
==== Front
PLoS Pathog
PLoS Pathog
plos
PLOS Pathogens
1553-7366
1553-7374
Public Library of Science San Francisco, CA USA

39186805
10.1371/journal.ppat.1012469
PPATHOGENS-D-23-01101
Research Article
Biology and Life Sciences
Cell Biology
Cell Processes
Cell Death
Apoptosis
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Blood Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Immune Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Medicine and Health Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Organisms
Bacteria
Yersinia
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Bacterial Pathogens
Yersinia
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Bacterial Pathogens
Yersinia
Biology and Life Sciences
Toxicology
Cytotoxicity
Medicine and Health Sciences
Pathology and Laboratory Medicine
Toxicology
Cytotoxicity
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Molecular Probe Techniques
Immunoblot Analysis
Research and Analysis Methods
Molecular Biology Techniques
Molecular Probe Techniques
Immunoblot Analysis
Biology and Life Sciences
Cell Biology
Cell Processes
Cell Death
Biology and Life Sciences
Cell Biology
Cell Processes
Cell Death
Necrotic Cell Death
Biology and life sciences
Biochemistry
Nucleic acids
RNA
Guide RNA
Blockade of IKK signaling induces RIPK1-independent apoptosis in human macrophages
IKK blockade activates human RIPK1-independent apoptosis
Nataraj Neha M. Conceptualization Data curation Formal analysis Funding acquisition Investigation Methodology Project administration Writing – original draft Writing – review & editing 1 2 3
Sillas Reyna Garcia Data curation Investigation 2
Herrmann Beatrice I. Investigation 2
Shin Sunny Conceptualization Formal analysis Funding acquisition Investigation Supervision Writing – original draft Writing – review & editing 1 3 *
https://orcid.org/0000-0001-7970-872X
Brodsky Igor E. Conceptualization Formal analysis Funding acquisition Investigation Supervision Writing – original draft Writing – review & editing 1 2 *
1 Institute for Immunology & Immune Health, University of Pennsylvania Perelman School of Medicine, Philadelphia, Pennsylvania, United States of America
2 Department of Pathobiology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, Pennsylvania, United States of America
3 Department of Microbiology, University of Pennsylvania Perelman School of Medicine, Philadelphia, Pennsylvania, United States of America
Sebbane Florent Editor
Inserm, FRANCE
The authors have declared that no competing interests exist.

* E-mail: sunshin@pennmedicine.upenn.edu (SS); ibrodsky@vet.upenn.edu (IEB)
26 8 2024
8 2024
20 8 e10124696 7 2023
31 7 2024
© 2024 Nataraj et al
2024
Nataraj et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Regulated cell death in response to microbial infection plays an important role in immune defense and is triggered by pathogen disruption of essential cellular pathways. Gram-negative bacterial pathogens in the Yersinia genus disrupt NF-κB signaling via translocated effectors injected by a type III secretion system, thereby preventing induction of cytokine production and antimicrobial defense. In murine models of infection, Yersinia blockade of NF-κB signaling triggers cell-extrinsic apoptosis through Receptor Interacting Serine-Threonine Protein Kinase 1 (RIPK1) and caspase-8, which is required for bacterial clearance and host survival. Unexpectedly, we find that human macrophages undergo apoptosis independently of RIPK1 in response to Yersinia or chemical blockade of IKKβ. Instead, IKK blockade led to decreased cFLIP expression, and overexpression of cFLIP contributed to protection from IKK blockade-induced apoptosis in human macrophages. We found that IKK blockade also induces RIPK1 kinase activity-independent apoptosis in human T cells and human pancreatic cells. Altogether, our data indicate that, in contrast to murine cells, blockade of IKK activity in human cells triggers a distinct apoptosis pathway that is independent of RIPK1 kinase activity. These findings have implications for the contribution of RIPK1 to cell death in human cells and the efficacy of RIPK1 inhibition in human diseases.

