
==== Front
Parasit Vectors
Parasit Vectors
Parasites & Vectors
1756-3305
BioMed Central London

6445
10.1186/s13071-024-06445-9
Research
Exploring Trypanosoma cruzi transmission dynamics in an acute Chagas disease outbreak using next-generation sequencing
Cruz-Saavedra Lissa 1
Ospina Carlos 1
Gutiérrez Stivenn A. 1
Jaimes-Dueñez Jeiczon 12
Cantillo-Barraza Omar 3
Hernández Carolina 14
Álvarez Francisco 5
Blanco María 6
Leal Bernardo 5
Martínez Lida 7
Medina Manuel 5
Medina Mabel 6
Valdivieso Silvia 6
Ramirez Celis Lauren Natalia 8
Patiño Luz H. 1
Ramírez Juan David juand.ramirez@urosario.edu.co
juan.ramirezgonzalez@mssm.edu

19
1 https://ror.org/0108mwc04 grid.412191.e 0000 0001 2205 5940 Centro de Investigaciones en Microbiología y Biotecnología-UR (CIMBIUR), Facultad de Ciencias Naturales, Universidad del Rosario, Bogotá, Colombia
2 https://ror.org/04td15k45 grid.442158.e 0000 0001 2300 1573 Grupo de Investigación en Ciencias Animales-GRICA, Facultad de Medicina Veterinaria y Zootecnia, Universidad Cooperativa de Colombia (UCC), Bucaramanga, Colombia
3 https://ror.org/03bp5hc83 grid.412881.6 0000 0000 8882 5269 Grupo BCEI, Universidad de Antioquia, Medellín, Colombia
4 Centro de Tecnología en Salud (CETESA), Innovaseq SAS, Bogotá, Colombia
5 https://ror.org/04a55zb79 grid.510567.0 Programa de Control de ETV, Secretaría de Salud de Boyacá, Tunja, Colombia
6 Secretaría Departamental de Salud de Arauca, Arauca, Colombia
7 https://ror.org/04a55zb79 grid.510567.0 Grupo de Vigilancia en Salud Pública, Secretaría de Salud de Boyacá, Tunja, Colombia
8 Hospital del Sarare Empresa Social del Estado, Saravena, Arauca, Colombia
9 https://ror.org/04a9tmd77 grid.59734.3c 0000 0001 0670 2351 Molecular Microbiology Laboratory, Department of Pathology, Molecular and Cell-Based Medicine, Icahn School of Medicine at Mount Sinai, New York, NY USA
18 9 2024
18 9 2024
2024
17 39510 4 2024
11 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Chagas disease (CD), caused by Trypanosoma cruzi, poses a major global public health challenge. Although vector-borne transmission is the primary mode of infection, oral transmission is increasingly concerning.

Methods

This study utilized long-amplicon-based sequencing (long-ABS), focusing on the 18S rRNA gene, to explore T. cruzi’s genetic diversity and transmission dynamics during an acute CD outbreak in Colombia, an area without domestic infestation.

Results

Analyzing samples from five patients and five T. cruzi-positive marsupial samples, we identified coinfections between T. cruzi and Trypanosoma rangeli, mixed T. cruzi DTUs, suggesting possible links between human and marsupial T. cruzi infections. Coexistence of TcI, TcIV and T. rangeli suggests marsupial secretions as the possible source of T. cruzi transmission. Our investigation revealed diversity loss in DTUs TcIV and T. rangeli in humans after infection and in marsupial samples after culture.

Conclusion

These findings provide significant insights into T. cruzi dynamics, crucial for implementing control and prevention strategies.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s13071-024-06445-9.

Keywords

Oral Chagas outbreak
Trypanosoma cruzi
Trypanosoma rangeli
DTU
Long-amplicon-based sequencing
Coinfection
Mixed infection
Loss of diversity
http://dx.doi.org/10.13039/501100008793 Universidad del Rosario Internal funds Ramírez Juan David issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Chagas disease, caused by the flagellate protozoan Trypanosoma cruzi, presents a grave global health challenge. The current estimates underscore the magnitude of the issue, with over 10 million people worldwide infected with the parasite. Even more alarmingly, over 100 million individuals are exposed to the risk of infection [1].

Chagas disease transmission primarily involves infected triatomine insects (vectorial transmission), but oral transmission is becoming a growing concern. This mode of transmission occurs when individuals consume contaminated food or water containing infective forms of T. cruzi from infected triatomine insects or marsupials [2]. Oral transmission has gained significant attention due to increasing cases reported in countries like Colombia, Venezuela and others [3–5]. A 2007 outbreak in Caracas, which infected 106 individuals, was one of the first indications of oral microepidemics [5]. These outbreaks lead to severe symptoms, with an average mortality rate reaching 6.51% [6], often concentrated in rural areas with T. cruzi reservoirs and vectors. This underscores the urgency of addressing oral transmission in efforts to control emergent forms of Chagas disease in endemic regions.

Trypanosoma cruzi exhibits remarkable genetic diversity, categorized into six Discrete Typing Units (DTUs, TcI-TcVI) and one genotype (TcBat) [7]. Intriguingly, even within the same DTU, variations can be observed [8, 9]. These distinct DTUs correlate with different host species, vectors, clinical manifestations, tissue preferences, treatment responses and disease severities [7]. The intricacy of T. cruzi infection is further highlighted by coinfections with other trypanosomatids and mixed infections involving various DTUs, illustrating the complex nature of the disease [10, 11]. Importantly, while the DTU TcI is primarily associated with most documented oral outbreaks, other DTUs like TcII, TcIII, TcIV and TcVI have also been linked [4, 12–14]. The methodologies based on molecular gene amplification or MLST approaches employed to study and surveillance these oral outbreaks have lacked the comprehensive resolution needed. Hence, a pressing need exists for further exploration to grasp the genetic diversity and dynamics of T. cruzi during oral transmission events.

