
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

39291956
88412
10.7554/eLife.88412
version of record
Research Article
Neuroscience
Ca2+ channel and active zone protein abundance intersects with input-specific synapse organization to shape functional synaptic diversity
Medeiros Audrey T https://orcid.org/0000-0002-5562-4772
1
Gratz Scott J https://orcid.org/0000-0002-0106-8336
scott_gratz@brown.edu
2
Delgado Ambar 2
Ritt Jason T https://orcid.org/0000-0003-3113-7977
23
O'Connor-Giles Kate M https://orcid.org/0000-0002-2259-8408
kate_oconnor-giles@brown.edu
123
1 https://ror.org/05gq02987 Neuroscience Graduate Training Program, Brown University Providence United States
2 https://ror.org/05gq02987 Department of Neuroscience, Brown University Providence United States
3 https://ror.org/05gq02987 Carney Institute for Brain Science, Brown University Providence United States
Bellen Hugo J Reviewing Editor https://ror.org/02pttbw34 Baylor College of Medicine United States

Desplan Claude Senior Editor https://ror.org/0190ak572 New York University United States

18 9 2024
2024
12 RP8841202 5 2023
This manuscript was published as a preprint.10 4 2023

This manuscript was published as a reviewed preprint.17 7 2023

The reviewed preprint was revised.18 7 2024

© 2023, Medeiros et al
2023
Medeiros et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Synaptic heterogeneity is a hallmark of nervous systems that enables complex and adaptable communication in neural circuits. To understand circuit function, it is thus critical to determine the factors that contribute to the functional diversity of synapses. We investigated the contributions of voltage-gated calcium channel (VGCC) abundance, spatial organization, and subunit composition to synapse diversity among and between synapses formed by two closely related Drosophila glutamatergic motor neurons with distinct neurotransmitter release probabilities (Pr). Surprisingly, VGCC levels are highly predictive of heterogeneous Pr among individual synapses of either low- or high-Pr inputs, but not between inputs. We find that the same number of VGCCs are more densely organized at high-Pr synapses, consistent with tighter VGCC-synaptic vesicle coupling. We generated endogenously tagged lines to investigate VGCC subunits in vivo and found that the α2δ–3 subunit Straightjacket along with the CAST/ELKS active zone (AZ) protein Bruchpilot, both key regulators of VGCCs, are less abundant at high-Pr inputs, yet positively correlate with Pr among synapses formed by either input. Consistently, both Straightjacket and Bruchpilot levels are dynamically increased across AZs of both inputs when neurotransmitter release is potentiated to maintain stable communication following glutamate receptor inhibition. Together, these findings suggest a model in which VGCC and AZ protein abundance intersects with input-specific spatial and molecular organization to shape the functional diversity of synapses.

calcium channel
synaptic diversity
presynaptic homeostasis
VGCC
active zone
Research organism

D. melanogaster
http://dx.doi.org/10.13039/100000065 National Institute of Neurological Disorders and Stroke R01NS078179 O'Connor-Giles Kate M http://dx.doi.org/10.13039/100000065 National Institute of Neurological Disorders and Stroke F31NS122424 Medeiros Audrey T Brown Neuroscience Graduate Program T32 MH020068 Medeiros Audrey T The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.Author impact statementIn vivo analysis of endogenously tagged Ca2+ channel subunits reveals unexpected differences in subunit composition and synapse-specific relationships between channel abundance and synaptic strength.
publishing-routeprc
==== Body
pmcIntroduction

The broad and complex functions of neural circuits depend on diverse neuronal subtypes communicating through synapses with distinct properties. Thus, understanding how synaptic diversity is established is critical for understanding neural circuit function. Neurotransmission occurs at specialized membranes called active zones (AZs) where action potentials drive the opening of voltage-gated Ca2+ channels (VGCCs) to trigger Ca2+-dependent synaptic vesicle (SV) fusion and neurotransmitter release. Neurotransmitter release properties are determined locally at individual synapses and vary considerably between neuronal subtypes and within homogeneous populations of neurons (Ariel et al., 2012; Atwood and Karunanithi, 2002; Branco and Staras, 2009; Hatt and Smith, 1976). In fact, functional imaging studies in Drosophila demonstrate that even single neurons forming synapses with the same postsynaptic partner display heterogeneous synaptic strength among individual AZs (Guerrero et al., 2005; Melom et al., 2013; Peled and Isacoff, 2011).

Presynaptic strength is defined as the likelihood of neurotransmitter release following an action potential (probability of release, Pr). This probabilistic process is determined by the number of functional SV release sites and their individual probability of vesicle release. The probability of SV release is highly dependent on transient increases in intracellular Ca2+ levels at vesicular sensors. Accordingly, SV release sites and VGCCs are key substrates for generating diversity of synaptic function (Akbergenova et al., 2018; Aldahabi et al., 2022; Chen et al., 2015; Fedchyshyn and Wang, 2005; Fekete et al., 2019; Gratz et al., 2019; Holderith et al., 2012; Laghaei et al., 2018; Miki et al., 2017; Nakamura et al., 2015; Newman et al., 2022; Rebola et al., 2019; Reddy-Alla et al., 2017; Sauvola et al., 2021; Sheng et al., 2012). Numerous studies have demonstrated that VGCC abundance is highly correlated with Pr across species (Akbergenova et al., 2018; Gratz et al., 2019; Holderith et al., 2012; Miki et al., 2017; Nakamura et al., 2015; Sheng et al., 2012). Paradoxically, this is not always the case. For example, a recent study investigated two cerebellar synaptic subtypes, one high-Pr formed by inhibitory stellate cells and one low-Pr formed by excitatory granule cells, and found higher VGCC levels at low-Pr granule synapses (Rebola et al., 2019). Since VGCCs in closer proximity to release sites are expected to have a greater impact on vesicular release probability than those positioned farther away, the spatial coupling of VGCCs and SVs at AZs is a critical determinant of Pr (Chen et al., 2015; Eggermann et al., 2011; Fedchyshyn and Wang, 2005; Nakamura et al., 2015; Rebola et al., 2019). Indeed, at high-Pr stellate synapses, a ‘perimeter release’ AZ organization places VGCCs ~40 nm closer to SVs than at low-Pr granular synapses (Rebola et al., 2019). Another recent study investigated two functionally distinct connections formed by CA1 pyramidal cells (Aldahabi et al., 2022). While Ca2+ influx was higher at the high-Pr synapse, raising Ca2+ influx at the low-Pr synapse to match the high-Pr synapse did not equalize Pr.

To further investigate this paradox, we sought a system where we could investigate the relationship between VGCCs and Pr both within and between two closely related neurons that form synapses with distinct release probabilities. Drosophila muscles are innervated by two glutamatergic motor neurons, one tonic and one phasic, that form type Ib and type Is synapses, respectively. Type Ib synapses have relatively low Pr and facilitate, whereas type Is synapses have higher Pr and depress in response to high-frequency stimulation (Aponte-Santiago et al., 2020; Lnenicka and Keshishian, 2000). In this study, we investigated how VGCC abundance, spatial organization, and subunit composition contribute to synaptic heterogeneity at AZs of low-Pr type Ib and high-Pr type Is inputs to the same postsynaptic targets. We find that individual synapses formed by both low- and high-Pr inputs exhibit heterogeneous release properties that can be predicted by VGCC abundance alone. However, VGCC abundance does not correspond to differences in Pr between the two inputs. We identify underlying molecular and organizational differences that may alter the relationship between VGCC abundance and Pr at low- vs. high-Pr inputs. We further find that the homeostatic potentiation of neurotransmitter release triggered by glutamate receptor inhibition involves dynamic increases in VGCCs, the α2δ–3 subunit Straightjacket (Stj), and the AZ cytomatrix protein Bruchpilot (Brp) across AZs of both inputs. These findings provide insight into how VGCC and AZ protein abundance intersects with underlying molecular and organizational differences between inputs to contribute to greater synaptic diversity.

Results

VGCC levels predict Pr within, but not between, inputs

To investigate the relationship between VGCC levels and neurotransmitter release properties at functionally distinct synapses, we took advantage of the two motor neuron subtypes with low and high release probabilities that innervate most Drosophila muscles (Aponte-Santiago and Littleton, 2020; Kurdyak et al., 1994). These glutamatergic neuromuscular junctions (NMJs) contain hundreds of individual synapses that are accessible to single AZ functional imaging using genetically encoded Ca2+ indicators.

In Drosophila, Cacophony (Cac) is the sole Cav2 pore-forming subunit and is the VGCC responsible for triggering synaptic transmission (Kawasaki et al., 2000; Macleod et al., 2006; Peng and Wu, 2007; Smith et al., 1996). To simultaneously monitor neurotransmitter release and VGCC levels, we swapped the N-terminal sfGFP tag in our well-characterized cacsfGFP-N line for a Td-Tomato tag (cacTd-Tomato-N) and confirmed that the tag does not impair synaptic function (Figure 1—figure supplement 1; Figure 1A–F; Ghelani et al., 2023; Gratz et al., 2019). We then expressed postsynaptically targeted GCaMP6f (SynapGCaMP6f; Newman et al., 2017), which reports Ca2+ influx through glutamate receptors in response to neurotransmitter release, in cacTd-Tomato-N animals for a plus/minus readout. We and others have previously shown that Cac levels are highly predictive of Pr at individual type Ib AZs (Akbergenova et al., 2018; Gratz et al., 2019). To determine if VGCC levels are similarly predictive at high-Pr type Is AZs, we measured CacTd-Tomato-N fluorescence intensity and monitored neurotransmitter release in response to 0.2 Hz stimulus at individual synapses. To enable direct comparisons between the two inputs, we simultaneously imaged type Ib and Is synapses at NMJ 6/7 (Figure 1A). We quantified the number of times a vesicle was released over 120 stimuli to determine single-synapse Pr. As has been previously reported, we found that type Is synapses exhibited significant heterogeneity and higher average Pr than type Ib synapses (Figure 1B and C; Lu et al., 2016; Newman et al., 2022). Consistent with their higher Pr, type Is connections contain relatively fewer low-Pr and more high-Pr AZs (Figure 1D). We next investigated the correlation between Pr and VGCC levels and found that at type Is inputs, single-AZ Cac intensity positively correlates with Pr (Figure 1E). We also observe a strong positive correlation between VGCC levels and Pr at type Ib inputs to the same muscles (Figure 1F), consistent with our and others’ prior findings (Akbergenova et al., 2018; Gratz et al., 2019; Newman et al., 2022).

Figure 1. VGCC levels predict Pr within, but not between, inputs.

(A) Representative confocal Z-projection of CacTd-Tomato-N (magenta) with type Ib (blue) and type Is (red) terminals outlined. (B) AZ heat map of terminals in A with color indicating Pr and size representing sum Cac intensity levels in arbitrary units (AU). (C) Average single-AZ probability of release at type Ib and Is terminals. N=6 animals, 6 NMJs. (D) Quintile distribution of single-AZ Pr frequency at type Ib and Is inputs. (E, F) Correlation between normalized CacTd-Tomato-N intensity and Pr at type Is and Ib AZs of the same 6 NMJs. Each dot represents a single AZ and each color corresponds to an individual NMJ with linear regression lines indicated for each. (G) Top, representative confocal Z-projection of CacsfGFP-N. Bottom, CacsfGFP-N in green with HRP marking neuronal membranes in gray. Type Ib (blue) and type Is (red) terminals are outlined. (H) Quantification of CacsfGFP-N AZ intensity at type Ib and Is terminals. Each data point represents the average normalized single AZ sum intensity for an individual NMJ. (I) Distribution of normalized CacsfGFP-N intensity from single type Ib and Is AZs in H (X-axis cutoff at 5.0). (J) Comparison between normalized CacTd-Tomato-N and Pr of type Ib and Is AZs combined from E-F with linear regression lines (blue and red, respectively) and 95% confidence intervals (black lines) indicated. All scale bars = 5 µm, all error bars indicate S.E.M, ****p<0.0001; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Figure 1—figure supplement 1. Electrophysiological validation of endogenously tagged cacophony lines.

(A-C) Representative traces of EJPs (top) and mEJPs (bottom) in control, cacHaloTag-N, and cacTd-Tomato-N. (D-F) Quantification of EJPs, mEJPs, and quantal content (QC). All error bars indicate S.E.M., ns, not significant.

A simple prediction of the observation that VGCC levels correlate highly with Pr at individual AZs of both low- and high-Pr inputs is that Cac levels will be higher at synapses of type Is inputs than type Ib. We analyzed CacsfGFP-N levels at individual type Ib and Is synapses and found that average Cac levels are the same at type Ib and Is AZs (Figure 1G and H). Cac levels are also similarly distributed across AZs of the two inputs (Figure 1I). Together, these findings indicate that the relationship between VGCC levels and Pr differs between the two inputs. Consistently, when we directly compare the best-fit lines for the relationship between Cac levels and Pr at type Ib and Is inputs from our correlative functional imaging data (Figure 1E and F), we find that the slopes are significantly different (Figure 1J). Across type Is AZs, a similar range of VGCC levels supports a higher range of release probabilities. Thus, VGCCs can predict Pr within synaptic subtypes, but not between AZs of different synaptic subtypes, providing a framework for understanding seemingly contradictory findings on the role of VGCCs in determining Pr.

VGCC clusters are more compact at AZs of high-Pr type Is inputs

Many differences between low-Pr type Ib and high-Pr type Is AZs have been described (Aponte-Santiago and Littleton, 2020; Aponte-Santiago et al., 2020; Atwood et al., 1993; He et al., 2023; Jetti et al., 2023; Kurdyak et al., 1994; Lu et al., 2016; Medeiros and O’Connor-Giles, 2023). Perhaps most notably, type Is AZs experience ~twofold greater Ca2+ influx than type Ib (He et al., 2023; Lu et al., 2016). While this alone could explain the estimated 3-fold greater Pr at type Is AZs and is certainly a key factor, several lines of evidence argue for additional contributors. A recent study using a botulinum transgene to isolate type Ib and Is synapses for electrophysiological analysis found that increasing external [Ca2+] from physiological levels (1.8 mM) to 3 mM or even 6 mM does not result in a 3-fold increase in EPSCs or quantal content at type Ib synapses and type Ib synapses continue to facilitate at 3 mM external [Ca2+] (He et al., 2023). Using this approach, they further found that type Ib synapses are more sensitive to the slow Ca2+ chelator EGTA, indicating looser VGCC-SV coupling.