Author summary

Programmed cell death is critical for organismal homeostasis and for host defense against microbial infection. Gram-negative bacteria of the genus Yersinia cause diseases ranging from plague (Y. pestis) to severe gastroenteritis (Y. pseudotuberculosis and Y. enterocolitica). Studies in murine models have demonstrated that all pathogenic Yersinia disrupt pro-inflammatory cell signaling, which triggers cell death in murine macrophages. This cell death is mediated by the kinase RIPK1, and RIPK1-mediated cell death is essential for host defense and survival. Although murine studies have provided insight into mechanisms that regulate host defense during Yersinia infection, there are important differences between human and murine immune systems regarding expression and presence of key proteins. Thus, how human cells respond to Yersinia infection remains poorly understood. Here, we report that, in contrast to murine systems, Yersinia infection or chemical blockade of immune signaling in human cells induces a distinct apoptotic cell death that is entirely independent of RIPK1 kinase activity. RIPK1 is implicated in a wide range of systemic disorders and is currently being targeted in clinical trials. Our study provides insight into human-specific cell death signaling and host defense mechanisms, which has implications for understanding human immune responses to infection and therapeutic approaches for treating human diseases.

http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases R01AI139102A1 https://orcid.org/0000-0001-7970-872X
Brodsky Igor E. http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases R21AI125924 https://orcid.org/0000-0001-7970-872X
Brodsky Igor E. http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases R01AI118861 Shin Sunny http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases R01AI123243 Shin Sunny http://dx.doi.org/10.13039/100000861 Burroughs Wellcome Fund https://orcid.org/0000-0001-7970-872X
Brodsky Igor E. http://dx.doi.org/10.13039/100000861 Burroughs Wellcome Fund Shin Sunny http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases 5T32AI141393 Nataraj Neha M. http://dx.doi.org/10.13039/100000968 American Heart Association Nataraj Neha M. http://dx.doi.org/10.13039/100006492 Division of Intramural Research, National Institute of Allergy and Infectious Diseases F31AI161319-03 Herrmann Beatrice This work was supported by NIH grants AI139102A1 (I.E.B.), AI125924 (I.E.B.), AI118861 (S.S.), AI123243 (S.S.), the Burroughs Wellcome Fund Investigator in the Pathogenesis of Infectious Disease awards (both I.E.B. and S.S.), T32 AI141393 (N.M.N.), the American Heart Association Predoctoral Fellowship (N.M.N.), and NIH NRSA training grant AI161319-03 (B.I.H.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. PLOS Publication Stagevor-update-to-uncorrected-proof
Publication Update2024-09-17
Data AvailabilityRaw data is available on Dryad. https://doi.org/10.5061/dryad.hmgqnk9rz.
Data Availability

Raw data is available on Dryad. https://doi.org/10.5061/dryad.hmgqnk9rz.
==== Body
pmcIntroduction

Regulated cell death in response to microbial infection is critical for immune defense. Innate immune cells utilize pattern recognition receptors to detect pathogen-associated molecular patterns and elicit an inflammatory response [1,2]. To evade this detection, many microbial pathogens employ mechanisms to suppress immune signaling [3,4]. In response, the host has evolved compensatory mechanisms to induce cell death and inflammation in response to pathogen-mediated disruption of TNFR superfamily [5,6] and TLR signaling [6,7].

Stimulation of TNFR or TLR4 induces recruitment of Receptor Interacting Serine-Threonine Protein Kinase 1 (RIPK1) to the receptor proximal signaling complex. RIPK1 serves as a Complex 1 scaffold for downstream signaling proteins, including TAK1 and IKKα/β, which phosphorylate RIPK1 to maintain its localization [8–15]. The kinases in Complex I initiate NF-κB and MAPK signaling, resulting in inflammatory cytokine production [16]. However, pathogen-mediated or pharmacological blockade of key Complex I proteins, particularly TAK1 and IKKα/β, destabilizes the complex. Released RIPK1 then recruits FADD and caspase-8 to form Complex II, mediating rapid caspase 8-dependent cell death [8,10,17].

The Gram-negative bacterial genus Yersinia is a natural pathogen of both rodents and humans and is responsible for human diseases ranging from gastroenteritis to plague [18,19]. Yersinia utilizes a type III secretion system (T3SS) to inject virulence factors known as Yersinia outer proteins (Yops) into the host cell cytosol [20,21]. One of these Yops, known as YopP in Y. enterocolitica and YopJ in Y. pseudotuberculosis, potently blocks IKKβ and TAK1 in murine macrophages, resulting in RIPK1- and caspase-8-dependent cell death [14,22–35]. Importantly, RIPK1 kinase activity is critical for caspase-8-dependent cell death, restriction of bacterial loads, and host survival during Yersinia infection in mice [12,33].

