
==== Front
Anim Nutr
Anim Nutr
Animal Nutrition
2405-6545
2405-6383
KeAi Publishing

S2405-6545(24)00051-9
10.1016/j.aninu.2024.04.004
Original Research Article
Characterization of serum proteomic and inflammatory profiling at early stage of iron deficiency in weaned piglets
Liu Guang ab
Li Lan ac
Liu Shuan ad
Dong Zhenglin a
Zhou Jian ad
Gong Chengyan ad
Yin Yulong ad
Tang Wenjie wenhan28@126.com
aef⁎
Wan Dan w.dan@isa.ac.cn
a⁎
a Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-Ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China
b Hubei Hongshan Laboratory, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
c Beijing Dabeinong Technology Group Co., Ltd., Beijing 100080, China
d University of Chinese Academy of Sciences, Beijing 101408, China
e Animal Breeding and Genetics Key Laboratory of Sichuan Province, Sichuan Animal Science Academy, Chengdu 610066, China
f Livestock and Poultry Biological Products Key Laboratory of Sichuan Province, Sichuan Animtech Feed Co., Ltd., Chengdu 610066, China
⁎ Corresponding authors. wenhan28@126.comw.dan@isa.ac.cn
16 4 2024
9 2024
16 4 2024
18 380389
10 4 2023
15 1 2024
9 4 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
The objective of this study was to examine the early serum proteomic and inflammatory profiles of weaned piglets subjected to iron deficiency. Twelve healthy piglets (Duroc × Landrace × Large Yorkshire, body weight: 4.96 ± 0.05 kg) were weaned at 21 days of age. Subsequently, these animals were randomly allocated to one of two groups, with six replicates in each group (maintaining a male-to-female ratio of 1:1), the control group (administered 100 mg/kg Fe as FeSO4·H2O) and L-Fe group (no additional Fe supplementation). The results showed that 42 days after initiating, compared with control group, routine blood analysis revealed a reduction in serum iron content, red blood cell (RBC) count, hemoglobin (HGB) content, hematocrit (HCT), and mean corpuscular volume (MCV) (P < 0.05). Subsequent sample analysis indicated a noteworthy decrease in iron deposition in the liver, spleen, and kidneys of piglets fed the L-Fe diet compared with control group (P < 0.05). However, final body weight, average daily gain (ADG), average daily feed intake (ADFI), feed conversion ratio, and tissue coefficients were similar between the two groups (P > 0.05). During the early stages of iron deficiency, piglets exhibited increased villus height (VH) and the ratio of VH to crypt depth (CD) in the duodenum (P < 0.05) and increased expression levels of iron transporters, including duodenal cytochrome (Cybrd), divalent metal transport 1 (DMT1), and ferritin light chain (FTL) (P < 0.05). Subsequently, isobaric tags for relative and absolute quantitation (iTRAQ) were used to identify serum proteins. Gene Ontology (GO) analysis of the differentially abundant proteins (DAP) revealed that 24 of the 30 DAP were involved in platelet function, immune response, cellular metabolism, transcription, and protein synthesis. Notably, prothrombin, asporin (ASPN), and Rac family small GTPase 3 (RAC3) expression was induced, whereas glycoprotein Ib platelet subunit alpha (GPIbA) expression was decreased. This was accompanied by a substantial reduction in serum complement 3 (C3) and complement 4 (C4) contents (P < 0.05), with elevated the contents of interleukin-1β (IL-1β), interleukin-4 (IL-4), interleukin-6 (IL-6), transforming growth factor-β1 (TGF-β1), and tumor necrosis factor-α (TNF-α) (P < 0.05). Our findings underscore the essential role of dietary iron supplementation in maintaining iron homeostasis and modulating inflammatory responses in piglets.

Keywords

Piglet
Iron deficiency
Proteomics
Inflammatory
Cytokine
Immune response
==== Body
pmc1 Introduction

Iron (Fe) is acknowledged as one of the most essential trace elements crucial for animal growth (Jin et al., 2023; Ma et al., 2023). It plays a pivotal role in numerous vital biological functions, encompassing oxygen transport, electron transfer, cellular respiration, and energy metabolism (Rincker et al., 2004). Neonatal piglets are vulnerable to iron deficiency. The National Research Council (NRC, 2012) recommends a standardized dietary contained iron 100 mg/kg for weaned piglets. However, owing to rapid growth, little iron storage and low bioavailability, dietary iron additives might not be sufficient for piglets in livestock production, especially during the weaning period (Eshaghpour et al., 1966; Svoboda and Drabek, 2005). Furthermore, early iron deficiency is often overlooked as it lacks clinical symptoms related to growth and feed consumption. Consequently, iron deficiency remains an important nutritional and metabolic concern in pig production (Dallman, 1987; Rincker et al., 2004).

Iron deficiency is frequently concomitant with various chronic inflammatory diseases (Xiao et al., 2023; Ludwig et al., 2013; Cappellini et al., 2017) that occur due to elevated levels of inflammatory cytokines that regulate hepcidin transcription. The transmembrane function of ferroportin is governed by hepcidin, and increased hepcidin levels promote ferroportin degradation. This degradation, in turn, results in iron deficiency (Hentze et al., 2010; Brasse-Lagnel et al., 2011). Hepcidin expression increases with the activation of inflammatory cytokines, such as interleukin-6 (IL-6) (Armitage et al., 2011). In mice, the administration of 150 or 300 mg of iron chloride solution to iron-deficient mice resulted in a marked decrease in serum contents of interleukin-1α (IL-1α) (Terpilowska and Siwicki, 2009). Therefore, iron deficiency may be accompanied by various inflammatory diseases that can reduce pig performance and even lead to death due to severe inflammation.

The small intestine plays a pivotal role in digestion, absorption, and metabolism of dietary nutrients (Yang et al., 2013; Yin et al., 2023). The structure and function of the small intestine are influenced by changes in the nutritional intake (Pluske et al., 1997). The absorption of dietary ferric iron by duodenal enterocytes occurs primarily through the action of duodenal cytochrome (Cybrd), a ferric reductase that reduces it to ferrous iron. Subsequently, ferrous iron is transported into epithelial cells via divalent metal transport 1 (DMT1) (Lane et al., 2015). Research has indicated that iron has a considerable impact on the morphology of the small intestine. Following ferrous sulfate supplementation, studies have observed a substantial increase in villus height (VH), crypt depth (CD), villus width, and surface area in the small intestine of suckling piglets (Zhou et al., 2021). In mice, iron overload induced by the injection of iron dextran results in atrophy and loss of jejunal villi. Additionally, there is a substantial decrease in jejunal VH and the ratio of VH to CD (VH/CD) (Zhang et al., 2023). In a rat model, overloading with carbonyl iron induces mucosal hypertrophy and alters the expression of transferrin receptors (Oates and Morgan, 1996).