We investigated the spatial distribution of VGCCs at type Ib and Is AZs using 3D dSTORM single-molecule localization microscopy (SMLM). An individual VGCC complex is estimated to be ~10 nm in diameter with the most common immunolabeling techniques adding significantly to their size and creating a linkage error of ~20 nm between the target molecule and fluorescent reporter (Früh et al., 2021; Liu et al., 2022; Thomas, 2000). For following VGCC dynamics using single-particle tracking via photoactivation localization microscopy (sptPALM), we recently incorporated mEOS4b (Paez-Segala et al., 2015) at the same N-terminal site we previously used to endogenously tag Cac, achieving a linkage error of less of than 5 nm (Ghelani et al., 2023; Gratz et al., 2019). To gain more flexibility in labeling Cac without adding to the linkage error, we swapped the mEOS tag for a similarly sized HaloTag (cacHaloTag-N). cacHaloTag-N flies are fully viable, do not display significant defects in synaptic function, and exhibit normal Cac localization at AZs as observed in super-resolution optical reassignment images, where Brp is arranged in rings surrounding puncta of VGCCs (Figure 1—figure supplement 1; Figure 2A–C, Ghelani et al., 2023). HaloTag, which covalently binds synthetic ligands, is 3.3 nm in diameter (Los et al., 2008; Yazaki et al., 2020), yielding a linkage error well under 5 nm. cacHaloTag-N larvae were stained with JaneliaFluor646 HaloTag ligand (Grimm et al., 2015) and horseradish peroxidase (HRP) to distinguish between type Ib and Is branches and enable simultaneous imaging of the two inputs at a single NMJ. We then used density-based spatial clustering of applications with noise (DBSCAN) analysis to identify Cac clusters at type Ib and Is AZs (Figure 2D and E; Ehmann et al., 2014). We find that the average size of CacHaloTag-N clusters is similar at low- and high-Pr AZs (Figure 2F), with mean diameters of approximately 102 nm and 105 nm, respectively. This is similar to the CacmEOS4b-N type Ib cluster size observed by sptPALM imaging (Ghelani et al., 2023). In agreement with our confocal level data, the number of localizations per cluster was similar at low- and high-Pr AZs (Figure 2G). We then calculated the average Cac density per AZ and found that VGCCs are significantly more densely organized at high-Pr type Is AZs than low-Pr type Ib AZs (Figure 2H, I). Greater VGCC AZ density at type Is AZs is consistent with a recent SMLM study using antibodies to label Cac, indicating these results are robust to different labeling approaches (Newman et al., 2022). Together, these findings suggest that more compact organization of VGCCs increases their coupling to SVs and contributes to the steeper relationship between VGCC levels and Pr at high-Pr type Is AZs.

Figure 2. VGCC clusters are more compact at AZs of high-Pr type Is inputs.

(A–C) Representative SoRa Z-projection of CacHaloTag-N (green), Brp (magenta), and merge. (D, E) Representative boutons of STORM CacHaloTag-N clusters as identified by DBSCAN at type Ib and Is boutons as indicated. Each color represents an individual identified cluster with purple scattered dots identifying excluded background signal. (F–H) Analysis of STORM-acquired CacHaloTag-N clusters where each data point represents the respective single-cluster measurement averaged over individual boutons. (F) Quantification of CacHaloTag-N cluster area at type Ib and Is AZs. (G) Quantification of localizations per cluster at type Ib and Is boutons. (H) Calculated CacHaloTag-N cluster density at type Ib and Is AZs. (I) Paired analysis of calculated AZ cluster density averaged over individual type Ib and Is inputs to the same muscle. All scale bars = 1 µm, all error bars indicate S.E.M. **p<0.01; *p<0.05; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Differences in Bruchpilot levels and function at low- and high-Pr inputs

To understand how these nanoscale differences in VGCC organization might be established, we investigated the AZ scaffolding protein Brp. Brp/CAST/ELKS family proteins function as central organizers of both VGCCs and SV release sites at developing synapses (Dai et al., 2006; Dong et al., 2018; Hallermann et al., 2010; Held et al., 2016; Kittel et al., 2006; Liu et al., 2014; McDonald et al., 2020; Radulovic et al., 2020). Like Cac, Brp is more densely arranged at type Is AZs as measured through SMLM and stimulated emission depletion (STED) imaging studies (He et al., 2023; Jetti et al., 2023; Mrestani et al., 2021). We simultaneously imaged type Ib and Is inputs and found lower Brp levels at type Is AZs (Figure 3A and B). Since Cac levels are similar at AZs of the two inputs, lower Brp levels result in a significantly higher Cac:Brp ratio at type Is synapses, which we hypothesize promotes compact organization of VGCCs (Figure 3C). In contrast, we and others have previously shown that Brp levels positively correlate with Pr among AZs of low-Pr type Ib inputs (Gratz et al., 2019; Muhammad et al., 2015; Newman et al., 2017; Peled et al., 2014; Reddy-Alla et al., 2017). Consistently, Brp and Cac levels strongly correlate at type Ib AZs (Gratz et al., 2019) and we observe a similarly strong correlation across individual type Is AZs (Figure 3D). Thus, like VGCCs, Brp levels contribute in distinct ways to synaptic heterogeneity within vs. between low- and high-Pr inputs, likely due to differences in AZ organization between the two synaptic subtypes.

Figure 3. Differences in Bruchpilot (Brp) levels and function at low-and high-Pr inputs.

(A) Representative confocal Z-projection of Brp expression at type Ib (blue outline) and type Is (red outline) terminals. (B) Quantification of Brp AZ intensity at type Ib and Is terminals. (C) Ratio of normalized CacsfGFP-N:Brp levels at type Ib and Is inputs to the same muscles. (D) Correlation of CacsfGFP-N and Brp at type Ib and Is single AZs with linear regression lines (blue and red, respectively) and 95% confidence intervals (black dotted lines) indicated. (E, F) Representative confocal Z-projections of CacsfGFP-N (green), Brp (magenta), HRP (white), and merge at type Ib (blue outline) and Is (red outline) terminals of cacsfGFP-N (control) or cacsfGFP-N;brp-/- (brp-/-) animals. (G) Quantification of CacsfGFP-N normalized fluorescence intensity at type Ib and Is AZs of control vs brp-/- NMJs. (H) Ratio of CacsfGFP-N fluorescence intensity at type Ib and Is AZs between brp-/-and control NMJs. For B and G, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M., ****p<0.0001. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

We next investigated the requirement for Brp in promoting VGCC accumulation at low- and high-Pr inputs by analyzing CacsfGFP-N levels in brp null mutants (brp-/-; Figure 3E and F). CacsfGFP-N levels are diminished at both type Ib and Is AZs, demonstrating a conserved role for Brp in promoting Cac accumulation at both inputs (Figure 3G). The relative decrease in Cac levels at type Ib AZs is significantly greater than at type Is AZs, indicating a greater requirement for Brp in regulating VGCC levels at low-Pr type Ib synapses (Figure 3H). This suggests that an additional factor or factors function with or upstream of Brp to establish differences in Brp dependence at low- and high-Pr AZs.

Brp differentially regulates VGCC dynamics at low- and high-Pr synapses during presynaptic homeostatic potentiation

In response to acute or chronic inhibition of glutamate receptors at NMJs, Drosophila motor neurons homeostatically increase neurotransmitter release to maintain synaptic communication (Davis and Müller, 2015; Frank, 2014; James et al., 2019). Pharmacological inhibition of glutamate receptors with the wasp toxin Philanthotoxin-433 (PhTx) induces acute presynaptic homeostatic potentiation of release (PHP) within minutes (Frank et al., 2006). We and others have demonstrated that acute PHP involves rapid changes in VGCC and other AZ protein levels at type Ib AZs (Böhme et al., 2019; Gratz et al., 2019; Weyhersmüller et al., 2011). Recent studies have revealed significant differences in the induction of PHP at low- and high-Pr synaptic inputs under different conditions (Genç and Davis, 2019; Newman et al., 2017; Sauvola et al., 2021). PhTx induces acute PHP at both type Ib and Is synapses (Genç and Davis, 2019), but the molecular changes underlying PHP at high-Pr type Is AZs remain unknown. To compare the dynamic modulation of VGCCs at low- and high-Pr AZs, we treated cacsfGFP-N larvae with non-saturating concentrations of PhTx for 10 min, then quantified Cac and Brp levels at type Ib and Is AZs (Figure 4A and B). We observe a significant PhTx-induced increase in Brp and CacsfGFP-N levels at type Is AZs similar to type Ib (Figure 4C and D; Gratz et al., 2019). Thus, despite their distinct baseline transmission and organizational properties, PhTx-induced potentiation of neurotransmitter release involves the rapid accumulation of VGCCs at both low- and high-Pr AZs.

Figure 4. Brp differentially regulates VGCC dynamics at low-and high-Pr inputs during presynaptic homeostatic potentiation.

(A, B) Representative confocal Z-projections of CacsfGFP-N (top, green), Brp (middle, magenta), and both merged with HRP (bottom, gray) at untreated and PhTx-treated cacsfGFP-N NMJs showing type Ib (blue) and type Is (red) terminals. (C) Quantification of Brp fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (D) Quantification of CacsfGFP-N fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (E, F) Representative confocal Z-projections of CacsfGFP-N (top, green), Brp (middle, magenta), and both merged with HRP (bottom, gray) at untreated and PhTx-treated cacsfGFP-N;brp-/- NMJs showing type Ib (blue) and type Is (red) terminals. (G) Quantification of CacsfGFP-N fluorescence intensity at untreated and PhTx-treated cacsfGFP-N;brp-/- type Ib and Is terminals. For all quantifications, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M. ****p<0.0001; ***p<0.001; **p<0.01; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

At low-Pr type Ib AZs, Brp is a critical regulator of PHP-induced accumulation of proteins associated with SV priming and release, specifically Unc13A and Syntaxin-1A (Böhme et al., 2019). At type Ib AZs, PhTx also induces a Brp-dependent increase in Cac density and decrease in channel mobility (Ghelani et al., 2023). Notably, Brp itself becomes more densely organized during PHP (Ghelani et al., 2023), consistent with its denser organization at high-Pr type Is AZs (Mrestani et al., 2021). Since baseline accumulation of VGCCs depends less on Brp at high-Pr type Is AZs, we investigated the role of Brp in promoting dynamic increases in VGCC levels at type Ib and Is AZs by treating cacsfGFP-N; brp-/- larvae with PhTx followed by quantification of CacsfGFP-N levels (Figure 4E and F). We find that PhTx failed to induce accumulation of Cac at either type Ib or Is AZs in brp-/- mutants, demonstrating a shared requirement for Brp in regulating VGCC dynamics at both inputs (Figure 4G). In contrast to no change at type Ib AZs, CacsfGFP-N levels are significantly decreased at type Is AZs (Figure 4G), revealing an input-specific role for Brp in maintaining VGCC levels during the dynamic reorganization of AZs. Consistently, Ghelani et al., 2023 found that whereas PhTx induces a decrease in Cac mobility at wild-type type Ib AZs, in brp-/- mutants Cac mobility increases (Ghelani et al., 2023). Together, these findings suggest potentiating synapses must coordinate the accumulation of new VGCCs with the stabilization of existing channels, and that meeting this challenge is more dependent upon Brp at high-Pr AZs.

Endogenous tagging of VGCC auxiliary subunits reveals distinct synaptic expression patterns

In addition to the pore-forming α subunits, VGCCs comprise auxiliary α2δ and β subunits that regulate forward channel trafficking, membrane insertion, and function (Figure 5A; Campiglio and Flucher, 2015; Dolphin and Lee, 2020; Weiss and Zamponi, 2017). β subunits interact with pore-forming α subunits intracellularly, whereas GPI-anchored α2δ subunits are largely extracellular. Beyond their interaction with α subunits, α2δs have been shown to interact with a growing number of extracellular proteins to promote synaptogenesis (Bauer et al., 2010; Dolphin, 2018; Risher et al., 2018). The Drosophila genome encodes one synaptic Cav2 α subunit (Cac), one β subunit, and three α2δ subunits (Littleton and Ganetzky, 2000). Auxiliary subunits are both spatially and temporally regulated and broadly able to interact with α subunits. Thus, the subunit composition of channel complexes is a potential source of significant diversity in both the spatial and functional regulation of VGCCs.

Figure 5. Endogenous tagging of VGCC auxiliary subunits reveals distinct synaptic expression patterns.

(A) Schematic of a Ca2+ channel complex with tagged auxiliary subunits (created with BioRender). (B) Schematic of Ca-β (isoform PL shown), Stj (isoform PC), and Stolid (isoform H/I) indicating endogenous tag locations. (C–E) Quantification of EJPs, mEJPs, and quantal content for each endogenously tagged line. (F–H) Representative confocal Z-projections of auxiliary subunit expression (green) at the larval ventral ganglion (VG, top, scale bars = 100 µm) and NMJs co-labeled with anti-HRP (magenta, bottom, scale bars = 5 µm). All error bars indicate S.E.M., ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

© 2024, BioRender Inc
2024
BioRender Inc
https://creativecommons.org/licenses/by-nc-nd/4.0/ Figure 5A was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.

Ca-β encodes the sole Drosophila β subunit and has been shown to enhance Ca2+ transients in sensory neurons (Kanamori et al., 2013). Drosophila α2δ–3, also known as Straightjacket (Stj), has well-characterized roles at the NMJ in promoting Ca2+ channel clustering, homeostatic plasticity, and, independently of Cac, synapse formation and organization (Dickman et al., 2008; Hoover et al., 2019; Kurshan et al., 2009; Ly et al., 2008; Schöpf et al., 2021; Wang et al., 2016). While low sequence homology between α2δ subunits within and across species makes 1:1 mapping difficult, the remaining two Drosophila α2δs map more closely to mammalian α2δ–3 and –4 than α2δ–1 and –2. Stolid was recently shown to promote dendritic Cac expression in motor neurons, whereas Ma2d is known to function in muscle where it is broadly expressed (Heinrich and Ryglewski, 2020; Reuveny et al., 2018). The synaptic localization of endogenous auxiliary subunits with VGCCs remains unknown in Drosophila.

To explore potential differences in VGCC subunit composition at type Ib and Is synapses, we used CRISPR gene editing to incorporate endogenous V5 tags in sequence common to all isoforms of stj, stolid, and Ca-β (Bruckner et al., 2017; Gratz et al., 2014). We inserted V5 after the N-terminal signal peptides of Stj and Stolid and near the C-terminus of Ca-β (see Materials and methods for details), and confirmed that the incorporation of the peptide tags did not impair neurotransmission (Figure 5B–E). We investigated the expression of each endogenously tagged subunit in the larval ventral ganglion and found that all subunits are expressed in the synaptic neuropil in a pattern similar to the α subunit Cac (Figure 5F–H; Gratz et al., 2019). Similar to Cac, Ca-βV5-C is highly enriched in the mushroom bodies of the larval brain. We next investigated expression at the larval NMJ where Cac localizes in a single punctum at each AZ and found that only Ca-βV5-C and StjV5-N are present (Figure 5F–H). This aligns with the recent finding that Stolid does not play a role in regulating Ca2+ transients at the larval NMJ (Heinrich and Ryglewski, 2020). We also observe Ca-βV5-C expression in muscle as expected for the sole Drosophila β subunit (Figure 5F and see Figure 6C).

Figure 6. Stj/α2δ–3 levels are lower at AZs of high-Pr type Is inputs.

(A) Representative SoRa Z-projections of Ca-βV5-C (green), Brp (magenta), and merge at a single bouton. (B) Representative SoRa Z-projections of CacsfGFP-N (green), StjV5-N (magenta), and merge at a single bouton. Scale bars for A and B=1 μm. (C, D) Representative confocal Z-projections of Ca-βV5-C expression and StjV5-N expression at type Ib (blue outline) and type Is (red outline) terminals. Scale bars = 5 μm. (E, F) Quantification of Ca-βV5-C and StjV5-N fluorescence intensity at type Ib and Is AZs. Each data point represents the average normalized single AZ sum intensity for an individual NMJ. (G, H) Correlation of CacsfGFP-N and StjV5-N fluorescence intensity levels at type Ib and Is single AZs with linear regression lines (blue or red line, respectively) and 95% confidence intervals (black lines). All error bars indicate S.E.M. ***p<0.001; ns, not significant. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Stj/α2δ-3 levels are lower at AZs of high-Pr type Is inputs

To investigate Ca-βV5-C and StjV5-N localization at type Ib and Is AZs, we used super-resolution optical reassignment microscopy. Both subunits localize to AZs labeled with Cac or the CAST/ELKS AZ cytomatrix protein Brp (Figure 6A and B). We observe Brp rings surrounding puncta of VGCCs including Ca-βV5-C (Figure 6A). The tight localization of both subunits to central AZ puncta suggests they are associated with α subunits and predicts that Ca-βV5-C and StjV5-N levels, like Cac, will be similar at the low- and high-Pr synapses. To test this, we imaged Ca-βV5-C and StjV5-N levels at both inputs simultaneously using confocal microscopy and measured fluorescence intensity (Figure 6C and D). As predicted, we found that Ca-βV5-C levels are similar at type Ib and Is AZs (Figure 6E). In contrast, StjV5-N levels are significantly lower at high-Pr type Is AZs (Figure 6F). Thus, while Cac and Ca-β are present in similar ratios at AZs of both inputs, surprisingly, the same is not true of Stj/α2δ–3 with high-Pr type Is AZs exhibiting lower levels of Stj. This unexpected finding indicates that α:α2δ–3 stoichiometry is not always 1:1 in vivo and differs at low- and high-Pr synapses. This is consistent with studies of mammalian subunits indicating that in contrast to β subunits, α2δ interactions with α subunits may be transient, leading to a pool of VGCCs lacking α2δ (Müller et al., 2010; Voigt et al., 2016). Our results indicate this pool may be present in vivo and larger at high-Pr type Is inputs.

