
==== Front
Immun Inflamm Dis
Immun Inflamm Dis
10.1002/(ISSN)2050-4527
IID3
Immunity, Inflammation and Disease
2050-4527
John Wiley and Sons Inc. Hoboken

10.1002/iid3.70025
IID370025
Original Article
Original Article
Association of rs2241766 and rs1501299 polymorphisms in the adiponectin gene with metabolic syndrome
TANG et al.
Tang Yinghua http://orcid.org/0000-0002-5655-9650
1 2
Yin Lianli 3
Lin Faquan 1 faquanlin@163.com

1 Department of Clinical Laboratory The First Affiliated Hospital of Guangxi Medical University, Key Laboratory of Clinical Laboratory Medicine of Guangxi Department of Education Nanning Guangxi China
2 Department of Clinical Laboratory The First Affiliated Hospital of Guangxi University of Chinese Medicine Nanning Guangxi China
3 Department of Clinical Laboratory The People's Hospital of Guangxi Zhuang Autonomous Region, Guangxi Academy of Medical Sciences Nanning Guangxi China
* Correspondence Faquan Lin, Department of Clinical Laboratory, The First Affiliated Hospital of Guangxi Medical University, Key Laboratory of Clinical Laboratory Medicine of Guangxi Department of Education, No. 6 Shuang Yong Rd, Nanning 530021, Guangxi, China.
Email: faquanlin@163.com

18 9 2024
9 2024
12 9 10.1002/iid3.v12.9 e7002504 9 2024
19 5 2024
06 9 2024
© 2024 The Author(s). Immunity, Inflammation and Disease published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

To investigate the influence of adiponectin (APN) rs2241766 and rs1501299 polymorphisms on adiponectin levels and their association with metabolic syndrome (MetS).

Methods

Analyzed two polymorphisms (rs2241766 and rs1501299) of the adiponectin gene (ADIPOQ) in 210 MetS patients and 102 control patients using the polymerase chain reaction‐restriction fragment length polymorphism method and DNA sequencing technology.

Results

The genotypes of the rs2241766 T/G and rs1501299 G/T polymorphism were significantly associated with serum APN levels in MetS patients. The ADIPOQ polymorphisms were associated with a risk of MetS when compared with that in healthy controls. TG and GG genotypes of rs2241766 were associated with a significantly elevated risk of MetS as compared with the TT genotype (OR = 1.32 and OR = 2.53). Subjects with the G allele appeared to have higher susceptibility to MetS than those with the T allele (OR = 2.21). In common with the findings for rs2241766, the rs1501299 GT and TT genotypes were associated with a significantly increased risk of MetS as compared with the GG genotype (OR = 1.51 and OR = 2.24). The susceptibility to MetS appeared to be higher in subjects with the T allele than in those with the G allele (OR = 1.88).

Conclusions

The occurrence of MetS may be associated with genetic variations at the rs2241766 and rs1501299 loci, especially in individuals with T to G mutations (rs2241766) and G to T mutations (rs1501299). These mutations may lead to decreased APN levels and a higher risk of developing MetS.

The occurrence of MetS may be associated with genetic variations at the rs2241766 and rs1501299 loci, especially in individuals with T to G mutations (rs2241766) and G to T mutations (rs1501299). These mutations may lead to decreased APN levels and a higher risk of developing MetS.

adiponectin
association
metabolic syndrome
polymorphisms
Guangxi Natural Science Foundation Project2023GXNSFAA026124 the Health Commission of the Guangxi Zhuang Autonomous RegionZ‐A20220039 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:18.09.2024
Tang Y , Yin L , Lin F . Association of rs2241766 and rs1501299 polymorphisms in the adiponectin gene with metabolic syndrome. Immun Inflamm Dis. 2024;12 :e70025. 10.1002/iid3.70025
==== Body
pmc1 INTRODUCTION

