
==== Front
Vet Res
Vet Res
Veterinary Research
0928-4249
1297-9716
BioMed Central London

1361
10.1186/s13567-024-01361-3
Research Article
Vector competence of Culex quinquefasciatus for Tembusu virus and viral factors for virus transmission by mosquitoes
Tang Yibin 1
He Yu 1234
Wang Xiaoli 1
Wu Zhen 1234
Du Senyan 5
Wang Mingshu 123
Jia Renyong 123
Zhu Dekang 123
Liu Mafeng 123
Zhao Xinxin 123
Yang Qiao 123
Wu Ying 123
Zhang Shaqiu 123
Huang Juan 123
Ou Xumin 1234
Sun Di 123
Cheng Anchun chenganchun@vip.163.com

123
http://orcid.org/0000-0002-7488-1037
Chen Shun shunchen@sicau.edu.cn

1234
1 https://ror.org/0388c3403 grid.80510.3c 0000 0001 0185 3134 Institute of Veterinary Medicine and Immunology, Sichuan Agricultural University, Chengdu, 611130 Sichuan China
2 https://ror.org/0388c3403 grid.80510.3c 0000 0001 0185 3134 Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, 611130 Sichuan China
3 https://ror.org/0388c3403 grid.80510.3c 0000 0001 0185 3134 Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, 611130 Sichuan China
4 https://ror.org/03m01yf64 grid.454828.7 0000 0004 0638 8050 Key Laboratory of Agricultural Bioinformatics, Ministry of Education, Chengdu, 611130 Sichuan China
5 https://ror.org/0388c3403 grid.80510.3c 0000 0001 0185 3134 Research Center for Swine Diseases, Sichuan Agricultural University, Chengdu, 611130 Sichuan China
Handling editor: Stéphane Biacchesi.

18 9 2024
18 9 2024
2024
55 1098 3 2024
5 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
The ongoing epidemic of flaviviruses worldwide has underscored the importance of studying flavivirus vector competence, considering their close association with mosquito vectors. Tembusu virus is an avian-related mosquito-borne flavivirus that has been an epidemic in China and Southeast Asia since 2010. However, the reason for the outbreak of Tembusu virus in 2010 remains unclear, and it is unknown whether changes in vector transmission played an essential role in this process. To address these questions, we conducted a study using Culex quinquefasciatus as a model for Tembusu virus infection, employing both oral infection and microinjection methods. Our findings confirmed that both vertical and venereal transmission collectively contribute to the cycle of Tembusu virus within the mosquito population, with persistent infections observed. Importantly, our data revealed that the prototypical Tembusu virus MM_1775 strain exhibited significantly greater infectivity and transmission rates in mosquitoes than did the duck Tembusu virus (CQW1 strain). Furthermore, we revealed that the viral E protein and 3′ untranslated region are key elements responsible for these differences. In conclusion, our study sheds light on mosquito transmission of Tembusu virus and provides valuable insights into the factors influencing its infectivity and transmission rates. These findings contribute to a better understanding of Tembusu virus epidemiology and can potentially aid in the development of strategies to control its spread.

Keywords

Tembusu virus
Culex quinquefasciatus
vector competence
mosquito transmission
vertical transmission
venereal transmission
http://dx.doi.org/10.13039/501100012232 National Key Clinical Specialty Discipline Construction Program of China 2022YFD1801900 Chen Shun http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 32272976 32302848 He Yu Chen Shun Sichuan Provincial Department of Science and Technology international scientific and technological innovation cooperation2022YFH0026 Chen Shun the earmarked fund for China Agriculture Research SystemCARS-42-17 Chen Shun the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research SystemSCCXTD-2021-18 Chen Shun issue-copyright-statement© L’Institut National de Recherche en Agriculture, Alimentation et Environnement (INRAE) 2024
==== Body
pmcIntroduction

Mosquito-borne flaviviruses, such as Zika virus (ZIKV), Dengue virus (DENV), Japanese encephalitis virus (JEV), and yellow fever virus (YFV), pose significant threats to global public health, causing various diseases in animals and humans worldwide. Among these flaviviruses, Tembusu virus (TMUV) is an emerging mosquito-borne flavivirus that causes severe neurological and reproductive diseases in birds.

TMUV (MM_1775 strain) was first isolated from Cx. tritaeniorhynchus mosquitoes in Malaysia in 1955 [1]. However, it was only sporadically reported in subsequent decades. In 2010, an infectious disease characterized by duck egg-drop syndrome broke out in China, resulting in significant economic losses. The pathogen responsible for this outbreak was eventually confirmed as duck TMUV. Currently, TMUV strains are classified into three clusters based on their major antigen gene E [2, 3]. Cluster 1 includes TMUV strains isolated from Southeast Asia, while Cluster 2 consists of most waterfowl-origin isolates from China and Southeast Asian countries. Most of the duck TMUV isolated in China since 2010 fall into Cluster 2.2. The mosquito-origin TMUV, including the MM_1775 strain, and the recent chicken-origin TMUV (since 2020) form Cluster 3 [2].