To further investigate the contribution of Stj to synaptic heterogeneity, we analyzed the relationship between Cac and Stj levels at individual AZs of type Is inputs. StjV5-N and CacsfGFP-N levels are highly positively correlated at type Is AZs (Figure 6G). We observe the same relationship between StjV5-N and CacsfGFP-N levels at type Ib AZs (Figure 6H). Because Pr is highly positively correlated with Cac levels within synaptic subtypes, this indicates that Stj levels are also positively correlated with Pr within, but not between, inputs.

Stj/α2δ–3 levels are modulated at AZs of both low- and high-Pr inputs during presynaptic homeostatic potentiation

α2δ subunits are critical regulators of α subunit forward trafficking. In flies and mammals, overexpression of α2δ subunits increases α subunit abundance, whereas overexpression of the α subunit alone does not (Cao et al., 2004; Cunningham et al., 2022; Hoppa et al., 2012). These findings suggest that α2δ may be dynamically regulated together with Cac during PHP, a prediction we can now test with our endogenously tagged line. Following PhTx exposure, we find that StjV5-N is recruited on a rapid timescale to both low- and high-Pr AZs, increasing by a similar percentage at both type Ib and Is AZs (27% and 26%, respectively) as predicted (Figure 7A-C). Cac levels are similarly increased (33% at type Ib and 30% at type Is; See Figure 4D), suggesting coordinated regulation. We have previously shown that Cac abundance is also increased in chronic PHP, which is induced by genetic loss of the GluRIIA receptor subunit (Gratz et al., 2019; Li et al., 2018; Petersen et al., 1997). We investigated Stj dynamics in GluRIIA-/- null animals and observed elevated StjV5-N levels at AZs of both type Ib and Is inputs (18% and 17%, respectively; Figure 7D–F), indicating similar dynamics during chronic PHP. These data are consistent with the recent finding that in addition to its previously uncovered role in promoting an increase in the readily releasable pool of SVs (Wang et al., 2016), Stj is required for the accumulation of Cac at type Ib AZs during both acute and chronic PHP (Zhang et al., 2023). Thus, the abundance of multiple key AZ proteins distinguishes low- and high-Pr synapses within, but not between, inputs at baseline and during homeostatic plasticity.

Figure 7. Stj/α2δ–3 levels are modulated at AZs of both low- and high-Pr inputs during presynaptic homeostatic potentiation.

(A, B) Representative confocal Z-projections of StjV5-N (top, green), HRP (middle, gray), and merge (bottom) at untreated and PhTx-treated stjV5-N NMJs showing type Ib (blue) and type Is (red) terminals. (C) Quantification of StjV5-N fluorescence intensity at untreated and PhTx-treated type Ib and Is terminals. (D–E) Representative confocal Z-projections of StjV5-N (top, green), HRP (middle, gray), and merge (bottom) at stjV5-N and stjV5-N;GluRIIA-/- NMJs showing type Ib (blue) and type Is (red) terminals. (F) Quantification of StjV5-N fluorescence intensity levels at stjV5-N and stjV5-N;GluRIIA-/- type Ib and Is terminals. For all quantifications, each data point represents the average normalized single AZ sum intensity for an individual NMJ. All scale bars = 5 µm, all error bars indicate S.E.M. ****p<0.0001. N’s, absolute values, and statistical information is detailed in Supplementary file 1a.

Discussion

Complex nervous system function depends on communication at synapses with heterogeneous and plastic properties. Paradoxical findings in the field have raised questions about the role of VGCCs in establishing neurotransmitter release properties. Our findings suggest a model in which two broad intersecting mechanisms contribute to synaptic diversity in the nervous system: (1) nanoscale spatial organization and relative molecular content establish distinct average basal release probabilities that differ between inputs and (2) coordinated modulation of VGCC and active zone protein abundance independently tunes Pr among individual synapses of distinct inputs. This model provides a framework for integrating diverse findings in the field and understanding how multiple levels of molecular and organizational diversity can intersect to generate extensive synaptic heterogeneity. Investigations at diverse synapses using approaches ranging from cell-attached patch recordings to freeze-fracture immuno-electron microscopy to correlative functional imaging have revealed a strong positive correlation between VGCC number and Pr (Akbergenova et al., 2018; Gratz et al., 2019; Holderith et al., 2012; Miki et al., 2017; Nakamura et al., 2015; Newman et al., 2022; Sheng et al., 2012). This holds true among mature synapses in the hippocampus or immature synapses of the calyx of Held (Holderith et al., 2012; Sheng et al., 2012) and at the developing Drosophila NMJ where the differences in Pr and channel number between AZs of a single input also correlate with synapse maturity (Akbergenova et al., 2018; Gratz et al., 2019; Newman et al., 2022). While this conclusion corresponds neatly with the dependence of neurotransmitter release on Ca2+ influx, counterintuitively, a disconnect between VGCC and Pr is observed in some studies. Although the number of functional VGCCs positively correlates with Pr among synapses in the immature calyx of Held, the mature calyx has higher Pr yet recruits fewer Ca2+ channels (Fedchyshyn and Wang, 2005; Sheng et al., 2012; Wang and Augustine, 2014). Similarly, in the cerebellum, inhibitory stellate cells form high-Pr synapses with lower VGCC levels than low-Pr synapses formed by excitatory granular cells (Rebola et al., 2019). Adding to these paradoxical examples, we find that VGCC levels positively correlate with Pr among the heterogeneous synapses formed by either low-Pr type Ib or high-Pr type Is motor neurons, but overall VGCC abundance is similar at the two inputs (Figures 1 and 2) despite an ~threefold difference in Pr (Lu et al., 2016; Newman et al., 2017). Accordingly, our correlative functional imaging confirms that the same number of channels can support greater release at these high-Pr AZs (Figure 1). While two-fold greater Ca2+ influx at high-Pr type Is AZs can explain much of this difference (He et al., 2023; Lu et al., 2016), mounting evidence suggests that here and in other systems differences in Pr are separable from Ca2+ influx. At distinct inputs formed by CA1 pyramidal neurons, Ca2+ influx is greater at high-Pr synapses, but doesn’t explain differences in synaptic strength as raising Ca2+ entry at low-Pr synapses to high-Pr synapse levels was not sufficient to increase synaptic strength to high-Pr input levels (Aldahabi et al., 2022). Similar findings have been reported at tonic and phasic synapses of the Crayfish NMJ (Msghina et al., 1999).

The separability of VGCC abundance, Ca2+ influx, and Pr appears to be due to molecular and spatial differences between synaptic subtypes. In CA1 pyramidal neurons, differences in Munc-13-dependent SV priming are proposed to establish synapse-specific release properties, possibly due to the presence of distinct isoforms at low- vs. high-Pr connections. In the cerebellum, fewer VGCC are more tightly coupled to SVs at high-Pr stellate synapses (Rebola et al., 2019). More densely organized VGCCs at the mature vs. developing calyx of Held also exhibit greater coupling with SVs (Chen et al., 2015; Fedchyshyn and Wang, 2005; Fekete et al., 2019; Nakamura et al., 2015; Sheng et al., 2012). We find that Cac clusters are denser at high-Pr AZs formed by Drosophila phasic motor neurons (Figure 2). Brp, which organizes both VGCCs and SVs, is also more densely organized at type Is synapses (He et al., 2023; Jetti et al., 2023; Mrestani et al., 2021), consistent with an overall more compact organization of high-Pr AZs. A straightforward prediction is that a more compact AZ organization will decrease the distance between VGCCs and SVs. Indeed, a recent electrophysiological study using new tools for genetically isolating type Ib and Is inputs demonstrated that neurotransmitter release at denser type Is synapses is less impacted by the slow Ca2+ chelator EGTA than type Ib synapses, indicating tighter VGCC-SV coupling (He et al., 2023). Together, these findings suggest that more compact AZs may be a common organizing principle of high-Pr synapses. Consistent with this model, Brp and Unc-13 density increase during PHP when Pr is increased (Dannhäuser et al., 2022; Ghelani et al., 2023; Mrestani et al., 2021).

We also observe molecular differences between Drosophila motor inputs that may contribute to distinct Pr. Somewhat counterintuitively, high-Pr type Is AZs have lower levels of both Brp and Stj/α2δ–3 (Figures 3 and 6). Brp/CAST/ELKS AZ cytomatrix proteins are central regulators of synapse organization across species (Dai et al., 2006; Dong et al., 2018; Hallermann et al., 2010; Held et al., 2016; Kittel et al., 2006; Liu et al., 2014; McDonald et al., 2020; Radulovic et al., 2020). Brp interacts broadly with AZ proteins to promote Cac clustering, organize SVs, and recruit Unc13A, which defines SV release sites (Böhme et al., 2016; Fulterer et al., 2018; Ghelani et al., 2023; Liu et al., 2011). While Brp clearly plays a central role in AZ organization and reorganization, we also find that type Ib and Is synapses have distinct requirements for Brp during synapse formation and homeostatic potentiation (Figures 3 and 4). Synapse-specific roles for Brp are supported by a recent functional imaging study in Drosophila (Jetti et al., 2023) and studies of ELKS at mammalian inhibitory and excitatory synapses (Held et al., 2016), and suggest additional factors establish neuron-specific differences in Brp dependence. A recent single-cell transcriptomic study of type Ib and Is motor neurons provides an unbiased starting point for identifying candidate regulators of molecular differences at low- and high-Pr AZs (Jetti et al., 2023). Differentially expressed genes encode cytoskeletal and motor-related proteins, regulators of proteostasis, and post-translational modifying enzymes/pathway components – all of which could potentially contribute to establishing the observed molecular and/or spatial differences between type Ib and Is AZs. The VGCC complex itself provides an additional potential mechanism for diversifying synaptic function. Both β and α2δ subunits can influence the membrane localization and function of VGCCs (Campiglio and Flucher, 2015; Dolphin and Lee, 2020; Weiss and Zamponi, 2017). In addition to the ability to mix and match subunits, many of the genes encoding VGCC subunits across species are extensively alternatively spliced to generate additional functional diversity (Cingolani et al., 2023; Lipscombe et al., 2013; Lipscombe and Lopez Soto, 2019) – an area of great interest for further investigation at the Drosophila NMJ. Because both β and α2δ subunits are generally considered positive regulators of channel trafficking and function, we were surprised to find upon endogenously tagging Stj/α2δ–3 that its levels are lower at high-Pr AZs (Figures 5 and 6). Since AZ levels of α subunit Cac are similar at the two inputs, lower levels of Stj at type Is synapses indicates a difference in α:α2δ–3 stoichiometry between low- and high-Pr synaptic subtypes. While some previous studies have observed a tight association between the two subunits, a single-molecule tracking and modeling study of mammalian VGCCs found that α2δ subunits have a relatively low affinity for α subunits and predicted a population of α subunits not associated with an α2δ subunit (Cassidy et al., 2014; Voigt et al., 2016). Consistently, whereas α and β subunits were isolated at near equimolar ratios following affinity purification of Cav2 channels, molar levels of α2δ were a surprising 90% lower (Müller et al., 2010). Our findings suggest there may be a pool of VGCCs lacking an α2δ subunit at endogenous synapses, and further suggest that this pool is specific to or enriched at high-Pr type Is AZs. Stj is both required (Dickman et al., 2008; Kurshan et al., 2009; Ly et al., 2008) and rate limiting (Cunningham et al., 2022) for Cac accumulation at AZs. Stj does not appear to function in the stabilization of channels at the AZ membrane, but rather at an upstream step in the progression from ER to plasma membrane (Cunningham et al., 2022), so complexes may not need to be maintained. However, a recent study in C. elegans suggested that auxiliary subunits to promote stabilization in the membrane, raising the possibility that the difference observed in α2δ levels could translate to a difference in α subunit mobility within Ib vs. Is AZs (Oh et al., 2023). Tools for following Stj dynamics in developing neurons will help clarify its precise role in Cac delivery at type Ib and Is AZs.

How might a higher α:α2δ–3 ratio result in higher Pr? One possibility involves α2δ–3 interactions with cell adhesion molecules. In mammals, α-Neurexin specifically inhibits Ca2+ currents in Cav2.2 channels containing α2δ–3 (Tong et al., 2017), which, if similar at the Drosophila NMJ, could result in greater inhibition of channel function at type Ib AZs and contribute to the observed difference in Ca2+ influx. Loss of Drosophila Neurexin reduces neurotransmitter release at the NMJ, but it also leads to reduced synaptogenesis so whether this is a direct effect remains unknown (He et al., 2007). Another possibility is that Stj isoforms with different functions are differentially expressed at type Ib and Is AZs. A recent transcriptomic study observed no significant differences in mRNA splice isoforms, but transcript levels do not always reflect protein levels (Jetti et al., 2023). Notably, we find that among synapses of either low- or high-Pr AZs, Stj levels correlate with Pr and Stj levels are increased across AZs of both inputs during acute and chronic PHP (Figure 7). Cac and Stj levels increase by similar amounts at the two inputs, suggesting the difference in stoichiometry is maintained following homeostatic potentiation. α2δ–3 is an important drug target for treating epilepsy, neuropathic pain, and anxiety, so understanding its cell-specific roles and how α:α2δ–3 stoichiometry impacts channel function and contributes to synaptic diversity is of great interest.

