86.53%) were identified. The isolates showed the highest resistance to ampicillin (93.79%), followed by tetracycline (91.53%), erythromycin (89.27%) and ciprofloxacin (87%). Conversely, ceftriaxone (80.79%) showed highest susceptibility, followed by gentamicin (37.29%) and neomycin (31.07%). All isolates were MDR, with a multiple antibiotic resistance indexes were <0.3. A significant percentage (16.38%) of E. coli isolates were MDR to five antimicrobial classes and harboured bla TEM, sul1, ere (A), tetA, tetB and tetC genes. The highest prevalent ARGs were bla TEM (88.14%) followed by ere (A) (83.62%) and sul 1 (72.32%). The prevalence of VAGs was astA (56.50%), iucD (31.07%), iss (21.47%), irp2 (15.82%) and cva/cvi (3.39%), respectively.

Conclusions

This study highlights the presence of ARGs contributing to the development of MDR in E. coli carrying VAGs in broilers. Effective monitoring and surveillance of antimicrobial usage in poultry production systems are urgently required to prevent emergence and dissemination of AMR.

This study investigated E. coli prevalence, AMR and VAGs isolated from broilers in Bangladesh. The prevalence of E. coli was 81.94%. The isolates exhibited the highest resistance to ampicillin (94%) and the lowest resistance to ceftriaxone (19%). All the isolates were MDR, and the correlation coefficient showed a significant correlation (r = 0.8) between the aac (3)‐IV gene and gentamicin, the ere (A) gene and erythromycin. The most prevalent ARG was bla TEM (88.14%), and VAG was astA (56.5%).

AMR
ARGs
chicken
public health
VAGs
source-schema-version-number2.0
cover-dateNovember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:19.09.2024
Islam, M. S. , Nath, C. , Hasib, F. M. Y. , Logno, T. A. , Uddin, M. H. , Hassan, M. M. , & Chowdhury, S. (2024). Detection and characterization of multidrug resistant Escherichia coli carrying virulence gene isolated from broilers in Bangladesh. Veterinary Medicine and Science, 10 , e70032. 10.1002/vms3.70032
==== Body
pmc1 INTRODUCTION

Escherichia coli, which has been considered a harmless and versatile microbe, can lead to various intestinal and extra‐intestinal diseases, including haemorrhagic diarrhoea, urinary tract infections, meningitis and pneumonia, in humans and animals by acquiring different virulence traits (Hammerum & Heuer, 2009; Kunert Filho et al., 2015; Parvin et al., 2020). Commonly used for treating and preventing diseases in poultry, antimicrobials were used for growth promotion in poultry production, leading to antimicrobial misuse (Hassan et al., 2021). Bacteria have acquired drug resistance genes through horizontal gene transfer or gene mutation mechanisms (Darby et al., 2023). The poor selection and irrational use of antimicrobials are the leading causes of the emergence and dissemination of antimicrobial resistant bacteria, which can potentially be transmitted to humans through the food chain (Hasib et al., 2024; Parvin et al., 2020). According to the World Health Organization (WHO), millions of patients are expected to die in the coming decades due to antimicrobial resistance (AMR), as antimicrobials fail to treat clinical cases of infections (WHO, 2023).

Bangladesh, a major poultry producer, according to the Department of Livestock Service Economy 2019–2020, relies on the poultry industry to drive economic growth in rural communities. In this context, approximately 3563.18 lakhs of poultry were generated from a total livestock production of 4122.44 lakhs (DLS, 2020). The extent of antimicrobial usage (AMU) in poultry and the annual sales data of antimicrobials in Bangladesh remain unknown (Imam et al., 2020). Farmers can easily acquire antimicrobials from drug sellers without needing a prescription from a registered veterinarian (Ahmed et al., 2020). Despite recent stringent regulations on antimicrobial sales, unregulated use of antimicrobials is widespread in poultry production in Bangladesh (Hassan et al., 2021).

Multidrug resistance has been increased all over the world that is considered a public health threat. Several recent investigations reported the emergence of multidrug resistant (MDR) bacterial pathogens from different origins that increase the necessity of the proper use of antibiotics. Besides, the routine application of the antimicrobial susceptibility testing (AST) to detect the antibiotic of choice as well as the screening of the emerging MDR strains (Algammal et al., 2019, 2022, 2023; Elbehiry et al., 2022; Shafiq et al., 2022).

Pathogenicity is expedited by virulence factors like adhesion, iron acquisition, haemolysin, aerobactin's and serum resistance translated by virulence‐associated genes (VAGs) found in plasmids or chromosomal areas of pathogenicity islands (PAIs) (Subedi et al., 2018). These virulence factors permeate host tissues, produce toxins, evade host defences and ultimately cause local inflammation in the host, among other pathways that lead to infection (El‐Baz et al., 2022). Isolates with at least five virulence genes are classified as avian pathogenic E. coli (APEC), and five genes (iutA, iss, ompT, iroN and hlyF) mainly were associated with pathogenesis (De Carli et al., 2015).

E. coli also causes colibacillosis, resulting in considerable disease in the poultry industry worldwide (Kika et al., 2023). The impacts include production losses, increased mortality and higher production costs due to systemic infections in the poultry gut, characterized by acute fatal septicemia or sub‐acute fibrinous pericarditis, air sacculitis, salpingitis and peritonitis (Ibrahim et al., 2019). Moreover, the presence of antimicrobial resistance genes (ARGs) and VAGs in the farm makes it more vulnerable to contaminating the surrounding environment and adds selection pressure on the environmental pathogens. Maintaining effective biosecurity on broiler farms appears to be impractical with current farming practices in Bangladesh, which would exacerbate the situation in terms of potential zoonotic pathogen transmission to humans and other animals.

AMR is a burning issue, and there is a lack of stringent strategies to control AMU in poultry production in Bangladesh. Given the importance of AMR and VAGs in E. coli, this study was undertaken to estimate the prevalence of E. coli from cloacal samples of broiler chickens. Subsequently, the phenotypic AMR profile was examined, followed by molecular identification of ARGs and VAGs to establish a baseline of AMR patterns and VAGs found in E. coli isolated from broiler chickens in Bangladesh.

2 MATERIALS AND METHODS

2.1 Sampling

This cross‐sectional study was conducted between June 2019 and March 2020 in six districts of Bangladesh: Chattogram, Dhaka, Narsingdi, Narayanganj, Munshigonj and Khagrachari. The first five districts are plain land, and the last one is a hilly area. The districts were selected based on their poultry population density (Figure 1). Broiler farms were chosen randomly from the list provided by the government district livestock office. The following formula was used for the sample size calculation: Samplesize,n=N×Z2×p×1−pe2N−1+Z2×p×1−pe2

where n is the sample size, N is the population size, critical value (95% level of significance) Z is the 1.96 s, margin of error e is the 0.05 and sample proportion p is the 0.5.

FIGURE 1 A map of Bangladesh displaying the geographical location of broiler farms included in the study.