While murine models have been vital to elucidate mechanisms of cell death and inflammation during Yersinia infection, there exist notable differences between human and murine immune systems [36–39], indicating that mice do not fully recapitulate human responses to infection. Notably, mice lacking RIPK1 experience acute perinatal lethality, succumbing to systemic inflammation and aberrant cell death [40], whereas humans with biallelic RIPK1 deficiency are viable, although they experience immunodeficiencies and autoinflammatory disease [41,42]. Clinical studies have implicated human RIPK1 in a wide range of systemic disorders and pathologies [41–46], leading to substantial interest in developing RIPK1 therapeutics, particularly for treating inflammatory diseases and cancer [46–48]. However, whether human and murine cells similarly undergo RIPK1-dependent cell death in response to blockade of IKK signaling remains poorly understood.

Here, we demonstrate that in human macrophages, cell death induced by Yersinia or chemical IKK blockade is independent of RIPK1, indicating that regulation of apoptosis in human macrophages is distinct from mouse macrophages. Instead, our data suggest that cell death is caused by IKK blockade-mediated downregulation of cFLIP. cFLIP overexpression partially protected human macrophages from IKK blockade-induced cell death. Moreover, we found that RIPK1 activity is also dispensable for apoptosis of human Jurkat T cells and pancreatic cells following IKK blockade. Altogether, our data demonstrate that IKK blockade triggers apoptosis independently of RIPK1 activity in multiple human cell types. Our findings suggest that investigation of compensatory cell death pathways is warranted in innate immune responses to bacterial infection and in the setting of therapeutics targeting RIPK1 for human disease.

Results

Yersinia YopP blockade of IKK signaling induces RIPK1 activity-independent apoptosis in human macrophages

Yersinia YopJ blockade of IKK signaling induces rapid RIPK1- and caspase-8-dependent cell death in murine bone marrow-derived macrophages (BMDMs) [12,23,31,33–35] (S1A Fig). However, primary human monocyte-derived macrophages (hMDMs) infected with Y. pseudotuberculosis (Yptb) did not undergo detectable cytotoxicity (S1B Fig), consistent with recent findings [34]. The related species Y. enterocolitica (Ye) expresses a YopJ homolog, termed YopP, that is required for Ye to block TNF production in hMDMs (Fig 1A) [22,49]. In contrast to Yptb, Ye induced robust YopP-dependent cell death in both hMDMs and BMDMs (S1A–S1C Fig), as previously reported [50]. Interestingly, a ΔyopJ Yptb strain expressing YopP was not sufficient to recapitulate the cell death induced by WT Ye (S1C Fig). Unexpectedly, Necrostatin-1 (Nec-1), a small molecule inhibitor of RIPK1 kinase activity, did not block Ye-induced death of hMDMs (Fig 1B and 1C), in contrast to its inhibitory effect on cell death in Yersinia-infected murine BMDMs (S1A Fig) [31,34].

Immunoblot analysis of hMDMs demonstrated that YopP-dependent caspase-8 processing into its active form was not inhibited by Nec-1 (Fig 1D), in contrast to BMDMs. Ye also induced YopP-dependent cleavage of the cell-intrinsic initiator caspase, caspase-9, which was not blocked with Nec-1 (S1D Fig), consistent with observations that Yersinia induces caspase-8-dependent cleavage of BID, which can activate the mitochondrial apoptosis pathway [25]. The downstream executioner caspase-3 was processed into the active subunits p17/p19 in a RIPK1 activity-independent manner (Fig 1E). Human THP-1 macrophages also exhibited robust YopP-dependent, RIPK1 activity-independent caspase-3/7 cleavage and activation (Fig 1F and 1G). Overall, these data demonstrate that Ye induces YopP-dependent, RIPK1 activity-independent apoptosis in human macrophages.

10.1371/journal.ppat.1012469.g001 Fig 1 RIPK1 activity is dispensable for Yersinia-induced extrinsic apoptosis in human macrophages.