TMUV exhibits broad host tropism and has been isolated from mosquitoes and various avian species, including ducks, chickens, geese, and sparrows. In laboratory studies, TMUV has shown efficient replication in avian (i.e., DF-1, embryo fibroblasts of duck and goose), mosquito (i.e., C6/36), and mammalian (i.e., Vero, BHK-21, HEK293, HepG2 and SH-SY5Y) cell lines. Although TMUV exhibits high neurovirulence in mice, it does not show neuroinvasiveness in adult mice. Serological investigations in China [4] and Thailand [5] have detected high anti-TMUV antibody titres in individuals at risk, such as workers on duck farms or nearby residents, and a high positive rate of TMUV by RT-PCR in duck farm workers in China has also been reported [4]. This raises the possibility that TMUV is a potentially zoonotic flavivirus.

Most mosquito-borne flaviviruses, such as ZIKV and DENV, undergo a cycle between mosquitoes and vertebrate hosts in nature. When mosquitoes bite and feed on infected hosts, they acquire virions that circulate in the host's blood. Then, the viruses establish an infection in the mosquito midgut and disseminate to other organs through the mosquito haemocoel. After robust virus replication in the salivary glands, the virus can be transmitted to naive hosts through mosquito biting. Within the mosquito population, both vertical transmission and venereal transmission routes have been confirmed to maintain flavivirus infection [6, 7]. In vertebrate hosts, viruses are injected intradermally by mosquitoes during a new blood meal. Immune cells in the skin, such as dendritic cell subsets, monocytes, and macrophages, are permissive for initial flavivirus infection in hosts and subsequently disseminate to systemic tissues through blood circulation [8]. Enhanced mosquito vector transmission of flaviviruses can significantly contribute to their epidemic potential. For example, a single mutation within the NS1 protein has been shown to increase ZIKV infectivity and prevalence in Aedes aegypti and therefore could have facilitated ZIKV transmission during its epidemic in 2016 [9].

Despite significant progress in understanding various aspects of TMUV over the past decade, our knowledge of its mosquito transmission remains limited. Although TMUV has been identified in different mosquitoes, such as Cx. pipiens, and the vector competence of Cx. pipiens has been experimentally confirmed [10], the mechanisms of TMUV cycling within mosquito populations are still unknown. Additionally, it is unclear whether evolutionary variations have an impact on viral infectivity and prevalence in mosquitoes.

In this study, we established a Cx. quinquefasciatus model for TMUV and conducted a detailed analysis of the transmission routes of TMUV within mosquito populations, as well as the viral factors affecting TMUV infection in mosquitoes. These findings will contribute to a better understanding of the vector transmission of TMUV.

Materials and methods

Viruses

Both TMUV strains used in the present study were rescued from infectious clones [11, 12], and all virus stocks were prepared in BHK-21 cells. CQW1 (KM233707.1) is a duck-origin strain isolated in 2013, while the prototypical strain MM_1775 (JX477685.2) was isolated from Cx. tritaeniorhynchus in Malaysia in 1955.

The chimeric TMUV MM/CQ-3′UTR has been reported previously [13]. MM/CQ-E and MM/CQ-NS1 were generated by replacing the entire MM_1775-E gene or NS1 gene with the corresponding genes from CQW1 using reverse genetic techniques.

Thoracic microinjection of TMUV in mosquitoes

At 7–10 days post-hatching, the mosquitoes were anaesthetized on a cold tray and fixed on their sides using forceps. Under a stereomicroscope (Phenix, China), the thorax of each mosquito was examined to identify a distinct “V”-shaped soft tissue area that lacks the protection of the mosquito cuticle. TMUV, diluted in DMEM to a specific titre, was microinjected into this thoracic region. The injection tip (RWD, China) was inserted to a shallow depth to avoid causing damage, with a total injection volume of 300 nL per mosquito. Following the injection, the mosquitoes were maintained under standard conditions of 28 ± 2 °C and 80% humidity. The survival of the injected mosquitoes was monitored and documented at 24–48 h post-infection. Seven days post-infection, live mosquitoes were collected and subjected to RT-qPCR analysis to assess the viral loads.

Membrane blood feeding

Commercial defibrinated sheep blood or heat-inactivated duck, mouse, or rabbit blood (following a pretreatment procedure similar to a previously reported method [9]) was gently mixed with TMUV at a 1:1 ratio. The mixed blood solution was then added to the membrane feeding system for blood-sucking insects (Hemotek, USA), and the temperature was maintained at 37 ℃. Subsequently, the feeders were placed into mosquito cups containing female mosquitoes starved from water and sucrose for 1–2 days. After approximately 45 min of blood meal in the dark, the feeder was removed, and the engorged female mosquitoes were selected, transferred to new containers and kept under standard conditions. Eight days post infection, live mosquitoes were collected and subjected to RT-qPCR analysis.

For the persistent TMUV infection experiment, 180 female mosquitoes were selected and randomly divided into 6 groups, with 30 mosquitoes in each group. Blood with a virus titre of 105.5 TCID50/mL was fed, and live mosquitoes were detected on days 7, 14, and 35. The experiment was limited to 35 days because mosquitoes began to die after this time point.

Mosquito transmission of MM_1775 and CQW1

At 7–10 days post hatching, a total of 240 female mosquitoes were randomly divided into 6 groups, with 40 mosquitoes in each group. After starvation treatment for 1–2 days, the mosquitoes were orally infected with MM_1775 or CQW1 at a titre of 105.5 TCID50/mL. At 4, 7, and 14 days post-infection, tissue samples from the mosquito midgut, head/legs, and salivary glands were collected. These samples were then subjected to RT-qPCR analysis to determine the virus infection rate (IR), dissemination rate (DR), and transmission rate (TR).