Metabolic syndrome (MetS), which refers to a series of pathological and physiological changes caused by abnormal accumulation of various metabolic components in the body, is a cluster of complex metabolic disorders. MetS is associated with a 2–3 fold increased risk of heart disease. 1 With improvements in people's living standards and lifestyle changes, the prevalence of MetS has continued to increase year on year. 2 As a result, MetS has become a serious public health problem, which has attracted much research attention. Adiponectin (APN), a protein specifically secreted by adipose tissue, is associated with increased insulin sensitivity. APN also exhibits anti‐inflammatory, antiatherosclerotic, and antiplatelet aggregation properties. Autocrine, paracrine, and endocrine forms of APN are thought to influence insulin resistance, glucose conversion, lipid metabolism, vascular endothelial function, and inflammatory responses. 3 Some scholars have proposed that the occurrence of Mets is closely related to APN levels and that the serum APN levels of Mets patients are significantly lower than those of healthy individuals. 4 Therefore, some researchers believe that APN serves as a biological marker of MetS and that it plays an important role in the occurrence and development of MerS. 5

In humans, the APN gene is located on chromosome 3q27, which is rich in polymorphisms and is a susceptibility gene region for type 2 diabetes mellitus, MetS, and coronary heart disease. 6 Ethnic and regional differences in APN polymorphisms have resulted in inconsistent and even conflicting results for populations of the same race and different regions in studies conducted. 7 The aim of the present study was to investigate the associations between two single nucleotide polymorphisms (SNPs), rs2241766 and rs1501299 of the APN gene ADIPOQ, and their association with APN levels and MetS. The resulting epidemiological and genetic data can aid understanding of the possible mechanism of the role of rs2241766 and rs1501299 in MetS patients. 8

2 MATERIAL AND METHODS

2.1 Study population

From June 2019 to December 2021, 210 patients (females, n = 114; males, n = 96) with MetS aged 34–66 years (median age, 42.3 years), and 102 volunteer blood donors (control group) aged 28–61 years (median age, 39.2 years) were enrolled in this study. All the patients were diagnosed with MetS according to the 2016 Chinese guidelines for the management of dyslipidemia in adults. Based on these guidelines, patients with central obesity (waist circumference ≥90 cm for men and ≥85 cm for women), in addition to any two of the following parameters were included: elevated plasma triglycerides (TG) (≥1.70 mmol/L), low plasma high‐density lipoprotein cholesterol (HDL‐C) (<1.00 mmol/L), systolic blood pressure (SBP) ≥ 130 or diastolic blood pressure (DBP) ≥ 85 mmHg, fasting plasma glucose (FPG) ≥ 6.10 mmol/L, or diagnosed with type 2 diabetes mellitus. The healthy controls did not meet any of the criteria for MetS.

Blood samples were obtained from all the participants at the time of diagnosis. The clinical characteristics of the patients (age, sex, therapeutic interventions, etc.) were obtained from medical records. The weight, height, and visceral adiposity of the patients were also recorded. This research was approved by the Medical Ethics Committee of the First Affiliated Hospital of Guangxi University of Chinese Medicine (No: AF/SC‐08/04.0). All the procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. All the participants in the study provided written informed consent.

2.2 Measurements of biochemical parameters and genotyping

A venous blood sample (5 ml) was collected from each subject and placed in a dry ethylene diamine tetraacetic acid (EDTA) anticoagulant tube. Serum from the patients and healthy controls was separated from the cellular fraction by centrifugation at 2500 rpm. (1,500 × g) for 10 min and frozen at −20°C for the determination of APN. The blood in EDTA anticoagulant tubes was well mixed and used for DNA extraction.

APN levels were measured using an enzyme‐linked immuno sorbent assay kit (Tiangen Biotech, Beijing, China) and processed according to the manufacturer's instructions. Genomic DNA was isolated from whole blood samples using a TIANamp genomic DNA kit (Tiangen Biotech,) and processed according to the manufacturer's instructions. The DNA concentration was determined spectrophotometrically. Genotyping of APN was determined by the polymerase chain reaction (PCR) restriction fragment length polymorphism method. The PCR assay was performed using a Gene AmpPCR ABI 9700 system (ABI Applied Biosystems, USA). The APN genomic sequence (NT_005612.16) was obtained from the National Center for Biotechnology Information. For the APN rs2241766 and rs1501299 polymorphisms, the forward primer was 5′‐ CTTGGTGAGGAAAGGAGAC‐3′, and the reverse primer was 5′‐ GAGGAATCAGAATATGAATG‐3′. The final PCR mixture (50 μl) contained DNA (2.0 μl), PCR mixed reaction liquid (8.0 μl), 1.0 μl of each primer, Taq DNA polymerase (2.5 U/μl), and water. The thermocycler program consisted of an initial step of 94°C for 15 min, followed by 35 cycles of 94°C for 1 min, 55°C for 45 s, 72° C for 1 min, and a final extension step of 72°C for 5 min.