Later, one pooled cloacal swab sample was collected for each of the representative farms from five randomly selected birds from the broiler flocks. Swabs were taken aseptically using commercial swabs (Model: PW005 Himedia) and transferred into the falcon tube containing 5 mL buffered peptone water (BPW) (Oxoid Ltd.). All samples were stored at 4°C and transferred carefully for laboratory processing (not more than 24 h) and subsequent isolation.

2.2 Isolation and identification of E. coli

Isolation and identification were performed following standard bacteriological methods (Dutta et al., 2020). Briefly, all samples were pre‐enriched overnight in BPW (Oxoid Ltd.). A loopful broth (∼10 µL) was inoculated onto MacConkey agar and eosin‐methylene blue (EMB) agar (Oxoid Ltd.) and incubated overnight at 37°C. The purified colonies were sub‐cultured onto blood agar with 5% bovine blood (Oxoid Ltd.) and incubated overnight at 37°C. Colonies were further confirmed by Gram stain properties and several biochemical tests (catalase, oxidase, lactose fermentation, Voges‐Proskauer, indole, methyl‐red and H2S production). A single‐isolated colony was preserved at −80°C in equal ratio (1:1) of brain heart infusion broth (Oxoid Ltd.) and 50% buffered glycerine.

2.3 Molecular confirmation of E. coli

The genomic DNA was extracted following the conventional crude boiling method (Malorny et al., 2003). A polymerase chain reaction (PCR) assay was conducted for the final confirmation of the suspected isolates using a genus‐specific universal primer targeting the 16S rRNA gene: (F) 5′‐GACCTCGGTTTAGTTCACAGA‐3′ and (R) 5′–CACACGCTGACGCTGACCA‐3′, maintaining the initial denaturation at 95°C for 5 min and final extension at 72°C for 7 min with the 35 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 1 min and extension at 72°C for 1 min (Schippa et al., 2010). The PCR products were visualized on a gel documentation system (UVP UVsolo touch‐Analytik Jena AG, Thermo Fisher Scientific) after electrophoresis with a 1.5% agarose gel (MP Biomedicals).

2.4 Phenotypic antimicrobial susceptibility test (AST)

All E. coli isolates were tested for AST following the Kirby–Bauer disc diffusion method (Bauer et al., 1966). Eight antimicrobials of seven different classes – cephalosporins: ceftriaxone (CRO, 30 µg), penicillins: ampicillin (AMP, 10 µg), fluoroquinolones: ciprofloxacin (CIP, 5 µg), aminoglycosides: gentamicin (CN, 10 µg) and neomycin (N, 30 µg), macrolides: erythromycin (E, 15 µg), sulphonamides: sulfamethoxazole‐trimethoprim (SXT, 23.75 + 1.25 µg) and tetracycline: tetracycline (TE, 30 µg) (Oxoid Ltd.) were used. The zone diameter was measured using slide calipers and interpreted in accordance with CLSI criteria (CLSI, 2020). E. coli ATCC25922 was used as a quality control organism. E. coli isolates resistant to at least three antimicrobial classes were classified as MDR (Magiorakos et al., 2012). Additionally, multiple antibiotic resistance (MAR) indexes were calculated using the following formula: a/b (a: a number of antimicrobial agents to which the isolates are resistant/b: total number of tested antimicrobial agents), as previously described by Algamma et al. (2022).

2.5 Detection of AMR genes (ARGs)

Although phenotypically eight antimicrobials were tested in this study, the following ARGs were screened from the isolates – aminoglycoside resistant [aac(3)‐IV], sulphonamide resistant (sul1), penicillin resistant (bla SHV, bla CMY, bla TEM), erythromycin resistant [ere (A)] and TE resistant (tetA, tetB, tetC) by PCR. The oligonucleotide primers sequence and cyclic conditions used for each gene are shown in Table 1.

TABLE 1 The oligonucleotide primer sequences for detection of antimicrobial resistance genes of Escherichia coli.

Gene	Primer sequence (5′–3′)	Size (bp)	Cyclic conditions (35 cycles)	References	
Denatur.	Annealing	Extension	
aac(3)‐IV (gentamicin resistance)	F: CTTCAGGATGGCAAGTTGGT	286	94°C for 1 min	55°C for 90 s	72°C for 1 min	Momtaz et al. (2012)	
R: TCATCTCGTTCTCCGCTCAT	
sul1 (sulphonamide resistance)	F: TTCGGCATTCTGAATCTCAC	822	94°C for 1 min	47°C for 90 s	72°C for 1 min	
R: ATGATCTAACCCTCGGTCTC	
bla SHV (penicillin resistance)	F: TCGCCTGTGTATTATCTCCC	768	94°C for 1 min	52°C for 90 s	72°C for 1 min	
R: CGCAGATAAATCACCACAATG	
bla CMY (penicillin resistance)	F: TGGCCAGAACTGACAGGCAAA	462	94°C for 1 min	47°C for 90 s	72°C for 1 min	
R: TTTCTCCTGAACGTGGCTGGC	
bla TEM (penicillin resistance)	F: GCGGAACCCCTATTTG	964 *	94°C for 3 min	50°C for 60 s	72°C for 1 min	Hasman et al. (2005)	
R: TCTAAAGTATATATGAGTAAA

CTTGGTCTGAC

	
ere(A) (erythromycin resistance)	F: GCCGGTGCTCATGAACTTGAG	419	94°C for 1 min	52°C for 90 s	72°C for 1 min	Momtaz et al. (2012)	
R: CGACTCTATTCGATCAGAGGC	
tetA (tetracycline resistance)	F: GGTTCACTCGAACGACGTCA	577	94°C for 1 min	57°C for 90 s	72°C for 1 min	
R: CTGTCCGACAAGTTGCATGA	
tetB (tetracycline resistance)	F: CCTCAGCTTCTCAACGCGTG	634	94°C for 1 min	56°C for 90 s	72°C for 1 min	
R: GCACCTTGCTGATGACTCTT	
tetC (tetracycline resistance)	F: AAC AAT GCG CTC ATC GT	1138	95°C for 30 s	58°C for 60 s	72°C for 1 min	Kim et al. (2013)	
R: GGA GGC AGA CAA GGT AT	
* 25 cycles.

John Wiley & Sons, Ltd.

2.6 Detection of virulence‐associated genes (VAGs)

All confirmed E. coli isolates were further investigated for targeted VAGs by multiplex PCR (Ewers et al., 2007). The primer sequences used for the PCR confirmation are summarized in Table 2. The reaction volume mixture was 25 µL containing 12.5 µL Taq 2X master mix (New England Biolabs Inc.), 1 µL forward and reverse primer (20 pmol/µL), 2 µL template DNA (average 3.35 ng/µL DNA) and 8.5 µL nuclease‐free water. PCR was run on a thermocycler (Applied Biosystem, 2720 thermal cycler) following the cycling conditions: the initial denaturation at 94°C for 3 min and final extension at 72°C for 10 min with the 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s and extension at 68°C for 3 min.