To determine the differences in mosquito vector competence between MM_1775 and CQW1, female mosquitoes were orally infected with MM_1775, TMUV MM/CQ-3′UTR, MM/CQ-E or MM/CQ-NS1 at a dose of 105 TCID50/mL. At 8 days post-infection, the mosquitoes were killed to detect IR. To further confirm these results, 103 TCID50/mL of each virus were microinjected into mosquitoes, and at 7 days post-infection, the mosquitoes were killed to detect IR.

Venereal transmission

The experimental procedure for the venereal transmission study was similar to a previously reported method [6] with slight modifications. In brief, Culex mosquitoes were divided into 4 groups, consisting of two female groups and two male groups. After a 24-h starvation period, one group of virgin female mosquitoes and one group of male mosquitoes were injected with CQW1 at a concentration of 105 TCID50/mL. The remaining two groups were injected with MM_1775. One day post-infection, the survival of the mosquitoes was recorded, and an equal number of naive female/male mosquitoes were assigned to each group to allow for mating. A piece of cotton mesh soaked in a 10% sucrose solution was provided for mosquito feeding (the sucrose solution was replaced daily) and placed on top of the cage to prevent oral contamination.

Vertical transmission

For the assessment of vertical transmission, at 7–10 days post-eclosion, 40 female mosquitoes were microinjected with CQW1 virus at a dose of 105 TCID50/mL. These infected females were then housed with male mosquitoes. To stimulate egg laying, anaesthetized Kunming mice were placed on top of the container for mosquito feeding and allowed to feed for approximately 30 min (the mosquitoes were starved for 24 h prior to engorgement). After laying eggs, a portion of the eggs was directly subjected to virus detection, while the remaining eggs were hatched, and the resulting larvae were raised to adulthood for subsequent virus detection.

RNA extraction and RT–qPCR

Total RNA was isolated from the mosquitoes using a Total RNA Extraction Kit (Axygen, USA) per the manufacturer’s instructions. Subsequently, 1st-strand cDNA was transcribed using a HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). To detect viral copies, RT–qPCR assays were performed using 2 × Taq SYBR Green qPCR Premix (Innovagene, Changsha, China) with a CFX Connect Real-Time PCR Detect System (Bio-Rad, USA) following the manufacturer’s protocols. The primers used for RT-qPCR are listed in Table 1. Table 1 RT-qPCR primers used to detect TMUV

Primer	Sequence (5′–3′)	
CQW1-E-qPCR-F	AATGGCTGTGGCTTGTTTGG	
CQW1-E-qPCR-R	GGGCGTTATCACGAATCTA	
MM_1775-NS5-qPCR-F	GAAATCGAATCTGCCAGGAC	
MM_1775-NS5-qPCR-F	CCGCTCACCCAATACATC	

Quantification and statistical analysis

The RT-qPCR data are presented as the mean ± standard error of the mean (SEM). Using GraphPad Prism 9.5 software, statistical significance was assessed by Student’s t test, and significance was defined by a P value < 0.05 (*).

Results

Cx. quinquefasciatus model for TMUV infection through membrane blood feeding

To simulate the infection process through mosquito bites, we initially employed the membrane blood feeding method to establish a Cx. quinquefasciatus model for studying TMUV transmission. We tested four different sources of blood from various animal hosts (duck, mouse, rabbit, and sheep) for infection (Figure 1A). As shown in Figures 1B–D, when feeding on duck blood, the IR of the mosquito TMUV (MM_1775 strain) was significantly greater than that of the duck TMUV (CQW1 strain). This may be attributed to the interaction between the duck host and the viruses. MM_1775 also showed a slightly greater IR than did CQW1 when fed with blood from other sources, although the difference was not statistically significant. Nevertheless, the data indicate that all blood from different host sources is competent for TMUV infection through membrane blood feeding. When commercial fibre sheep blood was used, the Culex infection rates of CQW1 and MM_1775 were relatively high, and considering the convenience and easy access of blood, sheep blood was used for subsequent membrane blood feeding.Figure 1 Cx. quinquefasciatus model for TMUV infection through membrane blood feeding. A Female Cx. quinquefasciatus mosquitoes were orally infected with either the CQW1 or MM_1775 virus via different blood sources from mice, ducks, rabbits, or sheep. B At 8 days post-infection, the infection rates of CQW1 were determined using RT-qPCR. C The infection rates of MM_1775. D Infection rate comparison of MM_1775 and CQW1 from (B, C). E The minimum dose required for MM_1775 virus infection through membrane blood feeding was determined. Statistical significance: *P < 0.05.

To determine the minimum dose of TMUV required to establish infection in Culex mosquitoes through membrane blood feeding, we performed a series of tenfold continuous dilutions of the MM_1775 virus solution (in DMEM) and mixed it with sheep blood for feeding. As shown in Figure 1E, most mosquitoes survived at 2 days post-infection. Surprisingly, an IR of 61.1% (11/18) was observed only at a dose of 105 TCID50/mL, and no viral RNA was detected when the infection dose was less than 104 TCID50/mL. These findings suggest that Cx. quinquefasciatus is competent for both the MM_1775 and CQW1 strains through membrane blood feeding.