The enzymatic reaction system consisted of an amplified product (20.0 μl), restriction enzyme (1.0 μl) buffer (3.0 μl), and water (6.0 μl). The amplified DNA fragments were verified on a 2% agarose gel after incubation for 1 h at 37°C.

Each study participant was classified as having one of three possible genotypes. To validate the accuracy of the genotyping results, 70 random samples were repeatedly tested. There was 100% concordance between the results of the two tests. In addition, direct sequencing of 30 samples revealed 100% concordance with the genotyping results of the present study.

2.3 Statistical analysis

The genotype and allele frequencies of ADIPOQ in two groups were compared using the χ2 test. To assess the relative risk conferred by a particular allele and genotype, odds ratios (ORs) and their 95% confidence intervals (CIs) were calculated by binary logistic regression and adjusted for age. Demographic and clinical data among the groups were compared using a χ2 test and an analysis of variance. To compare the observed genotype frequencies among the subjects with expected genotype frequencies, the Hardy–Weinberg equilibrium was tested using the goodness of fit χ2 test. Differences in serum APN levels among the MetS patients and differences in serum APN levels between the MetS patients and controls were examined using a one‐way analysis of variance, and if significant, pairwise comparisons were performed. To elucidate the interaction between the factors studied (genotype and serum APN levels), the data were analyzed by a two‐way analysis of variance. All statistical analyses were performed using SPSS 21.0 (International Business Machines Corporation, USA).

3 RESULTS

3.1 Clinical characteristics of the subjects

The clinical characteristics of the two groups are shown in Table 1. There were significant differences in the height, weight, hip circumference, waist circumference, SBP, DBP, FPG, body mass index, TG, HDL‐C, low‐density lipoprotein cholesterol, and APN levels of the subjects in the different groups. There were no significant differences in the ages and heights of the participants, suggesting that the subjects were adequately matched based on these variables.

Table 1 Clinical characteristics of the study participants.

Indicator	MetS group (n = 210)	Control group (n = 102)	p value	
Sex (F/M)	114/96	62/40	0.750	
Age	42.3 ± 13.2	38.2 ± 13.8	0.185	
Height (cm)	165.2 ± 12.9	166.8 ± 13.1	0.274	
Weight (kg)	64.4 ± 6.3	61.2 ± 6.9	<0.001	
Hip circumference (cm)	104.1 ± 11.2	93.5 ± 8.6	<0.001	
Waist circumference (cm)	90.2 ± 7.1	83.3 ± 6.4	<0.001	
SBP (mm Hg)	131.5 ± 19.2	108.6 ± 14.9	<0.001	
DBP (mm Hg)	84.2 ± 12.1	74.1 ± 8.9	<0.001	
FPG (mmol/L)	5.68 ± 2.02	4.66 ± 0.81	<0.001	
BMI (kg/m2)	26.43 ± 2.58	22.12 ± 2.39	<0.001	
TG (mmol/L)	2.89 ± 0.66	1.21 ± 0.52	<0.001	
TC (mmol/L)	5.54 ± 1.76	4.55 ± 1.25	<0.001	
LDL‐C (mmol/L)	3.52 ± 1.76	1.77 ± 0.95	<0.001	
HDL‐C (mmol/L)	1.31 ± 0.41	1.68 ± 0.56	<0.001	
APN (mg/L)	15.8 ± 4.2	26.8 ± 6.6	<0.001	
APN, adiponectin; BMI, body mass index; DBP, diastolic blood pressure; FPG, fasting blood glucose; HDL‐C, high‐density lipoprotein cholesterol; LDL‐C, low‐density lipoprotein cholesterol; MetS, metabolic syndrome; SBP, systolic blood pressure; TC, total cholesterol; TG, triglycerides.

