
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13342-7
10.1016/j.heliyon.2024.e37311
e37311
Research Article
Functional study of the ST6GAL2 gene regulating skeletal muscle growth and development
Wang Tao a1
Ran Bo b1
Luo Yingyu c1
Ma Jideng c
Li Jing c
Li Penghao d
Li Mingzhou mingzhou.li@sicau.edu.cn
c⁎⁎
Li Diyan lidiyan@cdu.edu.cn
a⁎
a School of Pharmacy, Chengdu University, Chengdu, 610106, China
b Sichuan Animal Science Academy, Chengdu, 610066, China
c State Key Laboratory of Swine and Poultry Breeding Industry, College of Animal Science and Technology, Sichuan Agricultural University, Chengdu, 611130, China
d Jinxin Research Institute for Reproductive Medicine and Genetics, Chengdu Xi Nan Gynecological Hospital Co., Ltd., 66 Bisheng Road, Chengdu, 610000, China
⁎ Corresponding author. lidiyan@cdu.edu.cn
⁎⁎ Corresponding author. mingzhou.li@sicau.edu.cn
1 Tao Wang, Bo Ran and Yingyu Luo contributed equally to this work.

01 9 2024
15 9 2024
01 9 2024
10 17 e3731122 1 2024
30 8 2024
30 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
ST6GAL2, a member of the sialoglycosyltransferase family, primarily localizes within the cellular Golgi apparatus. However, the role of the ST6GAL2 gene in skeletal muscle growth and development remains elusive. In this study, the impact of the ST6GAL2 gene on the proliferation, differentiation, and apoptosis of primary chicken myoblasts at the cellular level was investigated. Quantitative fluorescent PCR was used to measure the expression levels of genes. Subsequently, using gene knockout mice, we assessed its effects on skeletal muscle growth and development in vivo. Our findings reveal that the ST6GAL2 gene promotes the expression of cell cycle and proliferation-related genes, including CCNB2 and PCNA, and apoptosis-related genes, such as Fas and Caspase-9. At the individual level, double knockout of ST6GAL2 inhibited the formation of both fast and slow muscle fibers in the quadriceps, extensor digitorum longus, and tibial anterior muscle, while promoting their formation in the gastrocnemius and soleus. These results collectively demonstrate that the ST6GAL2 gene facilitates the proliferation, apoptosis, and fusion processes of primary chicken myoblasts. Additionally, it promotes the enlargement of cross-sectional muscle fiber areas and regulates the formation of fast and slow muscle fibers at the individual level, albeit inhibiting muscle fusion. This study provides valuable insights into the role of the ST6GAL2 gene in promoting proliferation of skeletal muscle.

Keywords

Primary myoblast
ST6GAL2
Cell proliferation and apoptosis
Induced differentiation
Knockout mice
Skeletal muscle
==== Body
pmc1 Introduction

Livestock farming, with a particular emphasis on domestic chicken farming, holds significant socio-economic importance for individuals residing in low-income nations across Africa and Asia [1]. Domestic chickens are a globally prevalent avian species, largely due to their brief generational span and remarkable adaptability across diverse agroecological settings [2,3]. Domestic chickens are a crucial source of high-quality protein and income for impoverished rural households, making them the most extensively raised livestock species globally [4]. This is due to the presence of the valuable traits of chickens like disease resistance, adaptation to harsh environments, and ability to utilize poor quality feeds [5].

ST6GAL2, a member of the sialoglycosyltransferase family, predominantly resides in the Golgi apparatus within cells. Its structural composition encompasses a short N-terminal cytoplasmic tail, a transmembrane domain, a stem domain, and a catalytic domain [6]. Sialic acid has been established as a pivotal contributor to the functional maintenance and structural integrity of skeletal muscle [7,8]. Sialoglycosyltransferases mediate the transfer of β-glycoside donor cytidine 5′-monophosphoric acid-N-acetylneuraminic acid (CMP-Neu5Ac) to the terminal non-reducing positions of glycoprotein and glycoliposaccharide oligosaccharide chains [9,10].

While prior investigations have largely centered on ST6GAL2 within the context of the brain and tumors, a study on adult brains revealed distinctive tissue-specific patterns of ST6GAL2 expression, hinting at its potential involvement in specific brain functions [11]. This investigation identified NF-κB and NRSF as transcriptional inhibitors of ST6GAL2, whereas neuronal-associated developmental factors Sox5, Purα, and Olf1 were identified as transcriptional activators of ST6GAL2 [12]. Furthermore, selective knockout of the dnmt3b gene in hippocampal excitatory neurons led to compensatory upregulation of ST6GAL2 expression, impairing object position recognition memory in knockout mice. Transcriptome studies of brain regions in Alzheimer's patients have also unveiled significant downregulation of ST6GAL2 gene expression, underscoring its potential importance in brain function.

In the realm of cancer, ST6GAL2 is overexpressed in certain types, including breast cancer, where its elevated expression correlates with poor patient prognosis [13]. Notably, silencing of ST6GAL2 in follicular thyroid carcinoma has reduced tumor growth in vivo models [14]. Additionally, ST6GAL2 overexpression has been shown to inhibit the Hippo signaling pathway, a tumor suppressor pathway that regulates cell differentiation and proliferation by restraining the YAP and TAZ transcriptional coactivators [15,16].

In contrast to the extensive research on ST6GAL2 in other contexts, its function in skeletal muscle remains largely unexplored. Sialic acid is crucial in preserving glycoproteins associated with fibrous structure, neuromuscular connectivity, development and regeneration, muscle excitability, and athletic performance in skeletal muscle [17,18]. Despite sialylation being less abundant in muscles than other tissues, muscle tissue is particularly sensitive to mutation-induced sialic acid deficiency, resulting in various diseases, often characterized by a significant loss of exercise capacity [19]. As a sialic acid acyltransferase, ST6GAL2 may be implicated in physiological processes influenced by sialic acid. Previous studies have indicated limited expression of ST6GAL2 in adult mouse skeletal muscle and C2C12 myotubular cells, both in tissues and cells [20].

Skeletal muscles constitute roughly 35 % of an individual's total body mass and play a crucial role in facilitating various bodily movements and maintaining proper posture [21,22]. The formation of skeletal muscle is a complex series of events that involves genes responsible for various aspects of muscle development [23]. Skeletal muscle formation is a complex process that ensues after the termination of the cell cycle, guided by an array of regulatory transcription factors such as MyoD1, MyoG, Myosin heavy chain (MyHC), and Myomaker. This process involves initiating muscle-specific gene transcription, cell elongation, and cell-to-cell fusion. MyoD1, in collaboration with MyoG, orchestrates myoblast fusion into multinucleated myotubes, albeit with the distinction that MyoG is expressed exclusively during myoblast differentiation, while MyoD1 is expressed during the skeletal muscle satellite cell period. MyHC is a marker for late skeletal muscle differentiation, with elevated levels predicting increased myofiber formation [24]. Myomaker, a myoblast membrane fusion protein, is pivotal in activating myoblasts' fusion capacity and contributes significantly to muscle regeneration and formation [25]. The potential impact of ST6GAL2 knockout on these critical genes remains unclear.