Compared with duck TMUV, mosquito TMUV exhibits greater infectivity in Cx. quinquefasciatus

Next, we used another artificial infection mode, microinjection, to determine the infective dose required for establishing infection (Figure 2A). As shown in Figure 2B, the IR of the CQW1 strain dramatically decreased from 95.2% (20/21) to 7.7% (1/13) when the infection dose decreased from 105 TCID50/mL to 102 TCID50/mL. In contrast, the MM_1775 strain exhibited greater potency, maintaining 100% IR when the infection dose was not less than 103 TCID50/mL (Figure 2C). Even at a very low dose of 102 TCID50/mL, 68.8% IR remained. These data suggest that MM_1775 is significantly more effective at infecting Cx. quinquefasciatus compared to CQW1 at the same dose.Figure 2 Mosquito TMUV is more infectious than duck TMUV in Cx. quinquefasciatus. A Female mosquitoes were infected with these two viruses through microinjection. At 7 days post infection, the infection rates were determined using RT-qPCR. B Culex mosquitoes were injected with CQW1 at various concentrations. C Culex mosquitoes were injected with MM_1775 at various concentrations.

Currently, there are limited data available on the vector transmission of TMUV. To better understand the effect of different virus strains on viral vector transmission, we compared the virus dissemination and transmission of the MM_1775 strain with those of the CQW1 strain. As shown in Table 2, viral dissemination of MM_1775 was consistently detected at all timepoints. In contrast, the dissemination of CQW1 viruses was detected only at later timepoints. Most importantly, only MM_1775 viruses were detected in the salivary glands of the mosquitoes, while no CQW1 virus RNA was detected under the same conditions. These results suggest that the mosquito-derived strain MM_1775 has a better transmission capability in mosquitoes than does the duck-derived strain CQW1. Table 2 Viral infection, dissemination, and transmission of CQW1 and MM_1775

Days	IR	DR	TR	
CQW1	MM_1775	CQW1	MM_1775	CQW1	MM_1775	
4	100%

(14/14)

	90.9%

(20/22)

	0	15%

(3/20)

	0	0	
7	100%

(15/15)

	73.7%

(14/19)

	33.3%(5/15)	14.3%

(2/14)

	0	50%

(1/2)

	
14	76.9%

(10/13)

	100%

(18/18)

	20%

(2/10)

	27.8%

(5/18)

	0	20%

(1/5)

	
IR (Infection rate): number of positive midgut samples/total number of female mosquitoes tested.

DR (Dissemination rate): number of positive head and leg samples/number of total samples.

TR (Transmission rate): number of positive salivary gland samples/number of total samples.

Viral factors influencing the vector transmission of TMUV

To further investigate the viral determinants affecting TMUV transmission, a set of chimeric viruses was generated using MM_1775 as the backbone. Following feeding with 105 TCID50/mL TMUV in a blood meal, the presence of virus was detected to calculate the IR at 8 days post-infection (Figures 3A–C). The IRs of the MM/CQ-E virus and MM/CQW1-3′UTR were 33.3% (5/15) and 23.5% (4/17), respectively, which were significantly lower than that of the wild-type MM_1775 (93.8%). However, the replacement of NS1 had little effect on IR in mosquitoes. When Culex mosquitoes were infected via microinjection, all chimeric TMUVs reached 100% IR, but the viral loads of the MM/CQW1-3′UTR strains were lower than those of the other strains (Figures 3D–F). The results suggest that variations in the E protein and 3′UTR, but not in NS1, are responsible for the differences in mosquito infection between the MM_1775 and CQW1 strains.Figure 3 Viral factors involved in vector transmission of TMUV. A Infection rate of Culex mosquitoes orally infected with these chimeric viruses. B Viral copies of positive samples from (A). C Comparison of the infection rates from (A). D Infection rate of Culex mosquitoes infected with these chimeric viruses by microinjection. E Viral copies of positive samples from (D). F Comparison of the infection rates from (D). The data are presented as the means ± SEM. Statistical significance: *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Venereal transmission of TMUV in paired mosquitoes

In the natural cycle, mosquito-borne flaviviruses are transmitted by female mosquito bites. However, the possibility of male mosquitoes acting as virus reservoirs through sexual transmission cannot be excluded. Therefore, we measured the viral loads and IRs of TMUV in both female and male mosquitoes (Figure 4A). Similar levels of CQW1 viral loads were detected in both female and male mosquitoes on days 4, 7 and 14 post-infection (Figure 4B), with no significant difference in the IRs between the sexes of Culex mosquitoes. Similar results were observed for the mosquito TMUV MM_1775 strain (Figure 4C), indicating that the sex of Culex mosquitoes has no effect on TMUV transmission among mosquitoes.Figure 4 Venereal transmission of TMUV in paired mosquitoes. A To compare the sex of Culex mosquitoes during viral infection, female or male mosquitoes were infected with MM_1775 or CQW1 through microinjection. B The infection rate of female or male mosquitoes infected with CQW1. C The infection rate of female or male mosquitoes infected with MM_1775. D The experimental procedure for detecting venereal transmission. Female (or male) mosquitoes were infected with CQW1 or MM_1775 through microinjection. At 1 day post-infection, virgin males (or females) were introduced into the respective female (or male) infected cages to allow them to freely mate for 5 days. Finally, virus infection was determined using RT-qPCR. E The infection rate detected from (D). The data are presented as the means ± SEM.