John Wiley & Sons, Ltd.

3.2 ADIPOQ genotypes and allele frequencies in the study groups

The genotype and allele frequencies of the ADIPOQ polymorphisms in the MetS patients and controls are summarized in Table 2 and Table 3. The genotype distributions of the rs2241766 T/G polymorphism and rs1501299 G/T polymorphism were consistent with Hardy‐Weinberg. Significant differences were observed in the distribution of the GG, TG, and TT genotypes at the rs2241766 locus between patients with MetS and the control group. Specifically, the frequencies of the GG, TG, and TT genotypes were significantly higher in MetS patients compared to the control group. Additionally, the frequencies of the G and T alleles were also significantly higher in the MetS patient group compared to the control group. Similarly, for the rs1501299 locus, there was a significant difference in the overall distribution of the GG, GT, and TT genotypes between MetS patients and the control group (p < .05). The frequencies of the GG, GT, and TT genotypes, as well as the G and T alleles, were also significantly higher in MetS patients compared to the control group (p < .05). The TG and GG genotypes of rs2241766 were associated with a increased risk of MetS as compared with the TT genotype (OR = 1.32, 95% CI 0.67–2.25; OR = 2.53, 95% CI 1.72–7.40 vs. OR = 1.00 ref). The G allele was associated with a significantly increased risk of MetS as compared with the T allele. Under the dominant model, genotype TG + GG appeared to be associated with an elevated risk of MetS when compared with the TT genotype (OR = 2.31, 95% CI 1.29–6.17). In common with rs2241766, the GT and TT genotypes of rs1501299 were associated with an elevated risk of MetS as compared with the GG genotype (OR = 1.51, 95% CI 0.84–2.50; OR = 2.24, 95% CI 1.35–5.92 vs. OR = 1.00 ref). The T allele was associated with a significantly increased risk of MetS as compared with the G allele. Under the dominant model, the genotype GT + TT appeared to be associated with an increased risk of MetS when compared with the GG genotype (OR = 1.78, 95% CI 1.22–4.81).

Table 2 Results of rs2241766 and rs1501299 gene testing in MetS patients and controls.

groups	n	SNP	genotypes	HW‐p value	Allele genes	SNP	genotypes	HW‐p value	Allele genes	
TT	TG	GG	T	G	TT	GT	GG	T	G	
MetS	210	rs2241766	33 (15.6)*	93 (44.3)*	84 (40.1)*	0.087	159 (37.9)*	261 (62.1)*	rs1501299	25 (11.9)*	59 (28.1)*	126 (60.0)*	0.089	109 (26.0)*	311 (74.0)*	
Controls	102	26 (25.6)	60 (58.8)	16 (16.1)	0.081	112 (54.9)	92 (45.1)	3 (2.9)	10 (9.8)	89 (87.3)	0.073	16 (7.8)	188 (92.2)	
* Compared with the controls, p < .05; MetS, metabolic syndrome; HW, Hardy‐Weinberg; SNP, single nucleotide polymorphisms.

John Wiley & Sons, Ltd.

Table 3 Genotype and allele frequencies of the two SNPs in the ADIPOQ in MetS patients and controls.