In 2021, a Chagas disease outbreak occurred in Cubará, Colombia, detailed by Gutierrez et al. [15] (Fig. 1). Five family members exhibited Chagas-like symptoms, confirmed through microhematocrit, ELISA, CHAGATEK ELISA and qPCR, indicating T. cruzi infection. Investigation covered patient residences and surroundings, detecting T. cruzi in marsupials but not in a Panstrongylus geniculatus specimen collected in the zone. Conventional PCR identified mixed T. cruzi infections in patients and one marsupial specimen. However, due to the potential presence of diverse Trypanosomatid species and DTUs, amplicon-based sequencing (ABS) is crucial for gaining deeper insights, highlighting the importance of employing innovative strategies for complex scenarios.Fig. 1 Map depicting the Chagas outbreak location in Cubará, Colombia. The map of Colombia highlights the Boyacá department in blue and the town of Cubará in red. The blue icon represents the index house of the patients on Cubará map, and the red icon depicts the location where marsupials were captured

ABS has already proven valuable in gauging the genetic diversity of Trypanosomatids like Leishmania and T. cruzi, yielding promising insights into transmission dynamics across humans, hosts, vectors and even maternal-fetal transmission cases [16–18]. ABS, targeting small regions like 18S ribosomal RNA and TcSC5D genes, showcased substantial genetic diversity in triatomines and congenital Chagas disease instances, hinting at specific genotypes linked to transmission [18, 19]. However, thus far, many studies have been confined to platforms such as Illumina, which might not be universally accessible and only facilitate short-read sequencing. Additionally, the application of long ABS to comprehensively assess all factors in oral outbreaks and the subsequent diversity loss over time, whether in infection or laboratory cultures, remains unexplored.

Since the COVID-19 pandemic, the Oxford nanopore (ON) sequencing platform has gained traction in regional health laboratories with limited access. This platform was incorporated thanks to funding projects targeting enhanced response to public health crises. Now, the ON technology can be extended to real-time monitoring of other endemic diseases, facilitating timely public health decisions. Thus, this research seeks to bridge a significant knowledge gap by leveraging the capabilities of long ABS to unveil a deeper comprehension of genetic diversity and transmission dynamics during T. cruzi oral transmission events.

Past studies focused on parasite presence, but our ABS-based investigation dives deeper, exploring T. cruzi’s genetic variations at a clone level during a recent acute Chagas disease outbreak. This approach illuminates genetic diversity implications for Chagas disease. We aim to guide effective strategies, deepen evolutionary insights and safeguard at-risk communities.

Methods

Chagas outbreak information and samples

A total of seven samples were gathered from human patients (Homo sapiens), alongside five samples from marsupials (Didelphis marsupialis). For detailed sample information, refer to Additional file 1: Table 1. Initial serum samples were obtained from two patients (C1 and C3) upon their arrival at the primary healthcare center. After hospitalization (2 days), serum samples were collected from all patients (C1post, C3post, C2, C6, C7). This longitudinal sampling approach provided insight into the progression of T. cruzi infection over time in patients. Marsupials’ blood samples, captured during the outbreak, were utilized as sources for DNA extraction (Z1–Z5) and hemoculture (Z1-post–Z3-post, Z5-post); the hemoculture was made in Tobbie/Liver infusion tryptose biphasic medium immediately after sample collection. Just four hemocultures were found positive, which offered an opportunity to study T. cruzi diversity effects under culture conditions. More information about sample collection's basic serological and molecular results can be found in Gutiérrez et al. [15].

DNA extraction, long sequencing PCR and SL-IR sequencing

DNA extraction from serum of patients and marsupials employed the High Pure PCR Template Roche kit (Roche, Germany). The first part of the 18S rRNA gene (approximately 900 bp—205 informative SNPs) was amplified using the previously validated primers Tc18s_longFs_Fw (TCAGACGTAATCTGCCGCAA) and Tc18s_longFs_Rv (CCAACAAAAGCCGAAACGGT) from our Laboratory. The PCR mixture included LongAmp Taq 2X Master Mix. Thermal cycling conditions encompassed denaturation, annealing and extension steps. Amplified products were visualized on a 2% agarose gel. DNA controls from reference strains of T. cruzi DTUs were included for quality control, ensuring selective amplification and T. cruzi DNA presence verification. Additionally, a fragment of 300 to 350 base pairs was amplified using PCR techniques targeting the intergenic mini-exon gene region (SL-IR) with the primers TCC (5′-CCCCCCCTCCCAGGCCACACTG-3′), TC1M (5′-GTGTCCGCCACCTCCTTCGGGCC-3′) and TC2 (5′-CCTGCAGGCACACGTGTGTGTG-3′), following the protocol described by Souto [20]. The genotyping PCR products were subjected to electrophoresis, purified using ExoSAP-IT® and sequenced in both forward and reverse directions using the Sanger method by Macrogen (Seoul, South Korea).

ON library preparation and sequencing

The PCR products were utilized to generate a sequencing library following the manufacturer’s instructions of the Ligation Sequencing Kit (SQK-LSK109, ONT, Oxford, UK). Initially, the PCR products underwent end-repair and A-tailing using the NEBNext End Repair/dA-tailing module. To incorporate barcodes, the end-prepped DNA was ligated using the NEBNext Ultra II Ligation Module Kit and PCR barcoding EXP-NBD196. Adapter ligation was performed subsequently using the NEBNext Quick Ligation Module Kit. The resulting library was loaded onto an R9.4 flow cell (FLO-MIN106) and sequenced on the MinIonMk1C instrument with MinKNOW software V22.10.7. Base-calling was conducted using Guppy v6.3.9, and reads below a minimum quality score of seven were excluded from further analysis.

Reads bioinformatic analysis

Nanostat software assessed fastq file quality. Filtlong applied quality and size filters (mean score ≥ 10). Centrifuge software ensured accurate taxonomic assignment, emphasizing Trypanosomatids. Ugene aligned NCBI refseq 18S rRNA gene references via MAFFT (Additional file 1: Table 1). Centrifuge was running under parameters --min-totallen 100 --qc-filter and generated csv files filtered by hit length 70% and query length between 850 and 1200 bp (expected length of amplicon). Abundance visualization used R Studio’s ggplot package. In cases of unexpected assignments, they were confirmed via BLASTn of extracted reads including parameter -perc_identity 90 -evalue 0.05 -max_target_seqs 1. Consult our github to access the bioinformatic pipeline: https://github.com/gimur.