Currently, isobaric tags for relative and absolute quantitation (iTRAQ) are used to measure protein abundance in various samples using MS spectra or specific reporter ions in tandem mass spectrometry (MS/MS) spectra. High-resolution iTRAQ technology is suitable on an increasing number of platforms for the study of proteins and their post-translational modifications in the microbiological, animal, plant, and biomedical fields. Wang and Fang (2016) used iTRAQ technology to perform a proteomic analysis of the endometrial tissues of Meishan and Duroc sows on days 49 and 72 of gestation and identified 4,499 proteins, 45 with upregulated and 69 with downregulated expression. Based on previous studies, the current study was conducted to compare the early effects of iron deficiency on growth performance, iron deposition and absorption, small intestine morphology, and immune cytokine expression in weaned piglets. Serum proteomic analysis was conducted to reveal the full picture of early changes during iron deficiency. The results of this study will provide a basis for the regulation of iron homeostasis, immune responses, and intestinal development in weaned piglets at the early stages of iron deficiency.

2 Materials and methods

2.1 Animal ethics statement

The experimental procedures were approved by the Protocol Management and Review Committee of the Institute of Subtropical Agriculture, Chinese Academy of Science (No. 20200628), and conducted according to the Institute of Subtropical Agriculture guidelines on Animal Care (Changsha, China).

2.2 Animals and experimental treatments

Twelve healthy, weaned piglets (Duroc × Landrace × Large Yorkshire, body weight: 4.96 ± 0.05 kg, weaned at 21 days of age) were selected for the experiment. These animals were randomly assigned to receive one of two groups with six replicates (male: female ratio 1:1) for each group: 1) control group (100 mg/kg Fe as FeSO4·H2O); 2) L-Fe group (no additional Fe was added). The piglets were fed their respective diets three times a day at 08:00, 12:00, and 20:00 to ensure ad libitum feeding for 42 d. Diets were formulated to meet the nutrient requirements (Table 1) recommended by the National Research Council (NRC, 2012) for weaned piglets during the 42 d of the experimental period, all piglets were individually housed in temperature-controlled, stainless-steel metabolism pens (25 ± 2 °C), allowing free access to drinking water within each 12-h light/dark cycle.Table 1 Composition and nutrient levels of the basal diet (as-fed basis, %).

Table 1Item	Content	
Corn	24.48	
Extruded corn	35.00	
Casein	17.20	
Corn starch	8.30	
Lactose	5.00	
Glucose	3.00	
Thr	0.12	
Trp	0.04	
Met	0.23	
Lys	0.15	
CaCO3	0.73	
CaHPO4	1.67	
NaCl	1.00	
Antioxidant	0.08	
Citric acid	1.50	
Antiseptic	0.50	
Permix1	1.00	
Total	100.00	
Calculated nutrient level2	
DE, kcal/kg	3,400	
DM	91.13	
CP	20.09	
EE	2.08	
Measured nutrient levels3	
DM	90.56	
CP	19.70	
EE	1.95	
Fe, mg/kg	29.04	
DE = digestive energy; DM = dry matter; CP = crude protein; EE = ether extract.

1 Supplied the following per kilogram of the diet: vitamin A 2,200 IU, vitamin D3 220 IU, vitamin E 16 IU, vitamin K 0.5 mg, vitamin B1 1.5 mg, vitamin B2 4.0 mg, vitamin B6 3.0 g, vitamin B12 0.02 mg, pantothenate 12 mg, nicotinic acid 30 mg, Cu 6 mg, Zn 100 mg, Mn 4 mg, Se 0.3 mg, I 0.14 mg, ZnO 300 mg, colistin 40 mg, 50% olaquindox 20 mg, cefetamet pivoxile hydrochloride 20 mg.

2 Based on NRC (2012) value of ingredients, calculation of DE, DM, CP and EE in the diet.

3 Measured values of DM, CP, EE and Fe in the diet.

2.3 Sample collection

On day 42, blood was collected via jugular vein puncture, and 10 mL of blood was collected in a blood collection vessel containing an anticoagulant (EDTA-Na2) for routine blood examination. Blood vessels without anticoagulants were filled with 10 mL of blood, stored at 37 °C for 30 min; hemolytic samples were discarded and centrifuged at 37 °C at 1,200 × g for 15 min. The supernatant was collected and stored at −20 °C until biochemical analysis (n = 6). Piglets were weighed and one piglet from each replicate was euthanized under prior anesthesia using sodium pentobarbital (40 mg/kg BW) (Ren et al., 2014). The liver, spleen, kidney, and heart were weighed and collected for iron content analysis. Middle sections of the duodenum, jejunum, and ileum were collected for hematoxylin and eosin (HE) staining and histomorphometry. Other pieces of duodenum, jejunum, and ileum samples were placed in liquid nitrogen immediately and stored at −80 °C for latter mRNA analysis.

2.4 Analysis of the content of conventional nutrients in samples

All experimental diets were determined in duplicate for dry matter (DM, method 934.01), crude protein (CP, method 990.03), and ether extract (EE, method 920.39), based on the Association of Official Analytical Chemists (AOAC, 2006). The content of iron in the diet and in the liver, heart, spleen, and kidney was analyzed using an inductively coupled plasma emission spectrometer (ICP, 720ES, Agilent, USA) according to a previously published protocol (Liu et al., 2018). Specifically, the DM was measured by weighing 2.00 ± 0.05 g of the sample using an aluminum box with lid and placing the sample in an oven at 100 °C for 5 h until constant weight; the DM content was calculated according to the weight change. After digestion of the dried samples according to method 990.03, the nitrogen content of the samples was determined using a rapid N analyzer (VAP450, Gerhardt, Germany) to calculate the CP content. The EE content of the sample (1.00 ± 0.05 g) was repeatedly extracted with ether to dissolve the fat and lipid substances (Sinopharm, China), and the sample was weighed after extraction. The samples were weighed (1.00 ± 0.05 g) and subjected to digestion under high-temperature conditions using a mixture of nitric acid (Sinopharm, China) and perchloric acid (Sinopharm, China) (v/v, 4/1). After the acids were volatilized, all the samples were filtered and diluted to 10 mL prior to ICP analysis.

2.5 Growth performance and organ coefficients

Initial and final body weights of weaned piglets were weighed and recorded at the beginning and end of the trial, and feed intake was weighed and recorded daily. The calculation of organ coefficients of heart, liver, kidney and spleen refers to the method of (Huang et al., 2010):Organ coefficient (g/kg) = weight of organ (g)/weight of weaned piglet (kg).

The measurement and calculation methods for average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio:ADG (kg/d) = (final body weight − initial body weight)/days on test;

ADFI (kg/d) = total feed intake/days on test;

Feed conversion ratio = total feed intake (kg)/total weight gain (kg).