To assess whether TMUV can be transmitted from female to male or from male to female mosquitoes, infected female or male mosquitoes were grouped into mating pairs with naive male or female mosquitoes, respectively (Figure 4D). Both the MM_1775 and CQW1 viruses exhibited female-to-male transmission, with minimum infection rates (MRRs) of 4.8% and 6.66%, respectively (Figure 4E). Male-to-female transmission was also detected at an MIR of 3.84% for the MM_1775 virus. These findings indicate that TMUV can be transmitted in both directions, from male to female as well as from female to male.

Vertical transmission of TMUV in Culex mosquitoes

It is believed that vertical transmission is the primary route for maintaining flaviviruses within mosquito populations. To verify whether TMUV can be vertically transmitted, female mosquitoes were infected with CQW1 viruses through microinjection. At 7 days post-infection, the infected mosquitoes were co-raised with mice to encourage mosquito bites and blood feeding, which would stimulate the females to lay eggs. A portion of the laid eggs was collected for virus detection, while the remaining eggs were used for hatching mosquito larvae (Figure 5A).Figure 5 Vertical transmission of TMUV in Culex mosquitoes. A Female mosquitoes were microinjected with the CQW1 virus, and at 7 days post-infection, the mosquitoes were allowed to bite a blood meal. The engorged mosquitoes were continuously reared for oviposition. B A portion of mosquito eggs was collected to detect virus infection. C The remaining mosquito eggs were allowed to hatch, and the virus infection rate was detected at the adult stage. The data are presented as the means ± SEM.

Among the collected mosquito egg samples, 13.8% (4/29) tested positive for TMUV, with a viral copy number of 105.091±0.9267 (Figure 5B, Table 3). After hatching and reaching adulthood, 25.9% (7/27) of the female mosquito sample pools were positive for TMUV, with an MIR of 5.2% (7/135) and a copy number of 105.469±0.0873 (Figure 5C, Table 3). Additionally, 47.2% (17/36) of the male mosquito sample pools were positive, with an MIR of 9.4% (17/180) and a copy number of 105.609±0.0953. These findings indicate that viral RNA can be detected in both the egg stage and adult stage, suggesting that TMUV can be vertically transmitted within Culex mosquitoes. Table 3 Analysis of the infection rates of vertical transmission

Strain	Stage	IR (%)	MIR (%)	RNA copies (log10)	
CQW1	Egg (29/pool)	13.8 (4/29)	/	5.091 ± 0.9267	
Adult-Female (27/pool)	25.9 (7/27)	5.2 (7/135)	5.469 ± 0.0873	
Adult-male (36/pool)	47.2 (17/36)	9.4 (17/180)	5.609 ± 0.0953	
IR: number of positive pools/number of total pools.

The minimum infection rate (MIR) was calculated as the number of positive pools/number of total mosquitoes.

Persistent infection of TMUV in Culex mosquitoes

While it is well established that many arboviruses can cause persistent infections in mosquitoes, the details of the vector competency of Cx. quinquefasciatus for specific arboviruses are less well understood. Therefore, we determined the duration of TMUV infection in Culex mosquitoes. As expected, CQW1 displayed a lower IR than MM_1775, but viral RNA was still detected at 35 days post-infection (Figure 6A). For MM_1775, the IR increased from 80% (4/5) to 100% (5/5) between day 7 and day 14 after infection. Importantly, MM_1775 maintained 60% IR at 35 days post infection (Figure 6B). These results indicate persistent TMUV infection in Culex mosquitoes.Figure 6 Persistent infection of Culex mosquitoes with TMUV. Female mosquitoes were microinjected with CQW1 or MM_1775 virus, and virus infections were detected at 7, 14, and 35 days post-infection. A CQW1 infection. B MM_1775 infection.

Discussion

TMUV was first identified in Malaysia from Cx. tritaeniorhynchus. However, it was only occasionally reported in Southeast Asia in the following decades. In 2010, duck farms in most duck-breeding regions of China experienced an outbreak of an infectious disease known as duck egg-drop syndrome, and it was finally confirmed that TMUV was the cause. TMUV has since been detected in several species of Culex mosquitoes, including Cx. tritaeniorhynchus, Cx. vishnui, Cx. quinquefasciatus, Cx. annulus, and Cx. pipiens [14]. Therefore, Culex spp. have been proposed as the main transmission vectors for TMUV, particularly Cx. tritaeniorhynchus [15]. However, the vector competence of Culex mosquitoes has not been thoroughly characterized in the past decade.

In this study, we assessed the vector competence of Cx. quinquefasciatus and analysed the factors associated with vector transmission of TMUV in mosquitoes. Consistent with a previous report [15], only a high titre of TMUV (≥ 105 TCID50/mL) resulted in successful infection when Cx. quinquefasciatus were challenged orally. This high titre requirement may be due to the lack of essential host factors or viral proteins that help mosquitoes acquire virions during the blood feeding process. This phenomenon has been widely reported for other mosquito-borne flaviviruses [8]. For example, ZIKV NS1 antigenemia promoted virion acquisition by mosquitoes, thereby facilitating transmission during the ZIKV epidemic in 2016 [9].