Phylogenetic analysis

The reads obtained from the fastq files were sorted based on the results obtained from Centrifuge and BLASTn analyses of length (850 bp to 1200 bp), coverage (> 70%) and identity (> 90%) compared to the trypanosomatid data base. The reads were then assigned to the respective DTUs that were most commonly identified. The Ugene software platform was utilized, employing tools such as MAFFT for multiple sequence alignment and IQ-TREE for phylogenetic tree construction, incorporating the best model of substitution based on statistical tests obtained for each alignment. The resulting phylogenetic trees were further edited for visualization using the Itol software. A dissimilarity distance matrix was generated in Ugene through alignment and used to create a heatmap and dendrogram using average linkage clustering and Pearson correlation as the distance measure in Heatmapper [21]. Additionally, PCA was performed using R software (v. 4.2.2) with the “stats” package and “prcomp” function.

Results

18S rRNA long amplicon-based sequencing reveals coinfection dynamics in patients and marsupials

After applying 18S rRNA long-amplicon-based sequencing and quality filtering, a significant number of reads per sample (ranging from 9325 to 29,823) passed the quality check. Centrifuge analysis focused on high-quality reads with expected lengths (around 900 bp) and optimal hit lengths (over 70%). To ensure accurate taxonomic assignments, a secondary BLASTn analysis against an in-house database was conducted for validation. All the detected DTUs and trypanosomatids per sample are summarized in Supplementary Table 3.

Strikingly, all patients were infected with the TcI DTU. Among them, four individuals had mixed infections with the TcIV DTU. Additionally, T. rangeli presence was detected in two patients. Similar results were observed by Gutierrez et al. [15] when employing conventional PCR genotyping on the same samples. Patient C1, immunosuppressed, displayed broader DTU infection, including TcII and TcIII (Fig. 2A). Among the marsupials, the TcI DTU was identified in four out of five samples, TcIV in two samples and TcIII in only one sample. Furthermore, T. rangeli was found in coinfection with T. cruzi in two samples, and a third coinfection event was observed involving two T. cruzi DTUs (TcIII and TcIV). Strikingly, marsupial Z1 displayed a similar pattern of infection involving DTUs TcI, TcIV and T. rangeli, mirroring the findings observed in two humans (Fig. 2A).Fig. 2 Trypanosomatids-ABS reveals high diversity of trypanosomatids and decrease in diversity during the Chagas oral outbreak in Cubará, Colombia. A Trypanosomatid diversity in blood samples from humans and marsupials. B Reduction in trypanosomatid diversity in human samples following infection (initial samples collected upon arrival at primary healthcare center and subsequently during hospitalization). C Loss of trypanosomatids in marsupial samples after culture. Initial serum samples for two patients (C1 and C3) upon their arrival at the primary healthcare center and after hospitalization from all patients (C1post, C3post, C2, C6, C7). Marsupial blood samples taken during the outbreak (Z1–Z5) and after hemoculture (Z1-post–Z3-post, Z5-post)

Sequential samples were collected from patients C1 and C3, initially after their first medical center visit and subsequently after 2 days of hospitalization (C1post and C3post). Notably, in immunosuppressed patient C1, a loss of diversity was observed in the second sample, with only the TcI and TcIV DTUs remaining (Fig. 2B). Regrettably, the loss of diversity could not be followed up until treatment and over time. This diversity loss was not observed in C3. In addition, blood samples from three captured marsupials were utilized to establish long-amplicon-based sequencing (long-ABS) and culture. Remarkably, the samples derived from culture exhibited a significant loss of diversity, with all three clones showing only the TcI DTU (Fig. 2C). This observation highlights the impact of culture on the diversity of T. cruzi populations.

Comparative analysis of TcI DTU reveals commonalities between patients and marsupials

Following the assignment and verification of reads, a phylogenetic analysis was conducted using 1000 bootstrap replicates. To confirm our findings, a reference sequence was included in the analysis. The reads assigned to the TcI DTU formed two distinct, well-defined clusters (Fig. 3A). Cluster 1 encompassed reads obtained from marsupials (Z3, Z4, Z5—depicted in pink), which grouped together with reference strains (blue color). Cluster 2 consisted of reads obtained from patients and marsupial Z1, which exhibited a strikingly similar pattern of coinfection and mixed infection to that observed in humans (depicted in green) (Fig. 3A). These results were corroborated using Sanger sequencing of the mini-exon gene (Fig. S1).Fig. 3 Comparative analysis of TcI DTU of T. cruzi reveals commonalities between patients and marsupials. A Phylogenetic analysis of TcI DTU of Trypanosoma cruzi. The reference sequences are in blue, sequences from human patients in red and sequences from marsupials in green. Cluster 1 is enclosed by a pink circle, while cluster 2 is represented by a green circle. B Matrix of dissimilarities based on Pearson correlations for cluster 1. C Matrix of dissimilarities based on Pearson correlations for cluster 2

Our exploration extended further, diving into dissimilarity matrices within each cluster, followed by Pearson correlation analysis. In the first cluster, Z3 and Z4’s genetic scripts showcased closeness, differing by just 40 SNPs—as evidence of genetic connection. Z5 presented a unique pattern, weaving in 69 SNPs with Z3 and 56 SNPs with Z4, highlighting its distinct genetic signature (Fig. 3B). Within the same patient (TcI-1 C7, TcI-2 C7), 76 dissimilarities revealed genetic changes within a single host. Notably, TcI-2 C7 matched with C2 with only 32 dissimilarities, hinting at a unique genetic pattern. Genetic similarity was strongest among reads from C1, C2, C6 and TcI-2 C7, suggesting a potential shared source. Marsupial Z1’s genetic datat showed connections: 62 SNPs with TcI-2 C7, 66 with C2 and 70 with C6. However, TcI-1 C7 and C3 reads showed contrasting results in terms of dissimilarities (Fig. 3C).