Cells were pre-treated with Nec-1 or a media control for 1 h and then mock-infected or infected with WT Y. enterocolitica (Ye) or ΔyopP Ye. (A–B) Each data point represents the mean of triplicate wells for each of 6–7 different human donor hMDMs. (A) TNF levels in the supernatant of hMDMs were measured by ELISA 18–19 h after infection. N = 7. (B) Cytotoxicity was measured by lactate dehydrogenase (LDH) release from hMDMs at 18–19 h after infection and normalized to untreated cells. (C) Cytotoxicity in hMDMs was measured by PI uptake in triplicate wells over 8 h. Representative of 3 independent experiments with different human donors. (D) Immunoblot analysis was performed on hMDM lysates 5 h after infection for full-length and cleaved caspase-8, and β-actin. Representative of 3 independent experiments with different human donors. (E) Immunoblot analysis was performed on hMDM lysates 18 h after infection for caspase-3 and β-actin. Representative of 3 independent experiments with different human donors. (F) Caspase-3/7 activity in THP-1 macrophages quantified 20–26 h after infection. N = 5. (G) Immunoblot analysis of THP-1 lysates 24 h after infection for caspase-3 and β-actin. Representative of 2 independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by Tukey’s multiple comparisons test. Graphs depict mean + SD.

RIPK1 activity is dispensable for IKK blockade-induced apoptosis of human macrophages

In murine BMDMs, TNF or TLR stimulation together with pharmacological TAK1 or IKK blockade induces RIPK1- and caspase-8-dependent cell death [12,34], similar to Yersinia infection. Consistently, hMDMs (Fig 2A and 2B) and THP-1 macrophages (Fig 2C) treated with LPS and an IKK inhibitor (LPS+IKKi) underwent cell death. However, as with Yersinia infection (Fig 1), this cell death was not blocked by Nec-1, indicating that RIPK1 activity was not required. hMDMs treated with LPS and a TAK1 inhibitor (LPS+TAK1i) also underwent cell death that was not significantly blocked by Nec-1 (S2A Fig). In murine cells, Complex I blockade induces RIPK1 autophosphorylation, which promotes recruitment of RIPK1 into a stable Complex II to robustly activate caspase-8 [10,51,52]. However, we did not detect RIPK1 phosphorylation following LPS+IKKi treatment in hMDMs (Figs 2D and S2B), but we did detect RIPK1 cleavage to its inactive form, likely by caspase-8 to prevent necroptosis as characterized previously [45,53,54]. Furthermore, we also did not observe potent RIPK1 phosphorylation in hMDMs following co-treatment with LPS, IKKi, and an inhibitor of p38 MAPK (LPS+IKKi+p38i), nor with LPS+TAK1i treatment (S2B Fig).

10.1371/journal.ppat.1012469.g002 Fig 2 RIPK1 activity is dispensable for IKK blockade-induced extrinsic apoptosis in human macrophages.

Cells were pre-treated with IKKi, Nec-1, and/or ZVAD and then stimulated with LPS. (A) Cytotoxicity in hMDMs was measured by LDH release 5–7 h post-stimulation. Each data point represents the mean of triplicate wells for 11–12 different human donors. (B) Cytotoxicity in hMDMs was measured by PI uptake in triplicate wells over 5 h. Representative of 3 independent experiments. (C) Cytotoxicity in THP-1 macrophages was measured by LDH release 17–24 h post-stimulation. N = 22–35. (D–G) Immunoblot analysis was performed on lysates as indicated: (D) hMDM lysates 6 h after stimulation for phospho-RIPK1 (S166), RIPK1, caspase-3, and β-actin, representative of 3–4 independent experiments, (E) THP-1 lysates 24 h after stimulation for caspase-3 and β-actin, representative of 2 independent experiments, (F) hMDM lysates 5 h after stimulation for full-length and cleaved caspase-8, and β-actin, representative of 3 independent experiments, and (G) hMDM lysates at various time points for cleaved caspase-8, caspase-9, and β-actin, representative of 2–3 independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by Tukey’s multiple comparisons test. Graphs depict mean + SD.