2.6 Blood cell analysis and serum biochemical indices

Hematological indices, including hemoglobin (HGB) content, were analyzed using an automated hematology analyzer (Sysmex KX-21 Hematology Analyzer, Kobe, Japan). An automated biochemistry analyzer (Cobas C311, Roche, Switzerland) was used to analyze serum samples for serum iron, immunoglobulin M (IgM), immunoglobulin G (IgG), complement 3 (C3) and complement 4 (C4) contents. Biochemical kits were purchased from Roche (Shanghai, China).

2.7 Serum protein extraction and labeling

A Proteominer kit (Bio-Rad, USA) was used to remove the high abundance of protein in the two groups of piglet serum samples. The protein concentration of each sample was determined using Bradford's method (Datta et al., 2014). Then, 100 μg of protein was extracted accurately from each sample for reductive alkylation and subsequent trypsin digestion at a ratio of protein/enzyme of 20:1. The peptides were then drained using a vacuum centrifugal pump, and the peptides were re-solubilized with 0.5 mol/L triethanolamine borate (TEAB); each set of peptides was labeled with different iTRAQ tags according to the manual.

2.8 LC–MS/MS analyses

The samples were separated in the liquid phase using a liquid-phase system (Shimadzu LC-20AB, Shimadzu, Japan), and the separation column was a PolySULFOETHYL SCX column (2.1 mm × 100 mm). The labeled and dried, mixed peptides were desalted using a Waters Sep-Pak Cartridge, dried, and re-solubilized in buffer A (10 mmol/L KH2PO4 in 25% acetonitrile, pH 2.8). After the column was loaded, a gradient elution was performed at a rate of 0.2 mL/min, buffer A was eluted for 10 min, followed by 0 to 35% buffer B (10 mmol/L KH2PO4, 350 mmol/L KCl in 25% acetonitrile, pH 2.8) for 30 min, and then 35% to 80% buffer B was gradually mixed in for 2 min. The entire elution process was monitored at an absorbance of 214 nm and 30 fractions were obtained after screening. Each fraction was desalted separately using a Strata X desalting column and then freeze-dried.

The dried SCX fractions were resolubilized and subjected to two consecutive liquid quality analyses. The liquid-phase system combined with the mass spectrometer was a HPLC system (20AD, Shimadzu, Japan) and consisted of a Micromass C18 column (5 μm, 300 Å, 0.1 mm × 15 mm). The mobile phases used were liquid A (water:acetonitrile:formic acid = 98:2:0.1) and liquid D (water:acetonitrile:formic acid = 2:98:0.1), with an appropriate amount of the calibration solution (Thermo Fisher Scientific, USA). After peptide adsorption and desalting, the samples were processed using a TripleTOF 5600 (AB SCIEX, Concord, ON, Canada) with a Nanospray III source (AB SCIEX, Concord, ON, Canada) serving as the ion source and a quartz-drawn spray needle (New Objectives, Woburn, MA, USA) as the emitter for MS/MS analysis. During data collection, the machine parameters were configured as follows: ion source spray voltage of 2.5 kV, nitrogen pressure of 30 psi (14.5 psi = 1 bar), spray pressure of 15 psi, and spray interface temperature of 150 °C; scanning mode was reflection mode. Ions from 2+ to 5+ were accumulated for 250 ms, with the first 50 ions accumulating more than 120 scores per second being scanned, and 2.8 s constituting a cycle. The transmission window of the second quadrupole (Q2) was set to 100 Da for 100%; the frequency of pulsed RF electricity was 11 kHz, and the detection frequency of the detector was 40 GHz. The particle signal of each scan was recorded in four channels for a total of four times and then merged into data. For iTRAQ, the ion fragmentation energy was set to 35 ± 5 eV; parent ion dynamic exclusion was set to 18 s, the same parent ion did not undergo fragmentation more than twice.

2.9 Bioinformatics analysis

The mass spectrometry data obtained were retrieved using Mascot (Matrix, USA) and then analyzed using Scaffold (Proteome Software, UAS) for relative quantification. Proteins were regarded as differentially abundant proteins (DAP) when the multiplicity of difference in protein abundance reached more than 1.2-fold and the P-value was less than 0.05 using a statistical test. Protein annotation and classification were performed using DAVID (Sherman et al., 2022), in which biological processes, cellular components, and molecular function annotations from Gene Ontology (GO) were selected to classify proteins.

2.10 Cytokine microarray

Reagent kits (Raybiotech, USA) were used for the cytokine microarray technique to detect differences in the serum cytokine content interleukin-1β (IL-1β), interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin-12 (IL-12), granulocyte-macrophage colony-stimulating factor (GM-CSF), transforming growth factor-β1 (TGF-β1) and tumor necrosis factor-α (TNF-α) between the control and L-Fe groups.

2.11 Quantitative real time-PCR (qRT-PCR)

Total RNA was isolated from duodenum, jejunum, and ileum samples frozen in liquid nitrogen using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and treated with Dnase I (Invitrogen) according to the manufacturer's instructions. The primers were designed using Primer 5.0 (Table 2). The LightCycler 480 Instrument (Applied Biosystems, Carlsbad, CA) was used to quantify mRNA expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene to normalize the expression of iron homeostasis-related genes. Gene relative expression levels were calculated as previously reported methodology (Zhou et al., 2017).Table 2 Primers used in this study.

Table 2Gene	Primer sequences (5′ to 3′)	GenBank No.	
GAPDH	F: GGGCATGAACCATGAGAAGT
R: AGCACCAGTAGAAGCAGGGA	NM_001206359	
Cybrd	F: AGATTGGCCCTGGAGACTGA
R: CAAGGAAGCCTTGGGTGAAG	XM_005671927.3	
DMT1	F: AGGATCTAGGGCATGTGGTG
R: CCACAGTCCAGGAAGGACAT	NM_001128440.1	
FPN	F: TGTCCACTGGGTGTCTGTGT
R: TGTTCATTCACTTCCTCTCTTTTC	XM_003483701.4	
IPR1	F: CTGTGGGAATGTTTCGGGAT
R: CCACTGCAGCAAGGCACTAC	XM_003357729.3	
IPR2	F: TGGTCATTGCTGCCGTTATC
R: TGTAACCATCCCACTGCCTG	NM_001167781.1	
TFRC	F: GTTTAGCGCAGGAGTGAGGC
R: TGGGACAAGCAACAGAGGAA	NM_214001.1	
FTL	F: AAAACCCAGGACGCTATGGA
R: CCAGGAAGTGGTTCTCCAGG	NM_001244131.1	
GAPDH = glyceraldehyde-3-phosphate dehydrogenase; Cybrd = duodenal cytochrome; DMT1 = divalent metal transport 1; FPN = ferroportin; TFRC = transferrin receptor; FTL = ferritin light chains; IPR1 = iron regulatory protein 1; IPR2 = iron regulatory protein 2.

2.12 Histopathology

The duodenum, jejunum, and ileum were incubated in 4% neutral-buffered 10% formalin until paraffin embedding. After fixation, paraffin embedding was performed and sections (at least three layers; thickness of 5 μm) were stained with hematoxylin and eosin. Images were acquired using a laser scanning confocal microscope (LSM880, Zeiss, Germany), and the VH and CD were measured (Liu et al., 2023).