Phylogenetic analysis of DTU TcIV reveals associations between patients and marsupials

In addition to the analysis of DTU TcI, a phylogenetic analysis was conducted for the reads assigned to DTU TcIV (Fig. 4A). Similar to the observations made for patient C7 within DTU TcI, we identified genetic differences in reads associated with patient C6 (TcIV-1 C6 and TcIV-2 C6) and marsupial Z1 (TcIV-1 Z1 and TcIV-2 Z1). The phylogenetic tree and PCA analysis exhibited two distinct clusters. In the first cluster (depicted in pink), the TcIV reference strains (shown in blue) grouped together with reads from the five samples, including C1, C3, TcIV-1 C6 and TcIV-1 Z1. Interestingly, within this cluster, the reads from the second samples of C1 and C3 (C1-post and C3-post) also clustered together. In the second cluster, the reads from human C2 and TcIV-2 C6 were closely related to reads from marsupial Z2 and TcIV-1 Z1. Notably, the reads from TcIV-2 C6 and Z1 formed a distinct branch within this cluster, suggesting a potential shared genetic lineage. These findings provide insights into the genetic relationships and associations between patients and marsupials within the DTU TcIV, highlighting the complexity of transmission dynamics and potential reservoir hosts in Chagas disease. These results were corroborated using Sanger sequencing of the mini-exon gene (Fig. S2).Fig. 4 Phylogenetic analysis of DTU TcIV reveals associations between patients and marsupials. A Phylogenetic analysis of TcIV DTU of Trypanosoma cruzi. Reference sequence is in blue, sequences from human patients in red and sequences from marsupials in green. Cluster 1 is enclosed by a pink circle, while cluster 2 is represented by a green circle. B Matrix of dissimilarities based on Pearson correlations for cluster 1. C Matrix of dissimilarities based on Pearson correlations for cluster 2

Our genetic exploration revealed intriguing connections. In the first cluster, TcIV C3-post and TcIV-1 C6 differed by only 31 SNPs. Shared genetic links between C1 and TcIV-1 C6 (40 SNPs). Marsupial Z1 mirrored this pattern, differing by 39 SNPs from TcIV-1 C6, 48 SNPs from TcIV C3-post and 50 SNPs from C1. Between initial and subsequent samples from C1 and C3, we noted 55 and 56 SNPs of change, respectively. A notable 69-SNP divergence emerged between TcIV-1 Z1 and C3 within this cluster (Fig. 4B). In the second cluster, our dissimilarity analysis highlighted 54 to 70 SNPs between samples, irrespective of origin. In addition, between TcIV Z2 and TcIV-2 Z1 (54 SNPs). Likewise, TcIV Z2 and TcIV_C2 linked with 60 SNPs, unveiling shared genetic links (Fig. 4C).

Exploring the diversity of T. rangeli in human and marsupials

To investigate the genetic diversity of T. rangeli in both human and marsupial hosts, we applied a similar approach of phylogenetic analysis and dissimilarity matrix. The phylogenetic tree revealed that the reference sequence of T. rangeli_Tol isolated from Colombia clustered together with samples obtained from human patients C1 and C6 as well as from marsupial Z1 (Fig. 5A). Additionally, the reads obtained from sample Z2 grouped with the other reference sequences indicating a shared genetic relationship (Fig. 5A). Consistent with the phylogenetic analysis, the dissimilarity matrix demonstrated the highest similarity between reads assigned to T. rangeli in the comparison between patient C1 and marsupial Z5, with only 45 SNPs of difference. This was followed by the comparison between patient C6 and marsupial Z1, exhibiting 81 SNPs of difference (Fig. 5B).Fig. 5 Exploring the diversity in Trypanosoma rangeli in humans and marsupials. A Phylogenetic analysis of T. rangeli. The reference sequence is in blue, sequences from human patients in red and sequences from marsupials in green. B Matrix of dissimilarities based on Pearson correlations for T. rangeli

Discussion

In this study, we utilized Long-18S rRNA Amplicon-Based Sequencing (ABS) to assess a wide range of samples with diverse origins and varying levels of parasite diversity and quantity. Our approach demonstrated remarkable sensitivity and precise resolution in analyzing the dynamics of T. cruzi transmission during the oral outbreak, encompassing samples from both humans and marsupials. This method yielded insights into the natural occurrence of coinfection and mixed infection of trypanosomatids in sylvatic hosts. Furthermore, it shed light on the subsequent reduction in diversity following human infection and culturing. These aspects may have been previously underestimated because of limitations in available genotyping methods, such as the lower accuracy and shorter read lengths of Oxford Nanopore sequencing as well as its inability to resolve mixed infections compared to the more precise PCR or MLST techniques in available genotyping methods.

The prevalence of DTU TcI in samples aligns with established data, reflecting its dominance in Colombia and its role in Chagas oral outbreaks [4, 22]. Notably, DTU TcIV and T. rangeli were found in patients and marsupials, indicating coinfection and mixed infection instances (Fig. 2). TcIV, less common but linked to oral Chagas, is noteworthy. Genetic similarities in trypanosomatids and DTUs between humans and marsupials are significant. Trypanosoma rangeli in both hosts complicates transmission and has been reported in few studies in human and skin of Didelphis albiventris [23, 24]. Phylogenetic analysis shows shared genetic lineage, while dissimilarity analysis implies genetic diversity within T. rangeli. Exploring interactions of T. cruzi and T. rangeli is key for Chagas disease insight [25]. Coinfection and mixed infection may impact the severity of clinical symptoms because of variations in parasite phenotypes, immune responses and tropism [26].

The detection of mixed infections involving different DTUs (TcI and TcIV) in patients and marsupials adds another layer of complexity to the transmission dynamics of T. cruzi. Four patients exhibited mixed infections, with the presence of both TcI and TcIV DTUs. Interestingly, marsupial Z1 displayed a similar pattern of mixed infection involving the same DTUs, reinforcing the potential role of marsupials in the transmission cycle. The dissimilarity analysis within clusters further supported the notion of shared infections, as the reads from different patients and marsupial Z1 exhibited low dissimilarities, indicating a potential shared source of infection. The strong pattern of DTUs and Trypanosomatid infection observed suggests a common origin of infection and potentially even cross-species transmission between the two groups. This interpretation gains further support from the genetic relationships unveiled by the phylogenetic analysis. The clustering of genetic sequences from both patients and marsupial Z1 strongly implies a genetic connection between these two entities (Figs. 3, 4). These findings point to the intriguing possibility of marsupials serving as reservoir hosts, actively contributing to the spread and transmission of T. cruzi during oral outbreak scenarios in the lack of evident vector transmission.

In fact, we made significant observations in the field. We identified a total of five qPCR T. cruzi-positive marsupials in the proximity of the patients’ residence, with four of them yielding positive results in subsequent hemoculture tests (Fig. 1; Additional file 1: Table 2). Interestingly, no T. cruzi-positive triatomine insects were discovered. This stark contrast underscores the substantial presence of sylvatic hosts in the region. Given that Cubará is a remote town with extensive sylvatic areas, this finding aligns with expectations. Notably, existing literature has provided support for and confirmation of the transmission of T. cruzi by the contamination of water and food with anal secretions, where infected forms of T. cruzi have been detected and observed, from infected opossums, and our results suggest the Cubará Chagas outbreak might have followed the same route [27, 28].