Compared to membrane blood feeding, microinjection is a more convenient and effective approach for infecting mosquitoes. However, the microinjection method cannot accurately reflect the process of infection during mosquito blood feeding because it skips the step of virus establishment in the midgut. However, it can be used as a supplement to membrane blood feeding methods and can be used to directly evaluate the level of virus replication in mosquitoes when membrane blood feeding data are insufficient. However, our data still indicate the successful establishment of a mosquito infection model for TMUV.

An increase in infectivity within mosquito vectors, leading to high epidemic potential, has been reported for several mosquito-borne viruses [9, 16, 17]. However, contrary to our expectations, the CQW1 strain showed significantly lower infectivity in mosquitoes than the MM_1775 strain. This result suggested that the outbreak of duck TMUV in China since 2010 may not be correlated with increased mosquito transmission of TMUV, and other routes of viral transmission (such as contact transmissibility) may play important roles in this process.

Flavivirus evolution shapes virus fitness in both vertebrate hosts and mosquitoes. Various viral determinants, such as C, E, NS1 and the 3′UTR, have been shown to influence flavivirus infectivity and transmission in mosquitoes [18]. In the present study, we revealed that both the E protein and the 3′UTR of TMUV contributed to differences in infectivity and transmission between MM_1775 and CQW1 in mosquitoes. The flavivirus E protein is a key envelope protein that controls virus attachment and entry, affecting viral host specificity and tissue/cell tropism. Additionally, the 3′UTR of flaviviruses, with its RNA structures and genomic variations, plays a role in host adaptation [19–21]. The 3′UTR is responsible for generating subgenomic flavivirus RNA (sfRNA), which can enhance mosquito transmission [22]. The structure of the 3′UTR determines the number and abundance of sfRNAs. In this study, we observed a significant decrease in the in vivo infectivity of TMUV in mosquitoes when the MM_1775 3′UTR was replaced with the CQW1 3′UTR, consistent with our previous findings [13] that the TMUV 3′UTR is responsible for cell-specific adaptation. However, further research is needed to elucidate the detailed mechanism underlying this phenomenon.

In conclusion, the present study successfully established the Cx. quinquefasciatus model for TMUV infection in the laboratory and investigated important factors associated with mosquito vector competence and transmission. These findings provide valuable insights for future research on TMUV mosquito transmission.

Acknowledgements

This work was funded by grants from the National Key Research and Development Program of China (2022YFD1801900), National Natural Science Foundation of China (32272976 & 32302848), Sichuan Provincial Department of Science and Technology International Scientific and Technological Innovation Cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System (CARS-42-17), Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18), and the Innovation and Demonstration of Industry and Education Integration in Feed Industrial Chain Transformation and Upgradation, Sichuan Province, China. The funding bodies had no role in the design of the study; the collection, analysis, or interpretation of the data; or the writing of the manuscript.

Authors’ contributions

SC, YT and XW designed the research; YT and XW performed the research; SD provided the experimental material; YT and YH analysed the data; and YH and SC wrote the paper. ZW, MW, RJ, DZ, ML, XZ, QY, YW, SZ, JH, XO, DS, and AC helped with the experiments. All authors have read and approved the final manuscript.

Funding

The National Key Research and Development Program of China (2022YFD1801900), the National Natural Science Foundation of China (32272976 and 32302848), the Sichuan Provincial Department of Science and Technology International Scientific and Technological Innovation Cooperation (2022YFH0026), the earmarked fund for the China Agriculture Research System (CARS-42–17), and the Program Sichuan Veterinary Medicine and Drug Innovation Group of the China Agricultural Research System (SCCXTD-2021–18) were used.

Availability of data and materials

All the data used to understand and assess the conclusions of this study are available in this published article. The raw data that support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

The experiments were approved by the Institutional Animal Care and Use Committee of Sichuan Agriculture University in Sichuan, China (Protocol Permit Number: SYXK (川) 2019–187).

Competing interests

The authors declare that they have no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yibin Tang, Yu He and Xiaoli Wang are contributed equally to this work.
==== Refs
References