SNP	Polymorphisms	MetS patients	Controls	OR (95% CI)	p value	
n = 210 (%)	n = 102 (%)	
rs2241766	TT	33 (15.6)	26 (25.6)	1.00 ref		
TG	93 (44.3)	60 (58.8)	1.32 (0.67–2.25)	0.219	
GG	84 (40.1)	16 (16.1)	2.53 (1.72–7.40)	0.000	
TG + GG	177 (84.3)	76 (74.5)	2.31 (1.29–6.17)	0.025	
T allele	159 (37.9)	112 (54.9)	1.00 ref		
G allele	261 (62.1)	92 (45.1)	2.21 (1.19–3.03)	0.038	
rs1501299	GG	126 (60.0)	89 (87.3)	1.00 ref		
GT	59 (28.1)	10 (9.8)	1.51 (0.84–2.50)	0.296	
TT	25 (11.9)	3 (2.9)	2.24 (1.35–5.92)	0.016	
GT + TT	84 (40.0)	13 (12.7)	1.78 (1.22–4.81)	0.024	
G allele	311 (74.0)	188 (92.2)	1.00 ref		
T allele	109 (26.0)	16 (7.8)	1.88 (1.26–3.98)	0.044	
MetS, metabolic syndrome; 95% CI, 95% confidence interval; OR, odds ratio; SNP, single nucleotide polymorphisms.

John Wiley & Sons, Ltd.

3.3 Association between ADIPOQ polymorphisms and serum APN levels in MetS patients

As shown in Table 4, serum APN levels were associated with ADIPOQ polymorphisms in MetS patients, with a significant association observed between the genotypes of the rs2241766 T/G and rs1501299 G/T polymorphisms and serum APN levels. Serum APN levels were significantly lower in individuals with a homozygous GG genotype (14.5 ± 4.3 mg/mL) or heterozygous TG genotype (15.9 ± 4.2 mg/mL) than a homozygous TT genotype (18.4 ± 4.7 mg/mL) of the rs2241766 polymorphism (p < .05). Similarly, serum APN levels were significantly lower in individuals with a homozygous TT genotype (13.7 ± 5.4 mg/mL) or a heterozygous GT genotype (14.1 ± 5.3 mg/mL) than a homozygous GG genotype (15.9 ± 4.9 pg/mL) of the rs1501299 polymorphism (p < .05).

Table 4 The association between ADIPOQ polymorphisms and serum APN concentrations in MetS patients.

SNP	Polymorphisms	MetS patients	APN (mg/mL)	p value	
n = 210 (%)	n = 210	
rs2241766	TT	33 (15.6)	18.4 ± 4.7		
TG	93 (44.3)	15.9 ± 4.2	<0.001	
GG	84 (40.1)	14.5 ± 4.3	<0.001	
TG + GG	177 (84.3)	15.1 ± 5.2	<0.001	
rs1501299	GG	126 (60.0)	15.9 ± 4.9		
GT	59 (28.1)	14.1 ± 5.3	<0.001	
TT	25 (11.9)	13.7 ± 5.4	<0.001	
GT + TT	84 (40.0)	13.9 ± 5.5	<0.001	
ADIPOQ, adiponectin gene; MetS, metabolic syndrome; APN, adiponectin; SNP, single nucleotide polymorphisms.

John Wiley & Sons, Ltd.

4 DISCUSSION

MetS is a cluster of complex metabolic disorders, resulting from a series of pathological and physiological changes caused by abnormal accumulation of various metabolic components in the body. Its prevalence among adults has increased from 25.3% to 35.8% in the United StatesIn recent years. 9 Due to lifestyle changes in human, the prevalence of MetS is rising rapidly. MetS is a risk factor for cardiovascular disease (CVD) and is associated with a 2–3 fold increased risk of heart disease and death. 10 Many patients with MetS eventually develop CVD and kidney disease, which are leading a large social and economic burden on many countries. 11 As such, there is an urgent need to determine the potential risk factors for predicting which patients without clinical symptoms are likely to develop MetS.

Adipose tissue can secrete a wide range of biologically active cytokines, which termed adipokines. Besides being involved in fat metabolism, many adipokines have pro‐inflammatory or anti‐inflammatory functions. 12 , 13 With an increase in adiposity, the expression of pro‐inflammatory adipokines is enhanced, whereas that of anti‐inflammatory adipokines is reduced. Classical examples of pro‐inflammatory adipokines are APN. 14 APN promotes metabolic functions and provides cardiovascular protection. 15 Many of the protective actions of APN are attributed to its anti‐inflammatory properties. Ouichi and Walsh reported that APN inhibited nuclear factor κB (NF‐κB) activation in endothelial cells following treatment with pro‐inflammatory factors, such as TNF‐α. 16 Wang et al. reported that APN appeared to protect the aorta from atherosclerotic injury by reducing inflammation and suggested that the molecular mechanism may involve inhibition of the expression of downstream components of NF‐κB. 17