Intriguingly, the immunosuppressed patient C1 cast a spotlight on a broader spectrum of T. cruzi diversity, revealing the presence of not only TcI but also TcII, TcIII and even T. rangeli. This finding hints at the dynamic interplay between the host’s immune status and the diversity of T. cruzi infection. The impact of immune status on Chagas disease is a terrain ripe for exploration. Emerging evidence points to the heightened severity of Chagas disease in individuals coinfected with HIV, a combination that seems to exacerbate tissue invasion and lead to potentially lethal outcomes [29, 30]. Delving into the complex interplay between host immune responses and the development of mixed infections could shed light on the factors that drive disease progression. This also might imply that a diverse initial pathogen load is subjected to selective filtration within the infected host, ultimately leading to a constrained infection outcome.

In human samples, we have observed a loss of DTU TcIV and T. rangeli after 2 days of infection, while DTU TcI remains dominant (Fig. 2B). This finding is highly intriguing, particularly considering the prevalence of TcI in Colombia. The underlying mechanism by which the immune system or other factors might lead to a bottleneck effect on T. cruzi DTU diversity in humans remains uncertain. To our knowledge, this marks the first report of diversity loss in human blood samples, potentially shedding light on the predominance of TcI in reports of Chagas acute outbreaks. Regarding the presence of T. cruzi DTUs II and III in the immunosuppressed host, it is noteworthy that these DTUs, while less common, are the second most reported in Colombia after TcI [22]. Their detection, despite their lower prevalence, could help explain the observed loss of diversity in the patient. This finding suggests that DTUs II and III, although present at lower frequencies, might play a role in the diversity loss observed in this patient. This case highlights the need for further investigation to better understand the full range of T. cruzi DTUs present and their distribution within the area, particularly in relation to immunological factors and tissue tropism.

One plausible hypothesis is the swift migration of DTU TcIV to specific tissues. In fact, studies involving oral infection of mice with TcIV oral outbreak strains have shown a notable parasite abundance in tissues post-infection [31]. If this scenario holds true, it prompts us to question whether we have underestimated Chagas diversity by solely relying on blood samples. The histotrophic of distinct T. cruzi DTUs in humans has indeed been observed [10]. However, addressing this question is challenging because of the complexity of obtaining cardiac and gastrointestinal tissues from patients given the ethical considerations involved. These findings pose intriguing inquiries and emphasize the need for continued exploration into the interplay among various factors influencing DTU infection dynamics and diversity in Chagas disease, particularly during oral outbreaks. Gaining a better understanding of the mechanisms underlying diversity loss in blood and how different DTUs behave in diverse tissues could hold significant implications for disease diagnosis, treatment and control.

The reduction in diversity we observed in the cultured samples from marsupials sheds light on the significant impact that laboratory techniques can have on the diversity of T. cruzi populations [32]. This phenomenon has been recognized and discussed in previous studies highlighting the potential for culture methods to favor the growth of certain DTUs, which might then skew our view of the entire parasite population. This insight is a reminder of the potential limitations posed by culture-based approaches when investigating T. cruzi diversity and transmission dynamics. To gain a more holistic understanding of the parasite population, it is crucial to be mindful of these biases introduced by culture techniques. Innovative long-amplicon-based sequencing methods provide a more comprehensive understanding of T. cruzi diversity and transmission dynamics. These advanced techniques help reveal the complexity of the parasite’s genetic landscape.

In our study, we used Oxford Nanopore sequencing, which is advantageous because of its longer read lengths and real-time data acquisition, allowing for exploration of complex genetic landscapes. However, it has drawbacks compared to Illumina sequencing, including higher error rates and lower accuracy in base calling, which can impact the reliability of detecting genetic variations. Conversely, Illumina sequencing is known for its high accuracy and comprehensive coverage but faces limitations such as shorter read lengths and challenges in detecting structural variations, which are crucial for distinguishing between T. cruzi DTUs. Our focus on Oxford Nanopore sequencing and only two molecular markers is a limitation of our study, offering a narrower perspective compared to more extensive genomic analyses. Additionally, using serum instead of whole blood for PCR analysis is another limitation, as serum is less effective for detecting T. cruzi because of its lower sensitivity in PCR-based diagnostics. This choice may have contributed to the observed loss of diversity in our results. Future research should combine different sequencing technologies and employ broader genomic analyses to achieve a more detailed understanding of T. cruzi and similar pathogens, ultimately enhancing our knowledge and informing more effective control strategies.

Conclusions

The findings of this study, based on Trypanosomatids ABS-long, shed light on the intricate dynamics of T. cruzi during acute outbreaks and provide valuable insights for control and prevention. This suggests the implementation of this technique to evaluate future Chagas outbreaks. The identification of marsupials as potential reservoir hosts emphasizes the importance of considering alternative transmission routes beyond triatomine vectors. Efforts should be directed toward understanding the interactions between different DTUs and other trypanosome species as well as the impact of host immune response, tissue tropism and laboratory techniques on the diversity of T. cruzi populations. Future studies should also explore the potential involvement of other wildlife species in the transmission cycle and investigate the genetic diversity and virulence factors of T. cruzi and T. rangeli strains to enhance our understanding of Chagas disease epidemiology and develop effective control measures.

Supplementary Information

Additional file 1: Table S1. Trypanosomatid sequences included as reference during the bioinformatic analysis.

Additional file 2: Table S2. Sample information from human and marsupial samples collected.

Additional file 3: Supplementary Table 3. DTUs and trypanosomatids detected in humans and marsupials.

Additional file 4: Supplementary Figure 1. Phylogenetic tree comparison between 18S RNA Oxford Nanopore and mini-exon Sanger sequencing for TcI sequences. A. 18S nanopore reads. B. Mini-exon Sanger sequencing.

Additional file 5: Supplementary Figure 2. Phylogenetic tree comparison between 18S RNA Oxford Nanopore and Mini-exon Sanger sequencing for TcIV sequences. A. 18S nanopore reads. B. Mini-exon Sanger sequencing.

Abbreviations

DTU Discrete typing unit

ABS Amplicon-based sequencing

ON Oxford nanopore

C Patients

Z Marsupials

PCA Principal component analysis

Acknowledgement

Not applicable.