To unravel the role of ST6GAL2 in skeletal muscle growth and development, this study employs a dual approach. Firstly, it investigates the effects of ST6GAL2 on myogenesis, differentiation, cell cycle regulation, apoptosis, and proliferation in chicken primary myoblasts in vitro, serving as a cellular model. Subsequently, gene knockout mice are generated to explore the in vivo effects of ST6GAL2 on myogenesis, differentiation, and the expression of genes associated with muscle fiber types. The objective of this research is to investigate the function of ST6GAL2 in skeletal muscle growth, which, to the best of our knowledge, has not been explored before. This study represents the first attempt to explore the impact of ST6GAL2 knockout on skeletal muscle development, thereby contributing original insights to the field and offering valuable insights that can potentially enhance meat yield and quality in livestock production.

2 Materials and methods

2.1 Experimental materials

Primary myoblasts were isolated using established protocols [26] from 100 Qingjiao chicken eggs from the farm of DEKON GROUP (DEKON, Chengdu, China). The incubation conditions maintained a temperature of 37.8 °C and 60 % humidity. C57/BL6J mice were obtained from Chengdu Dashuo Laboratory Animal Co., LTD, while ST6GAL2 knockout mice were provided by Jiangsu Jiocainyaokang Biotechnology Co., LTD. For experiments requiring wild-type, single-knockout, and double-knockout mice, breeding procedures were employed (Fig. 1A). Stable F1 generation single-knock mice and WT mice were hybridized, and then continuously bred to obtain the heterogeneous single-knock mice (ST6GAL2+/−) and double-knock mice (ST6GAL2−/−). Two pairs of primers (F1/R1 and F2/R2) were used to identify mouse genotypes. Among them, F1/R1 confirmed the presence of double-knock alleles by PCR, and F2/R2 confirmed the presence of wild-type alleles. The double-knock and wild-type bands were 314 bp and 455 bp, respectively (Fig. 1B). Additionally, PCR products were further sequenced to confirm the genotype of the target mouse (Fig. 1C).Fig. 1 Design and identification of ST6GAL2 knockout mice. (A) The schematic diagram of the gene knockout; (B) The glue map for genotype identification. The full, non-adjusted images were provided as supplementary material (Figs. S1 and S2). (C) The sequencing results of the PCR products.

Fig. 1

2.2 Cell culture

Primary myoblasts were isolated from the leg muscles of chicken embryos on the 10th day of incubation. After removing the bones, the leg muscles were placed in a DMEM medium supplemented with 10 % FBS and 0.2 % penicillin/streptomycin. The muscle tissue was then diced and transferred to a 50 ml centrifuge tube. The suspension was agitated for 1 min and passed through a 70 μm cell strainer. The filtrate was centrifugation at 1000 rpm for 5 min at room temperature. The collected cells were resuspended in a growth medium and transferred to culture bottles. The cells were cultured in a 5 % CO2 environment at 37 °C and subjected to differential adhesion, a process repeated three times. Cell growth was observed and recorded daily [27].

2.3 DNA extraction, RNA extraction, cDNA synthesis and quantitative real-time fluorescence quantitative PCR (qRT-PCR)

DNA was extracted from the toes of one-week-old mice using Tiangen Biochemical Technology Co., LTD. (Blood/cell/tissue genomic DNA extraction kit - centrifugal column DP304) for genotype identification. The DNA concentration was determined using a spectrophotometer. PCR assays were conducted using 2 × Rapid Taq Master Mix (Vazyme-P222), and mouse genotypes were identified through electrophoresis on a 1 % agarose gel. RNA extraction from tissues and cells was performed using Trizol, with RNA concentration determined using a spectrophotometer. The synthesis of cDNA chains was accomplished using the ExonScript RT SuperMix with dsDNase reverse transcription kit from the Chengdu Rongwei gene company. Quantification of selected genes was carried out using the LightCycler® Instrument system, employing the chick or mouse β-actin gene as the internal reference. qRT-PCR was performed using the Fast SYBR Green qPCR Master Mix UDG kit from Chengdu Rongwei Gene Co., LTD. All experiments were conducted in triplicate. Relative gene quantification utilized the 2−ΔΔCt method. Primers required for the experiments were synthesized by Qingke Biotechnology Co., LTD., with the primer sequences detailed in Table 1.Table 1 qRT-PCR primers of each detected genes.

Table 1Gene	Primer sequence (5′-3′)	Product length (bp)	Tm (°C)	Reference	
Gal-ST6GAL2	F:TGGAGCCGTCAGAGGAGAATGAG	85	60	XM_046906978.1	
R:GCCCATCCCAGTCATCAGATTCATC	
Gal-MyoD1	F:GCTACTACACGGAATCACCAAAT	200	60	[21]	
R:CTGGGCTCCACTGTCACTCA	
Gal-MyoG	F:CGGAGGCTGAAGAAGGTGAA	320	60	
R:CGGTCCTCTGCCTGGTCAT	
Gal-MyHC	F:CTCCTCACGCTTTGGTAA	213	60	
R:TGATAGTCGTATGGGTTGGT	
Gal-β-actin	F:TTGTTGACAATGGCTCCGGT	110	58	
R:AACCATCACACCCTGATGTCT	
Gal-Myomarker	F:TGGGTGTCCCTGATGGC	135	51	
R:CCCGATGGGTCCTGAGTAG	
Gal-Fas	F:TCCACCTGCTCCTCGTCATT	78	60	[28]	
R:GTGCAGTGTGTGTGGGAACT	
Gal-CCNB2	F:CCTCTTCCACTTCACTTCT	195	51	[29]	
R:CTTTGTACCCCACTTATCA	
Gal-CCND1	F:CAGAAGTGCGAAGAGGAAGT	188	51	
R:CTGATGGAGTTGTCGGTGTA	
Gal-PCNA	F:AGCACCAAATCAGGAAAAG	177	51	
R:GCACAGGAGATGACAACAG	
Gal-Caspase 3	F:GGCTACTACTCCTGGAGGA	193	51	
R:ACACAATGCATGGAATCTG	
Gal-Caspase 9	F:GGAGGAGAACAAAAGGACC	187	51	
R:CTGGAAAAGTTGAATAGGA	
Mus-MyoD1	F:CGAGCACTACAGTTGGCGACTAAGAT	204	60	[21]	
R:GCTCCACTATGCTGGACAGGCAGT	
Mus-MyoG	F:CCATCCAGTACATTGAGCGCCTACA	241	60	
R:ACGATGGACGTAAGGGAGTGCAGAT	
Mus-MyHC	F:CAAGTCATCGGTGTTTGTGG	158	60	
R:TGTCGTACTTGGGCGGGTTC	
Mus-Myomarker	F:ATCGCTACCAAGAGGCGTT	107	60	
R:CACAGCACAGACAAACCAGG	
Mus-MyHC I/Myh7	F:ACTGTCAACACTAAGAGGGTCA	114	60	[30]	
R:TTGGATGATTTGATCTTCCAGGG	
Mus-MyHC IIa/Myh2	F:AAGTGACTGTGAAAACAGAAGCA	222	60	
R:GCAGCCATTTGTAAGGGTTGAC	
Mus-MyHC IIb/MYH4	F:TTGAAAAGACGAAGCAGCGAC	190	60	
R:AGAGAGCGGGACTCCTTCTG	
Mus-MyHC IIx/MyHC	F:GCGAATCGAGGCTCAGAACAA	138	60	[31]	
R:GTAGTTCCGCCTTCGGTCTTG	
Mus-Tnni1	F:TGAAGCCAAATGCCTCCACAACAC	155	60	[32]	
R:ACACCTTGTGCTTAGAGCCCAGTA	
Mus-Tnnc1	F:AGCTCATGAAGGACGGTGACAAGA	102	61	
R:AACCGTGCAAGACCAGCATCTACT	
Mus-Tnni2	F:AGCAGCAAGGAGCTGGAAGA	101	58	
R:ATGGCGTCGGCAGACATAC	
Mus-Tnnc2	F:CCATCATCGAGGAGGTGGAC	101	60	
R:CTTCCCCTTCGCATCCTCTT	
Notes: Gal: Gallus gallus domesticus; Mus: Mus musculus.