TABLE 2 Oligonucleotide primer sequences for detection of target virulence genes of Escherichia coli isolates.

Gene	Descriptions	Primer sequence (5′–3′)	Size (bp)	References	
astA	EAST1 (heat‐stable cytotoxin associated with enteroaggregative E. coli)	F: TGCCATCAACACAGTATATCC	116	Ewers et al. (2007)	
R: TCAGGTCGCGAGTGACGGC	
iss	Increased serum survival	F: ATCACATAGGATTCTGCCG	309	
R: CAGCGGAGTATAGATGCCA	
irp2	Iron‐repressible protein (yersiniabactin synthesis)	F: AAGGATTCGCTGTTACCGGAC	413	
R: AACTCCTGATACAGGTGGC	
papC	Pilus associated with pyelonephritis	F: TGATATCACGCAGTCAGTAGC	501	
R: CCGGCCATATTCACATAA	
iucD	Aerobactin synthesis	F:ACAAAAAGTTCTATCGCTTCC	714	
R: CCTGATCCAGATGATGCTC	
tsh	Temperature‐sensitive haemagglutinin	F:ACTATTCTCTGCAGGAAGTC	824	
R: CTTCCGATGTTCTGAACGT	
vat	Vacuolating autotransporter toxin	F:TCCTGGGACATAATGGTCAG	981	
R:GTGTCAGAACGGAATTGT	
cva/cvi	Structural genes of colicin V operon (microcin ColV)	F:TGGTAGAATGTGCCAGAGCAAG	1181	
		R: GAGCTGTTTGTAGCGAAGCC		
John Wiley & Sons, Ltd.

2.7 Sequencing of virulence‐associated genes (VAGs)

Five VAGs (astA, iss, irp2, iucD and cvi/cvaC) from five E. coli isolates were randomly selected for partial sequencing. The PCR products were purified using a DNA purification kit (Favorgen Biotech Corp.) and sequenced both forward and reverse strands by sanger method using a commercial service (Macrogen Inc.). The raw forward and reverse sequence read data were manually cleaned up with a chromatogram and assembled by CAP3 sequence alignment programme (Huang & Madan, 1999) to make consensus sequence. The consensus sequences were then deposited in the NCBI GenBank database for accession numbers (Accession numbers: MT928164‐MT928166, MT982360‐MT982361).

2.8 Statistical analysis

Data retrieved from the samples were inserted in the Microsoft Office Excel 2016 Excel sheet. The frequency (n), prevalence (%) and 95% confidence intervals (CIs) were calculated using the modified Wald method in the GraphPad software QuickCalcs (https://www.graphpad.com/quickcalcs/). The map and the farm's location were created using QGIS 3.12.0. The correlation coefficient between phenotypic and genotypic resistance was calculated using R software (version 4.4.1; https://www.r‐project.org/).

3 RESULTS

AMR and VAGs in E. coli are major public health concerns worldwide, particularly in countries like Bangladesh, where poultry farming is popular. This study sought to assess the AMR patterns and VAG profiles of E. coli isolated from broiler cloacal samples in Bangladesh. This study hypothesized that E. coli isolated from broiler would be MDR and have several VAGs, increasing their harmful potential. Thus, we collected cloacal swabs from broilers on farms in various regions of Bangladesh, isolated E. coli and assessed antibiotic susceptibility and VAGs using PCR.

3.1 Phenotypic characteristics and prevalence of recovered E. coli isolates

All E. coli isolates recovered in this study were Gram‐negative, motile and rod shaped bacilli. The colonies were large, pink, lactose fermentative on MacConkey agar, showed metallic sheen on EMB agar and were hemolytic on blood agar. Additionally, all the isolates tested positive for catalase, lactose fermentation, indole and methyl red tests. Conversely, they tested negative for oxidase, H2S production and Voges–Proskauer test. A total of 216 pooled broiler cloacal samples were investigated. Among them, 177 of 216 samples (81.94%; 95% CI 76.24–86.53) were confirmed by PCR to be colonized with E. coli (Figure 2).

FIGURE 2 Result of polymerase chain reaction (PCR) assay for the 16s rRNA gene of Escherichia coli isolates tested; Lane L: 1 kb plus DNA ladder; Lane P: positive control; Lane N: negative control; Lane 1–5: 16S rRNA gene‐size (585 bp) amplicon.

3.2 AMR profiles

The AMR profiles of E. coli isolates are illustrated in Figure 3. The isolates showed the significant resistance to ampicillin (93.79%), followed by tetracycline (91.53%) and erythromycin (89.27%). On the other hand, they showed the highest susceptibility to ceftriaxone (80.79%), followed by gentamicin (37.29%) and neomycin (31.07%). Besides, the isolates showed remarkable resistance to sulfamethoxazole/trimethoprim (84.18%) and ciprofloxacin (87%), respectively.

FIGURE 3 Antimicrobial resistance profiles of Escherichia coli isolates. AMP, ampicillin; CIP, ciprofloxacin; CN, gentamicin; CRO, ceftriaxone; E, erythromycin; N, neomycin; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline.

3.3 Phenotypic MDR profiles and distribution of ARGs

All the isolates in this study were MDR (resistance against ≥3 antimicrobial classes), as illustrated in Figure 4. This study showed that 16.38% (29/177) of isolates were MDR to five antimicrobial classes carried bla TEM , sul 1, ere (A), tet A, tet B and tet C genes. Meanwhile, 15.82% (28/177) recovered isolates were MDR to 6 classes and possessed bla TEM , sul1, ere (A), tet A, tet B, tet C and aac (3)‐IV genes. Besides, 3.95% (7/177) and 3.39% (6/177) of isolates were MDR to 7 classes and carried bla TEM , bla SHV, bla CMY, sul1, ere (A), tet A, tet B and aac(3)‐IV genes, as illustrated in Table 3.

FIGURE 4 Multidrug resistant (MDR) patterns of Escherichia coli isolated from broiler chicken farms.

TABLE 3 The occurrence of multidrug resistant (MDR) among the recovered Escherichia coli isolates.