Author contributions

The conceptualization of the study was carried out by JDR. JJD, OCB, FÁ, MB, BL, LM, MM, MM, SV and LNRC collected samples from humans and marsupials, conducted sampling from insect vectors and performed the initial Chagas disease test. LCS and SAG handled DNA extraction and conducted the initial PCR. LCS and CO conducted the long-amplicon-based sequencing (long-ABS). The formal data analysis and original manuscript writing were performed by LCS. JDR reviewed and edited the manuscript. All authors reviewed and approved the final version of the manuscript.

Funding

This work was funded by Dirección de Investigación e Innovación from Universidad del Rosario.

Data availability

All the data generated in this project were uploaded under the Bioproject PRJEB70421. No datasets were generated or analyzed during the current study.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics committee of Universidad de Antioquia Act Number 22-02-1004 “Vigilancia de la Enfermedad de Chagas y Leishmaniasis en el departamento de Boyacá, Colombia.”

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Declaration of generative AI in scientific writing

During the preparation of this work the author(s) used ChatGPT, a language model trained by OpenAI, to providing helpful insights and corrections during the process of improving the drafting and readability. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. OMS. Chagas disease (American trypanosomiasis). 2022. https://www.who.int/health-topics/chagas-disease. Accessed 25 May 2022.
2. Silva-dos-Santos D Barreto-de-Albuquerque J Guerra B Moreira OC Berbert LR Ramos MT Unraveling Chagas disease transmission through the oral route: gateways to Trypanosoma cruzi infection and target tissues PLoS Negl Trop Dis 2017 11 e0005507 10.1371/journal.pntd.0005507 28379959
Silva-dos-Santos D, Barreto-de-Albuquerque J, Guerra B, Moreira OC, Berbert LR, Ramos MT, et al. Unraveling Chagas disease transmission through the oral route: gateways to Trypanosoma cruzi infection and target tissues. PLoS Negl Trop Dis. 2017;11:e0005507.28379959
3. Toso MA Vial UF Galanti N Oral transmission of Chagas’ disease Rev Med Chile 2011 139 258 266 21773665
Toso MA, Vial UF, Galanti N. Oral transmission of Chagas’ disease. Rev Med Chile. 2011;139:258–66.21773665
4. Ramírez JD Montilla M Cucunubá ZM Floréz AC Zambrano P Guhl F Molecular epidemiology of human oral Chagas disease outbreaks in Colombia PLoS Negl Trop Dis 2013 7 e2041 10.1371/journal.pntd.0002041 23437405
Ramírez JD, Montilla M, Cucunubá ZM, Floréz AC, Zambrano P, Guhl F. Molecular epidemiology of human oral Chagas disease outbreaks in Colombia. PLoS Negl Trop Dis. 2013;7:e2041.23437405
5. Díaz-Bello Z de Noya BA Muñoz-Calderón A Ruiz-Guevara R Mauriello L Colmenares C Ten-year follow-up of the largest oral Chagas disease outbreak. Laboratory biomarkers of infection as indicators of therapeutic failure Acta Trop 2021 222 106034 10.1016/j.actatropica.2021.106034 34224715
Díaz-Bello Z, de Noya BA, Muñoz-Calderón A, Ruiz-Guevara R, Mauriello L, Colmenares C, et al. Ten-year follow-up of the largest oral Chagas disease outbreak. Laboratory biomarkers of infection as indicators of therapeutic failure. Acta Trop. 2021;222:106034.34224715
6. López-García A Gilabert JA Oral transmission of Chagas disease from a One Health approach: a systematic review Trop Med Int Health 2023 28 689 698 10.1111/tmi.13915 37488635
López-García A, Gilabert JA. Oral transmission of Chagas disease from a One Health approach: a systematic review. Trop Med Int Health. 2023;28:689–98.37488635
7. Zingales B Miles MA Campbell DA Tibayrenc M Macedo AM Teixeira MMG The revised Trypanosoma cruzi subspecific nomenclature: rationale, epidemiological relevance and research applications Infect Genet Evol 2012 12 240 253 10.1016/j.meegid.2011.12.009 22226704
Zingales B, Miles MA, Campbell DA, Tibayrenc M, Macedo AM, Teixeira MMG, et al. The revised Trypanosoma cruzi subspecific nomenclature: rationale, epidemiological relevance and research applications. Infect Genet Evol. 2012;12:240–53.22226704
8. Herrera C Guhl F Falla A Fajardo A Montilla M Adolfo Vallejo G Genetic variability and phylogenetic relationships within Trypanosoma cruzi I isolated in Colombia based on miniexon gene sequences J Parasitol Res 2009 2009 897364 10.1155/2009/897364 20798881
Herrera C, Guhl F, Falla A, Fajardo A, Montilla M, Adolfo Vallejo G, et al. Genetic variability and phylogenetic relationships within Trypanosoma cruzi I isolated in Colombia based on miniexon gene sequences. J Parasitol Res. 2009;2009:897364.20798881
9. Ramírez JD Guhl F Messenger LA Lewis MD Montilla M Cucunuba Z Contemporary cryptic sexuality in Trypanosoma cruzi Mol Ecol 2012 21 4216 4226 10.1111/j.1365-294X.2012.05699.x 22774844
Ramírez JD, Guhl F, Messenger LA, Lewis MD, Montilla M, Cucunuba Z, et al. Contemporary cryptic sexuality in Trypanosoma cruzi. Mol Ecol. 2012;21:4216–26.22774844
10. Burgos JM Diez M Vigliano C Bisio M Risso M Duffy T Molecular identification of Trypanosoma cruzi discrete typing units in end-stage chronic Chagas heart disease and reactivation after heart transplantation Clin Infect Dis 2010 51 485 495 10.1086/655680 20645859
Burgos JM, Diez M, Vigliano C, Bisio M, Risso M, Duffy T, et al. Molecular identification of Trypanosoma cruzi discrete typing units in end-stage chronic Chagas heart disease and reactivation after heart transplantation. Clin Infect Dis. 2010;51:485–95.20645859