The APN gene, which is rich in polymorphisms, is located on human chromosome 3q27 in a susceptibility gene region for type 2 diabetes mellitus and MetS. 18 The present study aimed to identify APN polymorphisms associated with MetS and to determine whether these APN polymorphisms were related to the occurrence of MetS in this population. The selection criteria for the two SNPs were that they were located in exon or intron regions and that single nucleotide changes in these SNPs resulted in an amino acid substitution that led to decreased synthesis and secretion of APN. In this study, serum APN levels of the MetS group were significantly reduced as compared with those of healthy controls. This finding is in agreement with that of previous studies, 19 , 20 , 21 suggesting that low serum APN levels appear to be closely associated with the occurrence of MetS. Furthermore, it suggests that APN plays an important role in preventing the development and progression of MetS.

The rs2241766 and rs1501299 polymorphisms are common SNPs of ADIPOQ. The rs2241766 polymorphism is a T/G substitution in exon 2, and the rs1501299 polymorphism is a G/T substitution in intron 2. Although there is evidence for an association between rs2241766 and an elevated risk of MetS, the underlying molecular mechanism remains unclear. 22 The rs2241766 polymorphism, which is located in exon 2 and results in a synonymous change (G15G), is relatively close to the exon‐intron boundary. 23 Therefore, it may affect the splicing machinery. There is increasing evidence that even silent mutations in coding regions may modify RNA levels by affecting splicing and thus decreasing expression of the gene. In this regard, a bioinformatics analysis identified a consensus sequence recognized by a functional exonic splicing‐enhancer in which 87% of the sequence matched to a 4 bp sequence in the 3′ region of the rs2241766 polymorphism. 24 Therefore, rs2241766 may influence the expression of the APN gene and be associated with MetS. In common with the rs2241766 polymorphism, little is known about the molecular mechanism of rs1501299. Although rs1501299 is located in an intronic region, with no apparent biological function, this SNP may affect the expression level of the ADIPOQ gene through some unknown mechanisms. Alternatively, there may be undiscovered SNPs in the ADIPOQ gene or other genes that have biological effects on insulin resistance.

This study found significant differences in the genotype distribution between patients with MetS and healthy controls at two single‐nucleotide polymorphism (SNP) sites, rs2241766 and rs1501299. For rs2241766, the frequencies of the GG, TG, and TT genotypes in MetS patients were significantly higher than in the control group. Similarly, the frequencies of the G and T alleles were also significantly higher in the MetS patient group compared to healthy controls. These results suggest that these genotypes and alleles may play a promoting role in the development of MetS. Similarly, significant statistical differences were also observed at the rs1501299 site, where the frequencies of the GG, GT, and TT genotypes were also higher in MetS patients than in the control group. Additionally, the frequencies of the G and T alleles at this site were significantly higher in MetS patients compared to controls. The findings at these two sites not only reveal a specific association between certain genotypes and MetS but also emphasize the potential role of the G and T alleles in the pathophysiological processes. The high frequency of these genotypes and alleles may increase the risk of MetS by affecting key metabolic pathways such as lipid metabolism, insulin signaling, or inflammatory responses. In addition, further analysis of the association of the rs2241766 SNP with serum APN levels revealed that serum APN levels were significantly lower in individuals with the G genotype. This finding suggested that individuals carrying the G genotype with low to medium APN levels were more likely to develop MetS and that this genotype was a risk factor for MetS. This finding is in accordance with that of previous studies, 22 suggesting that rs2241766 is associated with susceptibility to MetS patients.

The literature on the association of the G/T mutation at the rs1501299 locus of APN intron 3 with MetS is inconsistent. Some studies showed that the G/T mutation at the rs1501299 locus was related to MetS, 25 whereas another study found no such relationship. 26 In this study, the distribution frequencies of GT and TT genotypes of rs1501299 in MetS patients were significantly lower than those in the healthy controls. In addition, the T allele was more common in the MetS patients than in the controls. Further analysis of the association of the rs1501299 SNP with serum APN levels revealed that APN levels were significantly lower in individuals with the T genotype, suggesting that individuals carrying the G genotype with a low to medium level of APN were more likely to develop MetS and that this genotype was a risk factor for MetS.