2.4 Overexpression and interference efficiency assays

Two overexpression vectors for ST6GAL2 transcripts (PEGFP-ST-201 and PEGFP-ST-202) were constructed by Nanjing Qingke Biological Co., LTD. Additionally, three si-RNA sequences for gene interference tests were designed and synthesized by Shanghai Sangon Bioengineering Co., LTD., with specific details provided in Table 2.Table 2 ST6GAL2 (XM_046906978.1) gene interference sequences and control sequences.

Table 2Sequence Name	Sequence (5′-3′)	Sequence length (bp)	
siRNA-452	GAUUUGGAAGAUGCCUUUAGATT	23	
UCUAAAGGCAUCUUCCAAAUCTT	23	
siRNA-862	GCGGUUCAAAGGGAAACGAAATT	23	
UUUCGUUUCCCUUUGAACCGCTT	23	
siRNA-1495	GUGUAACGAAGUGCACGUGUATT	23	
UACACGUGCACUUCGUUACACTT	23	
Negative Control	UUCUCCGAACGUGUCACGUTT	21	
ACGUGACACGUUCGGAGAATT	21	

When cell cultures in T175 flasks reached approximately 80 % confluence, they were trypsinized, counted, and plated. Transfection with overexpression and interference vectors occurred when cell confluence reached 40 %–50 %. The culture medium was replaced 8 h post-transfection. RNA samples were collected for quantitative analysis at 12 and 24 h after transfection to determine transfection efficiency.

2.5 CCK-8 assays

Myoblasts in the logarithmic growth phase were harvested, and their cell concentrations were calculated and adjusted accordingly. These cells were then seeded into 96-well plates at a volume of 100 μL per well and cultured in a CO2 incubator. When the cell confluence reached between 40 % and 50 %, transfection was performed using various vectors, including PEGFP-ST-201, PEGFP-N1, Si-NC, and Si-862. At 12, 24, 36, and 48 h post-transfection, 10 μL of CCK-8 reagent was added to each well. The plates were then incubated in the CO2 incubator for an additional 1.5 h. After incubation, the 96-well plate was removed, and the absorbance at 450 nm was measured using a microplate reader under dark conditions to assess cell viability and proliferation.

2.6 Cell cycle and apoptosis analysis

Flow cytometry was employed to analyze cell cycle and apoptosis. Cells from the experimental and control groups were collected 24 h after transfection. For cell cycle analysis, samples were washed with PBS and fixed with 70 % ethanol. DNA was stained with propidium iodide (PI) staining solution for 15 min at room temperature. Apoptotic samples were resuspended in 1 × binding buffer and stained in the dark with 5 μL of Annexin V-FITC staining fluorescent dye for 10 min, followed by adding 10 μL of PI for 5 min. Data analysis was conducted using Cytoflex flow cytometry (Beckman Coulter) and Modfit LT (v5.0).

2.7 Immunofluorescence

The purity of myoblasts, which are precursor cells that can differentiate into muscle cells, was determined using a technique called desmin immunofluorescence. In this method, a desmin antibody was used to specifically bind to desmin proteins, which are intermediate filament proteins found in muscle cells. To visualize this binding, a secondary antibody, rabbit IgG, conjugated with a fluorescent dye called FITC (Fluorescein isothiocyanate), was employed. This secondary antibody binds to the primary desmin antibody, and the FITC dye allows the desmin protein to be seen under a fluorescence microscope. Cell differentiation was assessed using MYHC and FITC-conjugated anti-mouse IgG antibodies. Nuclear staining was carried out using DAPI (4′,6-diamidino-2-phenylindole), a fluorescent stain that binds strongly to DNA. This allowed the nuclei of the cells to be clearly visualized. Finally, all images were acquired using a fluorescence microscope, which uses specific wavelengths of light to excite the fluorescent dyes (FITC and DAPI), causing them to emit light at different wavelengths. This emitted light is then captured to create detailed images of the cells, highlighting the presence of desmin, MYHC, and the nuclei.

2.8 Body weight analysis and growth curve determination

Weekly measurements of mouse body weight were carried out from birth until the 8th week. Each week, the body weight of each mouse was recorded meticulously. The collected body weight data were then categorized into three distinct groups based on the genotype identification results: wild type (WT), heterozygous (ST6GAL2+/−), and homozygous (ST6GAL2−/−). The body weight data for each group were then subjected to statistical analysis using GraphPad Prism 9, a software tool commonly used for scientific graphing and data analysis. The software was used to generate detailed growth curves for the mice, illustrating the changes in body weight over time for each genotype group. This analysis provided insights into the growth patterns and potential differences among the wild-type, heterozygous, and homozygous mice.

2.9 Hematoxylin-eosin (HE) stain

Paraffin-embedded tissue sections were first deparaffinized and then oven-dried at 65 °C to prepare them for staining. The sections were then stained with hematoxylin for 2 min to highlight the cell nuclei. Following the hematoxylin staining, the sections were rinsed thoroughly with tap water for 5 min to remove excess stain. Next, the cells underwent differentiation for 15–20 s to enhance the contrast between the nuclei and the cytoplasm, followed by another rinse with tap water for 3 min. After differentiation, the sections were stained with eosin for 40 s to stain the cytoplasm and other tissue components. This was followed by a final rinse with tap water for 3 min to ensure all excess eosin was removed. Once the staining process was complete, the sections were dehydrated through a series of alcohol washes to remove any remaining water. The dehydrated sections were then mounted using neutral resin to preserve the tissue and facilitate microscopic examination. Observations and imaging of the stained sections were performed using a slide scanner to capture detailed images for further analysis.

2.10 Statistical analysis

Throughout this study, Various software tools were utilized, including Primer 5.0 for primer design, BioRad CFX for real-time PCR data analysis, SPSS 8.0 for statistical analysis, GraphPad Prism 9 for graph plotting, and Image Plus (v1.4) for image analysis. For the analysis of experimental data from quantitative PCR, the 2-(ΔΔCt) method was employed [33], and GraphPad Prism 9.0 was used to plot the data and generate graphs. Results were presented as Mean ± standard error (SEM) [34]. Significance levels were determined on P-values: results were considered non-significant when P > 0.05; significant when 0.01 < P < 0.05, indicated by a single asterisk (“*"); and extremely significant when P < 0.01, indicated by double asterisks (“**"). Each dataset included at least three biological replicates to ensure the reliability and reproducibility of the results.