11. Cura CI Lucero RH Bisio M Oshiro E Formichelli LB Burgos JM Trypanosoma cruzi discrete typing units in Chagas disease patients from endemic and non-endemic regions of Argentina Parasitology 2012 139 516 521 10.1017/S0031182011002186 22309735
Cura CI, Lucero RH, Bisio M, Oshiro E, Formichelli LB, Burgos JM, et al. Trypanosoma cruzi discrete typing units in Chagas disease patients from endemic and non-endemic regions of Argentina. Parasitology. 2012;139:516–21.22309735
12. Díaz-Bello Z Thomas MC López MC Zavala-Jaspe R Noya O De Noya BA Trypanosoma cruzi genotyping supports a common source of infection in a school-related oral outbreak of acute Chagas disease in Venezuela Epidemiol Infect 2014 142 156 162 10.1017/S0950268813000757 23544849
Díaz-Bello Z, Thomas MC, López MC, Zavala-Jaspe R, Noya O, De Noya BA, et al. Trypanosoma cruzi genotyping supports a common source of infection in a school-related oral outbreak of acute Chagas disease in Venezuela. Epidemiol Infect. 2014;142:156–62.23544849
13. Andrade SG Campos RF Steindel M Guerreiro ML Magalhães JB de Almeida MC Biological, biochemical and molecular features of Trypanosoma cruzi strains isolated from patients infected through oral transmission during a 2005 outbreak in the state of Santa Catarina, Brazil: its correspondence with the new T. cruzi taxonomy consensus (2009) Mem Inst Oswaldo Cruz 2011 106 948 956 10.1590/S0074-02762011000800009 22241116
Andrade SG, Campos RF, Steindel M, Guerreiro ML, Magalhães JB, de Almeida MC, et al. Biological, biochemical and molecular features of Trypanosoma cruzi strains isolated from patients infected through oral transmission during a 2005 outbreak in the state of Santa Catarina, Brazil: its correspondence with the new T. cruzi taxonomy consensus (2009). Mem Inst Oswaldo Cruz. 2011;106:948–56.22241116
14. Monteiro WM Magalhães LKC de Sá ARN Gomes ML Toledo MJDO Borges L Trypanosoma cruzi IV causing outbreaks of acute Chagas disease and infections by different haplotypes in the Western Brazilian Amazonia PLoS ONE 2012 7 e41284 10.1371/journal.pone.0041284 22848457
Monteiro WM, Magalhães LKC, de Sá ARN, Gomes ML, Toledo MJDO, Borges L, et al. Trypanosoma cruzi IV causing outbreaks of acute Chagas disease and infections by different haplotypes in the Western Brazilian Amazonia. PLoS ONE. 2012;7:e41284.22848457
15. Gutiérrez SA Jaimes-Dueñez J Cruz-Saavedra L Hernández C Cantillo-Barraza O Álvarez F An outbreak of acute Chagas disease possibly spread through oral transmission involving animal reservoirs in eastern Colombia Am J Trop Med Hyg 2024 110 36 39 10.4269/ajtmh.23-0380 37956445
Gutiérrez SA, Jaimes-Dueñez J, Cruz-Saavedra L, Hernández C, Cantillo-Barraza O, Álvarez F, et al. An outbreak of acute Chagas disease possibly spread through oral transmission involving animal reservoirs in eastern Colombia. Am J Trop Med Hyg. 2024;110:36–9.37956445
16. Patiño LH Castillo-Castañeda AC Muñoz M Jaimes JE Luna-Niño N Hernández C Development of an amplicon-based next-generation sequencing protocol to identify Leishmania species and other trypanosomatids in leishmaniasis endemic areas Microbiol Spectr 2021 9 e0065221 10.1128/Spectrum.00652-21 34643453
Patiño LH, Castillo-Castañeda AC, Muñoz M, Jaimes JE, Luna-Niño N, Hernández C, et al. Development of an amplicon-based next-generation sequencing protocol to identify Leishmania species and other trypanosomatids in leishmaniasis endemic areas. Microbiol Spectr. 2021;9:e0065221.34643453
17. Velásquez-Ortiz N Hernández C Cantillo-Barraza O Medina M Medina-Alfonso M Suescún-Carrero S Estimating the genetic structure of Triatoma dimidiata (Hemiptera: Reduviidae) and the transmission dynamics of Trypanosoma cruzi in Boyacá, eastern Colombia PLoS Negl Trop Dis 2022 16 e0010534 10.1371/journal.pntd.0010534 35816541
Velásquez-Ortiz N, Hernández C, Cantillo-Barraza O, Medina M, Medina-Alfonso M, Suescún-Carrero S, et al. Estimating the genetic structure of Triatoma dimidiata (Hemiptera: Reduviidae) and the transmission dynamics of Trypanosoma cruzi in Boyacá, eastern Colombia. PLoS Negl Trop Dis. 2022;16:e0010534.35816541
18. Hakim JMC Waltmann A Tinajeros F Kharabora O Málaga Machaca E Calderon M Amplicon sequencing reveals complex infection in infants congenitally infected with Trypanosoma cruzi and informs the dynamics of parasite transmission J Infect Dis 2023 10.1093/infdis/jiad125 37119236
Hakim JMC, Waltmann A, Tinajeros F, Kharabora O, Málaga Machaca E, Calderon M, et al. Amplicon sequencing reveals complex infection in infants congenitally infected with Trypanosoma cruzi and informs the dynamics of parasite transmission. J Infect Dis. 2023. 10.1093/infdis/jiad125.37119236
19. Dario MA Moratelli R Schwabl P Jansen AM Llewellyn MS Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats PLoS Negl Trop Dis 2017 11 e0005790 10.1371/journal.pntd.0005790 28727769
Dario MA, Moratelli R, Schwabl P, Jansen AM, Llewellyn MS. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats. PLoS Negl Trop Dis. 2017;11:e0005790.28727769
20. Souto RP Fernandes O Macedo AM Campbell DA Zingales B DNA markers define two major phylogenetic lineages of Trypanosoma cruzi Mol Biochem Parasitol 1996 83 141 152 10.1016/S0166-6851(96)02755-7 9027747
Souto RP, Fernandes O, Macedo AM, Campbell DA, Zingales B. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi. Mol Biochem Parasitol. 1996;83:141–52.9027747
21. Babicki S Arndt D Marcu A Liang Y Grant JR Maciejewski A Heatmapper: web-enabled heat mapping for all Nucleic Acids Res 2016 44 W147 W153 10.1093/nar/gkw419 27190236