We also treated cells with LPS and the pan-caspase inhibitor ZVAD, which engages RIPK1-dependent necroptosis by blocking caspase-8 activity [55]. Importantly, we observed robust cell death that was effectively suppressed by Nec-1 (Fig 2A–2C). Furthermore, there was early and robust RIPK1 phosphorylation following LPS+ZVAD treatment (Figs 2D and S2B), which was effectively suppressed by Nec-1. Consistent with other studies [56], LPS+ZVAD-induced necroptosis of human macrophages was blocked by the RIPK3 inhibitor GSK’872 (S2C Fig). In total, our data indicate that IKK blockade-induced death in human macrophages occurs independently of RIPK1 activity, whereas necroptosis in human macrophages is dependent on RIPK1 activity.

As with Ye infection, LPS+IKKi treatment induced processing of both caspase-3 (Fig 2D and 2E) and caspase-8 (Fig 2F) into their active forms, which was not blocked by Nec-1. Moreover, LPS+IKKi-induced cell death was significantly reduced upon co-treatment with GSK’872 and the caspase-8 inhibitor IETD in hMDMs, or with GSK’872 and the pan-caspase inhibitor QVD in THP-1 macrophages (S2D Fig), consistent with the interpretation that LPS+IKKi induces caspase-8-dependent cell death. LPS+IKKi also induced RIPK1 activity-independent caspase-9 cleavage (S2E Fig), as observed with Ye infection (S1D Fig). Furthermore, we observed that caspase-8 and caspase-9 processing into their active forms both occurred rapidly by 2 hours following LPS+IKKi treatment or Ye infection (Fig 2G), indicating that both the extrinsic and intrinsic apoptosis pathways are activated concurrently.

To address the potential contribution of the mitochondrial apoptosis pathway to IKK blockade-induced apoptosis in human macrophages, we used siRNA to silence BID expression in THP-1 macrophages. Despite substantial reduction in BID protein levels (S2F Fig), we found no significant reduction in cytotoxicity following LPS+IKKi treatment (S2G Fig). These data indicate that although the mitochondrial apoptosis pathway is activated following IKK blockade, it is not required to execute cell death, presumably because the cell-extrinsic pathway is sufficient.

In murine macrophages, the Yersinia-induced RIPK1/caspase-8 Complex II contributes to pyroptosis by activating the pore-forming protein Gasdermin D (GSDMD) and promoting IL-18 release [31,34,35,57]. However, neither LPS+IKKi treatment nor Yersinia infection induced IL-18 release in THP-1 macrophages, suggesting that human macrophages do not undergo pyroptosis or inflammasome activation in response to IKK blockade (S2H Fig). As expected, LPS+Nigericin treatment, which activates the NLRP3 inflammasome, induced IL-18 release in THP-1 macrophages, which was abrogated by the NLRP3 inhibitor MCC950 (S2H Fig).

To further characterize the regulation of IKK blockade-induced cell death, we used CRISPR/Cas9 to generate three independent FADD-/- single-cell clonal cell lines (S2I and S2J Fig). Following LPS stimulation, FADD-/- THP-1 macrophages underwent cell death, and upon treatment with Nec-1 to block RIPK1 activity or with GSK’872 to block RIPK3 activity, there was significantly less cell death (S2K Fig), indicating that FADD-/- cells are predisposed to undergo necroptosis in response to LPS. Thus, upon LPS stimulation of human macrophages, FADD appears to protect cells from undergoing necroptosis, likely due to the role of FADD in stabilizing caspase-8:cFLIP heterodimers to promote their pro-survival and anti-necroptosis functions [58–60]. Importantly, FADD-/- cells also undergo significantly less cell death following LPS+IKKi treatment (S2L Fig) and significantly less caspase-3/7 activation following Yersinia infection (S2M Fig). Thus, FADD appears to be largely required for this cell-extrinsic apoptosis pathway in human macrophages. Collectively, our data indicate that blockade of IKK signaling in human macrophages induces caspase-8 activation and FADD-mediated apoptosis independently of RIPK1 activity.