No. of strains	%	Resistance type	Phenotypic multidrug resistance	Antibiotic resistance genes	MAR index	
29	16.38	MDR	Five classes

AMP, SXT, E, CIP and TE

	bla TEM , sul1, ere(A), tetA, tetB and tetC	0.63	
28	15.82	MDR	Six classes

AMP, SXT, E, CIP, TE, CN and N

	bla TEM , sul1, ere(A), tetA, tetB, tetC and aac(3)‐IV	0.88	
18	10.17	MDR	Six classes

AMP, SXT, CIP, TE, E and N

	bla TEM , sul1, ere(A), tetA, tetB and tetC	0.75	
11	6.21	MDR	Six classes

AMP, SXT, E, CIP, TE and CN

	bla TEM , sul1, ere(A), tetA, tetB, tetC and aac(3)‐IV	0.75	
7	3.95	MDR	Seven classes

CRO, AMP, SXT, E, CIP, TE and CN

	bla TEM , bla SHV, bla CMY, sul1, ere(A), tetA, tetB and aac(3)‐IV	0.88	
6	3.39	MDR	Seven classes

CRO, AMP, SXT, E, CIP, TE, CN and N

	bla TEM , bla SHV, bla CMY, sul1, ere(A), tetA, tetB and aac(3)‐IV	1	
5	2.82	MDR	Five classes

AMP, SXT, CIP, TE, CN and N

	bla TEM , sul1, tetA, tetB, tetC and aac(3)‐IV	0.75	
4	2.26	MDR	Four classes

AMP, E, SXT and CIP

	blaTEM, sul1, ere(A)	0.75	
4	2.26	MDR	Five classes

AMP, SXT, E, TE, CN and N

	bla TEM , sul1, ere(A), tetA and aac(3)‐IV	0.75	
4	2.26	MDR	Four classes

SXT, E, TE and CIP

	sul1, ere(A), tetA, tetB and tetC	0.5	
3	1.69	MDR	Six classes

CRO, AMP, SXT, CIP, TE and E

	blaTEM, blaSHV , blaCMY , sul1, ere(A), tetA and tetB	0.75	
3	1.69	MDR	Five classes

AMP, E, TE, CIP, CN and N

	bla TEM , ere(A), tetA, tetB and aac(3)‐IV	0.75	
3	1.69	MDR	Five classes

AMP, SXT, E, TE and N

	blaTEM, sul1, ere(A), tetA, tetB and aac(3)‐IV	0.63	
3	1.69	MDR	Five classes

AMP, SXT, CIP, TE and N

	blaTEM, sul1, tetA, tetB and tetC	0.63	
3	1.69	MDR	Four classes

SXT, E, TE, CN and N

	sul1, ere(A), tetA and aac(3)‐IV	0.63	
3	1.69	MDR	Four classes

AMP, SXT, CIP and N

	blaTEM and sul1	0.5	
3	1.69	MDR	Four classes

E, TE, CIP and N

	ere(A), tetA and aac(3)‐IV	0.5	
3	1.69	MDR	Seven classes

CRO, AMP, SXT, E, CIP, TE and N

	bla TEM , bla CMY, sul1, ere(A), tetA, tetB and tetC	0.88	
2	1.13	MDR	Six classes

CRO, AMP, SXT, E, TE, CN and N

	bla TEM , bla CMY, sul1, ere(A), tetA and aac(3)‐IV	0.88	
2	1.13	MDR	Six classes

CRO, AMP, E, CIP, TE and CN

	bla TEM , bla CMY, ere(A), tetA and aac(3)‐IV	0.75	
2	1.13	MDR	Six classes

CRO, AMP, SXT, E, CIP, CN and N

	bla CMY, sul1, ere(A) and aac(3)‐IV	0.88	
2	1.13	MDR	Five classes

CRO, AMP, E, CIP and TE

	bla TEM , ere(A), tetA and aac(3)‐IV	0.63	
2	1.13	MDR	Five classes

SXT, E, CIP, TE, CN and N

	sul1, ere(A), tetA, tetB and aac(3)‐IV	0.75	
2	1.13	MDR	Five classes

AMP, SXT, E, TE and CN

	bla TEM , sul1, ere(A), tetA and aac(3)‐IV	0.63	
2	1.13	MDR	Five classes

AMP, E, CIP, TE and N

	bla TEM , ere(A), tetA and tetB	0.63	
2	1.13	MDR	Five classes

AMP, E, SXT, CIP and N

	bla TEM , sul1 and ere(A)	0.63	
2	1.13	MDR	Five classes

CRO, AMP, E, TE and CN

	bla TEM , ere(A) and tetA	0.63	
2	1.13	MDR	Five classes

CRO, AMP, E, TE and N

	bla TEM , bla SHV, bla CMY, ere(A) and tetA	0.63	
2	1.13	MDR	Four classes

AMP, E, TE and CIP

	bla TEM, ere(A), tetA, tetB and tetC	0.5	
2	1.13	MDR	Four classes

AMP, SXT, TE and CIP

	bla TEM and tetA	0.5	
2	1.13	MDR	Four classes

AMP, E, TE and CN

	bla TEM , ere(A), tetA, tetB and aac(3)‐IV	0.5	
2	1.13	MDR	Four classes

AMP, SXT, CIP, CN and N

	bla TEM and sul1	0.63	
2	1.13	MDR	Three classes

AMP, E and TE

	bla TEM , ere(A) and tetA	0.38	
1	0.56	MDR	Three classes

AMP, CIP and E

	bla TEM and ere(A)	0.38	
1	0.56	MDR	Three classes

E, TE, CN and N

	ere(A), tetA, tetB and aac(3)‐IV	0.5	
1	0.56	MDR	Three classes

AMP, TE and CN

	bla TEM , tetA and aac(3)‐IV	0.38	
1	0.56	MDR	Six classes

CRO, AMP, SXT, CIP, TE and CN

	bla TEM , blaSHV , sul1, ere(A), tetA, tetB and aac(3)‐IV	0.75	
1	0.56	MDR	Five classes

AMP, SXT, E, CIP, CN and N

	bla TEM , sul1 and aac(3)‐IV	0.63	
1	0.56	MDR	Five classes

AMP, E, TE, CIP and CN

	bla TEM and ere(A)	0.63	
1	0.56	MDR	Three classes

AMP, CIP and TE

	bla TEM	0.38	
John Wiley & Sons, Ltd.

Moreover, the MAR index value in this study was >0.3, which indicated that recovered E. coli strains originated from high risk contamination. Furthermore, the correlation coefficient among phenotypic AMR and ARGs were estimated and revealed positive correlation between sul1 gene and SXT (r = 0.7), aac(3)‐IV gene and CN (r = 0.8), ere (A) gene and E (r = 0.8), tet A gene and TE (r = 0.6), bla TEM gene and AMP (r = 0.7), bla SHV gene and CRO (r = 0.5) and bla CMY gene and CRO (r = 0.6), as illustrated in Figure 5.

FIGURE 5 The heatmap represents the correlation between antimicrobial agents and antimicrobial resistance genes (ARGs).

In addition, 81.92% (95% CI 75.55–86.93) of the E. coli isolates carried the tetA gene, followed by 27.68% (95% CI 21.60–34.71) tetB and 8.47% (95% CI 5.11–13.60) tetC gene. All the isolates (n = 177) were tested for the presence of three penicillin resistance genes such as bla SHV, bla CMY and bla TEM. Among them, 88.14% (95% CI 82.48–92.17) of isolates harboured bla TEM gene, followed by bla CMY (7.91, 95% CI 4.67–12.93) and the bla SHV (5.65%, 95% CI 2.98–10.21) gene. Besides, the prevalence of aac(3)‐IV, sul1 and ere (A) genes was 42.37% (95% CI 35.33–49.74), 72.32% (95% CI 65.29–78.40) and 83.62% (95% CI 77.41–88.39). The ARG profile is presented in Table 4 and Figure 6.