This study has several limitations. First, the relatively small number of study participants is one of them. Additionally, all samples in this study come from patients at a single tertiary unit, and all subjects belong to the same ethnicity, which necessitates further research to determine if there are racial differences.

5 CONCLUSION

The variation at the rs2241766 and rs1501299 locus of the adiponectin gene is significantly associated with an increased risk of MetS. Especially individuals with T to G mutations (rs2241766) and G to T mutations (rs1501299) may lead to a decrease in APN levels and are more prone to MetS, indicating that these mutations are risk factors for MetS.

AUTHOR CONTRIBUTIONS

Conceived and designed the experiments: FQ Lin. Performed the experiments: YH Tang. Analyzed the data: LL Yin. Contributed reagents/materials/analysis tools: FQ Lin. Wrote the paper: YH Tang. Final approval of the version to be submitted: FQ Lin.

FUNDING

This study was supported by Guangxi Natural Science Foundation Project (2023GXNSFAA026124), and the Health Commission of the Guangxi Zhuang Autonomous Region (Z‐A20220039).

CONFLICTS OF INTEREST STATEMENT

The authors declare that they have no conflict of interest.

Supporting information

Supporting information.

DATA AVAILABILITY STATEMENT

Data will be made available on request.
==== Refs
REFERENCES

1 Wu Z , Cui H , Zhang Y , et al. The impact of the metabolic score for insulin resistance on cardiovascular disease: a 10‐year follow‐up cohort study. J Endocrinol Investig. 2023;46 (3 ):523‐533.36125732
2 Lee H , Rhee TM , Park HE , Han K , Choi SY . Association between cumulative metabolic risk exposure and cardiovascular disease: a nationwide cohort of over 3.6 million young adults. Eur J Prev Cardiol. 2024;31 (10 ):1288‐1300.38421612
3 Ito R , Narita S , Huang M , et al. The impact of obesity and adiponectin signaling in patients with renal cell carcinoma: a potential mechanism for the “obesity paradox”. PLoS One. 2017;12 (2 ):e0171615.28178338
4 Ghadge AA , Khaire AA , Kuvalekar AA . Adiponectin: a potential therapeutic target for metabolic syndrome. Cytokine Growth Factor Rev. 2018;39 :151‐158.29395659
5 Chen VCH , Chen CH , Chiu YH , Lin TY , Li FC , Lu ML . Leptin/Adiponectin ratio as a potential biomarker for metabolic syndrome in patients with schizophrenia. Psychoneuroendocrinology. 2018;92 :34‐40.29625373
6 Houshmand‐Oeregaard A , Hansen NS , Hjort L , et al. Differential adipokine DNA methylation and gene expression in subcutaneous adipose tissue from adult offspring of women with diabetes in pregnancy. Clin Epigenetics. 2017;9 :37.28413567
7 Li YY , Yang ZJ , Zhou CW , et al. 11377CG gene polymorphism and type 2 diabetes mellitus in the Chinese population: a meta‐analysis of 6425 subjects. PLoS One. 2013;8 (4 ):e61153.23585875
8 Wang L , Gao P , Zhang M , et al. Prevalence and ethnic pattern of diabetes and prediabetes in China in 2013. JAMA. 2017;317 (24 ):2515‐2523.28655017
9 Mazumder H , Husain M , Hossain MF , Mahmud S . Prevalence, trend and associated factors of obesity‐related cancers among US adults with metabolic syndrome: evidence from The National Health and Nutrition Examination Survey 2001‐2018. PLoS One. 2023;18 (9 ):e0290994.37656713
10 Li R , Li W , Lun Z , et al. Prevalence of metabolic syndrome in mainland China: a meta‐analysis of published studies. BMC Public Health. 2016;16 :296.27039079