Materials and methods

Drosophila genetics and gene editing

The following fly lines used in this study were obtained from the Bloomington Drosophila Stock Center (BDSC, NIH P40OD018537): w1118 (RRID:BDSC_5905), vasa-Cas9 (RRID:BDSC_51324), piggyBac transposase (RRID:BDSC_8283), and Df(2 R)brp6.1 (Gratz et al., 2014; Horn et al., 2003). brp69 and GluRIIAsp16 (GluRIIA-/-) alleles were generously provided by Stephan Sigrist (Freie Universität Berlin; Fouquet et al., 2009; Kittel et al., 2006) and Aaron DiAntonio (Petersen et al., 1997) respectively. brp loss-of-function experiments were performed in brp69/Df(2 R)brp6.1. Drosophila melanogaster stocks were raised on molasses food (Lab Express, Type R) in a 25 °C incubator with controlled humidity and 12 hr light/dark cycle. Endogenously tagged cac, Ca-β, stolid, and straightjacket (stj) alleles were generated using our piggyBac-based CRISPR approach as previously detailed (https://flycrispr.org/; Bruckner et al., 2017; Gratz et al., 2019). We used FlyBase (release FB2024_01) to obtain genomic sequences (doi.org/10.1093/genetics/iyad211). Td-Tomato and Halo tags were incorporated at the N-terminus of Cac, where we have previously incorporated fluorescent tags (Ghelani et al., 2023; Gratz et al., 2019). V5 tags were incorporated at the N-terminus of Stj and Stolid after their signal peptide sequences, immediately after Asparagine 34 of Stj and after Isoleucine 34 of Stolid. For Ca-β, V5 was inserted immediately after Proline 446 of isoform Ca-β-PN. All endogenously tagged lines are fully viable in homozygous males and females and were molecularly confirmed by Sanger sequencing. All genetic reagents generated in this study are available upon request. gRNAs sequences used:

cacHaloTag-N / cacTd-Tomato-N: CATCGCTTAGCTGATAGAATGG

stjV5-N: GCTGGCTGCAGATTGACGCACGG

stolidV5-N: ATTTGTTGCATTCGCCGATCAGG

Ca-β V5-C: CTCCGCAGATCCCGCGCGTCTGG

Immunostaining

All antibodies used, associated fixation methods, and incubation times can be found in Supplementary file 1b. Male wandering third-instar larvae were dissected in ice-cold saline and fixed either for 6 min at room temperature with Bouin’s fixative, 5 min on ice with 100% methanol, or 30 min at room temperature (RT) in 4% PFA. Dissections were permeabilized with PTX (PBS with 0.1% Triton-X 100) and blocked for 1 hr at RT using 5% goat serum and 1% bovine serum albumin. Stained larvae were mounted in Vectashield (Vector Laboratories, #H-1000) under Fisherbrand coverglass (Fisher Scientific, #12541B) for confocal microscopy, with Prolong glass mounting medium (Thermo Fisher Scientific, #P36980) under Zeiss High Performance Coverglass (Zeiss, #474030-9000-000) for super-resolution optical reassignment microscopy, or buffer (see STORM imaging and analysis section) under Zeiss coverglass with edges sealed using vacuum grease for STORM microscopy.

Ca2+ imaging and analysis

Functional imaging was performed on a Nikon A1R resonant scanning confocal mounted on a FN1 microscope using a Nikon Apo LWD 25x1.1 NA objective and a Mad City Labs piezo drive nosepiece. Dissections and data collection were performed as previously described in Gratz et al., 2019. Briefly, cacTd-Tomato-N; Mhc-GCaMP6f male 3rd instar larvae were dissected in HL3 containing 0.2 mM Ca2+ and 25 mM Mg2+ with motor axons severed and the larval brain removed. Larval filets were placed in HL3 containing 1.5 mM Ca2+ and 25 mM Mg2+ for recording. Nerves were suctioned into 1.5 mm pipettes and stimulus amplitude was adjusted to recruit both type Ib and Is inputs. Motor terminals from segments A2-4 at NMJ 6/7 were imaged for CacTd-Tomato-N levels first using a galvanometer scanner, then a resonant scanner to collect GCaMP6f events in a single focal plane continuously for 120 stimulations at a 0.2 Hz stimulation frequency.

Z-stacks and movies were loaded into Nikon Elements Software (NIS) where movies were motion corrected, background subtracted, and denoised. Change in fluorescence (ΔF) movies were then created by subtracting the average of the previous 10 frames from each frame. A substack of only stimulation frames was further processed using a gaussian filter followed by the Bright Spots detection module in the Nikon GA3 software to identify the location of each postsynaptic event. CacTd-Tomato-N fluorescence intensity levels and coordinate locations were measured for 531 AZs for type Ib and 365 AZs for type Is terminals across six animals. X-Y coordinate positions of fluorescent signals from GCaMP6f postsynaptic events were aligned to CacTd-Tomato-N puncta locations and each post synaptic event assigned to a Cac punctum using nearest neighbor analysis. Postsynaptic events that did not map within 960 nm of a CacTd-Tomato-N punctum were discarded from the analysis. Pearson’s correlation was used to determine the correlation between Pr and Cac levels normalized to average to account for variability between imaging sessions. Cac intensity-Pr heat maps were generated using Python matplotlib and seaborn plotting packages.

STORM imaging and analysis

STORM imaging was performed on a Nikon Eclipse Ti2 3D NSTORM with an Andor iXon Ultra camera, Nikon LUN-F 405/488/640 nm lasers, and a Nikon 100x1.49 NA objective. STORM buffer (10 mM MEA (pH 8.0), 3 U/mL pyranose oxidase, and 90 U/mL catalase, 10% (w/v) glucose, 10 mM sodium chloride, and 50 mM Tris hydrochloride) was made fresh each imaging day and pH adjusted to between 7.0–8.0 using acetic acid. cacHaloTag-N NMJs were labeled as detailed in Supplementary file 1b and immediately imaged for HRP in 488 channel to identify type Ib and Is terminals. CacHaloTag-N was then imaged using the 640 nm laser line at 33 Hz for 5000 frames. 405 nm laser power was gradually increased over the course of imaging to compensate for run-down of blinking rates. A back aperture camera was used to ensure beam focus and position for each imaging session to ensure high signal to noise. Data were binned with a CCD minimum threshold of 100 and drift correction was applied using the NIS Software STORM package. ROIs of single boutons were drawn in NIS using HRP in the 488 nm channel followed by a DBSCAN analysis with criteria of 10 molecules within 50 nm to determine clusters. Positional coordinates of localizations within clusters from DBSCAN were exported from NIS and run through a Python script published with this manuscript. Using the implementation developed in Mrestani et al., 2021 as a starting point, we wrote custom code to use the alpha shapes component of the CGAL package (https://www.cgal.org), via a python wrapper (https://anaconda.org/conda-forge/cgal), to measure the area of Ca2+ channel clusters, the number of localizations, and calculate cluster density. To achieve an average lateral localization accuracy of ~30 nm, all localizations with >50 nm localization accuracy were removed prior to analysis. Using this custom code, CacHaloTag-N area was analyzed using an alpha value of 0.015, which controls the complexity of cluster boundaries (not restricted to be convex).

Confocal imaging and analysis

For quantitative AZ analysis of larval NMJs, dissections stained in the same dish were imaged on a Nikon Eclipse Ni A1R+confocal microscope using an Apo TIRF 60x1.49 NA oil-immersion objective for larval NMJs. NMJs containing both type Is and type Ib branches from muscles 6/7 in segments A2-4 were collected. ROIs were drawn using HRP staining to differentiate between type Ib and Is branches. To analyze individual AZs, Nikon Elements GA3 Software was used to process images with Gaussian and rolling ball filters and measure fluorescence intensity levels at individual puncta identified by the Bright Spots module. When experimental design allowed, Brp fluorescence signal was used to create a binary mask to aid in the identification of AZ ROIs for analysis. Otherwise, binary masks were created based on the fluorescence signal of the channel analyzed. Quantifications were conducted masked to genotype and/or treatment. Confocal fluorescence intensity level data are reported as the sum fluorescence intensity per AZ averaged over individual NMJs. For Figure 5, larvae were stained separately and imaged using a Nikon Plan-Apo 20x0.75 NA objective (ventral ganglia) or Apo TIRF 60x1.49 NA oil-immersion objective (NMJs). Super-resolution optical reassignment images were obtained on a Nikon CSU-W1 SoRa (Spinning Disk Super Resolution by Optical Pixel Reassignment) with a Photometrics Prime BSI sCMOS camera and a 60x1.49 NA oil-immersion objective. Images were acquired using Nikon NIS and deconvolved using Richardson-Lucy deconvolution with 15–20 iterations.

Electrophysiology

Current-clamp recordings were performed as previously described (Bruckner et al., 2017). Male third-instar larvae were dissected in HL3 (70 mM NaCl, 5 mM KCl, 15 mM MgCl2, 10 mM NaHCO3, 115 mM sucrose, 5 mM trehalose, 5 mM HEPES, pH 7.2) with 0.25 mM Ca2+. Recordings were performed in HL3 at the external Ca2+ concentration indicated. Sharp borosilicate electrodes filled with 3 M KCl were used to record from muscle 6 of abdominal segments A3 and A4. Recordings were conducted on a Nikon FN1 microscope using a 40x0.80 NA water-dipping objective and acquired using an Axoclamp 900 A amplifier, Digidata 1550B acquisition system, and pClamp 11.0.3 software (Molecular Devices). For each cell with an initial resting potential between −60 and −80 mV and input resistance ≥5 MΩ, mean miniature excitatory junctional potentials (mEJPs) were collected for 1 min in the absence of stimulation and analyzed using Mini Analysis (Synaptosoft). EJPs were generated by applying a stimulus to severed segmental nerves at a frequency of 0.2 Hz using an isolated pulse stimulator 2100 (A-M Systems). Stimulus amplitude was adjusted to consistently elicit compound responses from both type Ib and Is motor neurons. At least 25 consecutive EJPs were recorded for each cell and analyzed in pClamp to obtain mean amplitude. Quantal content was calculated for each recording as mean EJP amplitude divided by mean mEJP amplitude.

Acute homeostatic challenge

Acute PHP was induced by incubating semi-intact preparations in 20 µM Philanthotoxin-433 (Figure 4: PhTx; Santa Cruz, sc-255421, Lot B1417 and Figure 7: PhTx; Sigma Aldrich, P207-2, Lot MKCK7405) diluted in HL3 containing 0.4 mM Ca2+ for 10 min at room temperature (Frank et al., 2006). Control preparations were given a mock treatment. Following control and experimental treatment, dissections were completed, fixed in 4% PFA for 30 min (cacsfGFP-N) or 100% ice-cold methanol on ice for 5 min (stjV5-N), and stained in the same dish. Analyses of fluorescent intensity levels were performed as previously described in the Confocal imaging and analysis section.

Experimental design and statistical analysis

Statistical analyses were conducted in GraphPad Prism 9. Normality was determined by the D’Agostino–Pearson omnibus test. Comparisons of normally distributed data were conducted by Student’s t test (with Welch’s correction in the case of unequal variance) for single comparisons and ANOVA followed by Tukey’s test for multiple comparisons. For non-normally distributed data, the Mann–Whitney U test and Kruskal-Wallis test followed by Dunn’s multiple comparisons tests were used for single and multiple comparisons, respectively. Paired analysis of non-normally distributed data was conducted using Wilcoxon’s matched-pairs signed rank test. One-dimensional Pearson correlation coefficients (r) were used to compare intensity levels and neurotransmitter release probability. ANCOVA test was performed on all regression lines to determine if slopes were significantly different. Reported values are mean ± SEM. Sample size, statistical test, and p values for each comparison are reported in Supplementary file 1a. All source data, including statistical tests and raw images, can be found in the following Harvard Dataverse dataset https://doi.org/10.7910/DVN/GGP3UM.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/100000065 National Institute of Neurological Disorders and Stroke R01NS078179 to Kate M O'Connor-Giles.

http://dx.doi.org/10.13039/100000065 National Institute of Neurological Disorders and Stroke F31NS122424 to Audrey T Medeiros.

Brown Neuroscience Graduate Program T32 MH020068 to Audrey T Medeiros.

Acknowledgements

We thank the Developmental Studies Hybridoma Bank, the Bloomington Drosophila Stock Center (NIH P40OD018537), Flybase (Öztürk-Çolak et al., 2024), Ehud Isacoff (UC Berkeley), and Stephan Sigrist (Freie Universität Berlin) for providing antibodies and fly stocks. The Nikon SoRa/STORM microscope was generously provided by The Neurobiology of Cells and Circuits/Center for Translational Neuroscience Microscopy Committee, Carney Institute for Brain Science. We are grateful to Joel Hirsch (Tel Aviv University) for consultations on tagging Ca-β, Nicholas Deakin (Nikon) for guidance on STORM imaging, the Heckmann lab (University of Würzburg) for guidance on STORM image analysis pipelines, Matthew Knoeppel for help generating CRISPR alleles, and Liana Lewis for her assistance with image analysis. We thank Rajan Thakur and the members of the O’Connor-Giles lab for thoughtful discussions and comments on the manuscript. This work was supported by grants from the National Institute of Neurological Disorders and Stroke, National Institutes of Health to KMOG (R01NS078179) and ATM (F31NS122424), Brown Neuroscience Graduate Program training grant T32 MH020068, and funds from the Brown University Carney Institute for Brain Science.

Additional information

Competing interests

Author contributions

Additional files

Transparent reporting form

Supplementary file 1. Tables detailing absolute values, statistics, and imaging conditions of endogenously-tagged genetic lines.

Data availability

All source data, including statistical tests and raw images, can be found in the following Harvard Dataverse dataset https://doi.org/10.7910/DVN/GGP3UM.

The following dataset was generated:

Audrey M 2024 Source data for Medeiros et al., eLife Version of Record Harvard Dataverse 10.7910/DVN/GGP3UM

10.7554/eLife.88412.3.sa0
eLife assessment
Bellen Hugo J Reviewing Editor https://ror.org/05gq02987 Baylor College of Medicine United States

Convincing
Important
Calcium channels are key regulators of synaptic strength and plasticity. The authors generate new endogenous tags of the Drosophila channel Cac as well as auxiliary subunits to investigate distinct calcium channel functions at the fly NMJ, Is and Ib. They demonstrate functions for voltage-gated calcium channel subunits in promoting synaptic strength, diversity, and plasticity with a series of convincing analyses. The work is important and has broad implications. In addition, the newly developed tools should be quite beneficial for fly biologists.

10.7554/eLife.88412.3.sa1
Reviewer #1 (Public Review):
Reviewer
Calcium channels are key regulators of synaptic strength and plasticity, yet how these channels are differentially utilized to enable synaptic diversity is not clear. In this manuscript, the authors use new endogenous tagging of the Drosophila CaV2 channel Cac and three auxiliary subunits to investigate distinct calcium channel functions at two motor neuron subtypes at the fly NMJ, Is and Ib. Although it is clear from previous studies that Pr is higher at Is over Ib, it is not clear why. The authors confirm these differences using postsynaptic calcium imaging combined with post-hoc Cac-TdTomato imaging. Then, through a series of confocal and super resolution imaging studies, the authors describe differences in calcium channel and active zone structure between Is and Ib motor neuron terminals, and the role of Brp and homeostatic plasticity in regulating channel abundance. Finally, the authors show that while the CaBeta subunit is present at similar levels at Is and Ib active zones, there is an interesting reduction in Stj at Is active zones. The authors conclude that these differences in active zone structure and architecture contribute to the generation of the observed heterogeneity in synaptic strength.

Overall the manuscript is well written, and the successful generation of the new endogenous Cac tags (Td-Tomato, Halo) and CaBeta, stj, and stolid genes with V5 tags will be powerful reagents for the field to enable new studies on calcium channels in synaptic structure, function, and plasticity. There are also some interesting, though not entirely unexpected, findings regarding how Brp and homeostatic plasticity modulate calcium channel abundance. The key factors generating diversity in synaptic strength beyond simple Ca2+ influx are well articulated in framing this study. Beyond the particularly useful new reagents for the field presented, the new data demonstrating a concerted and coupled increase in Cac, Stj, and CaB together after plasticity provides an interesting new dimension to the study and a foundation for new work moving forward.

Comments on revision:

This is a much improved revised manuscript, where the authors have done an excellent job of responding to my initial concerns. In particular, the key factors generating diversity in synaptic strength beyond simple Ca2+ influx are better articulated in framing this study. Beyond the particularly useful new reagents for the field presented, the new data demonstrating a concerted and coupled increase in Cac, Stj, and CaB together after plasticity provides an interesting new dimension to the study and a foundation for new work moving forward.