2.13 Statistical analysis

The results were analyzed using a completely randomized study design. None of the animals exhibited growth arrest during the trial. Therefore, all animal data were included. Given the similar growth rates of the male and female piglets in the feeding trial, sex effects were not considered in this study.

Data are presented as the mean values. All statistical analyses were performed using SPSS 26.0 software (IBM Corp., Armonk, NY, USA). Differences between the treatments were evaluated using a simple t-test. For the analysis, the dietary treatment was considered a fixed effect, and the animal was considered a randomized factor. P < 0.05 were considered statistically significant.

3 Results

3.1 Growth performance and organ coefficients of weaned piglets

The effects of a low iron diet on body weight, feed intake, feed conversion ratio, and organ coefficients are shown in Table 3. Compared with the control group, ADG, ADFI, feed conversion ratio, organ weight, and organ coefficients of the heart, liver, kidney, and spleen were not affected by the low-iron diet during the experimental period (P > 0.05).Table 3 Effects of low iron diet on growth performance and organ coefficients of weaned pigs (n = 6).

Table 3Item	Control group	L-Fe group	SEM	P-value	
Initial body weight, kg	4.95	4.97	0.051	0.867	
Final body weight, kg	16.45	16.08	0.524	0.744	
Average daily gain, kg/d	0.27	0.27	0.004	0.333	
Average daily feed intake, kg/d	0.75	0.76	0.017	0.722	
Feed conversion ratio	2.73	2.87	0.082	0.427	
Heart weight, g	80.62	78.15	3.306	0.728	
Heart organ coefficient, g/kg	4.91	4.83	0.095	0.669	
Liver weight, g	518.00	485.82	23.480	0.519	
Liver organ coefficient, g/kg	31.53	29.99	0.735	0.317	
Spleen weight, g	47.30	41.42	3.401	0.413	
Spleen organ coefficient, g/kg	2.89	2.57	0.198	0.439	
Kidney weight, g	103.02	100.68	5.775	0.851	
Kidney organ coefficient, g/kg	6.26	6.19	0.238	0.891	
Basal diet analyzed 29.04 mg/kg Fe DM. Supplemental Fe was 0 mg/kg (L-Fe group) and 100 mg/kg (control group).

3.2 Hematological parameters and iron content in tissues

Compared to the control group, red blood cell (RBC) count, hemoglobin (HGB) content, hematocrit (HCT), mean corpuscular volume (MCV), and serum iron content were reduced (P < 0.05) in the iron-deficient piglets (Table 4). Compared to the control group, the iron contents in the liver, kidney, and heart were lower than those in the L-Fe group (P < 0.05) (Table 5).Table 4 Effects of low iron diet on blood state of weaned piglets (n = 6).

Table 4Item	Control group	L-Fe group	SEM	P-value	
RBC, ×1012/L	5.87	4.89	0.149	<0.001	
HGB, g/L	124.00	102.50	3.250	<0.001	
HCT, %	0.39	0.31	0.012	<0.001	
MCV, fL	66.27	62.50	0.639	0.001	
Serum iron, μg/L	1,560.00	690.00	179.344	0.007	
RBC = red blood cell; HGB = hemoglobin; HCT = hematocrit; MCV = mean corpuscular volume.

Basal diet analyzed 29.04 mg/kg Fe DM. Supplemental Fe was 0 mg/kg (L-Fe group) and 100 mg/kg (control group).

Table 5 Effects of low iron diet on tissue iron contents (mg/kg) in liver, kidney, heart, spleen of the weaned piglets (n=6).

Table 5Item	Control group	L-Fe group	SEM	P-value	
Liver iron	64.76	33.14	7.228	0.020	
Kidney iron	33.06	22.07	2.445	0.016	
Heart iron	39.71	32.21	1.683	0.017	
Spleen iron	140.64	77.64	14.327	0.091	
Basal diet analyzed 29.04 mg/kg Fe DM. Supplemental Fe was 0 mg/kg (L-Fe group) and 100 mg/kg (control group).

3.3 Gene relative expression in iron homeostasis

The relative expression levels of Cybrd, DMT1, ferroportin (FPN), iron regulatory protein 1 (IPR1), iron regulatory protein 2 (IPR2), transferrin receptor (TFRC), ferritin light chains (FTL) genes in the duodenum (Fig. 1A), jejunum (Fig. 1B), and ileum (Fig. 1C) of all weaned piglets were tested using qRT-PCR. Results showing that the relative expression levels of Cybrd, DMT1, and FTL genes increased in the duodenum of the L-Fe group (P < 0.05; Fig. 1A). Moreover, DMT1 gene relative expression level was higher than that of the control group in the jejunum (P < 0.05; Fig. 1B). In addition, the relative expression levels of TFRC and FTL genes were increased in the ileum of the L-Fe group compared to that in the control group (P < 0.05; Fig. 1C).Fig. 1 Effects of low iron diet on the relative expression levels of genes related to iron absorption in duodenum (A), jejunum (B) and ileum (C) of the weaned piglets (n = 6). Cybrd = duodenal cytochrome; DMT1 = divalent metal transport 1; FPN = ferroportin; IPR1 = iron regulatory protein 1; IPR2 = iron regulatory protein 2; TFRC = transferrin receptor; FTL = ferritin light chains. Supplemental Fe was 100 mg/kg (control group) and 0 mg/kg (L-Fe group). Values are means, with standard errors represented by vertical bars. Different letters represent significant difference (P < 0.05).

Fig. 1

3.4 Histopathology

Intestinal VH, CD, and VH/CD are presented in Table 6 and Fig. 2. The VH, CD, and VH/CD of the jejunum and ileum were similar to those of the control group (P > 0.05). However, duodenal VH in the L-Fe group was higher than that in the control group (P = 0.003). Moreover, the VH/CD of the duodenum was higher in the L-Fe group than in the control group (P = 0.002).Table 6 Effects of low iron diet on small intestinal morphology of weaned piglets (n = 6).

Table 6Item	Control group	L-Fe group	SEM	P-value	
Duodenum VH, μm	393.09	532.24	27.082	0.003	
Duodenum CD, μm	116.47	111.25	2.756	0.368	
Duodenum VH/CD	3.37	4.82	0.276	0.002	
Jejunum VH, μm	421.49	501.40	28.926	0.181	
Jejunum CD, μm	112.03	117.91	3.079	0.369	
Jejunum VH/CD	4.30	3.78	0.284	0.387	
Ileum VH, μm	414.63	371.63	23.243	0.385	
Ileum CD, μm	113.16	97.78	5.028	0.134	
Ileum VH/CD	3.92	3.65	0.276	0.642	
VH = villus height; CD = crypt depth.

Basal diet analyzed 29.04 mg/kg Fe DM. Supplemental Fe was 0 mg/kg (L-Fe group) and 100 mg/kg (control group).