TABLE 4 Distribution of antimicrobial resistance genes (ARGs) (n = 177) in Escherichia coli isolates.

Antimicrobials	Resistance genes	No. of resistant isolates (n)	Percentage (95% CI)	
Gentamicin resistance	aac(3)‐IV	75	42.37 (35.33–49.74)	
Sulphonamide resistance	sul1	128	72.32 (65.29–78.40)	
Penicillin resistance	bla SHV	10	5.56 (2.98–10.21)	
bla CMY	14	7.91 (4.67–12.93)	
bla TEM	156	88.14 (82.48–92.17)	
Erythromycin resistance	ere (A)	148	83.62 (77.41–88.39)	
Tetracycline resistance	tet A	145	81.92 (75.55–86.93)	
tet B	49	27.68 (21.60–34.71)	
tet C	15	8.47 (5.11–13.60)	
John Wiley & Sons, Ltd.

FIGURE 6 Result of polymerase chain reaction (PCR) assay for the antimicrobial resistance genes of Escherichia coli isolates tested; Lane L: 1 kb plus DNA ladder; Lane N: negative control; Lane 1–9: samples.

3.4 Distribution of VAGs

All the E. coli isolates (n = 177) were tested for the presence of VAGs of APEC. A total of eight virulence genes were tested in this study. Among them, astA genes (also known as EAST1 or heat‐stable cytotoxin associated with enteroaggregative E. coli [EAEC]) were carried by 56.5% (95% CI 49.13–63.59) of E. coli isolates. E. coli genes responsible for aerobactin synthesis, iucD, and increasing survival of E. coli in the serum, iss, were found in 31.07% (95% CI 24.71–38.24) and 21.47% (95% CI 16.03–28.12) of E. coli isolates, respectively. Besides, iron‐responsible protein (irp2) and colicin V (cva/cvi) were found in 15.82% (95% CI 11.13–21.96) and 3.39% (95% CI 1.40–7.36) isolates in this study. papC, tsh and vat were not detected among E. coli isolates. The VAG profile is presented in Table 5 and Figure 7.

TABLE 5 Frequency of virulence‐associated genes (VAGs) of Escherichia coli isolated from broiler (n = 177).

VAGs	Positive (%)	95% CI	
astA	100 (56.50)	49.13–63.59	
iss	38 (21.47)	16.03–28.12	
irp2	28 (15.82)	11.13–21.96	
papC	0	0	
iucD	55 (31.07)	24.71–38.24	
tsh	0	0	
Vat	0	0	
cva/cvi	6 (3.39)	1.40–7.36	
John Wiley & Sons, Ltd.

FIGURE 7 Result of the polymerase chain reaction (PCR) assay for the virulence‐associated genes of Escherichia coli isolates tested; Lane L: 1 kb plus DNA ladder; Lane N: negative control; Lane 1–5: samples.

4 DISCUSSION

The comprehensive examination of E. coli in broiler cloacal samples conducted in this study sheds light on the complex interplay among poultry health, AMR and virulence factors. The phenotypic characteristics of recovered E. coli isolates were similar to a previously reported study by Algammal et al. (2022). In addition, the prevalence of E. coli in this study was 81.94%, which is higher than previous studies reported from Bangladesh (Dutta et al., 2020; Hossain et al., 2008; Sarker et al., 2019). The variations in E. coli prevalence may be influenced by numerous factors, including geographical location, farm biosecurity practices, isolation methods, farm hygiene and management practices (Ievy et al., 2020).

In this study, all E. coli isolates exhibited varying degrees of resistance to important antimicrobials, including ceftriaxone, ampicillin, erythromycin, gentamicin, ciprofloxacin, neomycin, tetracycline and sulfamethoxazole/trimethoprim. E. coli isolates exhibited the highest (94%) resistance to ampicillin and the lowest (19%) resistance to ceftriaxone. More than 80% of the isolates showed resistance to tetracycline, erythromycin, ciprofloxacin and sulfamethoxazole/trimethoprim. These resistance patterns align with the previous studies (Al Azad et al., 2019; Das et al., 2021; Subedi et al., 2018; Sarker et al., 2019). However, Al Azad et al. (2019) reported 100% resistance to ampicillin, tetracycline, erythromycin, ciprofloxacin and sulfamethoxazole/trimethoprim. The high resistance level of these antimicrobials in broilers reflects the indiscriminate use of antimicrobials in broiler production by farmers in Bangladesh (Hassan et al., 2021). In contrast, ceftriaxone showed lower resistance (19%), which is expected for this type of cephalosporin as it is not used in broiler farms of Bangladesh (Hasan et al., 2011; Imam et al., 2020).

Furthermore, nine ARGs were screened and their prevalence was similar to a previous study from Bangladesh (Al Azad et al., 2019) but higher than a study reported from Iran (Momtaz et al., 2012). All the E. coli isolates in this study were MDR. However, this study could not classify the isolates as extensively drug resistant (XDR) or pan‐drug resistant (PDR) because only a few antimicrobials were tested. According to Magiorakos et al. (2012), an adequate number of antimicrobials must be tested for Enterobacteriaceae to classify XDR and PDR.

Regarding the MDR patterns, the highest percentage of isolates were resistant to five or six antimicrobial classes and carried all ARGs tested in this study. It represents the misuse of antimicrobials in the poultry sector of Bangladesh. Resistance can spread through conjugation, transformation and transduction processes, making it possible for highly resistant isolates from broiler farms to transfer resistance markers to other bacteria. Apart from these, resistance is associated with other processes, including growth in the stationary phase, biofilms and persistence (Amer et al., 2018). This transfer occurs to humans through the food chain, mainly by consuming inadequately cooked meat or handling meat unsafely during processing (Nath et al., 2023) and is widely circulated to the environment through poultry waste (Elbehiry et al., 2022). Al Sattar et al. (2023) indicated that increasing farmers’ awareness of antimicrobials has been improved AMR conditions in the farming environment.

In this study, PCR analysis revealed that most of the isolates carried varying amounts of VAGs. The most prevalent VAG identified was astA (56.5%), commonly found in EAEC pathotypes (Sidhu et al., 2013). The genes iucD and irp2, related to iron acquisition, were present at frequency of 31.07% and 15.82%, respectively. This aligns with findings from Subedi et al. (2018), reported higher frequency of iucD (97.3%) compared to irp2 gene (73.3%) in Nepal. Additionally, the serum survival gene (iss) and colicin V plasmid operon gene (cva/cvi) were detected at frequencies of 21.47% and 3.39%, respectively. In contrast, papC, tsh and vat were not detected among the E. coli isolates.

The overall frequency of VAGs in this study was lower compared to reports from Nepal (Subedi et al., 2018), Jordan (Ibrahim et al., 2019) and Korea (Kwon et al., 2008). Although no isolates in this study were APEC, but most of the isolates carried two to three VAGs. These genes, often chromosomal or plasmid‐mediated and integrated into PAI, cause colibacillosis (De Carli et al., 2015). They contribute to tissue damage, colonization and inflammatory reactions within the host, allowing pathogens to evade host defences, thus escalating the pathogenesis of MDR E. coli, thereby limiting treatment options (El‐Baz et al., 2022; Shafiq et al., 2022).