11 Kang SY , Lee YH , Jeong SJ , Kim JS , Jeong KH , Hwang HS . How obesity and metabolic syndrome affect cardiovascular events, progression to kidney failure and all‐cause mortality in chronic kidney disease. Nephrol Dial Transpl. 2024;39 (5 ):778‐787.
12 Rutkowski JM , Halberg N , Wang QA , Holland WL , Xia JY , Scherer PE . Differential transendothelial transport of adiponectin complexes. Cardiovasc Diabetol. 2014;13 :47.24552349
13 Davis SK , Gebreab SY , Xu R , et al. Association of adiponectin with type 2 diabetes and hypertension in African American men and women: the Jackson Heart Study. BMC Cardiovasc Disord. 2015;15 :13.25885320
14 Tilija Pun N , Subedi A , Kim MJ , Park PH . Globular adiponectin causes tolerance to LPS‐induced TNF‐α expression via autophagy induction in RAW 264.7 macrophages: involvement of SIRT1/FoxO3A axis. PLoS One. 2015;10 (6 ):e0124636.25961287
15 Peng J , Chen Q , Wu C . The role of adiponectin in cardiovascular disease. Cardiovasc Pathol. 2023;64 :107514.36634790
16 Ouchi N , Walsh K . Adiponectin as an anti‐inflammatory factor. Clin Chim Acta. 2007;380 (1‐2 ):24‐30.17343838
17 Wang X , Chen Q , Pu H , et al. Adiponectin improves NF‐κB‐mediated inflammation and abates atherosclerosis progression in apolipoprotein E‐deficient mice. Lipids Health Dis. 2016;15 :33.26965176
18 Divella R , Daniele A , Mazzocca A , et al. ADIPOQ rs266729 G/C gene polymorphism and plasmatic adipocytokines connect metabolic syndrome to colorectal cancer. J Cancer. 2017;8 (6 ):1000‐1008.28529612
19 Cho SA , Joo HJ , Cho JY , et al. Visceral fat area and serum adiponectin level predict the development of metabolic syndrome in a community‐based symptomatic population. PLoS One. 2017;12 (1 ):e0169289.28046037
20 Kang DR , Yadav D , Koh SB , Kim JY , Ahn SV . Impact of serum leptin to adiponectin ratio on regression of metabolic syndrome in high‐risk individuals: the ARIRANG study. Yonsei Med J. 2017;58 (2 ):339‐346.28120564
21 Kim JY , Ahn SV , Yoon JH , et al. Prospective study of serum adiponectin and incident metabolic syndrome. Diabetes Care. 2013;36 (6 ):1547‐1553.23275369
22 Yuan HP , Sun L , Li XH , et al. Association of adiponectin polymorphism with metabolic syndrome risk and adiponectin level with stroke risk: a meta‐analysis. Sci Rep. 2016;6 :31945.27578536
23 Zhao N , Li N , Zhang S , et al. Associations between two common single nucleotide polymorphisms (rs2241766 and rs1501299) of ADIPOQ gene and coronary artery disease in type 2 diabetic patients: a systematic review and meta‐analysis. Oncotarget. 2017;8 (31 ):51994‐52005.28881706
24 Peters KE , Beilby J , Cadby G , et al. A comprehensive investigation of variants in genes encoding adiponectin (ADIPOQ) and its receptors (ADIPOR1/R2), and their association with serum adiponectin, type 2 diabetes, insulin resistance and the metabolic syndrome. BMC Med Genet. 2013;14 :15.23351195
25 Larifla L , Rambhojan C , Joannes MO , et al. Gene polymorphisms of FABP2, ADIPOQ and ANP and risk of hypertriglyceridemia and metabolic syndrome in Afro‐Caribbeans. PLoS One. 2016;11 (9 ):e0163421.27684940
26 AlSaleh A , O'Dell SD , Frost GS , et al. Single nucleotide polymorphisms at the ADIPOQ gene locus interact with age and dietary intake of fat to determine serum adiponectin in subjects at risk of the metabolic syndrome. Am J Clin Nutr. 2011;94 (1 ):262‐269.21562092