Fig. 2 Stained with hematoxylin and eosin (HE) in the duodenum, jejunum and ileum tissues (40 ×). Supplemental Fe was 100 mg/kg (control group) and 0 mg/kg (L-Fe group).

Fig. 2

3.5 Serum proteome

Among the 1,196 proteins identified by iTRAQ, 43 proteins in the L-Fe group were different from the control group (P < 0.05), with a threshold of at least 1.2-fold change in the expression levels of 30 DAP. A volcano plot of DAP (Fig. 3) is shown. Gene Ontology analysis of all DAP revealed that 24 of the 30 DAP found in the serum were involved in platelet function, immune response, cellular metabolism, transcription, and protein synthesis (Table 7, Table 8). Of the proteins, 12 of the 30 DAP were associated with the immune response. The abundance of proteins including R4H4K5, F1SUE4, I3LKU0, and K7ZRK0 was higher; A0SEG9, B6ECP2, F1RS37, I3L5Z3, F1S8U2, L8AXM9, I3LQP7, and C0JPM4 were lower in mildly iron-deficient piglets. Eight of the 30 DAP were related to transcription and protein synthesis, where the abundances of Q29387 and Q0PY11 increased, and the abundances of B6DT15, F2Z557, F2Z5K2, F1SBA5, A5D9J4, and A1XQU1 decreased. Moreover, five of the 30 DAP, including increased O97765, I3LFF0, and F1RSC3, and decreased I3LQP7 and C0JPM4, were associated with cellular metabolism. The proteins (B3STX9 and B6ECP2), which are associated with platelet function, also fluctuated in response to the iron status.Fig. 3 Volcano diagrams constructed from fold changes and P-values of serum proteins in low iron diets and control piglets. With log 2 (fold change) as the horizontal coordinate and −log 10 (P-value) of the t-test significance test P-value as the vertical coordinate, changes greater than 1.2-fold and P < 0.05 are DAP (red in the graph is significant up-regulation and blue is significant down-regulation). ASPN = asporin; BTRC = beta-transducin repeat containing E3 ubiquitin protein ligase; CLEC3B = C-type lectin domain family 3 member B; CTGF = connective tissue growth factor; EEF1A = eukaryotic translation elongation factor 1 alpha 1; EEF1G = eukaryotic translation elongation factor 1 gamma; EFEMP2 = EGF containing fibulin extracellular matrix protein 2; EMSY = EMSY transcriptional repressor; FETUB = fetuin B; GPIbA = glycoprotein Ib platelet subunit alpha; IGHA = immunoglobulin heavy constant alpha; IGHG = immunoglobulin heavy constant gamma; LMNA = lamin A/C; OAF = out at first homolog; PABPC3 = poly(A) binding protein cytoplasmic 3; PLCH1 = phospholipase C Eta 1; POSTN = periostin; PRG4 = proteoglycan 4; PSMA5 = proteasome 20S subunit alpha 5; PSMA8 = proteasome 20S Subunit alpha 8; PSMB7 = proteasome 20S subunit beta 7; PSMB8 = proteasome 20S subunit beta 8; RAB7A = RAS-related in brain 7A; RAC3 = Rac family small GTPase 3; SCPEP1 = secreted phosphoprotein 1; SLIT1 = slit guidance ligand 1; TIMP-2 = tissue inhibitor of metalloproteinase-2; TMBIM6 = transmembrane BAX inhibitor motif containing 6; USP7 = ubiquitin specific peptidase 7. Supplemental Fe was 100 mg/kg (control group) and 0 mg/kg (L-Fe group).

Fig. 3

Table 7 Fold changes in serum of specific functional differentially abundant proteins in piglets weaned on low iron diets (n = 6).

Table 7Accession no.	Gene name	Protein name	Annotation	Fold change (L-Fe/control)	P-value	
Platelet function	
B3STX9	–	Prothrombin	Prothrombin	1.22	0.093	
B6ECP2	GPIbA	Glycoprotein Ib platelet subunit alpha	Platelet glycoprotein Ib alpha polypeptide	0.67	0.037	
Immune response	
A0SEG9	C9	Complement component C9	Complement component C9	0.80	0.009	
B6ECP2	GPIbA	Glycoprotein Ib platelet subunit alpha	Platelet glycoprotein Ib alpha polypeptide	0.67	0.037	
F1RS37	POSTN	Periostin	Uncharacterized protein	0.76	0.041	
R4H4K5	–	Retinoic acid receptor responder protein 2	Chemerin	1.24	0.013	
F1SUE4	ASPN	Asporin	Uncharacterized protein	1.27	0.003	
I3L5Z3	PRG4	–	Uncharacterized protein	0.74	0.003	
I3LKU0	RAC3	Rac family small GTPase 3	Uncharacterized protein	1.56	0.029	
F1S8U2	BTRC	Beta-transducin repeat containing E3 ubiquitin protein ligase	Uncharacterized protein	0.38	0.031	
K7ZRK0	IGHA	IgA heavy chian constant region	IgA heavy chain constant region (fragment)	1.24	0.032	
L8AXM9	IGHG	IgG heavy chain	IgG heavy chain	0.66	0.005	
I3LQP7	TMBIM6	Bax inhibitor 1	Bax inhibitor 1	0.61	<0.001	
C0JPM4	TIMP-2	Metalloproteinase inhibitor-2	Tissue inhibitor of metalloproteases 2	0.64	0.019	
Cell metabolism	
I3LQP7	TMBIM6	Bax inhibitor 1	Bax inhibitor 1	0.61	<0.001	
C0JPM4	TIMP-2	Metalloproteinase inhibitor-2	Tissue inhibitor of metalloproteases-2	0.64	0.019	
O97765	CTGF	Connective tissue growth factor	Connective tissue growth factor	1.22	0.033	
I3LFF0	PLCH1	Phosphoinositide phospholipase C1	Phosphoinositide phospholipase C1	1.40	0.005	
F1RSC3	SCPEP1	Carboxypeptidase 1	Carboxypeptidase 1	1.60	0.041	
Transcription and protein syntheses	
B6DT15	USP7	Ubiquitin carboxyl-terminal hydrolase 7	Ubiquitin-specific peptidase 7	0.65	0.050	
F2Z557	PABPC3	Polyadenylate-binding protein 3	Polyadenylate-binding protein 3	0.78	0.044	
F2Z5K2	PSMA5	Proteasome subunit alpha type5	Proteasome subunit alpha type5	0.81	0.034	
F1SBA5	PSMA8	Proteasome subunit alpha type 8	Proteasome subunit alpha type8	0.69	0.007	
A5D9J4	PSMB8	Proteasome subunit beta 8	Proteasome subunit beta type8	0.83	0.011	
A1XQU1	PSMB7	Proteasome subunit beta type 7	Proteasome subunit beta type7	0.75	0.005	
Q29387	EEF1G	Elongation factor 1-gamma	Elongation factor 1-gamma	1.21	0.028	
Q0PY11	EEF1A	Elongation factor 1-alpha	Elongation factor 1-alpha	1.35	0.023	

Table 8 Gene Ontology annotation of differentially abundant proteins involved in immune responses.