3 Results

3.1 Identification of chicken primary myoblasts

To verify the purity of the primary myoblasts, we conducted immunofluorescence to detect the cell-specific expression of desmin protein. The results demonstrated that most F1 generation cells were myoblasts after 24 h of culture, confirming their suitability for further study (Fig. 2A).Fig. 2 Identification of chicken primary myoblasts by immunofluorescence, overexpression, and interference efficiency of myoblasts. (A) Identification of chicken primary myoblasts by immunofluorescence. (B) Interference efficiency of the ST6GAL2 gene at 12 h, 24 h, and 48 h; (C) Overexpression efficiency of the ST6GAL2 gene at 12 h and 24 h. Note: The data above were presented as mean ± SEM (n = 3), error bars show the SEM of the triplicate; (*) represents significant (P < 0.05), (**) represents extremely significant (P < 0.01).

Fig. 2

To modulate the mRNA expression of the ST6GAL2 gene in chicken myoblasts, we designed and synthesized ST6GAL2 interfering Si-RNA (Si-452, Si-862, Si-1495) and eukaryotic overexpression vectors (PEGFP-ST-201, PEGFP-ST-202). These constructs were then transfected into primary myoblasts from chickens. Cells were collected at 12 h, 24 h, and 48 h post-transfection, and the fluorescence quantitative detection of the target gene ST6GAL2 and the internal reference gene β-actin was performed to analyze interference efficiency and overexpression efficiency. The results revealed that the expression of ST6GAL2 in primary myoblasts transfected with interfering RNA exhibited a significant downregulation at 12 h and 24 h (P < 0.01) compared to the control group (Fig. 2B). Si-862 displayed stable interference efficiency at both time points, with the interference effect gradually increasing. In the overexpression test, the relative expression of ST6GAL2 mRNA significantly increased (P < 0.001) at both 12 h and 24 h post-PEGFP-ST-201 transfection, particularly at 24 h, where it exceeded 1000-fold, confirming the successful construction of the overexpression vector. The overexpression effect of PEGFP-ST-202 diminished significantly at 24 h (Fig. 2C). Based on these results, Si-862 and PEGFP-ST-201 were selected for subsequent interference and overexpression tests, with 24 h identified as the optimal transfection time point.

3.2 ST6GAL2 promotes the proliferation and apoptosis of primary chicken myoblasts

Chicken primary myoblasts were cultured in 96-well cell plates, and when the cell density reached 25 %, they were transfected according to the grouping with PEGFP-N1, PEGFP-ST-201, Si-NC, and Si-862. The mass of transfected plasmid per well in the PEGFP-N1 and PEGFP-ST-201 groups was 0.15 μg, while the concentration of Si-NC and Si-862 transfected per well was 10 nM, with 6 replicates per group. CCK8 results indicated that interference with ST6GAL2 gene led to significant inhibition of chicken myoblast viability at 12 h (P < 0.05), followed by a notable increase in cell viability compared to the control group at 24 h and 48 h (Fig. 3A). There was no significant difference in cell viability between overexpression ST6GAL2 and the control group before 24 h, but at 48 h, the viability of chicken myoblasts was significantly and progressively enhanced (P < 0.01) (Fig. 3B). These findings suggest that ST6GAL2 may play a role in promoting the proliferation of chicken primary myoblasts.Fig. 3 Effect of ST6GAL2 on myoblast proliferation. Light absorption values of chicken primary myoblasts at 450 nm after interference and overexpression with ST6GAL2 using Si-862 (A) and PEGFP-ST-201 (B), respectively. Detection of cell apoptosis-related marker gene expression after interference (C) and overexpression (D) with the ST6GAL2 gene. From left to right on the horizontal axis: cyclin B2 (CCNB2), cyclin 1 (CCND1), proliferating cell nuclear antigen (PCNA), cell indicative death receptor (Fas), Caspase-3, Caspase-9. The influence of the ST6GAL2 gene interference (E) and overexpression (F) after EdU detection on myoblast proliferation. (G) Microscopic results of the EdU experiment after transfection of Si-862 and PEGFP-ST-201.

Fig. 3

To investigate how the ST6GAL2 gene influences the proliferation process of chicken myoblasts, we examined the expression changes of cell cycle and apoptosis-related genes upon ST6GAL2 gene overexpression and interference via qRT-PCR. Primary myoblasts from chickens were transfected with PEGFP-N1, PEGFP-ST-201, Si-NC, and Si-862 groups when the cell density reached 40–50 %. PEGFP-N1 and PEGFP-ST-201 plasmids were transfected at 4 μg per well, while Si-NC and Si-862 were transfected at 80 nM per well. The qRT-PCR results revealed that upon interference with the ST6GAL2 gene, the expression of cell cycle and proliferation-related genes CCNB2 and PCNA was significantly downregulated (P < 0.01), whereas the expression of CCND1 was not significantly affected (P > 0.05). Additionally, the expression of apoptosis-related genes Fas and Caspase-9 was markedly reduced (P < 0.01), while Caspase-3 expression remained unchanged (P > 0.05) (Fig. 3C). Similarly, overexpression of the ST6GAL2 gene resulted in a significant upregulation of CCNB2 and CCND1 expression (0.01 < P < 0.05), with no significant change in PCNA expression. However, among apoptosis-related genes, only Caspase-9 showed a significant increase (P < 0.01), while the other two genes exhibited no significant changes (Fig. 3D).

We further employed the EdU assay to assess the impact of ST6GAL2 on the proliferation of chicken myoblasts. The results indicated that disturbance of ST6GAL2 gene expression led to a significant reduction in the proliferation of chicken primary myoblasts (0.01 < P < 0.05) (Fig. 3E). Conversely, overexpression of the ST6GAL2 gene appeared to promote chicken primary myoblast proliferation, although this effect was not statistically significant (P > 0.05) (Fig. 3F and G). Thus, the ST6GAL2 gene appears to have a promoting effect on chicken myoblast proliferation.

To gain further insights into the role of the ST6GAL2 gene in the apoptosis process of chicken myoblasts, we investigated the cycle distribution of myoblasts in each group 24 h after transfection PEGFP-N1, PEGFP-ST-201, Si-NC, and Si-862 using flow cytometry. Compared with the control group (PEGFP-N1), the number of primary myoblasts in the G0/G1 phase decreased to a certain extent after overexpression of ST6GAL2, while the number of the S phase increased. These effects were not significant (P > 0.05) (Fig. 4A). Additionally, after interfering with the ST6GAL2 gene, the number of primary myoblasts in the G1 phase increased significantly (P < 0.05) (Fig. 4B), while the number of cells in the G2 and S phases decreased, indicating that the cells were blocked in the G1 phase, the DNA synthesis and DNA replication of the cells were relatively reduced. These results demonstrated that interference had a more significant effect on cell proliferation than the overexpression of ST6GAL2. Similarly, we also employed flow cytometry to investigate the effect of ST6GAL2 gene interference on myoblastic apoptosis. The results revealed that interference with ST6GAL2 gene expression significantly decreased the rate of late apoptosis in chicken myoblasts (P < 0.01) and increased cell viability (P < 0.01) (Fig. 4C–E).Fig. 4 Effect of the ST6GAL2 gene on apoptosis of myoblasts. Cell cycle detection results by flow cytometry of ST6GAL2 overexpression (A) and ST6GAL2 interference (B). Flow cytometry results are shown on the left and quantified flow cytometry results are shown on the right. (C) and (D) represent scatter plot results of apoptosis after Si-NC and Si-862 transfection, respectively. (E) The statistical results of flow cytometry after transfection of Si-862.