RIPK1 is dispensable for IKK blockade-induced cell-extrinsic apoptosis in human macrophages

In murine cells, RIPK1 can contribute to cell-extrinsic apoptosis via both kinase-dependent and independent functions [8–12,15,51,61,62]. Blockade of Complex I proteins at Checkpoint 1 occurs upstream of NF-κB-dependent gene regulation and triggers rapid RIPK1 activity-dependent cell death [7–12,17,51,63]. Checkpoint 2 occurs at the level of transcriptional/translational regulation of pro-survival genes such as cFLIP and A20 [7,10,15,17,51,61]. Downregulation of cFLIP leads to the loss of caspase-8-cFLIP heterodimers that normally inhibit cell death, inducing RIPK1 activity-independent cell death [6,10,17,51,62]. As our data suggested that IKK blockade-induced apoptosis in human macrophages is independent of RIPK1 kinase activity, we next directly tested the requirement for RIPK1 in IKK blockade-induced cell death. We used CRISPR/Cas9 to generate two independent, sequence-validated RIPK1-/- THP-1 single-cell clonal cell lines (S3A–S3D Fig). RIPK1-/- THP-1 macrophages released significantly lower levels of TNF upon LPS stimulation (Fig 3A), consistent with the reported role for RIPK1 in TLR4 signaling [64]. RIPK1-/- THP-1 macrophages were not sensitized to LPS-induced cytotoxicity (Fig 3B), similar to previous findings [42], but in contrast to other findings with human iPSC-derived macrophages stimulated with LPS [65] and RIPK1-/- Jurkat T cells stimulated with TNF [8,17,66].

10.1371/journal.ppat.1012469.g003 Fig 3 Human RIPK1-/- macrophages undergo cell-extrinsic apoptosis following IKK blockade and Yersinia infection.

(A–D) WT and RIPK1-/- THP-1 macrophages were pre-treated with inhibitors and then stimulated with LPS or infected with Ye (WT or ΔyopP). (A) WT and RIPK1-/- THP-1 macrophages were stimulated with LPS for 18–24 h. TNF levels were measured in the supernatant by ELISA. (B) Cytotoxicity was measured by LDH release 18–24 h post-stimulation. N = 6–14. (C,D) Caspase-3/7 activity was detected and quantified by Caspase-Glo 3/7 22–24 h after (C) stimulation, N = 3–4 or (D) infection, N = 3. (E,F) WT, RIPK1-/-, and TRADD-/- THP-1 macrophages were pre-treated with IKKi, Nec-1, and/or Apt-1 and then stimulated with LPS. Cytotoxicity was measured by LDH release (E) 20–24 h after stimulation, N = 3 and (F) 13–14 h after stimulation, N = 3. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001 by (A–D,F) Tukey’s or (E) Šídák’s multiple comparisons test. Graphs depict mean + SD.

Following LPS+IKKi treatment or Ye infection, WT and RIPK1-/- THP-1 macrophages exhibited comparable levels of cell death (Fig 3B) and caspase-3/7 activation (Figs 3C, 3D and S3E). Consistent with the critical role of RIPK1 in necroptosis, RIPK1-/- THP-1 macrophages were protected from cytotoxicity in response to LPS+ZVAD (Fig 3B). Altogether, these findings demonstrate that human macrophages do not require RIPK1 for IKK blockade-induced apoptosis.

In some contexts, the protein TNFR1-associated death domain (TRADD) can serve as a redundant scaffolding protein to promote Complex II assembly and mediate apoptosis independently of RIPK1. Like RIPK1, TRADD is a multifunctional protein that regulates both pro-inflammatory gene expression and cell death downstream of cell surface receptor ligation by recruiting distinct signaling complexes [13,59,67–71]. Notably, both hMDMs and THP-1 macrophages express high levels of TRADD, in contrast to murine BMDMs (S3F Fig).

To directly test the requirement for TRADD, we generated TRADD-/- THP-1 macrophages using CRISPR/Cas9 (S3G Fig) and utilized the bulk population, which demonstrated efficient TRADD depletion at the protein level (S3H Fig). LPS+IKKi treatment induced comparable levels of cell death between WT and TRADD-/- THP-1 macrophages (Fig 3E), indicating that TRADD is not required to mediate cell death following IKK blockade. To account for the possibility of functional redundancy between TRADD and RIPK1, we treated TRADD-/- THP-1 macrophages with Nec-1, which failed to restrict cytotoxicity (Fig 3E). Furthermore, we treated cells with the small-molecule compound Apostatin-1 (Apt-1), which prevents TRADD from assembling Complex II [71], and treatment with this too failed to block LPS+IKKi-induced cell death in both WT and RIPK1-/- THP-1 macrophages (Fig 3F). In total, these data suggest that human macrophages do not require TRADD nor RIPK1 to regulate IKK blockade-induced apoptosis.