Table 8Accession no.	Gene name	GO annotation	
B6ECP2	GPIbA	GO:0046426	Negative regulation of JAK-STAT cascade	
GO:0019221	Cytokine-mediated signaling pathway	
F1SUE4	ASPN	GO:0046426	Negative regulation of JAK-STAT cascade	
GO:0019221	Cytokine-mediated signaling pathway	
F1RS37	POSTN	GO:0008593	Regulation of Notch signaling pathway	
F1S8U2	BTRC	GO:0043122	Regulation of I-kappaB kinase/NF-kappaB signaling	
A0SEG9	–	GO:0045087	Innate immune response	
I3L5Z3	PRG4	GO:0006955	Immune response	
R4H4K5	–	GO:0006954	Inflammatory response	
C0JPM4	TIMP-2	GO:0034097	Response to cytokine	
I3LKU0	RAC3	GO:0071593	Lymphocyte aggregation	
GO:0042129	Regulation of T cell proliferation	
I3LQP7	TMBIM6	GO:0051025	Negative regulation of immunoglobulin secretion	
GPIbA = glycoprotein Ib platelet subunit alpha; ASPN = asporin; POSTN = periostin; BTRC = beta-transducin repeat containing E3 ubiquitin protein ligase; PRG4 = proteoglycan 4; TIMP-2 = tissue inhibitor of metalloproteinase-2; RAC3 = Rac family small GTPase 3; TMBIM6 = transmembrane BAX inhibitor motif containing 6; JAK-STAT = Janus kinase/signal transducer and activator of transcription; NF-kappaB = nuclear factor-kappa B.

3.6 Serum immunity and cytokines

There was no marked change in IgM or IgG contents in the serum of piglets in the L-Fe group compared to those in the control group (P > 0.05; Table 9). However, C3 and C4 contents in the L-Fe group were lower than those in the control group (P < 0.05). To determine whether iron deficiency leads to the development of inflammation, the contents of IL-1β, IL-4, IL-6, IL-12, GM-CSF, TGF-β1, and TNF-α in the serum of weaned piglets in each group were measured using a cytokine microarray (Fig. 4). The contents of IL-1β, IL-4, IL-6, TGF-β1, and TNF-α in the serum of piglets in the L-Fe group were higher than those in the control group (P < 0.05), whereas the differences in the contents of IL-12 and GM-CSF were similar (P > 0.05).Table 9 Effects of low iron diet on the contents (mg/mL) of IgM, IgG, C3 and C4 in serum of weaned piglets (n=6).

Table 9Item	Control group	L-Fe group	SEM	P-value	
IgM	0.31	0.26	0.032	0.405	
IgG	1.56	1.54	0.057	0.846	
C3	0.13	0.08	0.008	0.002	
C4	0.05	0.04	0.003	0.029	
IgM = immunoglobulin M; IgG = immunoglobulin G; C3 = complement protein 3; C4 = complement protein 4.

Basal diet analyzed 29.04 mg/kg Fe DM. Supplemental Fe was 0 mg/kg (L-Fe group) and 100 mg/kg (control group).

Fig. 4 Effects of low iron diet on contents of inflammatory cytokines in the serum of weaned piglets (n = 6). IL-1β = interleukin-1β; IL-4 = interleukin-4; IL-6 = interleukin-6; IL-12 = interleukin-12; GM-CSF = granulocyte-macrophage colony-stimulating factor; TGF-β1 = transforming growth factor-β1; TNF-α = tumor necrosis factor-α. Supplemental Fe was 100 mg/kg (control group), 0 mg/kg (L-Fe group). Values are means, with standard errors represented by vertical bars. Different letters represent significant difference (P < 0.05).

Fig. 4

4 Discussion

The effects of early iron deficiency on iron homeostasis, immune response, and intestinal development in weaned piglets were investigated in the present study. Iron content in tissues is regarded as a reliable response criterion for evaluating mineral status (Feng et al., 2009). In the present study, the iron content in the liver, spleen, kidney, and heart decreased substantially, indicating that the weaned piglets were fed an iron-deficient diet, likely in an iron-deficient state. Iron deficiency may lead to decreased growth performance, and growth performance and intestinal barrier function have been reported to be impaired in iron-deficient weaned piglets (Hansen et al., 2009; Perri et al., 2016). However, our data indicated that the changes in growth performance, organ weight, and organ coefficient of weaned piglets were not significant. However, iron metabolism was substantially altered, suggesting that these piglets were at an early stage of iron deficiency or had a mild iron deficiency.

Iron is an essential element in the body and the most basic material for the synthesis of hemoglobin and erythrocytes. Iron deficiency affects the synthesis of hemoglobin, which in turn reduces the hemoglobin content and the oxygen-carrying capacity of erythrocytes, leading to iron deficiency anemia (Brugnara et al., 1999). In this study, after feeding an iron-deficient diet for 42 d, the serum iron contents in the L-Fe group were significantly lower, and the HGB content in the L-Fe group was reduced to 102.50 g/L, which was substantially lower than that in the control group (124.00 g/L). Since pigs with HGB content below 100 g/L are classified as mildly anemic (Kim et al., 2018), the L-Fe group was close to mildly iron-deficient. This is consistent with the results of previous studies, in which HGB content and MCV increased with increasing dietary iron content (Feng et al., 2007; Dong et al., 2023; Liu et al., 2023).

To explore the reaction of the small intestine to an iron-deficient diet, the expression of the genes, Cybrd, DMT1, FPN, IPR1, IPR2, TFRC and FTL, which are involved in iron absorption and transportation in the small intestine, was determined. Cybrids are the primary mammalian transplasma ferric reductases. In the duodenum, ferric iron is reduced by cybard and transported by DMT1 (Lane et al., 2015). TFRC transports transferrin-binding iron. Consistent with previous reports in other animals, the expression of Cybrd and DMT1 genes was higher in the duodenum of piglets in the L-Fe group, suggesting an increased capability for the absorption and transportation of iron to meet iron requirements (Fcollins, 2006; Hansen et al., 2009), but there was no significant difference on expression of TFRC gene. Ferroportin, a critical protein for iron transportation from duodenal enterocytes to the blood, is regulated by hepcidin (Donovan et al., 2005). In our study, there was no significant difference in FPN expression in mildly iron-deficient piglets, whereas it has been documented that targeted deletion of FPN in macrophages results in a relatively mild iron deficiency in a rat model (Zhang et al., 2011). However, the expression of FTL gene was markedly elevated in the duodenum and ileum of the L-Fe group. Ferritin light chains is a clear marker of coronary atherosclerosis (You et al., 2003) and its expression is increased in glioblastomas (Wu et al., 2016). Unexpectedly, the expression levels of IRP1 and IRP2 genes were similar between the control and L-Fe groups. The IPR1/IPR2 had been proven to be involved in regulating the expression of iron metabolism- and transport-related proteins to optimize cellular iron availability at the post-transcriptional level (Rouault, 2006). However, they are primarily located in the liver. Thus, IPR1/IPR2 may not participate in exogenous iron absorption in the small intestine. Thus, at the early stages of iron deficiency, it may alter the expression of iron absorption-related genes in the small intestine, resulting in improved digestion and absorption of iron. The duodenum is the primary organ responsible for iron absorption in the small intestine (Frazer and Anderson, 2005; Ganz and Nemeth, 2006). In the current study, the VH/CD in the duodenum of piglets in the L-Fe group increased, which may also help improve iron bioavailability from food, thereby reducing the symptoms of iron deficiency in piglets.