Upon reflection, I think my initial review came across as a bit harsh, and I am happy to now update my original evaluation to better reflect the importance and impact of this very nice study. I commend the authors on an outstanding study.

10.7554/eLife.88412.3.sa2
Reviewer #2 (Public Review):
Reviewer
The authors aim to investigate how voltage-gated calcium channel number, organization, and subunit composition lead to changes in synaptic activity at tonic and phasic motor neuron terminals, or type Is and Ib motor neurons in Drosophila. These neuron subtypes generate widely different physiological outputs, and many investigations have sought to understand the molecular underpinnings responsible for these differences. Additionally, these authors explore not only static differences that exist during the third-instar larval stage of development but also use a pharmacological approach to induce homeostatic plasticity to explore how these neuronal subtypes dynamically change the structural composition and organization of key synaptic proteins contributing to physiological plasticity. The Drosophila neuromuscular junction (NMJ) is glutamatergic, the main excitatory neurotransmitter in the human brain, so these findings not only expand our understanding of the molecular and physiological mechanisms responsible for differences in motor neuron subtype activity, but also contribute to our understanding of how the human brain and nervous system functions.

The authors employ state-of-the-art tools and techniques such as single-molecule localization microscopy 3D STORM and create several novel transgenic animals using CRISPR to expand the molecular tools available for exploration of synaptic biology that will be of wide interest to the field. Additionally, the authors use a robust set of experimental approaches from active zone level resolution functional imaging from live preparations to electrophysiology and immunohistochemical analyses to explore and test their hypotheses. All data appear to be robustly acquired and analyzed using appropriate methodology. The authors make important advancements to our understanding of how the different motor neuron subtypes, phasic and tonic-like, exhibit widely varying electrical output despite the neuromuscular junctions having similar ultrastructural composition in the proteins of interest, voltage gated calcium channel cacophony (cac) and the scaffold protein Bruchpilot (brp). The authors reveal the ratio of brp:cac appears to be a critical determinant of release probability (Pr), and in particular, the packing density of VGCCs and availability of brp. Importantly, the authors demonstrate a brp-dependent increase in VGCC density following acute philanthotoxin perfusion (glutamate receptor inhibitor). This VGCC increase appears to be largely responsible for the presynaptic homeostatic plasticity (PHP) observable at the Drosophila NMJ. Lastly, the authors created several novel CRISPR-tagged transgenic lines to visualize the spatial localization of VGCC subunits in Drosophila. Two of these lines, CaβV5-C and stjV5-N, express in motor neurons and in the nervous system, localize at the NMJ, and most strikingly, strongly correlate with Pr at tonic and phasic-like terminals.

10.7554/eLife.88412.3.sa3
Author response
Medeiros Audrey T Author Brown University Providence United States

Gratz Scott J Author Brown University Providence United States

Delgado Ambar Author Brown University Providence United States

Ritt Jason T Author Brown University Providence United States

O'Connor-Giles Kate M Author Brown University Providence United States

The following is the authors’ response to the original reviews.

Reviewer #1 (Public review):

[...] Overall the manuscript is well written, and the successful generation of the new endogenous Cac tags (Td-Tomato, Halo) and CaBeta, stj, and stolid genes with V5 tags will be powerful reagents for the field to enable new studies on calcium channels in synaptic structure, function, and plasticity. There are also some interesting, though not entirely unexpected, findings regarding how Brp and homeostatic plasticity modulate calcium channel abundance. However, a major concern is that the conclusions about how "molecular and organization diversity generate functional synaptic heterogeneity" are not really supported by the data presented in this study. In particular, the key fact that frames this study is that Cac levels are similar at Ib and Is active zones, but that Pr is higher at Is over Ib (which was previously known). While Pr can be influenced by myriad processes, the authors should have first assessed presynaptic calcium influx - if they had, they would have better framed the key questions in this study. As the authors reference from previous studies, calcium influx is at least two-fold higher per active zone at Is over Ib, and the authors likely know that this difference is more than sufficient to explain the difference in Pr at Is over Ib. Hence, there is no reason to invoke differences in "molecular and organization diversity" to explain the difference in Pr, and the authors offer no data to support that the differences in active zone structure at Is vs Ib are necessary for the differences in Pr. Indeed, the real question the authors should have investigated is why there are such differences in presynaptic calcium influx at Is over Ib despite having similar levels/abundance of Cac. This seems the real question, and is all that is needed to explain the Pr differences shown in Fig. 1. The other changes in active zone structure and organization at Is vs Ib may very well contribute to additional differences in Pr, but the authors have not shown this in the present study, and rely on other studies (such as calcium-SV coupling at Is vs Ib) to support an argument that is not necessitated by their data. At the end of this manuscript, the authors have found an interesting possibility that Stj levels are reduced at Is vs Ib, that might perhaps contribute to the difference in calcium influx. However, at present this remains speculative.

Overall, the authors have generated powerful reagents for the field to study calcium channels and how they are regulated, but draw conclusions about active zone structure and organization contributing to functional heterogeneity that are not strongly supported by the data presented.

Reviewer 1 raises an interesting question that we agree will form the basis of important studies. Here, we set out to address a different question, which we will work to better frame. While we and others had previously found a strong correlation between calcium channel abundance and synaptic release probability (Pr (Akbergenova et al., 2018; Gratz et al., 2019; Holderith et al., 2012; Nakamura et al., 2015; Sheng et al., 2012)), more recent studies found that calcium channel abundance does not necessarily predict synaptic strength (Aldahabi et al., 2022; Rebola et al., 2019). Our study explores this paradox and presents findings that provide an explanation: calcium channel abundance predicts Pr among individual synapses of either low-Pr type-Ib or high-Pr type-Is inputs where modulating channel number tunes synaptic strength, but does not predict Pr between the two inputs, indicating an inputspecific role for calcium channel abundance in promoting synaptic strength. Thus, we propose that calcium channel abundance predictably modulates synaptic strength among individual synapses of a single input or synapse subtype, which share similar molecular and spatial organization, but not between distinct inputs where the underlying organization of active zones differs. Consistently, in the mouse, calcium channel abundance correlates strongly with release probability specifically when assessed among homogeneous populations of connections (Aldahabi et al., 2022; Holderith et al., 2012; Nakamura et al., 2015; Rebola et al., 2019; Sheng et al., 2012).

As Reviewer 1 notes, the two-fold difference in calcium influx at type-Is synapses is certainly an important difference underlying three-fold higher Pr. However, growing evidence indicates that calcium influx alone, like calcium channel abundance, does not reliably predict synaptic strength between inputs. For example, Rebola et al. (2019) compared cerebellar synapses formed by granule and stellate cells and found that lower Pr granule synapses exhibit both higher calcium channel abundance and calcium influx. In another example, Aldahabi et al. (2023) demonstrate that even when calcium influx is greater at high-Pr synapses, it does not necessarily explain differences in synaptic strength between inputs. Studying excitatory hippocampal CA1 synapses onto distinct interneuronal targets, they found that raising calcium entry at low-Pr inputs to high-Pr synapse levels is not sufficient to increase synaptic strength to high-Pr synapse levels. Similarly, at the Drosophila NMJ, the finding that type-Ib synapses exhibit loose calcium channel-synaptic vesicle coupling whereas type-Is synapses exhibit tight coupling suggests factors beyond calcium influx also contribute to differences in Pr between the two inputs (He et al., 2023). Consistently, a two-fold increase in external calcium does not induce a three-fold increase in release at low-Pr type-Ib synapses (He et al., 2023). Thus, upon finding that calcium channel abundance is similar at type-Ib and -Is synapses, we focused on identifying differences beyond calcium channel abundance and calcium influx that might contribute their distinct synaptic strengths. We agree that these studies, ours included, cannot definitively determine the contribution of identified organizational differences to distinct release probabilities because it is not currently possible to specifically alter subsynaptic organization, and will ensure that our language is tempered accordingly. However, in addition to the studies cited above and our findings, recent work demonstrating that homeostatic potentiation of neurotransmitter release is accompanied by greater spatial compaction of multiple active zone proteins (Dannhauser et al., 2022; Mrestani et al., 2021) and decreased calcium channel mobility (Ghelani et al., 2023) provide support for the interpretation that subsynaptic organization is a key parameter for modulating Pr.

Reviewer #2 (Public review):

The authors aim to investigate how voltage-gated calcium channel number, organization, and subunit composition lead to changes in synaptic activity at tonic and phasic motor neuron terminals, or type Is and Ib motor neurons in Drosophila. These neuron subtypes generate widely different physiological outputs, and many investigations have sought to understand the molecular underpinnings responsible for these differences. Additionally, these authors explore not only static differences that exist during the third-instar larval stage of development but also use a pharmacological approach to induce homeostatic plasticity to explore how these neuronal subtypes dynamically change the structural composition and organization of key synaptic proteins contributing to physiological plasticity. The Drosophila neuromuscular junction (NMJ) is glutamatergic, the main excitatory neurotransmitter in the human brain, so these findings not only expand our understanding of the molecular and physiological mechanisms responsible for differences in motor neuron subtype activity but also contribute to our understanding of how the human brain and nervous system functions.

The authors employ state-of-the-art tools and techniques such as single-molecule localization microscopy 3D STORM and create several novel transgenic animals using CRISPR to expand the molecular tools available for exploration of synaptic biology that will be of wide interest to the field. Additionally, the authors use a robust set of experimental approaches from active zone level resolution functional imaging from live preparations to electrophysiology and immunohistochemical analyses to explore and test their hypotheses. All data appear to be robustly acquired and analyzed using appropriate methodology. The authors make important advancements to our understanding of how the different motor neuron subtypes, phasic and tonic-like, exhibit widely varying electrical output despite the neuromuscular junctions having similar ultrastructural composition in the proteins of interest, voltage gated calcium channel cacophony (cac) and the scaffold protein Bruchpilot (brp). The authors reveal the ratio of brp:cac appears to be a critical determinant of release probability (Pr), and in particular, the packing density of VGCCs and availability of brp. Importantly, the authors demonstrate a brp-dependent increase in VGCC density following acute philanthotoxin perfusion (glutamate receptor inhibitor). This VGCC increase appears to be largely responsible for the presynaptic homeostatic plasticity (PHP) observable at the Drosophila NMJ. Lastly, the authors created several novel CRISPRtagged transgenic lines to visualize the spatial localization of VGCC subunits in Drosophila. Two of these lines, CaBV5-C and stjV5-N, express in motor neurons and in the nervous system, localize at the NMJ, and most strikingly, strongly correlate with Pr at tonic and phasic-like terminals.

(1) The few limitations in this study could be addressed with some commentary, a few minor follow-up analyses, or experiments. The authors use a postsynaptically expressed calcium indicator (mhcGal4>UAS -GCaMP) to calculate Pr, yet do not explore the contribution that glutamate receptors, or other postsynaptic contributors (e.g. components of the postsynaptic density, PSD) may contribute. A previous publication exploring tonic vs phasic-like activity at the Drosophila NMJ revealed a dynamic role for GluRII (Aponte-Santiago et al, 2020). Could the speed of GluR accumulation account for differences between neuron subtypes?

We did observe that GCaMP signals are higher at type Is synapses, where synapses tend to form later but GluRs accumulate more rapidly upon innervation (Aponte-Santiago et al., 2020). However, because we are using our GCaMP indicator as a plus/minus readout of synaptic vesicle release at mature synapses, we do not expect differences in GluR accumulation to have a significant effect on our measures. Consistently, the difference in Pr we observe between type-Ib and -Is inputs (Fig. 1C) is similar to that previously reported (He et al., 2023; Lu et al., 2016; Newman et al., 2022).

(2) The observation that calcium channel density and brp:cac ratio as a critical determinant of Pr is an important one. However, it is surprising that this was not observed in previous investigations of cac intensity (of which there are many). Is this purely a technical limitation of other investigations, or are other possibilities feasible? Additionally, regarding VGCC-SV coupling, the authors conclude that this packing density increases their proximity to SVs and contributes to the steeper relationship between VGCCs and Pr at phasic type Is. Is it possible that brp or other AZ components could account for these differences. The authors possess the tools to address this directly by labeling vesicles with JanellaFluor646; a stronger signal should be present at Is boutons. Additionally, many different studies have used transmission electron microscopy to explore SVs location to AZs (t-bars) at the Drosophila NMJ.

To date, the molecular underpinnings of heterogeneity in synaptic strength have primarily been investigated among individual type-Ib synapses. However, a recent study investigating differences between type-Ib and -Is synapses also found that the Cac:Brp ratio is higher at type-Is synapses (He et al., 2023).

At this point, we do not know which active zone components are responsible for the organizational (Figs. 1, 2) and coupling (now demonstrated by He et al., 2023) differences between type-Ib and -Is synapses or what establishes the differences in active zone protein levels we observe (Figs. 3,6), although Brp likely plays a local role. We find that Brp is required for dynamically regulating calcium channel levels during homeostatic plasticity and plays distinct roles at type-Ib and -Is synapses (Figs. 3, 4). Brp regulates a number of proteins critical for the distribution of docked synaptic vesicles near T bars of type Ib active zones, including Unc13 (Bohme et al., 2016). Extending these studies to type-Is synapses will be of great interest.

(3) In reference to the contradictory observations that VGCC intensity does not always correlate with, or determine Pr. Previous investigations have also observed other AZ proteins or interactors (e.g. synaptotagmin mutants) critically control release, even when the correlation between cac and release remains constant while Pr dramatically precipitates.

This is an important point as a number of molecular and organizational differences between high- and low-Pr synapses certainly contribute to baseline functional differences. The other proteins we (Figs. 3,6) and others (Dannhauser et al., 2022; Ehmann et al., 2014; He et al., 2023; Jetti et al., 2023; Mrestani et al., 2021; Newman et al., 2022) have investigated are less abundant and/or more densely organized at type-Is synapses. Investigating additional active zone proteins, including synaptic proteins, and determining how these factors combine to yield increased synaptic strength are important next steps.Thank you. We have corrected this error.

(4) To confirm the observations that lower brp levels results in a significantly higher cac:brp ratio at phasic-like synapses by organizing VGCCs; this argument could be made stronger by analyzing their existing data. By selecting a population of AZs in Ib boutons that endogenously express normal cac and lower brp levels, the Pr from these should be higher than those from within that population, but comparable to Is Pr. I believe the authors should also be able to correlate the cac:brp ratio with Pr from their data set generally; to determine if a strong correlation exists beyond their observation for cac correlation.

We do not have simultaneous measures of Pr and Cac and Brp abundance. However, our findings suggest that distinct Cac:Brp ratios at type Ib and Is inputs reflect underlying organizational differences that contribute to distinct release probabilities between the two synaptic subtypes. In contrast, within either synaptic subtype, release probability is positively correlated with both Cac and Brp levels. Thus, the mechanisms driving functional differences between synaptic subtypes are distinct from those driving functional heterogeneity within a subtype, so we do not expect Cac:Brp ratio to correlate with Pr among individual type-Ib synapses. We will work to clarify this point in the revised text.

(5) For the philanthotoxin induced changes in cac and brp localization underlying PHP, why do the authors not show cac accumulation after PhTx on live dissected preparations (i.e. in real time)? This also be an excellent opportunity to validate their brp:cac theory. Do the authors observe a dynamic change in brp:cac after 1, or 5 minutes; do Is boutons potentiate stronger due to proportional increases in cac and brp? Also regarding PhTx-induced PHP, their observations that stj and α2δ-3 are more abundant at Is synapses, suggests that they may also play a role in PhTx induced changes in cac. If either/both are overexpressed during PhTx, brp should increase while cac remains constant. These accessory proteins may determine cac incorporation at AZs.