1. US Army Medical Research Unit (Malaya) Institute for medical research FoM (1957) annual report 1957 Kuala Lampur Institute for Medical Research
US Army Medical Research Unit (Malaya) (1957) Institute for medical research FoM (1957) annual report. Institute for Medical Research, Kuala Lampur
2. Huang Y Hu Z Dong J Li L Zhang J Kuang R Gao S Sun M Liao M Chicken-origin Cluster 3.2 Tembusu virus exhibits higher infectivity than duck-origin Cluster 2 Tembusu virus in chicks Front Vet Sci. 2023 10 1152802 10.3389/fvets.2023.1152802 37035806
Huang Y, Hu Z, Dong J, Li L, Zhang J, Kuang R, Gao S, Sun M, Liao M (2023) Chicken-origin Cluster 3.2 Tembusu virus exhibits higher infectivity than duck-origin Cluster 2 Tembusu virus in chicks. Front Vet Sci. 10:115280237035806
3. Yan D Li X Wang Z Liu X Dong X Fu R Su X Xu B Teng Q Yuan C Zhang Z Liu Q Li Z The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China Vet Microbiol. 2022 272 109500 10.1016/j.vetmic.2022.109500 35792374
Yan D, Li X, Wang Z, Liu X, Dong X, Fu R, Su X, Xu B, Teng Q, Yuan C, Zhang Z, Liu Q, Li Z (2022) The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China. Vet Microbiol. 272:10950035792374
4. Tang Y Gao X Diao Y Feng Q Chen H Liu X Ge P Yu C Tembusu virus in human, China Transbound Emerg Dis 2013 60 193 196 10.1111/tbed.12085 23551969
Tang Y, Gao X, Diao Y, Feng Q, Chen H, Liu X, Ge P, Yu C (2013) Tembusu virus in human, China. Transbound Emerg Dis 60:193–19623551969
5. Pulmanausahakul R Ketsuwan K Jaimipuk T Smith DR Auewarakul P Songserm T Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks Transbound Emerg Dis 2022 69 870 873 10.1111/tbed.13998 33470024
Pulmanausahakul R, Ketsuwan K, Jaimipuk T, Smith DR, Auewarakul P, Songserm T (2022) Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks. Transbound Emerg Dis 69:870–87333470024
6. Campos SS Fernandes RS Dos Santos AAC de Miranda RM Telleria EL Ferreira-de-Brito A de Castro MG Failloux AB Bonaldo MC Lourenco-de-Oliveira R Zika virus can be venereally transmitted between Aedes aegypti mosquitoes Parasit Vectors 2017 10 605 10.1186/s13071-017-2543-4 29246237
Campos SS, Fernandes RS, Dos Santos AAC, de Miranda RM, Telleria EL, Ferreira-de-Brito A, de Castro MG, Failloux AB, Bonaldo MC, Lourenco-de-Oliveira R (2017) Zika virus can be venereally transmitted between Aedes aegypti mosquitoes. Parasit Vectors 10:60529246237
7. Thangamani S Huang J Hart CE Guzman H Tesh RB Vertical transmission of Zika virus in Aedes aegypti mosquitoes Am J Trop Med Hyg 2016 95 1169 1173 10.4269/ajtmh.16-0448 27573623
Thangamani S, Huang J, Hart CE, Guzman H, Tesh RB (2016) Vertical transmission of Zika virus in Aedes aegypti mosquitoes. Am J Trop Med Hyg 95:1169–117327573623
8. Yu X Zhu Y Xiao X Wang P Cheng G Progress towards understanding the mosquito-borne virus life cycle Trends Parasitol 2019 35 1009 1017 10.1016/j.pt.2019.09.006 31669148
Yu X, Zhu Y, Xiao X, Wang P, Cheng G (2019) Progress towards understanding the mosquito-borne virus life cycle. Trends Parasitol 35:1009–101731669148
9. Liu Y Liu J Du S Shan C Nie K Zhang R Li XF Zhang R Wang T Qin CF Wang P Shi PY Cheng G Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes Nature 2017 545 482 486 10.1038/nature22365 28514450
Liu Y, Liu J, Du S, Shan C, Nie K, Zhang R, Li XF, Zhang R, Wang T, Qin CF, Wang P, Shi PY, Cheng G (2017) Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes. Nature 545:482–48628514450
10. Guo X Jang T Jiang Y Zhao T Zhao T Potential vector competence of mosquitoes to transmit Baiyangdian virus, a new Tembusu-related virus in China Vector Borne Zoonotic Dis 2020 20 541 546 10.1089/vbz.2019.2523 32240075
Guo X, Jang T, Jiang Y, Zhao T, Zhao T (2020) Potential vector competence of mosquitoes to transmit Baiyangdian virus, a new Tembusu-related virus in China. Vector Borne Zoonotic Dis 20:541–54632240075
11. Wang X He Y Guo J Jiang B Wang M Jia R Zhu D Liu M Zhao X Yang Q Wu Y Zhang S Liu Y Zhang L Yu Y Cheng A Chen S Construction of an infectious clone for mosquito-derived Tembusu virus prototypical strain Virol Sin 2021 36 1678 1681 10.1007/s12250-021-00447-y 34570343
Wang X, He Y, Guo J, Jiang B, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Zhang S, Liu Y, Zhang L, Yu Y, Cheng A, Chen S (2021) Construction of an infectious clone for mosquito-derived Tembusu virus prototypical strain. Virol Sin 36:1678–168134570343
12. Guo J He Y Wang X Jiang B Lin X Wang M Jia R Zhu D Liu M Zhao X Yang Q Wu Y Chen S Cheng A Stabilization of a full-length infectious cDNA clone for duck Tembusu virus by insertion of an intron J Virol Methods 2020 283 113922 10.1016/j.jviromet.2020.113922 32598895
Guo J, He Y, Wang X, Jiang B, Lin X, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Chen S, Cheng A (2020) Stabilization of a full-length infectious cDNA clone for duck Tembusu virus by insertion of an intron. J Virol Methods 283:11392232598895