Immunoglobulins are important components of the blood. In previous studies, an increased risk of immune deficiency and infection was observed in the presence of iron deficiency (Jonker and van Hensbroek, 2014). A randomized trial follow-up study of Kenyan infants found that infants who were supplemented with iron at the time of vaccination showed higher IgG content, seroconversion, and IgG avidity than those who did not (Stoffel et al., 2020). Contrary to a previous study (Sadeghian, 2010), our results in piglets showed that serum immunoglobulin content did not change during the early stages of iron deficiency. However, the contents of the important complement components, C3 and C4, which participate in the body's immune response through various complement activation pathways and contribute to early defense against infection, were substantially lower than those in the control group (Galan et al., 1988). Therefore, iron deficiency may result in immune dysfunction via complement activation pathways and exacerbate the inflammatory responses (Rayes et al., 2018).

In the present study, we demonstrated that iron deficiency led to an enhanced pro-inflammatory response, resulting in a marked increase in serum contents of the inflammatory cytokines, IL-1β, IL-4, IL-6, TGF-β1, and TNF-α and a trend towards increased contents of IL-12 and GM-CSF. The higher inflammatory response in piglets without additional iron in the diet in this study is consistent with previous studies in which low iron status led to increased pro-inflammatory cytokines (including IL-1β, IL-6, and TNF-α) in iron deficiency anemia (Ferrucci et al., 2010; Pu et al., 2015). Therefore, according to our research, the immunization of piglets in a state of iron deficiency increases the risk of early infection during production.

The iTRAQ analysis indicated that the abundance of differentially expressed proteins was closely associated with the expression of common inflammatory mediators such as IL-6, IL-8, and TNF-α in the serum of the L-Fe group of piglets. In the L-Fe group, the serum expression of ASPN and RAC3 increased 1.27- and 1.56-fold, respectively, whereas GPIbA expression decreased 0.67-fold. Asporin has been shown to strongly inhibit apoptosis, promote growth in gastric cancer cells, and selectively promote LEF1 binding to activate the promoters of PTGS2, IL-6, and WISP1 to facilitate their transcription (Zhang et al., 2021). Rac family small GTPase 3 regulates the secretion of matrix metalloproteinase-9 (MMP-9), IL-6, IL-8, and growth-related oncogene (GRO), as well as resistance to TNF-induced apoptosis (Gest et al., 2013). Glycoprotein Ib platelet subunit alpha plays a key role in hemostasis and has long been recognized as a key gene that mediates platelet coagulation. These previous findings could help to explain the synchronous changes in inflammatory cytokines (IL-1β, IL-4, IL-6, TGF-β1, and TNF-α) and the ASPN, RAC3, and GPIbA abundance in the present study. According to changes in prothrombin and GPIbA, piglets at an early stage of iron deficiency have increased compensatory hemagglutination, which may result in reduced bleeding after trauma (Lanza, 2006).

5 Conclusion

In conclusion, although growth performance remained unaffected during the early stages of iron deficiency, there were substantial reductions in serum iron content, RBC counts, HGB content, HCT, and MCV. The height of the duodenal villi increased along with an upregulation in the expression of genes associated with iron absorption to facilitate increased iron uptake by the body. However, alterations in several serum proteins indicate that iron deficiency can lead to increased pro-inflammatory responses and can affect immune function. These results suggest that early iron deficiency activates immune responses and is detrimental to the intestinal health of piglets.

Author contributions

Guang Liu: Conceptualization, Writing-Original draft preparation, Software. Lan Li: Data curation, Methodology. Shuan Liu: Project administration, Data curation. Zhenglin Dong: Visualization. Jian Zhou: Software. Chengyan Gong: Project administration, Data curation. Yulong Yin: Writing-Reviewing and Editing, Supervision. Wenjie Tang: Funding acquisition, Writing-Reviewing and Editing. Dan Wan: Funding acquisition, Writing-Reviewing and Editing.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

This work was supported by the 10.13039/501100012166 National Key R&D Program of China (2022YFD1300504 ), the 10.13039/501100001809 National Natural Science Foundation of China (32372827 ), the science and technology innovation Program of Hunan Province (2023RC3201 ), and the 10.13039/501100004739 Youth Innovation Promotion Association of Chinese Academy of Sciences (2022370 ). We would like to thank Dr. Jiurong Wang in Public Service Technology Center, Institute of Subtropical Agriculture for helping us analyze the iron content in feeds and tissues.

Peer review under the responsibility of Chinese Association of Animal Science and Veterinary Medicine.
==== Refs
References