Fig. 4

3.3 ST6GAL2 gene promotes expression of myomaker in chicken primary myoblast

To investigate the role of the ST6GAL2 gene in the differentiation and fusion of chicken primary myoblasts, we cultured these myoblasts in 6-well cell plates and transfected them with PEGFP-N1, PEGFP-ST-201, Si-NC, and Si-862 when they reached a density of 50 %. Upon reaching 80–90 % confluence, the culture medium was replaced with a differentiation medium. RNA samples were collected 72 h after induction of differentiation for qRT-PCR analysis. After Si-862 transfection, it was observed that the expression of MYOD1, MYOG, and MyHC genes did not change (Fig. 5A). However, the expression of Myomaker was significantly downregulated (P < 0.05) compared to the Si-NC group (Fig. 5A), Furthermore, the expression of Myomaker was notably increased following PEGFP-ST-201 transfection (P < 0.05) (Fig. 5B). Consistently, MyHC immunofluorescence results indicated no significant difference in the MyHC-positive area after ST6GAL2 overexpression and interference compared to the control group (Fig. 5C).Fig. 5 Expression of myoblast-related marker genes after interference (A) and overexpression (B) with ST6GAL2 gene (n = 3). Myoblast regulatory factor (MyoD1), myogenic hormone (MyoG), myosin heavy chain (MyHC), and Myoblast fusion factor (Myomaker). (C) MyHC staining of chicken myoblasts after 72 h of interference and overexpression with ST6GAL2. Note: MyHC positive in myotubule (red), DAPI positive in the nucleus (blue); right panels show MyHC positive area statistics (n = 6). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Fig. 5

3.4 ST6GAL2 absence affects adult mice skeletal muscle characteristics of gene expression and morphology

To delve further into the function of ST6GAL2, we employed ST6GAL2 knockout mice to explore its impact on muscle development. We targeted exon 2 to exon 6 of the ST6GAL2-201 (ENSMUST00000025000.3) transcript for knockout using CRISPR/Cas9 technology, as completed by Jiangsu Jicui Yaokang Biological Technology Co., Ltd. The knockout strategy is illustrated in Fig. 1. Expression of ST6GAL2 in chicken skeletal muscle showed higher expression on day 9 of embryonic incubation (Carnegie stages 22–23). In alignment with the corresponding embryonic periods, we examined the expression of ST6GAL2 at day 16 (Carnegie stage 23) of mouse embryonic development. The expression of ST6GAL2 in muscle tissue was quantitatively analyzed at two-time points. The results revealed that ST6GAL2 was nearly absent in adult mouse skeletal muscle (Fig. 6A).Fig. 6 ST6GAL2 absence affects adult mice skeletal muscle characteristics of gene expression and morphology. (A) Expression of ST6GAL2 in mouse muscles at Day 16 of the embryonic stage (EM16) and 8 weeks after birth (8W). (B) Body weight growth curves of mice with different genotypes. (C) Tissue weight analysis of mice with different genotypes at 8 weeks of age.

Fig. 6

As comprehensive observation of the specific effects of ST6GAL2 on various types of skeletal muscle in mice during the embryonic stage was challenging, we selected 8-week-old (adult) mice to investigate the function of ST6GAL2 in skeletal muscle growth and development. During the first week, wild-type mice exhibited significantly higher body weight than double-knockout mice (P < 0.05). However, there were no significant differences in body weight (P > 0.05) during the subsequent six-time points at 3, 4, 5, 6, 7, and 8 weeks (Fig. 6B). These results suggest that ST6GAL2 knockout primarily plays a role in early development. Further analysis of the collected weight of 16 tissues indicated that both ST6GAL2 ± and ST6GAL2−/− mice exhibited significantly reduced liver and groin fat weights (P < 0.01) compared to wild-type mice. Moreover, ST6GAL2−/− mice displayed a significant reduction in gonadal fat weight (P < 0.01) compared to wild-type mice. In the target muscle tissue, Quadriceps muscle (QUA) weight in ST6GAL2−/− mice was significantly decreased (P < 0.05) compared to both wild-type and ST6GAL2 ± mice. However, this difference was not significant in the remaining five muscle sites (P > 0.05) (Fig. 6C).

To assess the effect of ST6GAL2 knockout on the morphology of muscle fibers in mouse skeletal muscles, we prepared paraffin sections of six muscle parts from 8-week-old mice, stained them with HE (Fig. 7A), and conducted microscopic scanning to observe the morphological characteristics of muscle fibers. Image-Pro Plus 6.0 was used to analyze the cross-sectional area and number of muscle fibers stained by HE in each muscle site. The results demonstrated that both gastrocnemius muscle (GAS) and soleus muscle (SOL) exhibited a decreased number of fibers compared to wild-type mice (Fig. 7B).Fig. 7 The characteristics and parameters of muscle fibers in different mice muscle parts. (A) Histological section of skeletal muscle of six parts. (B) The number of myofibers in each skeletal muscle tissue. (C) Muscle fiber cross-sectional area (CSA) of each muscle. Quadriceps muscle (QUA), gastrocnemius muscle (GAS), triceps brachii (TRI), tibial anterior muscle (TA), Extensor digitorum longus (EDL), and soleus muscle (SOL).

Fig. 7

Moreover, the cross-sectional area of muscle fibers in the QUA increased within the range of 800–1600 mm after single and complete knockout, while the number of muscle fibers with a larger cross-sectional area decreased to some extent. In the GAS, knockout resulted in a decrease in the number of myofibers within the 0–800 mm range, accompanied by an increase in the number of myofibers with a larger cross-sectional area. Similar trends were observed in the extensor digitorum longus (EDL). In the triceps brachii (TRI), a higher proportion of myofibers exhibited a smaller cross-sectional area (Fig. 7B). However, in the tibial anterior muscle (TA) of the three genotypes of mice, there was no significant change in the distribution of muscle fiber cross-sectional area. Additionally, the number of myofibers smaller than 400 mm was significantly reduced in the SOL (P < 0.01), while the number of myofibers with a cross-sectional area of 800–1200 mm increased significantly (P < 0.01 or P < 0.05) (Fig. 7C). These findings suggest that ST6GAL2 knockout promotes the enlargement of muscle fibers in the GAS, EDL, and SOL, whereas this effect is less pronounced in other muscle parts.

3.5 ST6GAL2 absence affects adult mice muscle gene expression

We proceeded to assess the mRNA levels of MyoD1, MyHC, MyoG, and Myomaker in the skeletal muscles of 8-week-old mice with three distinct genotypes. These genes serve as markers associated with muscle proliferation, differentiation, and fusion. The findings showed a slight tendency for increased Myomaker expression in the skeletal muscles of single-knock mice compared to wild-type mice, but this trend did not reach statistical significance (P > 0.05). Nevertheless, upon complete knockout of the ST6GAL2 gene, the expression of Myomaker in all muscle sites consistently exhibited a significant increase (P < 0.01) (Fig. 8A–F). Additionally, the expression of MyoD1, MyHC, and MyoG, related to muscle proliferation and differentiation, did not undergo significant changes in any of the six muscle tissues. These results suggest that ST6GAL2 may exert an inhibitory effect during muscle fusion.Fig. 8 Expression of skeletal muscle development-related genes (A–F), and the fiber type-related genes (G–L) in six muscle tissues of mice.