The acquisition of VAGs usually occurs through horizontal gene transfer (Hacker & Kaper, 2000; Ochman et al., 2000), which may explain the absence or the low prevalence of certain VAGs in this study. The presence of virulence markers in E. coli is genetically similar with different pathogenic clones, indicating their potential for transferring virulence genes to pathogenic E. coli clones in humans and animals (Ahmed et al., 2020). However, several studies have taken an “integrated poultry production” approach and suggested that broiler breeders and hatcheries may be significant reservoirs of early APEC infections via environmental contamination or vertical transmission (Giovanardi et al., 2005; Petersen et al., 2006).

This study highlights the urgency of addressing resistance and virulence in poultry, emphasizing the significance of policy changes, strong legislation, law enforcement and collaborative efforts. By aligning with global standards and research‐driven strategies, the poultry industry can effectively combat AMR, protect poultry health and mitigate potential public health risks.

Further studies on AMR using all listed and available antimicrobials for E. coli are recommended to understand the current status of AMR. Additionally, investigations using the one health approach are urgently needed in Bangladesh to identify the spread of AMR pathogens, including those affecting clinical patients. A holistic farm‐to‐fork approach would be valuable for future research to identify contamination points in meat and assess consumer exposure to AMR pathogens by identifying potential hazards along the food chain. Moreover, additional studies on biofilm characteristics should be conducted to assess the potential pathogenicity of the isolates.

5 CONCLUSION

This study investigated the occurrence of VAGs in E. coli and identified their AMR patterns. The widespread AMR of E. coli and the identification of ARGs highlighted the importance of monitoring the spread of ARGs in poultry farms and in the environment. The presence of VAGs in MDR E. coli limits the treatment options for pathogenic strains. Routine surveillance, monitoring and stakeholder awareness should be strengthened to prevent the dissemination of MDR E. coli as well as minimize possible risks to public health.

AUTHOR CONTRIBUTIONS

Md. Sirazul Islam: Conceptualization; data curation; methodology; project investigation; ncbi data submission; visualization; writing‐ original draft; writing‐review and editing. Chandan Nath: Data curation; methodology; formal analysis; visualization; writing‐ review; and editing. F. M. Yasir Hasib and Tahia Ahmed Logno: Data curation; methodology. Md. Helal Uddin: Data curation; formal analysis. Mohammad Mahmudul Hassan: Validation; writing‐review and editing. Sharmin Chowdhury: Funding acquisition; project administration; supervision; validation; writing‐review and editing.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ETHICS STATEMENT

Licensed veterinarians carried out all investigations and sample collection procedures from the implementing institute. Before data collection and sampling, farmers were informed about the research and asked to participate willingly. The Chattogram Veterinary and Animal Sciences University's (CVASU) Ethical Committee (EC) reviewed the proposal and gave ethical approval on 18 March 2019, for conducting this research [Memo# CVASU/Dir(R&E) EC/2019/39(2/6/6)]

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.70032

ACKNOWLEDGEMENTS

The authors would like to express their heartfelt appreciation to Abdullah Al‐Maruf, Md. Sahidur Rahman and Md Jashim Uddin for enabling them to collect samples for the study. The author would like to convey his sincere gratitude to the veterinary surgeons and livestock extension officers of various upazilla for their kind support in collecting samples.

DATA AVAILABILITY STATEMENT

The five virulence‐associated gene (astA, iss, irp2, iucD and cvi/cvaC) sequences were submitted to GenBank of the National Center for Biotechnology Information (NCBI) under accession numbers MT928164‐MT928166 and MT982360‐MT982361.
==== Refs
REFERENCES