As we have previously followed Cac accumulation in live dissected preparations and found that levels increase proportionally across individual synapses (Gratz et al., 2019), we did not attempt to repeat these challenging experiments at smaller type-Is synapses. We will reanalyze our data to investigate Cac:Brp ratio at individual active zones post PhTx. However, as noted above, we do not expect changes in the Cac:Brp ratio to correlate with Pr among individual synapses of single inputs as this measure reflects organization differences between inputs and PhTx induces an increase in the abundance of both proteins at both inputs.

Determining the effect of PhTx on Stj levels at type-Ib and -Is active zones is an excellent idea and might provide insight into how lower Stj levels correlate with higher Pr at type-Is synapses. While prior studies have demonstrated critical roles for Stj in regulating Cac accumulation during development and in promoting presynaptic homeostatic potentiation (Cunningham et al., 2022; Dickman et al., 2008; Kurshan et al., 2009; Ly et al., 2008; Wang et al., 2016), its regulation during PHP has not been investigated.

Taken together this study generates important data-driven, conceptional, and theoretical advancements in our understanding of the molecular underpinnings of different motor neurons, and our understanding of synaptic biology generally. The data are robust, thoroughly analyzed, appropriately depicted. This study not only generates novel findings but also generated novel molecular tools which will aid future investigations and investigators progress in this field.

References

Akbergenova, Y., K.L. Cunningham, Y.V. Zhang, S. Weiss, and J.T. Littleton. 2018. Characterization of developmental and molecular factors underlying release heterogeneity at Drosophila synapses. eLife. 7.

Aldahabi, M., F. Balint, N. Holderith, A. Lorincz, M. Reva, and Z. Nusser. 2022. Different priming states of synaptic vesicles underlie distinct release probabilities at hippocampal excitatory synapses. Neuron. 110:4144-4161 e4147.

Aponte-Santiago, N.A., K.G. Ormerod, Y. Akbergenova, and J.T. Littleton. 2020. Synaptic Plasticity Induced by Differential Manipulation of Tonic and Phasic Motoneurons in Drosophila. The Journal of neuroscience : the official journal of the Society for Neuroscience. 40:6270-6288.

Bohme, M.A., C. Beis, S. Reddy-Alla, E. Reynolds, M.M. Mampell, A.T. Grasskamp, J. Lutzkendorf, D.D. Bergeron, J.H. Driller, H. Babikir, F. Gottfert, I.M. Robinson, C.J. O'Kane, S.W. Hell, M.C. Wahl, U. Stelzl, B. Loll, A.M. Walter, and S.J. Sigrist. 2016. Active zone scaffolds differentially accumulate Unc13 isoforms to tune Ca(2+) channel-vesicle coupling. Nature neuroscience. 19:1311-1320.

Cunningham, K.L., C.W. Sauvola, S. Tavana, and J.T. Littleton. 2022. Regulation of presynaptic Ca(2+) channel abundance at active zones through a balance of delivery and turnover. Elife. 11.

Dannhauser, S., A. Mrestani, F. Gundelach, M. Pauli, F. Komma, P. Kollmannsberger, M. Sauer, M. Heckmann, and M.M. Paul. 2022. Endogenous tagging of Unc-13 reveals nanoscale reorganization at active zones during presynaptic homeostatic potentiation. Front Cell Neurosci. 16:1074304.

Dickman, D.K., P.T. Kurshan, and T.L. Schwarz. 2008. Mutations in a Drosophila alpha2delta voltage gated calcium channel subunit reveal a crucial synaptic function. The Journal of neuroscience : the official journal of the Society for Neuroscience. 28:31-38.

Ehmann, N., S. Van De Linde, A. Alon, D. Ljaschenko, X.Z. Keung, T. Holm, A. Rings, A. Diantonio, S. Hallermann, U. Ashery, M. Heckmann, M. Sauer, and R.J. Kittel. 2014. Quantitative super-resolution imaging of Bruchpilot distinguishes active zonestates. Nature Communications. 5.

Ghelani, T., M. Escher, U. Thomas, K. Esch, J. Lützkendorf, H. Depner, M. Maglione, P. Parutto, S. Gratz, T. Matkovic-Rachid, S. Ryglewski, A.M. Walter, D. Holcman, K. O‘Connor Giles, M. Heine, and S.J. Sigrist. 2023. Interactive nanocluster compaction of the ELKS scaffold and Cacophony Ca2+ channels drives sustained active zone potentiation. Science Advances. 9:eade7804.

Gratz, S.J., P. Goel, J.J. Bruckner, R.X. Hernandez, K. Khateeb, G.T. Macleod, D. Dickman, and K.M. O'Connor-Giles. 2019. Endogenous tagging reveals differential regulation of Ca2+ channels at single AZs during presynaptic homeostatic potentiation and depression. The Journal of Neuroscience:3068-3018.

He, K., Y. Han, X. Li, R.X. Hernandez, D.V. Riboul, T. Feghhi, K.A. Justs, O. Mahneva, S. Perry, G.T. Macleod, and D. Dickman. 2023. Physiologic and Nanoscale Distinctions Define Glutamatergic Synapses in Tonic vs Phasic Neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience. 43:4598-4611.

Holderith, N., A. Lorincz, G. Katona, B. Rózsa, A. Kulik, M. Watanabe, and Z. Nusser. 2012. Release probability of hippocampal glutamatergic terminals scales with the size of the active zone. Nature neuroscience. 15:988-997.

Jetti, S.K., A.B. Crane, Y. Akbergenova, N.A. Aponte-Santiago, K.L. Cunningham, C.A. Whittaker, and J.T. Littleton. 2023. Molecular Logic of Synaptic Diversity Between Drosophila Tonic and Phasic Motoneurons. bioRxiv:2023.2001.2017.524447.

Kurshan, P.T., A. Oztan, and T.L. Schwarz. 2009. Presynaptic alpha2delta-3 is required for synaptic morphogenesis independent of its Ca2+-channel functions. Nature neuroscience. 12:1415-1423.

Lu, Z., A.K. Chouhan, J.A. Borycz, Z. Lu, A.J. Rossano, K.L. Brain, Y. Zhou, I.A. Meinertzhagen, and G.T. Macleod. 2016. High-Probability Neurotransmitter Release Sites Represent an Energy-Efficient Design. Current biology : CB. 26:2562-2571.

Ly , C.V., C.-K. Yao , P. Verstreken , T. Ohyama , and H.J. Bellen 2008. straightjacket is required for the synaptic stabilization of cacophony, a voltage-gated calcium channel α1 subunit. Journal of Cell Biology. 181:157-170.

Mrestani, A., M. Pauli, P. Kollmannsberger, F. Repp, R.J. Kittel, J. Eilers, S. Doose, M. Sauer, A.-L. Sirén, M. Heckmann, and M.M. Paul. 2021. Active zone compaction correlates with presynaptic homeostatic potentiation. Cell Reports. 37:109770.

Nakamura, Y., H. Harada, N. Kamasawa, K. Matsui, Jason S. Rothman, R. Shigemoto, R.A. Silver, David A. DiGregorio, and T. Takahashi. 2015. Nanoscale Distribution of Presynaptic Ca2+ Channels and Its Impact on Vesicular Release during Development. Neuron. 85:145-158.

Newman, Z.L., D. Bakshinskaya, R. Schultz, S.J. Kenny, S. Moon, K. Aghi, C. Stanley, N. Marnani, R. Li, J. Bleier, K. Xu, and E.Y. Isacoff. 2022. Determinants of synapse diversity revealed by superresolution quantal transmission and active zone imaging. Nature Communications. 13:229.

Rebola, N., M. Reva, T. Kirizs, M. Szoboszlay, A. Lőrincz, G. Moneron, Z. Nusser, and D.A. Digregorio. 2019. Distinct Nanoscale Calcium Channel and Synaptic Vesicle Topographies Contribute to the Diversity of Synaptic Function. Neuron. 104:693-710.e699.

Sheng, J., L. He, H. Zheng, L. Xue, F. Luo, W. Shin, T. Sun, T. Kuner, D.T. Yue, and L.-G. Wu. 2012. Calcium-channel number critically influences synaptic strength and plasticity at the active zone. Nature neuroscience. 15:998-1006.

Wang, T., R.T. Jones, J.M. Whippen, and G.W. Davis. 2016. alpha2delta-3 Is Required for Rapid Transsynaptic Homeostatic Signaling. Cell Rep. 16:2875-2888.

Reviewer #1 (Recommendations For The Authors):

Major points:

(1) A central question regarding VGCC differences at Is vs Ib active zones is why is calcium influx higher at Is active zones compared to Ib. Ideally, the authors would have started this study by showing correlations between Cac abundance, presynaptic calcium influx, and Pr at Is vs Ib active zones. If they had, they would likely find that Cac abundance scales with calcium influx and Pr within Is vs Ib, but that calcium influx is over two-fold enhanced at Is over Ib when normalized to the same Cac abundance. This is more than sufficient to explain the Pr differences, so the rest of the study should have focused on revealing why influx is different at Is over Ib despite an apparently similar level of Cac abundance. Then the examination of CaBeta, Stj, etc could have been used to help explain this conundrum

A lesson might be gleaned in how to structure this narrative from the Rebola 2019 study, which the authors cite and discuss at length. Similar to the current study, that paper started with two synapses ("strong" vs "weak") and sought to explain why they were so different in synaptic strength. First, they examined presynaptic calcium influx, and surprisingly found that the strong synapse had reduced calcium influx compared to the weak. Then the rest of the paper sought to explain why synaptic strength (Pr) was higher at the strong synapse despite reduced calcium influx. The authors do not use this logical flow and narrative in the present study, despite the focus being on how Cav2 channels contribute to strong vs weak synapses - and the primary function of Cav2 channels is to pass calcium at active zones to drive vesicle fusion.

Although the authors did not show that presynaptic calcium influx is higher at Is vs Ib active zones in the current manuscript, other studies have previously established that calcium influx is two-fold higher at Is active zones vs Ib (as the authors cite). Rather than focusing so much on Pr at Is vs Ib active zones, which as the authors know can be influenced by myriad differences, it seems the more relevant parameter to study is simply to address presynaptic calcium influx at Is vs Ib, which is the primary function of Cac. Put more simply, if Cac levels are the same at Is vs Ib active zones, why is calcium influx at least two-fold higher at Is?

It would therefore seem crucial for the authors to determine presynaptic calcium influx levels (ideally at individual AZs) to really understand how Cac intensity levels correlate with calcium influx. The authors instead map Pr at individual AZs, but as the authors know there are many variables that influence whether a SV releases in addition to calcium influx. There are a number of options for this kind of imaging in Drosophila, including genetically encoded calcium indicators targeted to active zones. But since several studies have previously established that influx is higher at Is active zones over Ib, this may not be necessary. That being said, there is a lot of value in quantitatively analyzing Cac/Stj/CaBeta abundance, calcium influx, and Pr together at individual active zones.

We appreciate the perspective that we could have focused on why Ca2+ influx is 2x greater at type Is active zones, which we agree is an important and interesting question. However, growing evidence indicates that Ca2+ influx alone, like Ca2+ channel abundance, does not reliably predict synaptic strength between inputs. So, here we focused instead on how other differences between synapses influence Pr and contribute to synaptic heterogeneity between and/or among synapses formed by strong and weak inputs. We have changed our title and framing to better reflect this focus.

As Reviewer 1 notes, Rebola et al. (2019) found that lower Pr granule synapses exhibit higher Ca2+ influx (and Ca2+ channel abundance). In another example, Aldahabi et al. (2022) demonstrated that even when Ca2+ influx is greater at high-Pr synapses, it does not necessarily explain differences in synaptic strength as raising Ca2+ entry at low-Pr synapses to high-Pr synapse levels was not sufficient to increase synaptic strength to high-Pr input levels. Similar findings have been reported at tonic and phasic synapses of the Crayfish NMJ (Msghina, 1999).

Several lines of evidence argue that factors beyond Ca2+ influx also play important roles in establishing distinct release properties at the Drosophila NMJ. A recent study using using a botulinum transgene to isolate type Ib and Is synapses for electrophysiological analysis found that increasing external [Ca2+] from physiological levels (1.8 mM) to 3 mM or even 6 mM does not result in a 3-fold increase in EPSCs or quantal content at type Ib synapses despite the prediction that the increase would be even greater given the power dependence of release on between Ca2+ concentration (He et al., 2023). The authors further found that type Ib synapses are more sensitive than type Is synapses to the slow Ca2+ chelator EGTA, indicating looser Ca2+ channel-SV coupling.

Consistently, we find that although VGCC levels are similar at the two inputs, their density is greater at type Is active zones (Figs. 1 and 2). Our findings also reveal additional molecular differences that may contribute to the observed differences in neurotransmitter release properties between the two inputs, including lower levels of the active zone protein Brp (Fig 3) and the auxiliary subunit α2δ-3/Stj (Fig. 6) at high Pr type Is inputs. In contrast, levels of each of these proteins positively correlate with synaptic strength among active zones of a single input, whether low- or high-Pr (Figs. 1, 3, 6). Similarly, levels of each of these proteins increase during homeostatic potentiation of neurotransmitter release (Figs. 4 and 7). Thus, we propose that two broad mechanisms contribute to synaptic diversity in the nervous system: (1) spatial organization and relative molecular content establish distinct average basal release probabilities that differ between inputs and (2) among individual synapses of distinct inputs, coordinated modulation of Ca2+ channel and active zone protein abundance independently tunes Pr. These intersecting mechanisms provide a framework for understanding the extensive and dynamic synaptic diversity observed across nervous systems.

(2) In addition to key points made above, it seems the authors should at least consider (if not experimentally test) what other differences might contribute to the higher calcium influx at Is over Ib:

- Distinct splice isoforms of Cac (and/or Stj/Cabeta): The recent RNAseq analysis of gene expression at Is vs Ib motor neurons from Troy Littleton's group may inform this consideration?

- Stj reduction at Is: Do channel studies in heterologous systems give any insight into VGCC channel function with and without a2d-3? Do Cav2 channels without a2d pass more calcium? This would then offer an obvious solution to the key conundrum underlying this study.

These are excellent questions that we are actively pursuing. While there is no evidence of differentially expressed splice isoforms of Stj or Ca-β in the recent RNA-seq data from Jetti et al., 2023, subtle changes in Cac isoform usage were observed that may contribute to differences in Ca2+ influx. In heterologous systems, α2δ expression generally increases Ca2+ channel membrane insertion and Ca2+ currents. However, in vivo α2δ’s can also mediate extracellular interactions that may modulate channel function. We address these points in greater detail in the revised discussion.

(3) Assess Stj and CaBeta levels at AZs after PhTx: The successful generation of endogenously tagged Stj and CaBeta enables some relatively easy experiments that would be of interest, similar to what the authors present for Cac. Does Brp similarly control Stj and CaBeta at Is vs Ib compared to what they show for Cac? In addition, does homeostatic plasticity similarly change Stj and CaBeta at Is vs Ib compared to what the authors have shown for Cac? i.e., do they both similarly increase in intensity, by the same amount, as Cac?

We agree and have included an analysis of α2δ-3/Stj levels following PhTx exposure (Fig. 7A-C). We have also investigated the regulation of Stj during chronic presynaptic homeostatic potentiation (Fig. 7D-F). In both cases, StjV5-N levels significantly increase at type Ib and Is active zones, consistent with our finding that among AZs of either type Ib or Is inputs, Stj levels correlate with Cac abundance and, thus, Pr. Together with our and others’ findings, this suggests that coordinated increases Ca2+ channel, auxiliary subunit, and active zone protein abundance positively tunes synaptic strength at diverse synaptic subtypes.