Fig. 8

To further explore the role of ST6GAL2 in transforming myofiber types, we examined the expression of fast-twitch and slow-twitch muscle genes in the six muscle tissues of mice with three genotypes. Fast-twitch muscle fiber marker genes, including MyHC IIa, MyHC IIb, and MyHC IIx, along with Tnni2 and Tnnc2, were investigated, while slow-twitch fiber marker genes encompassed MyHC I, Tnni1, and Tnnc1. The results demonstrated that complete knockout of ST6GAL2 led to a significant downregulation of MyHC I expression (P < 0.01) and MyHC IIa expression (P < 0.01) (Fig. 8G) in QUA. In the GAS, both single-knock and double knockout significantly increased the expression of MyHC I (P < 0.01), with the double knockout effect being more pronounced. MyHC IIa expression showed an extremely significant increase (P < 0.01) in ST6GAL2−/− mice (Fig. 8H). MyHC IIa expression also increased in ST6GAL2 ± mice, although the difference was not statistically significant.

Conversely, in the TRI (Fig. 8I) and TA muscle (Fig. 8J), most gene expressions remained largely unchanged. Tnnc1 expression at both sites was concentrated in single-knock mice and was several times higher than in wild-type and double-knock mice (P < 0.01). In addition, in the EDL, a feather-like muscle of the anterior (extensor) compartment of the leg, the expression of both MyHC I and MyHC IIa in ST6GAL2 ± mice significantly increased (P < 0.01) compared to wild-type mice, while in ST6GAL2−/− mice, their expression markedly decreased (P < 0.01), showing an inverse trend. The changes of Tnnc1 in both mice showed a significant decrease in expression (0.01 < P < 0.05) (Fig. 8K). In the SOL, the expression of MyHC IIb in ST6GAL2 ± and ST6GAL2−/− mice was significantly downregulated (P < 0.01). Additionally, compared to WT mice, single-knock significantly downregulated Tnni1 expression in the SOL (0.01 < P < 0.05), while double knockout significantly downregulated the expression of Tnnc2 (P < 0.01) (Fig. 8L).

4 Discussion

4.1 ST6GAL2 gene promotes the proliferation and apoptosis of chicken primary myoblasts

Myogenesis encompasses various crucial processes, including myoblast proliferation, differentiation, apoptosis, and fusion, with genes regulating these processes providing insights into myogenesis progression. Cyclin D1 (CCND1) plays a pivotal role in regulating the G1 phase of the cell cycle, and its activation by cyclin-dependent kinase 4 (CDK4) drives the cell cycle from G1 to S phase [35]. Cyclin B2 (CCNB2) serves as a critical cell cycle regulator, being synthesized in the G1 phase and subsequently downregulated, and defects in CCNB2 have been associated with abnormal cell division and cell cycle arrest [36,37]. Proliferating nuclear antigen (PCNA) is a crucial factor in DNA synthesis and cell cycle progression, and its inhibition can impede the cell cycle [38].

In our study, interference with the ST6GAL2 gene significantly reduced the expression of CCNB2 and PCNA, while overexpression of the gene resulted in a notable increase in CCNB2 and CCND1 expression. Which showed the positive regulation effect of ST6GAL2 on these genes. In addition, the apoptosis is regulated by many pathways and genes, the gene fas might not have such significant effect on muscle death here. Additionally, EdU assays indicated that reduced ST6GAL2 expression inhibited cell proliferation. Flow cytometry analysis further revealed an increase in the number of cells in the G0/G1 phase following ST6GAL2 gene interference, accompanied by a decrease in the G2 and S phases, implying that more cells were arrested in the G0/G1 phase. Together, these findings demonstrate that the ST6GAL2 gene promotes the proliferation of chicken primary myoblast.

Apoptosis, a programmed cell death process, involves the activation, expression, and regulation of various genes, including Caspase-3, Fas, and Caspase-9 [39,40]. Mammals possess two apoptotic pathways: the extrinsic pathway, which is extrinsic receptor-induced, and the intrinsic mitochondrial stress-induced pathway, which involves cascades of caspase [41]. Both overexpression and interference of ST6GAL2 in myoblasts resulted in significant changes in Caspase-9 expression. Caspase-9 has been shown to participate in the apoptosis process by mediating mitochondrial disruption and increasing the production of reactive oxygen species (ROS) [40]. Furthermore, Fas was significantly downregulated in the interference group. Fas, a cell surface death receptor, is ubiquitously expressed in cells and can induce apoptosis through interactions with its ligand FasL [42]. Subsequent flow cytometry apoptosis assays demonstrated that ST6GAL2 interference reduced myoblast apoptosis. These results collectively suggest that ST6GAL2 gene expression promotes myoblastic apoptosis through both the receptor-induced and mitochondrial-induced apoptotic pathways.

4.2 ST6GAL2 gene regulating the balance between myoblast proliferation and differentiation

In the context of myoblast differentiation, the changes in Myomaker expression resulting from ST6GAL2 gene overexpression and interference were not accompanied by alterations in MyoD1 and MyoG gene expression. This suggests that ST6GAL2 might directly regulate Myomaker gene expression or act through other transcription factors. For instance, previous studies have identified miR-140–3p, miR-491, and miR-16-1 as binding to the 3′-UTR of Myomaker in both mice and chickens [43,44].

Myoblast fusion is a multi-step process involving two distinct stages mediated by Myomaker and Myomerger. Myomaker facilitates the formation of hemifusions, while Myomerger acts on cell membranes to generate membrane stress that enables complete fusion independently of Myomaker [45]. In our study, decreased ST6GAL2 expression can significantly increase the expression of Myomaker. Myomaker is a muscle-specific membrane protein that regulates myoblast fusion during early embryonic development in mice [46]. In adult mouse skeletal muscle, Myomaker is typically expressed at low levels but is reactivated during muscle fiber repair following injury [47,48]. Thus, the significant upregulation of Myomaker in adult mice observed in this study also suggests potential muscle fiber formation.

Furthermore, the coordinated regulation of myoblast proliferation, differentiation, and apoptosis is essential for skeletal muscle formation [49]. Previous work by Dehkordi et al. demonstrated that overexpression of CCND1 inhibits MyoD1-induced myogenesis and transcriptional activation [50]. Consistent with these findings, our study revealed that the overexpression of the ST6GAL2 gene promotes CCND1 expression, and leads to a decrease in MyoD1 expression. This suggests that ST6GAL2 may play a role in modulating the balance of myoblast proliferation and differentiation, possibly through regulating CCND1 and MyoD1 expression levels.

4.3 ST6GAL2 genes are involved in the regulation of muscle fiber types and size in different types of muscle

Changes in muscle fiber size are a fundamental aspect of muscle plasticity adaptation and are influenced by various factors, including regulating growth and development processes and environmental factors. Typically, alterations in muscle fiber size are critical indicators of muscle hypertrophy and atrophy. Notably, muscle fiber cross-sectional area significantly increases in response to resistance training-induced hypertrophy [51]. Ohno et al. also reported increased myofiber cross-sectional area in lactic acid-induced hypertrophy of the TA muscle [52]. Conversely, muscle fiber cross-sectional area decreases significantly in muscles experiencing atrophy, such as the GAS and TA muscles in mice with muscle atrophy [53,54]. In this study, the knockout of the ST6GAL2 gene led to an increased muscle fiber cross-sectional area in the GAS, EDL, and SOL. This observation suggests that the ST6GAL2 gene inhibits the increase in muscle fiber size during the growth and development of specific muscle groups in mice. In addition, after ST6GAL2 gene was knocked out, not every muscle was affected and the significant effect on each muscle is different, and our results provided preliminary visualization results for this purpose.