AOAC Official methods of analysis 18th ed. 2006 AOAC International Gaithersburg, MD 2006
Armitage Hepcidin regulation by innate immune and infectious stimuli Blood J Am Soc Hematol 118 2011 4129 4139
Brasse-Lagnel Intestinal DMT1 cotransporter is down-regulated by hepcidin via proteasome internalization and degradation Gastroenterology 140 2011 1261 1271. e1261 21199652
Brugnara Reticulocyte hemoglobin content to diagnose iron deficiency in children JAMA 281 1999 2225 2230 10376576
Cappellini Iron deficiency across chronic inflammatory conditions: international expert opinion on definition, diagnosis, and management Am J Hematol 92 2017 1068 1078 28612425
Dallman Iron deficiency and the immune response Am J Clin Nutr 46 1987 329 334 3303900
Datta Novel pathophysiological markers are revealed by iTRAQ-based quantitative clinical proteomics approach in vascular dementia J Proteomics 99 2014 54 67 24448401
Dong Role of iron in host-microbiota interaction and its effects on intestinal mucosal growth and immune plasticity in a piglet model Sci China Life Sci 66 2023 2086 2098 37530911
Donovan The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis Cell Metabol 1 2005 191 200
Eshaghpour Iron deficiency anemia in a newborn infant J Pediatr-Us 68 1966 806 810
Fcollins Gene chip analyses reveal differential genetic responses to iron deficiency in rat duodenum and jejunum Biol Res 39 2006 25 37 16629162
Feng Effects of iron glycine chelate on growth, haematological and immunological characteristics in weanling pigs Anim Feed Sci Technol 134 2007 261 272
Feng The effect of iron glycine chelate on tissue mineral levels, fecal mineral concentration, and liver antioxidant enzyme activity in weanling pigs Anim Feed Sci Technol 150 2009 106 113
Ferrucci Proinflammatory state, hepcidin, and anemia in older persons Blood J Am Soc Hematol 115 2010 3810 3816
Frazer Anderson Iron imports. I. Intestinal iron absorption and its regulation Am J Physiol Gastrointest Liver Physiol 289 2005 G631 G635 16160078
Galan Iron deficiency, inflammatory processes and humoral immunity in children. International journal for vitamin and nutrition research. Internationale Zeitschrift fur Vitamin-und Ernahrungsforschung J Int Vitaminol Nutr 58 1988 225 230
Ganz Nemeth Iron imports. IV. Hepcidin and regulation of body iron metabolism Am J Physiol Gastrointest Liver Physiol 290 2006 G199 G203 16407589
Gest Rac3 induces a molecular pathway triggering breast cancer cell aggressiveness: differences in MDA-MB-231 and MCF-7 breast cancer cell lines BMC Cancer 13 2013 1 14 23282137
Hansen Iron transporters are differentially regulated by dietary iron, and modifications are associated with changes in manganese metabolism in young pigs J Nutr 139 2009 1474 1479 19535423
Hentze Two to tango: regulation of Mammalian iron metabolism Cell 142 2010 24 38 20603012
Huang In vitro and in vivo antitumor activity of Macrothelypteris torresiana and its acute/subacute oral toxicity Phytomedicine 17 2010 930 934 20381325
Jin Crosstalk between trace elements and T-cell immunity during early-life health in pigs Sci China Life Sci 66 2023 1994 2005 37300752
Jonker van Hensbroek Anaemia, iron deficiency and susceptibility to infections J Infect 69 2014 S23 S27 25264159
Kim Iron status of piglets and impact of phytase superdosing on iron physiology: a review Anim Feed Sci Technol 235 2018 8 14
Lane Duodenal cytochrome b (DCYTB) in iron metabolism: an update on function and regulation Nutrients 7 2015 2274 2296 25835049
Lanza Bernard-Soulier syndrome (hemorrhagiparous thrombocytic dystrophy) Orphanet J Rare Dis 1 2006 1 6
Liu Effects of dietary energy and lipase levels on nutrient digestibility, digestive physiology and noxious gas emission in weaning pigs Asian Australas J Anim Sci 31 2018 1963 29879828
Liu Dietary iron regulates intestinal goblet cell function and alleviates Salmonella typhimurium invasion in mice Sci China Life Sci 66 2023 2006 2019 37340176
Ludwig Prevalence of iron deficiency across different tumors and its association with poor performance status, disease status and anemia Ann Oncol 24 2013 1886 1892 23567147
Ma Trace metal elements: a bridge between host and intestinal microorganisms Sci China Life Sci 66 2023 1976 1993 37528296
NRC Nutrient requirements of swine 11th revised ed. 2012 National Academic Press Washington (DC) 2012
Oates Morgan Effects of dietary iron loading with carbonyl iron and of iron depletion on intestinal growth, morphology, and expression of transferrin receptor in the rat Anat Rec 246 1996 364 371 8915458
Perri An investigation of iron deficiency and anemia in piglets and the effect of iron status at weaning on post-weaning performance J Swine Health Prod 24 2016 10 20
Pluske Factors influencing the structure and function of the small intestine in the weaned pig: a review Livest Prod Sci 51 1997 215 236
Pu Iron supplementation attenuates the inflammatory status of anemic piglets by regulating hepcidin Biol Trace Elem Res 167 2015 28 35 25774043
Rayes Complement C3 is a novel modulator of the anti-factor VIII immune response Haematologica 103 2018 351 29146705
Ren Serum amino acids profile and the beneficial effects of L-arginine or L-glutamine supplementation in dextran sulfate sodium colitis PLoS One 9 2014 e88335
Rincker Effects of dietary iron supplementation on growth performance, hematological status, and whole-body mineral concentrations of nursery pigs J Anim Sci 82 2004 3189 3197 15542465
Rouault The role of iron regulatory proteins in mammalian iron homeostasis and disease Nat Chem Biol 2 2006 406 414 16850017
Sadeghian Serum immunoglobulins in patients with iron deficiency anemia Indian J Hematol Blood Transfus 26 2010 45 48 21629635
Sherman DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update) Nucleic Acids Res 50 2022 W216 W221 35325185
Stoffel Iron deficiency anemia at time of vaccination predicts decreased vaccine response and iron supplementation at time of vaccination increases humoral vaccine response: a birth cohort study and a randomized trial follow-up study in Kenyan infants Front Immunol 11 2020 1313 32754150
Svoboda Drabek Iron deficiency in suckling piglets: etiology, clinical aspects and diagnosis Folia Vet 49 2005 104 111
Terpilowska Siwicki The influence of iron on cell-mediated and humoral-mediated immunity in mice Cent Eur J Immunol 34 2009 57 60
Wang Fang Characterization of endometrium protein expression during mid-late gestation in Meishan and Duroc sows with iTRAQ analysis J Anim Sci 94 2016 58–58
Wu Expression of ferritin light chain (FTL) is elevated in glioblastoma, and FTL silencing inhibits glioblastoma cell proliferation via the GADD45/JNK pathway PLoS One 11 2016 e0149361
Xiao Gut microbiota bridges the iron homeostasis and host health Sci China Life Sci 66 2023 1952 1975 37515687
Yang Dietary supplementation with N-carbamylglutamate increases the expression of intestinal amino acid transporters in weaned Huanjiang mini-pig piglets J Anim Sci 91 2013 2740 2748 23478823
Yin Mechanism of iron on the intestinal epithelium development in suckling piglets Sci China Life Sci 66 2023 2070 2085 37233872
You Proteomic approach to coronary atherosclerosis shows ferritin light chain as a significant marker: evidence consistent with iron hypothesis in atherosclerosis Physiol Genom 13 2003 25 30
Zhang Ferroportin1 deficiency in mouse macrophages impairs iron homeostasis and inflammatory responses Blood J Am Soc Hematol 118 2011 1912 1922
Zhang Asporin represses gastric cancer apoptosis via activating LEF1-mediated gene transcription independent of beta-catenin Oncogene 40 2021 4552 4566 34127813
Zhang Plasma non-transferrin-bound iron uptake by the small intestine leads to intestinal injury and intestinal flora dysbiosis in an iron overload mouse model and Caco-2 cells Sci China Life Sci 66 2023 2041 2055 37452897
Zhou Diurnal variations in polyunsaturated fatty acid contents and expression of genes involved in their de novo synthesis in pigs Biochem Biophys Res Commun 483 2017 430 434 28013051
Zhou Effects of iron, vitamin A, and the interaction between the two nutrients on intestinal development and cell differentiation in piglets J Anim Sci 99 2021