Ahmed, S. , Das, T. , Islam, M. Z. , Herrero‐Fresno, A. , Biswas, P. K. , & Olsen, J. E. (2020). High prevalence of mcr‐1‐encoded colistin resistance in commensal Escherichia coli from broiler chicken in Bangladesh. Scientific Reports, 10 (1 ), 18637. 10.1038/s41598-020-75608-2 33122817
Al Azad, M. A. R. , Rahman, M. M. , Amin, R. , Begum, M. I. A. , Fries, R. , Husna, A. , Khairalla, A. S. , Badruzzaman, A. T. M. , El Zowalaty, M. E. , Lampang, K. N. , & Ashour, H. M. (2019). Susceptibility and multidrug resistance patterns of Escherichia coli isolated from cloacal swabs of live broiler chickens in Bangladesh. Pathogens, 8 (3 ), 118. 10.3390/pathogens8030118 31370344
Al Sattar, A. , Chisty, N. N. , Irin, N. , Uddin, M. H. , Hasib, F. Y. , & Hoque, M. A. (2023). Knowledge and practice of antimicrobial usage and resistance among poultry farmers: A systematic review, meta‐analysis, and meta‐regression. Veterinary Research Communications, 47 (3 ), 1047–1066. 10.1007/s11259-023-10082-5 36823483
Algammal, A. M. , Wahdan, A. , & Elhaig, M. M. (2019). Potential efficiency of conventional and advanced approaches used to detect Mycobacterium bovis in cattle. Microbial Pathogenesis, 134 , 103574. 10.1016/j.micpath.2019.103574 31170450
Algammal, A. M. , El‐Tarabili, R. M. , Alfifi, K. J. , Al‐Otaibi, A. S. , Hashem, M. E. A. , El‐Maghraby, M. M. , & Mahmoud, A. E. (2022). Virulence determinant and antimicrobial resistance traits of Emerging MDR Shiga toxigenic E. coli in diarrheic dogs. AMB Express, 12 (1 ), 34. 10.1186/s13568-022-01371-4 35298727
Algammal, A. M. , El‐Tarabili, R. M. , Abd El‐Ghany, W. A. , Almanzalawi, E. A. , Alqahtani, T. M. , Ghabban, H. , Al‐Otaibi, A. S. , Alatfeehy, N. M. , Abosleima, N. M. , Hetta, H. F. , & Badawy, G. A. (2023). Resistance profiles, virulence and antimicrobial resistance genes of XDR S. enteritidis and S. typhimurium . AMB Express, 13 (1 ), 110. 10.1186/s13568-023-01615-x 37817026
Algammal, A. M. , Ibrahim, R. A. , Alfifi, K. J. , Ghabban, H. , Alghamdi, S. , Kabrah, A. , Khafagy, A. R. , Abou‐Elela, G. M. , Abu‐Elala, N. M. , Donadu, M. G. , & El‐Tarabili, R. M. (2022). A first report of molecular typing, virulence traits, and phenotypic and genotypic resistance patterns of newly emerging XDR and MDR Aeromonas veronii in Mugil seheli . Pathogens, 11 , 1262. 10.3390/pathogens11111262 36365013
Amer, M. M. , Mekky, H. M. , Amer, A. M. , & Fedawy, H. S. (2018). Antimicrobial resistance genes in pathogenic Escherichia coli isolated from diseased broiler chickens in Egypt and their relationship with the phenotypic resistance characteristics. Veterinary World, 8 , 1082–1088. 10.14202/vetworld.2018.1082-1088
Bauer, A. W. , Kirby, W. M. , Sherris, J. C. , & Turck, M. (1966). Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology, 45 (4 ), 493–496.5325707
Clinical and Laboratory Standards Institute . (2020). Performance standards for antimicrobial susceptibility testing, CLSI. https://clsi.org/media/3481/m100ed30_sample.pdf
Das, T. , Islam, M. Z. , Rana, E. A. , Dutta, A. , Ahmed, S. , Barua, H. , & Biswas, P. K. (2021). Abundance of mobilized colistin resistance gene (mcr‐1) in commensal Escherichia coli from diverse sources. Microbial Drug Resistance, 27 (11 ), 1585–1593. 10.1089/mdr.2020.0433 33909471
Darby, E. M. , Trampari, E. , Siasat, P. , Gaya, M. S. , Alav, I. , Webber, M. A. , & Blair, J. M. (2023). Molecular mechanisms of antibiotic resistance revisited. Nature Reviews Microbiology, 21 (5 ), 280–295. 10.1038/s41579-022-00820-y 36411397
De Carli, S. , Ikuta, N. , Lehmann, F. K. M. , da Silveira, V. P. , de Melo Predebon, G. , Fonseca, A. S. K. , & Lunge, V. R. (2015). Virulence gene content in Escherichia coli isolates from poultry flocks with clinical signs of colibacillosis in Brazil. Poultry Science, 94 (11 ), 2635–2640. 10.3382/ps/pev256
Department of Livestock Services (DLS) . (2020). Annual report on livestock economy 2019–2020. Division of Livestock Statistics, Ministry of Fisheries and Livestock.
Dutta, A. , Islam, M. Z. , Barua, H. , Rana, E. A. , Jalal, M. S. , Dhar, P. K. , Das, A. , Das, T. , Sarma, S. M. , Biswas, S. K. , & Biswas, P. K. (2020). Acquisition of plasmid‐mediated colistin resistance gene mcr‐1 in Escherichia coli of livestock origin in Bangladesh. Microbial Drug Resistance, 26 , 1058–1062. 10.1089/mdr.2019.0304 32349645
El‐Baz, R. , Said, H. S. , Abdelmegeed, E. S. , & Barwa, R. (2022). Characterization of virulence determinants and phylogenetic background of multiple and extensively drug resistant Escherichia coli isolated from different clinical sources in Egypt. Applied Microbiology and Biotechnology, 106 (3 ), 1279–1298. 10.1007/s00253-021-11740-x 35050388
Elbehiry, A. , Marzouk, E. , Aldubaib, M. , Moussa, I. , Abalkhail, A. , Ibrahem, M. , Hamada, M. , Sindi, W. , Alzaben, F. , Almuzaini, A. M. , & Algammal, A. M. (2022). Pseudomonas species prevalence, protein analysis, and antibiotic resistance: An evolving public health challenge. AMB Express, 12 (1 ), 53. 10.1186/s13568-022-01390-1 35532863
Ewers, C. , Li, G. , Wilking, H. , Kießling, S. , Alt, K. , Antáo, E. M. , Laturnus, C. , Diehl, I. , Glodde, S. , Homeier, T. , Böhnke, U. , Steinrück, H. , Philipp, H. C. , & Wieler, L. H. (2007). Avian pathogenic, uropathogenic, and newborn meningitis‐causing Escherichia coli: How closely related are they? International Journal of Medical Microbiology, 297 , 163–176. 10.1016/j.ijmm.2007.01.003 17374506
Giovanardi, D. , Campagnari, E. , Ruffoni, L. S. , Pesente, P. , Ortali, G. , & Furlattini, V. (2005). Avian pathogenic Escherichia coli transmission from broiler breeders to their progeny in an integrated poultry production chain. Avian Pathology, 34 (4 ), 313–318. 10.1080/03079450500179046 16147567
Hacker, J. , & Kaper, J. B. (2000). Pathogenicity islands and the evolution of microbes. Annual Reviews in Microbiology, 54 (1 ), 641–679. 10.1146/annurev.micro.54.1.641
Hammerum, A. M. , & Heuer, O. E. (2009). Human health hazards from antimicrobial‐resistant Escherichia coli of animal origin. Clinical Infectious Diseases, 48 (7 ), 916–921. 10.1086/597292 19231979
Hasan, B. , Faruque, R. , Drobni, M. , Waldenström, J. , Sadique, A. , Ahmed, K. U. , Islam, Z. , Parvez, M. H. , Olsen, B. , & Alam, M. (2011). High prevalence of antibiotic resistance in pathogenic Escherichia coli from large‐and small‐scale poultry farms in Bangladesh. Avian Diseases, 55 (4 ), 689–692. 10.1637/9686-021411-reg.1 22312993
Hasib, F. Y. , Magouras, I. , St‐Hilaire, S. , Paudel, S. , Kamali, M. , Lugsomya, K. , Lam, H. K. , Elsohaby, I. , Butaye, P. , & Nekouei, O. (2024). Prevalence and characterization of antimicrobial‐resistant Escherichia coli in chicken meat from wet markets in Hong Kong. Frontiers in Veterinary Science, 11 , 1340548. 10.3389/fvets.2024.1340548 38288141