The function of skeletal muscle is often achieved through changes in the proportion of different muscle fiber types within the muscle [55]. The diversity and variations in fiber type are primarily attributed to the differential accumulation of specific proteins, which is controlled by the regulation of protein synthesis and degradation. Research has indicated that MyHC subtypes are the primary proteins responsible for muscle strength production and constitute approximately 25 % of total muscle protein [56]. MyHC subtypes also serve as cell type-specific markers for identifying signaling pathways that govern muscle cell identity [57]. In this study, the expression of MyHC I (a marker for oxidative type I slow-twitch muscle fiber) was significantly upregulated in the fast-twitch EDL and hybrid muscles (QUA, GAS, TA) of single-knockout mice. Conversely, its expression was reduced in the slow-twitch SOL muscle, suggesting changes in the ratio of type I muscle fibers in these muscles. Moreover, the expression of Tnnc1 significantly rose in the TRI and TA of single-knockout mice, suggesting that Tnni1 enhances the interaction between actin and myosin by binding to calcium [58]. These findings suggest that single-knockout ST6GAL2 may promote the formation of slow-twitch muscles in the QUA, GAS, TRI, TA, and EDL; while inhibiting slow-twitch muscle formation in the SOL muscle. However, the expression of both MyHC I and MyHC IIa (type IIa fast-twitch muscle fibers) decreased dramatically after ST6GAL2 double knockout in QUA, EDL, and TA muscles, suggesting that the loss of ST6GAL2 function in these muscles led to impaired myofiber formation. In contrast, the increase in both type I slow-twitch and type IIa fast-twitch muscle fibers in GAS and SOL, two adjacent muscles, suggests the involvement of genes other than ST6GAL2 in these muscles. Further research is needed to understand more complex scenarios.

There are limitations for our study, according to the existing results, ST6GAL2 gene has no effect on the differentiation of myoblasts. The dysregulation of myomaker expression may be caused by other potential molecular mechanisms, which still need to be further explored. We have provided a preliminary description of the changes observed in multiple muscle tissues of ST6GAL2 gene-knockout mice, and the type of muscle fibers may be helpful in explaining these changes, although not every part of the muscle had distinct change. These can serve as a targeted research direction for further studies.

5 Conclusions

The specific role of ST6GAL2 in skeletal muscle is not fully understood, as this is a relatively new class of enzymes, and most research on the ST6GAL family of enzymes has focused on the immune system and cancer. Therefore, we first studied the effect of ST6GAL2 on muscle function by conducting interference and overexpression experiments on primary myocytes, mainly to assess cell proliferation, apoptosis, and myomaker expression, and the results showed that: (1) ST6GAL2 promotes cell proliferation and myocyte fusion process. Then, phenotypic analysis of skeletal muscle in six parts of the ST6GAL2 knockout mice and detection of muscle-related molecular markers indicated that (2) ST6GAL2 genes are involved in the changes of fast-twitch and slow-twitch may be the main influencing mode. Therefore, more experimental data and studies may be needed to elucidate the specific mechanisms of ST6GAL2 in skeletal muscle.

Funding

This research was supported by the 10.13039/501100012166 National Key R & D Program of China (2022YFF1000100 and 2023YFD1300400 ), the Sichuan Science and Technology Program (2021YFYZ0009 and 2021ZDZX0008 ), the 10.13039/501100001809 National Natural Science Foundation of China (32225046 ).

Ethics statement

Animal experiments conducted in this study adhered to the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China, revised in March 2017). Ethical approval for the study was obtained from the Ethics Committee of Sichuan Agricultural University (protocol number 2020202010).

Informed consent statement

Not applicable.

Data availability statement

The data presented in this study are not publicly available and are available on request from the corresponding author.

CRediT authorship contribution statement

Tao Wang: Writing – original draft, Formal analysis, Data curation. Bo Ran: Writing – original draft. Yingyu Luo: Data curation. Jideng Ma: Formal analysis. Jing Li: Formal analysis. Penghao Li: Methodology. Mingzhou Li: Writing – review & editing, Conceptualization. Diyan Li: Writing – review & editing, Visualization, Formal analysis, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following are the Supplementary data to this article:figs1 figs1

figs2 figs2

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e37311.
==== Refs
References