Babicki S, Arndt D, Marcu A, Liang Y, Grant JR, Maciejewski A, et al. Heatmapper: web-enabled heat mapping for all. Nucleic Acids Res. 2016;44:W147–53.27190236
22. Hernández C Cucunubá Z Flórez C Olivera M Valencia C Zambrano P Molecular diagnosis of Chagas disease in Colombia: parasitic loads and discrete typing units in patients from acute and chronic phases PLoS Negl Trop Dis 2016 10 e0004997 10.1371/journal.pntd.0004997 27648938
Hernández C, Cucunubá Z, Flórez C, Olivera M, Valencia C, Zambrano P, et al. Molecular diagnosis of Chagas disease in Colombia: parasitic loads and discrete typing units in patients from acute and chronic phases. PLoS Negl Trop Dis. 2016;10:e0004997.27648938
23. de Sousa MA da Silva FT Dos Santos BN Dos Santos Pereira SM Carvalhal C Hasslocher Moreno AM Trypanosoma rangeli Tejera, 1920, in chronic Chagas’ disease patients under ambulatory care at the Evandro Chagas Clinical Research Institute (IPEC-Fiocruz, Brazil) Parasitol Res 2008 103 697 703 10.1007/s00436-008-1033-1 18563444
de Sousa MA, da Silva FT, Dos Santos BN, Dos Santos Pereira SM, Carvalhal C, Hasslocher Moreno AM. Trypanosoma rangeli Tejera, 1920, in chronic Chagas’ disease patients under ambulatory care at the Evandro Chagas Clinical Research Institute (IPEC-Fiocruz, Brazil). Parasitol Res. 2008;103:697–703.18563444
24. Brandão EMV Xavier SCC Carvalhaes JG D’Andrea PS Lemos FG Azevedo FC Trypanosomatids in small mammals of an agroecosystem in Central Brazil: another piece in the puzzle of parasite transmission in an anthropogenic landscape Pathogens 2019 8 190 10.3390/pathogens8040190 31615153
Brandão EMV, Xavier SCC, Carvalhaes JG, D’Andrea PS, Lemos FG, Azevedo FC, et al. Trypanosomatids in small mammals of an agroecosystem in Central Brazil: another piece in the puzzle of parasite transmission in an anthropogenic landscape. Pathogens. 2019;8:190.31615153
25. Guhl F Hudson L Marinkelle CJ Jaramillo CA Bridge D Clinical Trypanosoma rangeli infection as a complication of Chagas’ disease Parasitology 1987 94 475 484 10.1017/S0031182000055827 2441341
Guhl F, Hudson L, Marinkelle CJ, Jaramillo CA, Bridge D. Clinical Trypanosoma rangeli infection as a complication of Chagas’ disease. Parasitology. 1987;94:475–84.2441341
26. Cruz L Vivas A Montilla M Hernández C Flórez C Parra E Comparative study of the biological properties of Trypanosoma cruzi I genotypes in a murine experimental model Infect Genet Evol 2015 29 110 117 10.1016/j.meegid.2014.11.012 25461848
Cruz L, Vivas A, Montilla M, Hernández C, Flórez C, Parra E, et al. Comparative study of the biological properties of Trypanosoma cruzi I genotypes in a murine experimental model. Infect Genet Evol. 2015;29:110–7.25461848
27. Carreira JC Jansen AM de Nazareth Meirelles M Costa e Silva F Lenzi HL Trypanosoma cruzi in the scent glands of Didelphis marsupialis: the kinetics of colonization Exp Parasitol 2001 97 129 140 10.1006/expr.2001.4603 11312575
Carreira JC, Jansen AM, de Nazareth Meirelles M, Costa e Silva F, Lenzi HL. Trypanosoma cruzi in the scent glands of Didelphis marsupialis: the kinetics of colonization. Exp Parasitol. 2001;97:129–40.11312575
28. Torhorst CW White ZS Bhosale CR Beatty NL Wisely SM Identification of the parasite, Trypanosoma cruzi, in multiple tissues of epidemiological significance in the Virginia opossum (Didelphis virginiana): implications for environmental and vertical transmission routes PLoS Negl Trop Dis 2022 16 e0010974 10.1371/journal.pntd.0010974 36534706
Torhorst CW, White ZS, Bhosale CR, Beatty NL, Wisely SM. Identification of the parasite, Trypanosoma cruzi, in multiple tissues of epidemiological significance in the Virginia opossum (Didelphis virginiana): implications for environmental and vertical transmission routes. PLoS Negl Trop Dis. 2022;16:e0010974.36534706
29. Hernández C Cucunubá Z Parra E Toro G Zambrano P Ramírez JD Chagas disease (Trypanosoma cruzi) and HIV co-infection in Colombia Int J Infect Dis 2014 26 146 148 10.1016/j.ijid.2014.04.002 25080354
Hernández C, Cucunubá Z, Parra E, Toro G, Zambrano P, Ramírez JD. Chagas disease (Trypanosoma cruzi) and HIV co-infection in Colombia. Int J Infect Dis. 2014;26:146–8.25080354
30. Martins-Melo FR Castro MC Werneck GL Heukelbach J Deaths related to Chagas disease and HIV/AIDS coinfection in Brazil: a nationwide population-based analysis Trans R Soc Trop Med Hyg 2022 116 579 588 10.1093/trstmh/trab183 34891173
Martins-Melo FR, Castro MC, Werneck GL, Heukelbach J. Deaths related to Chagas disease and HIV/AIDS coinfection in Brazil: a nationwide population-based analysis. Trans R Soc Trop Med Hyg. 2022;116:579–88.34891173
31. Margioto Teston AP de Abreu AP Abegg CP Gomes ML de Ornelas Toledo MJ Outcome of oral infection in mice inoculated with Trypanosoma cruzi IV of the Western Brazilian Amazon Acta Trop 2017 166 212 217 10.1016/j.actatropica.2016.11.019 27876646
Margioto Teston AP, de Abreu AP, Abegg CP, Gomes ML, de Ornelas Toledo MJ. Outcome of oral infection in mice inoculated with Trypanosoma cruzi IV of the Western Brazilian Amazon. Acta Trop. 2017;166:212–7.27876646
32. Matos GM Lewis MD Talavera-López C Yeo M Grisard EC Messenger LA Microevolution of Trypanosoma cruzi reveals hybridization and clonal mechanisms driving rapid genome diversification Elife 2022 11 e75237 10.7554/eLife.75237 35535495
Matos GM, Lewis MD, Talavera-López C, Yeo M, Grisard EC, Messenger LA, et al. Microevolution of Trypanosoma cruzi reveals hybridization and clonal mechanisms driving rapid genome diversification. Elife. 2022;11:e75237.35535495