Hasman, H. , Mevius, D. , Veldman, K. , Olesen, I. , & Aarestrup, F. M. (2005). β‐Lactamases among extended‐spectrum β‐lactamase (ESBL)‐resistant Salmonella from poultry, poultry products and human patients in The Netherlands. Journal of Antimicrobial Chemotherapy, 56 (1 ), 115–121. 10.1093/jac/dki190 15941775
Hassan, M. M. , Kalam, M. A. , Alim, M. A. , Shano, S. , Nayem, M. R. K. , Badsha, M. R. , Al Mamun, M.A. , Hoque, A. , Tanzin, A. Z. , Nath, C. , Khanom, H. , Khan, S. A. , Islam, M. M. , Uddin, M. B. , & Islam, A. (2021). Knowledge, attitude, and practices on antimicrobial use and antimicrobial resistance among commercial poultry farmers in Bangladesh. Antibiotics, 10 (7 ), 784. 10.3390/antibiotics10070784 34203195
Hossain, M. T. , Siddique, M. P. , Hossain, F. M. A. , Zinnah, M. A. , Hossain, M. M. , Alam, M. K. , Rahman, M. T. , & Choudhury, K. A. (2008). Isolation, identification, toxin profile and antibiogram of Escherichia coli isolated from broilers and layers in Mymensingh district of Bangladesh. Bangladesh Journal of Veterinary Medicine, 6 (1 ), 1–5. 10.3329/bjvm.v6I1.1330
Huang, X. , & Madan, A. (1999). CAP3: A DNA sequence assembly program. Genome Resource, 9 (9 ):868–877. 10.1101/gr.9.9.868
Ibrahim, R. A. , Cryer, T. L. , Lafi, S. Q. , Basha, E. A. , Good, L. , & Tarazi, Y. H. (2019). Identification of Escherichia coli from broiler chickens in Jordan, their antimicrobial resistance, gene characterization and the associated risk factors. BMC Veterinary Research, 15 , 1–16. 10.1186/s12917-019-1901-1 30606179
Imam, T. , Gibson, J. S. , Foysal, M. , Das, S. B. , Gupta, S. D. , Fournié, G. , Hoque, M. A. , & Henning, J. (2020). A cross‐sectional study of antimicrobial usage on commercial broiler and layer chicken farms in Bangladesh. Frontiers in Veterinary Science, 7 , 576113. 10.3389/fvets.2020.576113 33392279
Kim, M. , Kwon, T. H. , Jung, S. M. , Cho, S. H. , Jin, S. Y. , Park, N. H. , Kim, C. G. , & Kim, J. S. (2013). Antibiotic resistance of bacteria isolated from the internal organs of edible snow crabs. PLoS ONE, 8 (8 ), e70887. 10.1371/journal.pone.0070887 23990916
Kika, T. S. , Cocoli, S. , Pelić, D. L. , Puvača, N. , Lika, E. , & Pelić, M. (2023). Colibacillosis in modern poultry production. Journal of Agronomy, Technology and Engineering Management, 6 (6 ), 975–987. 10.55817/YZFA3391
Kunert Filho, H. C. , Brito, K. C. T. , Cavalli, L. S. , & Brito, B. G. (2015). Avian pathogenic Escherichia coli (APEC)‐an update on the control. The Battle Against Microbial Pathogens: Basic Science, Technological Advances and Educational Programs, A Méndez‐Vilas Ed, 1 , 598–618.
Kwon, S. G. , Cha, S. Y. , Choi, E. J. , Kim, B. , Song, H. J. , & Jang, H. K. (2008). Epidemiological prevalence of avian pathogenic Escherichia coli differentiated by multiplex PCR from commercial chickens and hatchery in Korea. Journal of Bacteriology and Virology, 38 (4 ), 179–188. 10.4167/JBV.2008.38.4.179
Levy, S. , Islam, Md. S. , Sobur, Md. A. , Talukder, M. , Rahman, Md. B. , Khan, M. F. R. , & Rahman, Md. T. (2020). Molecular detection of Avian Pathogenic Escherichia coli (APEC) for the first time in layer farms in Bangladesh and their antibiotic resistance patterns. Microorganisms, 8 (7 ), 1021. 10.3390/microorganisms8071021 32660167
Magiorakos, A. P. , Srinivasan, A. , Carey, R. B. , Carmeli, Y. , Falagas, M. E. , Giske, C. G. , Harbarth, S. , Hindler, J. F. , Kahlmeter, G. , Olsson‐Liljequist, B. , & Paterson, D. L. (2012). Multidrug‐resistant, extensively drug‐resistant and pandrug‐resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection, 18 (3 ), 268–281. 10.1111/j.1469-0691.2011.03570.x 21793988
Malorny, B. , Hoorfar, J. , Hugas, M. , Heuvelink, A. , Fach, P. , Ellerbroek, L. , Bunge, C. , Dorn, C. , & Helmuth, R. (2003). Interlaboratory diagnostic accuracy of a Salmonella specific PCR based method. International Journal of Food Microbiology, 89 (2–3 ), 241–249. 10.1016/S0168-1605(03)00154-5 14623390
Momtaz, H. , Rahimi, E. , & Moshkelani, S. (2012). Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran. Veterinary Medicine, 57 , 193–197. 10.17221/5916-vetmed
Nath, C. , Das, T. , Islam, M. S. , Hasib, F. Y. , Singha, S. , Dutta, A. , Barua, H. , & Islam, M. Z. (2023). Colistin resistance in multidrug‐resistant Escherichia coli isolated from retail broiler meat in Bangladesh. Microbial Drug Resistance, 29 (11 ), 523–532. 10.1089/mdr.2023.0026 37699212
Ochman, H. , Lawrence, J. G. , & Groisman, E. A. (2000). Lateral gene transfer and the nature of bacterial innovation. Nature, 405 (6784 ), 299–304. 10.1038/35012500 10830951
Parvin, M. S. , Talukder, S. , Ali, M. Y. , Chowdhury, E. H. , Rahman, M. T. , & Islam, M. T. (2020). Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens, 9 (6 ), 420. 10.3390/pathogens9060420 32481680
Petersen, A. , Christensen, J. P. , Kuhnert, P. , Bisgaard, M. , & Olsen, J. E. (2006). Vertical transmission of a fluoroquinolone‐resistant Escherichia coli within an integrated broiler operation. Veterinary Microbiology, 116 (1–3 ), 120–128. 10.1016/j.vetmic.2006.03.015 16650662
Sarker, M. S. , Mannan, M. S. , Ali, M. Y. , Bayzid, M. , Ahad, A. , & Bupasha, Z. B. (2019). Antibiotic resistance of Escherichia coli isolated from broilers sold at live bird markets in Chattogram, Bangladesh. Journal of Advance Veterinary and Animal Research, 6 , 272. 10.5455/javar.2019.f344
Schippa, S. , Iebba, V. , Barbato, M. , DiNardo, G. , Totino, V. , Checchi, M. P. , Longhi, C. , Maiella, G. , Cucchiara, S. , & Conte, M. P. (2010). A distinctive’ microbial signature’ in celiac pediatric patients. BMC Microbiology, 10 , 175. 10.1186/1471-2180-10-175 20565734
Shafiq, M. , Zeng, M. , Permana, B. , Bilal, H. , Huang, J. , Yao, F. , Algammal, A. M. , Li, X. , Yuan, Y. , & Jiao, X. (2022). Coexistence of bla NDM–5 and tet(X4) in international high‐risk Escherichia coli clone ST648 of human origin in China. Frontiers in Microbiology, 13 , 1031688. 10.3389/fmicb.2022.1031688 36439817
Sidhu, J. P. , Ahmed, W. , Hodgers, L. , & Toze, S. (2013). Occurrence of virulence genes associated with diarrheagenic pathotypes in Escherichia coli isolates from surface water. Applied and Environmental Microbiology, 79 (1 ), 328–335. 10.1128/aem.02888-12 23124225
Subedi, M. , Luitel, H. , Devkota, B. , Bhattarai, R. K. , Phuyal, S. , Panthi, P. , Shrestha, A. , & Chaudhary, D. K. (2018). Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Veterinary Research, 14 , 1–6. 10.1186/S12917-018-1442-Z 29291752
World Health Organization (WHO) . (2023). Antimicrobial resistance. World Health Organization. https://www.who.int/news‐room/fact‐sheets/detail/antimicrobial‐resistance