1 Mujyambere V. Local chickens in East African region: their production and potential Poultry Sci. 101 1 2022 101547
2 Mohammadifar A. Mohammadabadi M. Melanocortin-3 receptor (mc3r) gene association with growth and egg production traits in Fars indigenous chicken Malays. Appl. Biol. 47 3 2018 85 90
3 Yang M. Characteristics and functions of DNA N(6)-methyladenine in embryonic chicken muscle development Poultry Sci. 102 5 2023 102528
4 Li D. Dynamic transcriptome and chromatin architecture in granulosa cells during chicken folliculogenesis Nat. Commun. 13 1 2022 131 35013308
5 Khabiri A. Introduction of a Newcastle disease virus challenge strain (sub-genotype VII. 1.1) isolated in Iran Veterinary Research Forum 2023 Faculty of Veterinary Medicine, Urmia University Urmia, Iran
6 Schauer R. Sialic acids as regulators of molecular and cellular interactions Curr. Opin. Struct. Biol. 19 5 2009 507 514 19699080
7 Hanisch F. Sialylation and muscle performance: sialic acid is a marker of muscle ageing PLoS One 8 12 2013 e80520
8 Broccolini A. Hyposialylation of neprilysin possibly affects its expression and enzymatic activity in hereditary inclusion-body myopathy muscle J. Neurochem. 105 3 2008 971 981 18182043
9 Harduin-Lepers A. The human sialyltransferase family Biochimie 83 8 2001 727 737 11530204
10 Szabo, et al., Advancement of Sialyltransferase Inhibitors: Therapeutic Challenges and Opportunities.
11 Lehoux S. Transcriptional regulation of the human ST6GAL2 gene in cerebral cortex and neuronal cells Glycoconj. J. 27 1 2010 99 114 19768537
12 Xinyu Tang C.B.L. Jin Lee-Way Maezawa Izumi Harvey Danielle J. Zivkovic Angela M. Brain-region-specific, glycosylation-related transcriptomic alterations in Alzheimer's disease Alzheimer's Dementia 2021 e05111
13 Cheng J. ST6GAL2 Downregulation Inhibits Cell Adhesion and Invasion and is Associated with Improved Patient Survival in Breast Cancer 13 2020 903 914
14 Xu G. Resveratrol inhibits the tumorigenesis of follicular thyroid cancer via st6gal2-regulated activation of the Hippo signaling pathway Mol Ther Oncolytics 16 2020 124 133 32055676
15 Maugeri-Sacca M. De Maria R. The Hippo pathway in normal development and cancer Pharmacol. Ther. 186 2018 60 72 29305295
16 Yu F.X. Zhao B. Guan K.L. Hippo pathway in organ size control, tissue homeostasis, and cancer Cell 163 4 2015 811 828 26544935
17 Hanisch F. Sialylation and muscle performance: sialic acid is a marker of muscle ageing 8 12 2013 e80520
18 Marini M. Overview of sialylation status in human nervous and skeletal muscle tissues during aging Acta Histochem. 123 8 2021 151813
19 Broccolini A. Hereditary inclusion-body myopathy: clues on pathogenesis and possible therapy Muscle Nerve 40 3 2009 340 349 19618441
20 Milcheva R. Expression of sialyltransferases from the ST3Gal ST6Gal and ST6GalNAc Families in Mouse Skeletal Muscle and Mouse C2C12 Myotube Cell Cultures 2021
21 Luo W. TMEM182 interacts with integrin beta 1 and regulates myoblast differentiation and muscle regeneration J Cachexia Sarcopenia Muscle 12 6 2021 1704 1723 34427057
22 Li D. Population genomics identifies patterns of genetic diversity and selection in chicken BMC Genom. 20 1 2019 263 263
23 Xu Z. 3D genomic alterations during development of skeletal muscle in chicken1 J. Integr. Agric. 2024 https://www.sciencedirect.com/science/article/pii/S2095311924001242 Available online 16 March 2024
24 Reiser P.J. Current understanding of conventional and novel Co-Expression patterns of mammalian sarcomeric myosin heavy chains and light chains Arch. Biochem. Biophys. 662 2018 129 133 30528779
25 Chen B. The regulatory role of Myomaker and Myomixer-Myomerger-Minion in muscle development and regeneration Cell. Mol. Life Sci. 77 8 2020 1551 1569 31642939
26 Li W.-y. The VGLL2 gene participates in muscle development in Gushi chickens1 J. Integr. Agric. 2023 https://www.sciencedirect.com/science/article/pii/S2095311923001922 Available online 15 June 2023
27 Chen B. Whole transcriptome profiling reveals a lncMDP1 that regulates myogenesis by adsorbing miR-301a-5p targeting CHAC1 Commun. Biol. 7 1 2024 518 38698103
28 Peng X. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1 Oncotarget 7 11 2016 12222 12234 26933817
29 Chen B. Transcriptome-based identification of the muscle tissue-specific expression gene CKM and its regulation of proliferation, apoptosis and differentiation in chicken primary myoblasts Animals (Basel) 13 14 2023
30 Chen J. Nec-1 alleviated the deleterious effect of CoCl2 on C2C12 myoblast differentiation and fusion via the mTOR pathway Tissue Cell 79 2022 101910
31 Chen R. Comprehensive analysis of lncRNAs and mRNAs with associated co-expression and ceRNA networks in C2C12 myoblasts and myotubes Gene 647 2018 164 173 29331478
32 Liu L. Histone methyltransferase MLL4 controls myofiber identity and muscle performance through MEF2 interaction J. Clin. Invest. 130 9 2020 4710 4725 32544095
33 Yin H.D. Housing system influences abundance of Pax3 and Pax7 in postnatal chicken skeletal muscles Poultry Sci. 93 6 2014 1337 1343 24879683
34 Li D. Genetic effects of the melatonin receptor genes on chicken reproductive traits Czech J. Anim. Sci. 58 2 2013 58 64
35 Mende N. CCND1-CDK4-mediated cell cycle progression provides a competitive advantage for human hematopoietic stem cells in vivo J. Exp. Med. 212 8 2015 1171 1183 26150472
36 Wu S. Su R. Jia H. Cyclin B2 (CCNB2) stimulates the proliferation of triple-negative breast cancer (TNBC) cells in vitro and in vivo Dis. Markers 2021 2021 5511041
37 Gui L. Homer H. Hec1-dependent cyclin B2 stabilization regulates the G2-M transition and early prometaphase in mouse oocytes Dev. Cell 25 1 2013 43 54 23541922
38 Strzalka W. Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation Ann. Bot. 107 7 2011 1127 1140 21169293
39 Lan R. Fas regulates the apoptosis and migration of trophoblast cells by targeting NF-κB Spandidos Publications 22 4 2021 1055
40 Brentnall M. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis BMC Cell Biol. 14 1 2013 32 23834359
41 Li P. Caspase-9: structure, mechanisms and clinical application Oncotarget 8 14 2017 23996 24008 28177918
42 Zhang L. Kaizuka Y. Hanagata N. Imaging of Fas-FasL membrane microdomains during apoptosis in a reconstituted cell-cell junction Biochem. Biophys. Res. Commun. 422 2 2012 298 304 22580277
43 He K. Transiently expressed pattern during myogenesis and candidate miRNAs of Tmem8C in goose J. Genet. 96 1 2017 39 46 28360388
44 He J. miR-491 inhibits skeletal muscle differentiation through targeting myomaker Arch. Biochem. Biophys. 625–626 2017 30 38
45 Leikina E. Myomaker and myomerger work independently to control distinct steps of membrane remodeling during myoblast fusion Dev. Cell 46 6 2018 767 780 e7 30197239
46 Millay D.P. Myomaker is a membrane activator of myoblast fusion and muscle formation Nature 499 7458 2013 301 305 23868259
47 Shi J. Knockout of myomaker results in defective myoblast fusion, reduced muscle growth and increased adipocyte infiltration in zebrafish skeletal muscle Hum. Mol. Genet. 27 20 2018 3542 3554 30016436
48 Si Y. Wen H. Du S. Genetic mutations in jamb, jamc, and myomaker revealed different roles on myoblast fusion and muscle growth Mar. Biotechnol. 21 1 2019 111 123
49 Connolly P.F. Fearnhead H.O. DNA‐PK activity is associated with caspase‐dependent myogenic differentiation FEBS J. 283 19 2016 3626 3636 27513301
50 Ruijtenberg S. van den Heuvel S. Coordinating cell proliferation and differentiation: antagonism between cell cycle regulators and cell type-specific gene expression Cell Cycle 15 2 2016 196 212 26825227
51 Santanielo N. Effect of resistance training to muscle failure vs non-failure on strength, hypertrophy and muscle architecture in trained individuals Biol. Sport 37 4 2020 333 341 33343066
52 Ohno Y. Lactate stimulates a potential for hypertrophy and regeneration of mouse skeletal muscle Nutrients 11 4 2019
53 Wan Q. Aspirin alleviates denervation-induced muscle atrophy via regulating the Sirt1/PGC-1α axis and STAT3 signaling Ann. Transl. Med. 8 22 2020 1524 33313269
54 Nakamura S. Vitamin D protects against immobilization-induced muscle atrophy via neural crest-derived cells in mice Sci. Rep. 10 1 2020 12242
55 Blaauw B. Schiaffino S. Reggiani C. Mechanisms modulating skeletal muscle phenotype Compr. Physiol. 3 4 2013 1645 1687 24265241
56 Qaisar R. Bhaskaran S. Van Remmen H. Muscle fiber type diversification during exercise and regeneration Free Radic. Biol. Med. 98 2016 56 67 27032709
57 Schiaffino S. Muscle fiber type diversity revealed by anti-myosin heavy chain antibodies FEBS J. 285 20 2018 3688 3694 29761627
58 Shu J. Molecular cloning, characterization, and temporal expression profile of troponin I type 1 (TNNI1) gene in skeletal muscle during early development of gaoyou duck (Anas platyrhynchos domestica) Anim. Biotechnol. 30 2 2019 118 128 29557225