Minor points:

(1) Including line numbers would make reviewing/commenting easier.

We apologize for this oversight and have added line numbers to the revised manuscript.

(2) Fig. 2I: It is not apparent what the mean cluster density is between Ib vs Is (as it is in Fig. 2F-H graphs). The mean and error bars should be included in 2I as it is in 2G. Same with Fig. 3C.

Thank you for pointing this out. We have added error bars to the paired analysis in 2I as well as in 3C and 1C.

(3) Fig. 4 - it might make more sense to normalize Brp and Cac intensity as a percentage of baseline (PhTx at Is or Ib) rather than normalizing everything to control Ib.

We have revised the graphs as suggested in Figure 4 and throughout.

(4) Page 5 bottom - REFS missing after Fig. 1E.

Thank you for catching this. We have fixed it.

Reviewer #2 (Recommendations For The Authors):

This reader found differentiating between low Pr sites (deep purple) and cac measurements (black) difficult in Fig 1B. You may consider depicting this differently.

Thank you for this feedback. We have changed the color scheme to improve readability.

I found it difficult to discern the difference between experiments Fig 1E and Fig 1J. Why are individual dots distributed differently?

The individual data points are the same as in 1E and 1F, but we have removed the individual NMJ dimensionality to combine all Is and Ib data points together along with best fit lines for comparison of their slopes. We have added text to the revised manuscript to clarify this.

Results section, second paragraph, add references, remove 'REF': We next investigated the correlation between Pr and VGCC levels and found that at type Is inputs, single-AZ Cac intensity positively correlates with Pr (Fig. 1E; REFS).

Thank you. We have corrected this error.

No competing interests declared.

Conceptualization, Resources, Data curation, Software, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Data curation, Formal analysis, Investigation, Writing – review and editing.

Software, Formal analysis, Methodology, Writing – review and editing.

Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing.
==== Refs
References

Akbergenova Y Cunningham KL Zhang YV Weiss S Littleton JT 2018 Characterization of developmental and molecular factors underlying release heterogeneity at Drosophila synapses eLife 7 e38268 10.7554/eLife.38268 29989549
Aldahabi M Balint F Holderith N Lorincz A Reva M Nusser Z 2022 Different priming states of synaptic vesicles underlie distinct release probabilities at hippocampal excitatory synapses Neuron 110 4144 4161 10.1016/j.neuron.2022.09.035 36261033
Aponte-Santiago NA Littleton JT 2020 Synaptic properties and plasticity mechanisms of invertebrate tonic and phasic neurons Frontiers in Physiology 11 611982 10.3389/fphys.2020.611982 33391026
Aponte-Santiago NA Ormerod KG Akbergenova Y Littleton JT 2020 Synaptic plasticity induced by differential manipulation of tonic and phasic motoneurons in Drosophila The Journal of Neuroscience 40 6270 6288 10.1523/JNEUROSCI.0925-20.2020 32631939
Ariel P Hoppa MB Ryan TA 2012 Intrinsic variability in Pv, RRP size, Ca(2+) channel repertoire, and presynaptic potentiation in individual synaptic boutons Frontiers in Synaptic Neuroscience 4 9 10.3389/fnsyn.2012.00009 23335896
Atwood HL Govind CK Wu CF 1993 Differential ultrastructure of synaptic terminals on ventral longitudinal abdominal muscles in Drosophila larvae Journal of Neurobiology 24 1008 1024 10.1002/neu.480240803 8409966
Atwood HL Karunanithi S 2002 Diversification of synaptic strength: presynaptic elements Nature Reviews. Neuroscience 3 497 516 10.1038/nrn876 12094207
Bauer CS Tran-Van-Minh A Kadurin I Dolphin AC 2010 A new look at calcium channel alpha2delta subunits Current Opinion in Neurobiology 20 563 571 10.1016/j.conb.2010.05.007 20579869
Böhme MA Beis C Reddy-Alla S Reynolds E Mampell MM Grasskamp AT Lützkendorf J Bergeron DD Driller JH Babikir H Göttfert F Robinson IM O’Kane CJ Hell SW Wahl MC Stelzl U Loll B Walter AM Sigrist SJ 2016 Active zone scaffolds differentially accumulate Unc13 isoforms to tune Ca(2+) channel-vesicle coupling Nature Neuroscience 19 1311 1320 10.1038/nn.4364 27526206
Böhme MA McCarthy AW Grasskamp AT Beuschel CB Goel P Jusyte M Laber D Huang S Rey U Petzoldt AG Lehmann M Göttfert F Haghighi P Hell SW Owald D Dickman D Sigrist SJ Walter AM 2019 Rapid active zone remodeling consolidates presynaptic potentiation Nature Communications 10 1085 10.1038/s41467-019-08977-6 30842428
Branco T Staras K 2009 The probability of neurotransmitter release: variability and feedback control at single synapses Nature Reviews. Neuroscience 10 373 383 10.1038/nrn2634 19377502
Bruckner JJ Zhan H Gratz SJ Rao M Ukken F Zilberg G O’Connor-Giles KM 2017 Fife organizes synaptic vesicles and calcium channels for high-probability neurotransmitter release The Journal of Cell Biology 216 231 246 10.1083/jcb.201601098 27998991
Campiglio M Flucher BE 2015 The role of auxiliary subunits for the functional diversity of voltage-gated calcium channels Journal of Cellular Physiology 230 2019 2031 10.1002/jcp.24998 25820299
Cao Y-Q Piedras-Rentería ES Smith GB Chen G Harata NC Tsien RW 2004 Presynaptic Ca2+ channels compete for channel type-preferring slots in altered neurotransmission arising from Ca2+ channelopathy Neuron 43 387 400 10.1016/j.neuron.2004.07.014 15294146
Cassidy JS Ferron L Kadurin I Pratt WS Dolphin AC 2014 Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary α2δ-1 subunits PNAS 111 8979 8984 10.1073/pnas.1403731111 24889613
Chen Z Das B Nakamura Y DiGregorio DA Young SM 2015 Ca2+ channel to synaptic vesicle distance accounts for the readily releasable pool kinetics at a functionally mature auditory synapse The Journal of Neuroscience 35 2083 2100 10.1523/JNEUROSCI.2753-14.2015 25653365
Cingolani LA Thalhammer A Jaudon F Muià J Baj G 2023 Nanoscale organization of CaV2.1 splice isoforms at presynaptic terminals: implications for synaptic vesicle release and synaptic facilitation Biological Chemistry 404 931 937 10.1515/hsz-2023-0235 37658578
Cunningham KL Sauvola CW Tavana S Littleton JT 2022 Regulation of presynaptic Ca2+ channel abundance at active zones through a balance of delivery and turnover eLife 11 78648 10.7554/eLife.78648 35833625
Dai Y Taru H Deken SL Grill B Ackley B Nonet ML Jin Y 2006 SYD-2 Liprin-alpha organizes presynaptic active zone formation through ELKS Nature Neuroscience 9 1479 1487 10.1038/nn1808 17115037
Dannhäuser S Mrestani A Gundelach F Pauli M Komma F Kollmannsberger P Sauer M Heckmann M Paul MM 2022 Endogenous tagging of Unc-13 reveals nanoscale reorganization at active zones during presynaptic homeostatic potentiation Frontiers in Cellular Neuroscience 16 1074304 10.3389/fncel.2022.1074304 36589286
Davis GW Müller M 2015 Homeostatic control of presynaptic neurotransmitter release Annual Review of Physiology 77 251 270 10.1146/annurev-physiol-021014-071740 25386989
Dickman DK Kurshan PT Schwarz TL 2008 Mutations in a Drosophila alpha2delta voltage-gated calcium channel subunit reveal a crucial synaptic function The Journal of Neuroscience 28 31 38 10.1523/JNEUROSCI.4498-07.2008 18171920
Dolphin AC 2018 Voltage-gated calcium channel α2δ subunits: an assessment of proposed novel roles F1000Research 7 1830 10.12688/f1000research.16104.1
Dolphin AC Lee A 2020 Presynaptic calcium channels: specialized control of synaptic neurotransmitter release Nature Reviews. Neuroscience 21 213 229 10.1038/s41583-020-0278-2 32161339
Dong W Radulovic T Goral RO Thomas C Suarez Montesinos M Guerrero-Given D Hagiwara A Putzke T Hida Y Abe M Sakimura K Kamasawa N Ohtsuka T Young SM 2018 CAST/ELKS proteins control voltage-gated Ca2+ channel density and synaptic release probability at a mammalian central synapse Cell Reports 24 284 293 10.1016/j.celrep.2018.06.024 29996090
Eggermann E Bucurenciu I Goswami SP Jonas P 2011 Nanodomain coupling between Ca²⁺ channels and sensors of exocytosis at fast mammalian synapses Nature Reviews. Neuroscience 13 7 21 10.1038/nrn3125 22183436
Ehmann N van de Linde S Alon A Ljaschenko D Keung XZ Holm T Rings A DiAntonio A Hallermann S Ashery U Heckmann M Sauer M Kittel RJ 2014 Quantitative super-resolution imaging of Bruchpilot distinguishes active zone states Nature Communications 5 4650 10.1038/ncomms5650 25130366
Fedchyshyn MJ Wang LY 2005 Developmental transformation of the release modality at the calyx of Held synapse The Journal of Neuroscience 25 4131 4140 10.1523/JNEUROSCI.0350-05.2005 15843616
Fekete A Nakamura Y Yang YM Herlitze S Mark MD DiGregorio DA Wang LY 2019 Underpinning heterogeneity in synaptic transmission by presynaptic ensembles of distinct morphological modules Nature Communications 10 826 10.1038/s41467-019-08452-2 30778063
Fouquet W Owald D Wichmann C Mertel S Depner H Dyba M Hallermann S Kittel RJ Eimer S Sigrist SJ 2009 Maturation of active zone assembly by Drosophila Bruchpilot The Journal of Cell Biology 186 129 145 10.1083/jcb.200812150 19596851
Frank CA Kennedy MJ Goold CP Marek KW Davis GW 2006 Mechanisms underlying the rapid induction and sustained expression of synaptic homeostasis Neuron 52 663 677 10.1016/j.neuron.2006.09.029 17114050
Frank CA 2014 Homeostatic plasticity at the Drosophila neuromuscular junction Neuropharmacology 78 63 74 10.1016/j.neuropharm.2013.06.015 23806804
Früh SM Matti U Spycher PR Rubini M Lickert S Schlichthaerle T Jungmann R Vogel V Ries J Schoen I 2021 Site-specifically-labeled antibodies for super-resolution microscopy reveal in situ linkage errors ACS Nano 15 12161 12170 10.1021/acsnano.1c03677 34184536
Fulterer A Andlauer TFM Ender A Maglione M Eyring K Woitkuhn J Lehmann M Matkovic-Rachid T Geiger JRP Walter AM Nagel KI Sigrist SJ 2018 Active zone scaffold protein ratios tune functional diversity across brain synapses Cell Reports 23 1259 1274 10.1016/j.celrep.2018.03.126 29719243
Genç Ö Davis GW 2019 Target-wide induction and synapse type-specific robustness of presynaptic homeostasis Current Biology 29 3863 3873 10.1016/j.cub.2019.09.036 31708391
Ghelani T Escher M Thomas U Esch K Lützkendorf J Depner H Maglione M Parutto P Gratz S Matkovic-Rachid T Ryglewski S Walter AM Holcman D O’Connor Giles K Heine M Sigrist SJ 2023 Interactive nanocluster compaction of the ELKS scaffold and Cacophony Ca2+ channels drives sustained active zone potentiation Science Advances 9 eade7804 10.1126/sciadv.ade7804 36800417
Gratz SJ Ukken FP Rubinstein CD Thiede G Donohue LK Cummings AM O’Connor-Giles KM 2014 Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila Genetics 196 961 971 10.1534/genetics.113.160713 24478335
Gratz SJ Goel P Bruckner JJ Hernandez RX Khateeb K Macleod GT Dickman D O’Connor-Giles KM 2019 Endogenous tagging reveals differential regulation of Ca2+ channels at single active zones during presynaptic homeostatic potentiation and depression The Journal of Neuroscience 39 2416 2429 10.1523/JNEUROSCI.3068-18.2019 30692227
Grimm JB English BP Chen J Slaughter JP Zhang Z Revyakin A Patel R Macklin JJ Normanno D Singer RH Lionnet T Lavis LD 2015 A general method to improve fluorophores for live-cell and single-molecule microscopy Nature Methods 12 244 250 10.1038/nmeth.3256 25599551
Guerrero G Reiff DF Agarwal G Ball RW Borst A Goodman CS Isacoff EY 2005 Heterogeneity in synaptic transmission along a Drosophila larval motor axon Nature Neuroscience 8 1188 1196 10.1038/nn1526 16116446
Hallermann S Kittel RJ Wichmann C Weyhersmüller A Fouquet W Mertel S Owald D Eimer S Depner H Schwärzel M Sigrist SJ Heckmann M 2010 Naked dense bodies provoke depression The Journal of Neuroscience 30 14340 14345 10.1523/JNEUROSCI.2495-10.2010 20980589
Hatt H Smith DO 1976 Non-uniform probabilities of quantal release at the crayfish neuromuscular junction The Journal of Physiology 259 395 404 10.1113/jphysiol.1976.sp011472 8636
He Y Dupree J Wang J Sandoval J Li J Liu H Shi Y Nave KA Casaccia-Bonnefil P 2007 Crucial role of Drosophila neurexin in proper active zone apposition to postsynaptic densities, synaptic growth, and synaptic transmission Neuron 55 217 230 10.1016/j.neuron.2007.06.029 17640524
He K Han Y Li X Hernandez RX Riboul DV Feghhi T Justs KA Mahneva O Perry S Macleod GT Dickman D 2023 Physiologic and nanoscale distinctions define glutamatergic synapses in tonic vs phasic neurons The Journal of Neuroscience 43 4598 4611 10.1523/JNEUROSCI.0046-23.2023 37221096
Heinrich L Ryglewski S 2020 Different functions of two putative Drosophila α2δ subunits in the same identified motoneurons Scientific Reports 10 13670 10.1038/s41598-020-69748-8 32792569
Held RG Liu C Kaeser PS 2016 ELKS controls the pool of readily releasable vesicles at excitatory synapses through its N-terminal coiled-coil domains eLife 5 e14862 10.7554/eLife.14862 27253063
Holderith N Lorincz A Katona G Rózsa B Kulik A Watanabe M Nusser Z 2012 Release probability of hippocampal glutamatergic terminals scales with the size of the active zone Nature Neuroscience 15 988 997 10.1038/nn.3137 22683683
Hoover KM Gratz SJ Qi N Herrmann KA Liu Y Perry-Richardson JJ Vanderzalm PJ O’Connor-Giles KM Broihier HT 2019 The calcium channel subunit α2δ-3 organizes synapses via an activity-dependent and autocrine BMP signaling pathway Nature Communications 10 5575 10.1038/s41467-019-13165-7 31811118
Hoppa MB Lana B Margas W Dolphin AC Ryan TA 2012 α2δ expression sets presynaptic calcium channel abundance and release probability Nature 486 122 125 10.1038/nature11033 22678293
Horn C Offen N Nystedt S Häcker U Wimmer EA 2003 piggyBac-based insertional mutagenesis and enhancer detection as a tool for functional insect genomics Genetics 163 647 661 10.1093/genetics/163.2.647 12618403
James TD Zwiefelhofer DJ Frank CA 2019 Maintenance of homeostatic plasticity at the Drosophila neuromuscular synapse requires continuous IP(3)-directed signaling eLife 08 e39643 10.7554/eLife.39643
Jetti SK Crane AB Akbergenova Y Aponte-Santiago NA Cunningham KL Whittaker CA Littleton JT 2023 Molecular logic of synaptic diversity between Drosophila tonic and phasic motoneurons Neuron 111 3554 3569 10.1016/j.neuron.2023.07.019 37611584
Kanamori T Kanai MI Dairyo Y Yasunaga K Morikawa RK Emoto K 2013 Compartmentalized calcium transients trigger dendrite pruning in Drosophila sensory neurons Science 340 1475 1478 10.1126/science.1234879 23722427
Kawasaki F Felling R Ordway RW 2000 A temperature-sensitive paralytic mutant defines A primary synaptic calcium channel in Drosophila The Journal of Neuroscience 20 4885 4889 10.1523/JNEUROSCI.20-13-04885.2000 10864946
Kittel RJ Wichmann C Rasse TM Fouquet W Schmidt M Schmid A Wagh DA Pawlu C Kellner RR Willig KI Hell SW Buchner E Heckmann M Sigrist SJ 2006 Bruchpilot promotes active zone assembly, Ca2+ channel clustering, and vesicle release Science 312 1051 1054 10.1126/science.1126308 16614170
Kurdyak P Atwood HL Stewart BA Wu CF 1994 Differential physiology and morphology of motor axons to ventral longitudinal muscles in larval Drosophila The Journal of Comparative Neurology 350 463 472 10.1002/cne.903500310 7884051
Kurshan PT Oztan A Schwarz TL 2009 Presynaptic alpha2delta-3 is required for synaptic morphogenesis independent of its Ca2+-channel functions Nature Neuroscience 12 1415 1423 10.1038/nn.2417 19820706
Laghaei R Ma J Tarr TB Homan AE Kelly L Tilvawala MS Vuocolo BS Rajasekaran HP Meriney SD Dittrich M 2018 Transmitter release site organization can predict synaptic function at the neuromuscular junction Journal of Neurophysiology 119 1340 1355 10.1152/jn.00168.2017 29357458
Li X Goel P Wondolowski J Paluch J Dickman D 2018 A glutamate homeostat controls the presynaptic inhibition of neurotransmitter release Cell Reports 23 1716 1727 10.1016/j.celrep.2018.03.130 29742428
Lipscombe D Andrade A Allen SE 2013 Alternative splicing: functional diversity among voltage-gated calcium channels and behavioral consequences Biochimica et Biophysica Acta 1828 1522 1529 10.1016/j.bbamem.2012.09.018 23022282
Lipscombe D Lopez Soto EJ 2019 Alternative splicing of neuronal genes: new mechanisms and new therapies Current Opinion in Neurobiology 57 26 31 10.1016/j.conb.2018.12.013 30703685
Littleton JT Ganetzky B 2000 Ion channels and synaptic organization Neuron 26 35 43 10.1016/S0896-6273(00)81135-6 10798390
Liu KSY Siebert M Mertel S Knoche E Wegener S Wichmann C Matkovic T Muhammad K Depner H Mettke C Bückers J Hell SW Müller M Davis GW Schmitz D Sigrist SJ 2011 RIM-binding protein, a central part of the active zone, is essential for neurotransmitter release Science 334 1565 1569 10.1126/science.1212991 22174254
Liu C Bickford LS Held RG Nyitrai H Südhof TC Kaeser PS 2014 The active zone protein family ELKS supports Ca2+ influx at nerve terminals of inhibitory hippocampal neurons The Journal of Neuroscience 34 12289 12303 10.1523/JNEUROSCI.0999-14.2014 25209271
Liu S Hoess P Ries J 2022 Super-resolution microscopy for structural cell biology Annual Review of Biophysics 51 301 326 10.1146/annurev-biophys-102521-112912 35119945
Lnenicka GA Keshishian H 2000 Identified motor terminals in Drosophila larvae show distinct differences in morphology and physiology Journal of Neurobiology 43 186 197 10770847
Los GV Encell LP McDougall MG Hartzell DD Karassina N Zimprich C Wood MG Learish R Ohana RF Urh M Simpson D Mendez J Zimmerman K Otto P Vidugiris G Zhu J Darzins A Klaubert DH Bulleit RF Wood KV 2008 HaloTag: a novel protein labeling technology for cell imaging and protein analysis ACS Chemical Biology 3 373 382 10.1021/cb800025k 18533659
Lu Z Chouhan AK Borycz JA Lu Z Rossano AJ Brain KL Zhou Y Meinertzhagen IA Macleod GT 2016 High-probability neurotransmitter release sites represent an energy-efficient design Current Biology 26 2562 2571 10.1016/j.cub.2016.07.032 27593375
Ly CV Yao C-K Verstreken P Ohyama T Bellen HJ 2008 straightjacket is required for the synaptic stabilization of cacophony, a voltage-gated calcium channel alpha1 subunit The Journal of Cell Biology 181 157 170 10.1083/jcb.200712152 18391075
Macleod GT Chen L Karunanithi S Peloquin JB Atwood HL McRory JE Zamponi GW Charlton MP 2006 The Drosophila cacts2 mutation reduces presynaptic Ca2+ entry and defines an important element in Cav2.1 channel inactivation The European Journal of Neuroscience 23 3230 3244 10.1111/j.1460-9568.2006.04873.x 16820014
McDonald NA Fetter RD Shen K 2020 Assembly of synaptic active zones requires phase separation of scaffold molecules Nature 588 454 458 10.1038/s41586-020-2942-0 33208945
Medeiros AT O’Connor-Giles K 2023 To Ib or not to b: Transcriptional regulation of tonic type Ib vs. phasic type Is motor neurons Neuron 111 3497 3499 10.1016/j.neuron.2023.10.033 37972561
Melom JE Akbergenova Y Gavornik JP Littleton JT 2013 Spontaneous and evoked release are independently regulated at individual active zones The Journal of Neuroscience 33 17253 17263 10.1523/JNEUROSCI.3334-13.2013 24174659
Miki T Kaufmann WA Malagon G Gomez L Tabuchi K Watanabe M Shigemoto R Marty A 2017 Numbers of presynaptic Ca2+ channel clusters match those of functionally defined vesicular docking sites in single central synapses PNAS 114 E5246 E5255 10.1073/pnas.1704470114 28607047
Mrestani A Pauli M Kollmannsberger P Repp F Kittel RJ Eilers J Doose S Sauer M Sirén A-L Heckmann M Paul MM 2021 Active zone compaction correlates with presynaptic homeostatic potentiation Cell Reports 37 109770 10.1016/j.celrep.2021.109770 34610300
Msghina M Millar AG Charlton MP Govind CK Atwood HL 1999 Calcium entry related to active zones and differences in transmitter release at phasic and tonic synapses The Journal of Neuroscience 19 8419 8434 10.1523/JNEUROSCI.19-19-08419.1999 10493743
Muhammad K Reddy-Alla S Driller JH Schreiner D Rey U Böhme MA Hollmann C Ramesh N Depner H Lützkendorf J Matkovic T Götz T Bergeron DD Schmoranzer J Goettfert F Holt M Wahl MC Hell SW Scheiffele P Walter AM Loll B Sigrist SJ 2015 Presynaptic spinophilin tunes neurexin signalling to control active zone architecture and function Nature Communications 6 8362 10.1038/ncomms9362 26471740
Müller CS Haupt A Bildl W Schindler J Knaus H-G Meissner M Rammner B Striessnig J Flockerzi V Fakler B Schulte U 2010 Quantitative proteomics of the Cav2 channel nano-environments in the mammalian brain PNAS 107 14950 14957 10.1073/pnas.1005940107 20668236
Nakamura Y Harada H Kamasawa N Matsui K Rothman JS Shigemoto R Silver RA DiGregorio DA Takahashi T 2015 Nanoscale distribution of presynaptic Ca(2+) channels and its impact on vesicular release during development Neuron 85 145 158 10.1016/j.neuron.2014.11.019 25533484
Newman ZL Hoagland A Aghi K Worden K Levy SL Son JH Lee LP Isacoff EY 2017 Input-specific plasticity and homeostasis at the Drosophila larval neuromuscular junction Neuron 93 1388 1404 10.1016/j.neuron.2017.02.028 28285823
Newman ZL Bakshinskaya D Schultz R Kenny SJ Moon S Aghi K Stanley C Marnani N Li R Bleier J Xu K Isacoff EY 2022 Determinants of synapse diversity revealed by super-resolution quantal transmission and active zone imaging Nature Communications 13 229 10.1038/s41467-021-27815-2 35017509
Oh KH Xiong A Choe J-Y Richmond JE Kim H 2023 Active zone trafficking of CaV2/UNC-2 channels is independent of β/CCB-1 and α2δ/UNC-36 Subunits The Journal of Neuroscience 43 5142 5157 10.1523/JNEUROSCI.2264-22.2023 37160370
Öztürk-Çolak A Marygold SJ Antonazzo G Attrill H Goutte-Gattat D Jenkins VK Matthews BB Millburn G Dos Santos G Tabone CJ FlyBase Consortium 2024 FlyBase: updates to the Drosophila genes and genomes database Genetics 227 iyad211 10.1093/genetics/iyad211 38301657
Paez-Segala MG Sun MG Shtengel G Viswanathan S Baird MA Macklin JJ Patel R Allen JR Howe ES Piszczek G Hess HF Davidson MW Wang Y Looger LL 2015 Fixation-resistant photoactivatable fluorescent proteins for CLEM Nature Methods 12 215 218 10.1038/nmeth.3225 25581799
Peled ES Isacoff EY 2011 Optical quantal analysis of synaptic transmission in wild-type and rab3-mutant Drosophila motor axons Nature Neuroscience 14 519 526 10.1038/nn.2767 21378971
Peled ES Newman ZL Isacoff EY 2014 Evoked and spontaneous transmission favored by distinct sets of synapses Current Biology 24 484 493 10.1016/j.cub.2014.01.022 24560571
Peng IF Wu CF 2007 Drosophila cacophony channels: a major mediator of neuronal Ca2+ currents and a trigger for K+ channel homeostatic regulation The Journal of Neuroscience 27 1072 1081 10.1523/JNEUROSCI.4746-06.2007 17267561
Petersen SA Fetter RD Noordermeer JN Goodman CS DiAntonio A 1997 Genetic analysis of glutamate receptors in Drosophila reveals a retrograde signal regulating presynaptic transmitter release Neuron 19 1237 1248 10.1016/s0896-6273(00)80415-8 9427247
Radulovic T Dong W Goral RO Thomas CI Veeraraghavan P Montesinos MS Guerrero-Given D Goff K Lübbert M Kamasawa N Ohtsuka T Young SM Jr 2020 Presynaptic development is controlled by the core active zone proteins CAST/ELKS The Journal of Physiology 598 2431 2452 10.1113/JP279736 32304329
Rebola N Reva M Kirizs T Szoboszlay M Lőrincz A Moneron G Nusser Z DiGregorio DA 2019 Distinct nanoscale calcium channel and synaptic vesicle topographies contribute to the diversity of synaptic function Neuron 104 693 710 10.1016/j.neuron.2019.08.014 31558350
Reddy-Alla S Böhme MA Reynolds E Beis C Grasskamp AT Mampell MM Maglione M Jusyte M Rey U Babikir H McCarthy AW Quentin C Matkovic T Bergeron DD Mushtaq Z Göttfert F Owald D Mielke T Hell SW Sigrist SJ Walter AM 2017 Stable Positioning of Unc13 restricts synaptic vesicle fusion to defined release sites to promote synchronous neurotransmission Neuron 95 1350 1364 10.1016/j.neuron.2017.08.016 28867551
Reuveny A Shnayder M Lorber D Wang S Volk T 2018 Ma2/d promotes myonuclear positioning and association with the sarcoplasmic reticulum Development 145 dev159558 10.1242/dev.159558 30093550
Risher WC Kim N Koh S Choi J-E Mitev P Spence EF Pilaz L-J Wang D Feng G Silver DL Soderling SH Yin HH Eroglu C 2018 Thrombospondin receptor α2δ-1 promotes synaptogenesis and spinogenesis via postsynaptic Rac1 The Journal of Cell Biology 217 3747 3765 10.1083/jcb.201802057 30054448
Sauvola CW Akbergenova Y Cunningham KL Aponte-Santiago NA Littleton JT 2021 The decoy SNARE Tomosyn sets tonic versus phasic release properties and is required for homeostatic synaptic plasticity eLife 10 e72841 10.7554/eLife.72841 34713802
Schöpf CL Ablinger C Geisler SM Stanika RI Campiglio M Kaufmann WA Nimmervoll B Schlick B Brockhaus J Missler M Shigemoto R Obermair GJ 2021 Presynaptic α2δ subunits are key organizers of glutamatergic synapses PNAS 118 e1920827118 10.1073/pnas.1920827118 33782113
Sheng J He L Zheng H Xue L Luo F Shin W Sun T Kuner T Yue DT Wu L-G 2012 Calcium-channel number critically influences synaptic strength and plasticity at the active zone Nature Neuroscience 15 998 1006 10.1038/nn.3129 22683682
Smith LA Wang X Peixoto AA Neumann EK Hall LM Hall JC 1996 A Drosophila calcium channel alpha1 subunit gene maps to A genetic locus associated with behavioral and visual defects The Journal of Neuroscience 16 7868 7879 10.1523/JNEUROSCI.16-24-07868.1996 8987815
Thomas GD 2000 Effect of dose, molecular size, and binding affinity on uptake of antibodies Methods in Molecular Medicine 25 115 132 10.1385/1-59259-075-6:115 21318844
Tong X-J López-Soto EJ Li L Liu H Nedelcu D Lipscombe D Hu Z Kaplan JM 2017 Retrograde synaptic inhibition is mediated by α-neurexin binding to the α2δ Subunits of N-type calcium channels Neuron 95 326 340 10.1016/j.neuron.2017.06.018 28669545
Voigt A Freund R Heck J Missler M Obermair GJ Thomas U Heine M 2016 Dynamic association of calcium channel subunits at the cellular membrane Neurophotonics 3 041809 10.1117/1.NPh.3.4.041809 27872869
Wang LY Augustine GJ 2014 Presynaptic nanodomains: a tale of two synapses Frontiers in Cellular Neuroscience 8 455 10.3389/fncel.2014.00455 25674049
Wang T Jones RT Whippen JM Davis GW 2016 α2δ-3 is required for rapid transsynaptic homeostatic signaling Cell Reports 16 2875 2888 10.1016/j.celrep.2016.08.030 27626659
Weiss N Zamponi GW 2017 Trafficking of neuronal calcium channels Neuronal Signaling 1 S20160003 10.1042/NS20160003 32714572
Weyhersmüller A Hallermann S Wagner N Eilers J 2011 Rapid active zone remodeling during synaptic plasticity The Journal of Neuroscience 31 6041 6052 10.1523/JNEUROSCI.6698-10.2011 21508229
Yazaki J Kawashima Y Ogawa T Kobayashi A Okoshi M Watanabe T Yoshida S Kii I Egami S Amagai M Hosoya T Shiroguchi K Ohara O 2020 HaloTag-based conjugation of proteins to barcoding-oligonucleotides Nucleic Acids Research 48 e8 10.1093/nar/gkz1086 31752022
Zhang Y Wang T Cai Y Cui T Kuah M Vicini S Wang T 2023 Role of α2δ-3 in regulating calcium channel localization at presynaptic active zones during homeostatic plasticity Frontiers in Molecular Neuroscience 16 1253669 10.3389/fnmol.2023.1253669 38025261