13. Mao L He Y Wu Z Wang X Guo J Zhang S Wang M Jia R Zhu D Liu M Zhao X Yang Q Mao S Wu Y Zhang S Huang J Ou X Gao Q Sun D Cheng A Chen S Stem-loop I of the Tembusu virus 3′-untranslated region is responsible for viral host-specific adaptation and the pathogenicity of the virus in mice Microbiol Spectr 2022 10 e0244922 10.1128/spectrum.02449-22 36214697
Mao L, He Y, Wu Z, Wang X, Guo J, Zhang S, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Mao S, Wu Y, Zhang S, Huang J, Ou X, Gao Q, Sun D, Cheng A, Chen S (2022) Stem-loop I of the Tembusu virus 3′-untranslated region is responsible for viral host-specific adaptation and the pathogenicity of the virus in mice. Microbiol Spectr 10:e024492236214697
14. Hamel R Phanitchat T Wichit S Morales Vargas RE Jaroenpool J Diagne CT Pompon J Missé D New insights into the biology of the emerging Tembusu virus Pathogens 2021 10 1010 10.3390/pathogens10081010 34451474
Hamel R, Phanitchat T, Wichit S, Morales Vargas RE, Jaroenpool J, Diagne CT, Pompon J, Missé D (2021) New insights into the biology of the emerging Tembusu virus. Pathogens 10:101034451474
15. Sanisuriwong J Yurayart N Thontiravong A Tiawsirisup S Vector competence of Culex tritaeniorhynchus and Culex quinquefasciatus (Diptera: Culicidae) for duck Tembusu virus transmission Acta Trop 2021 214 105785 10.1016/j.actatropica.2020.105785 33309596
Sanisuriwong J, Yurayart N, Thontiravong A, Tiawsirisup S (2021) Vector competence of Culex tritaeniorhynchus and Culex quinquefasciatus (Diptera: Culicidae) for duck Tembusu virus transmission. Acta Trop 214:10578533309596
16. Tsetsarkin KA Vanlandingham DL McGee CE Higgs S A single mutation in chikungunya virus affects vector specificity and epidemic potential PLoS Pathog 2007 3 e201 10.1371/journal.ppat.0030201 18069894
Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S (2007) A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog 3:e20118069894
17. Brault AC Powers AM Ortiz D Estrada-Franco JG Navarro-Lopez R Weaver SC Venezuelan equine encephalitis emergence: enhanced vector infection from a single amino acid substitution in the envelope glycoprotein Proc Natl Acad Sci USA 2004 101 11344 11349 10.1073/pnas.0402905101 15277679
Brault AC, Powers AM, Ortiz D, Estrada-Franco JG, Navarro-Lopez R, Weaver SC (2004) Venezuelan equine encephalitis emergence: enhanced vector infection from a single amino acid substitution in the envelope glycoprotein. Proc Natl Acad Sci USA 101:11344–1134915277679
18. Wang X Usama A Huanchun C Cao S Ye J Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses Emerg Microb Infect 2023 12 2212812 10.1080/22221751.2023.2212812
Wang X, Usama A, Huanchun C, Cao S, Ye J (2023) Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses. Emerg Microb Infect 12:2212812
19. Villordo SM Carballeda JM Filomatori CV Gamarnik AV RNA structure duplications and flavivirus host adaptation Trends Microbiol 2016 24 270 283 10.1016/j.tim.2016.01.002 26850219
Villordo SM, Carballeda JM, Filomatori CV, Gamarnik AV (2016) RNA structure duplications and flavivirus host adaptation. Trends Microbiol 24:270–28326850219
20. Filomatori CV Carballeda JM Villordo SM Aguirre S Pallarés HM Maestre AM Sánchez-Vargas I Blair CD Fabri C Morales MA Fernandez-Sesma A Gamarnik AV Dengue virus genomic variation associated with mosquito adaptation defines the pattern of viral non-coding RNAs and fitness in human cells PLoS Pathog 2017 13 e1006265 10.1371/journal.ppat.1006265 28264033
Filomatori CV, Carballeda JM, Villordo SM, Aguirre S, Pallarés HM, Maestre AM, Sánchez-Vargas I, Blair CD, Fabri C, Morales MA, Fernandez-Sesma A, Gamarnik AV (2017) Dengue virus genomic variation associated with mosquito adaptation defines the pattern of viral non-coding RNAs and fitness in human cells. PLoS Pathog 13:e100626528264033
21. de Borba L Villordo SM Marsico FL Carballeda JM Filomatori CV Gebhard LG Pallarés HM Lequime S Lambrechts L Sánchez Vargas I Blair CD Gamarnik AV RNA structure duplication in the Dengue virus 3′ UTR: redundancy or host specificity mBio 2019 10 e02506 18 10.1128/mBio.02506-18 30622191
de Borba L, Villordo SM, Marsico FL, Carballeda JM, Filomatori CV, Gebhard LG, Pallarés HM, Lequime S, Lambrechts L, Sánchez Vargas I, Blair CD, Gamarnik AV (2019) RNA structure duplication in the Dengue virus 3′ UTR: redundancy or host specificity. mBio 10:e02506-1830622191
22. Yeh SC Pompon J Flaviviruses produce a subgenomic flaviviral RNA that enhances mosquito transmission DNA Cell Biol 2018 37 154 159 10.1089/dna.2017.4059 29251994
Yeh SC, Pompon J (2018) Flaviviruses produce a subgenomic flaviviral RNA that enhances mosquito transmission. DNA Cell Biol 37:154–15929251994