cFLIP partially protects human macrophages from IKK blockade-induced apoptosis

Since RIPK1 is dispensable for IKK blockade-induced apoptosis in human macrophages, we hypothesized that inhibition of IKK reduces expression of pro-survival genes such as CFLAR (encoding cFLIP), thus relieving a brake on cell-extrinsic apoptosis [17,55,57,58,72]. Indeed, we observed rapid downregulation of cFLIP expression following LPS+IKKi treatment (Fig 4A). Consistently, we also observed rapid cFLIP downregulation following LPS+Cycloheximide (Chx) treatment (S4A Fig). We generated two independent, sequence-validated CFLAR-/- THP-1 single-cell clonal cell lines (S4B–S4D Fig). Notably, CFLAR-/- THP-1 macrophages were significantly more susceptible than WT cells to caspase-3/7 activation and cell death following LPS or TNF stimulation alone (Fig 4B and 4C), consistent with the established protective role of cFLIP in preventing cell-extrinsic apoptosis [17,55,57,58,72]. Cytotoxicity of LPS+IKKi-treated WT cells was comparable to that of CFLAR-/- cells, suggesting that IKKi-induced downregulation of cFLIP sensitizes THP-1 macrophages to death similarly to cells genetically lacking cFLIP (Fig 4B). Furthermore, LPS+ZVAD treatment largely protected CFLAR-/- cells from LPS-induced cell death (Fig 4B), consistent with our finding that CFLAR-/- cells are predisposed to undergo caspase-3/7 activation and apoptosis in response to LPS (Fig 4C).

10.1371/journal.ppat.1012469.g004 Fig 4 cFLIP partially regulates extrinsic apoptosis in human macrophages following IKK blockade.

(A) hMDMs were pre-treated with IKKi and then stimulated with LPS. Immunoblot analysis was performed on lysates at various time points for cFLIP and β-actin. Representative of 4 independent experiments. (B–C) WT and CFLAR-/- THP-1 macrophages were pre-treated with inhibitors and then stimulated with LPS for 18–25 h. N = 3–4. (B) Cytotoxicity was measured by LDH release. (C) Caspase-3/7 activity was detected and quantified by Caspase-Glo 3/7. (D–G) mCherry- and CFLAR-overexpressing THP-1 macrophages were pre-treated with inhibitors and then stimulated with LPS or TNF or infected with Ye for 24 h. (D) Cytotoxicity was measured by LDH release. N = 5. (E) Cell viability was measured by ATP signal. N = 4. (F,G) Caspase-3/7 activity was detected and quantified by Caspase-Glo 3/7. Representative of 3 independent experiments performed in triplicate wells. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by (B,C) Dunnett’s multiple comparisons test, (D,E) Holm-Šídák method T test, or (F,G) Šídák’s multiple comparisons test. All graphs depict mean + SD.

We next tested whether cFLIP overexpression would protect human macrophages from IKK blockade-induced apoptosis by generating THP-1 cells stably overexpressing either cFLIP (plenti-CFLAR) or mCherry as a negative control (plenti-mcherry) (S4E Fig). Indeed, THP-1 macrophages overexpressing cFLIP were significantly protected from cell death following Yersinia infection or LPS+IKKi treatment (Fig 4D–4G). Furthermore, we observed reduced caspase-8 and caspase-9 cleavage in THP-1 macrophages overexpressing cFLIP (S4F Fig). However, protection from cell death was incomplete, indicating that although cFLIP is necessary, its overexpression is not sufficient to fully protect cells from IKK blockade-induced cell death. Altogether, these data indicate that cFLIP overexpression partially protects against IKK blockade-induced apoptosis in human macrophages.

RIPK1 kinase activity is dispensable for IKK blockade-induced cell death in multiple human cell types

We next considered whether the lack of a role for RIPK1 activity in regulating IKK blockade-induced apoptosis was specific to human macrophages or a feature shared by other human cells. RIPK1 was previously reported to contribute to apoptosis in both human Jurkat T cells and PANC-1 pancreatic tumor cells [17,73,74]. Given the lack of TLR4 expression in Jurkat cells [75], we stimulated the cells instead with TNF following IKK blockade, which largely phenocopies LPS+IKKi-induced apoptosis [12,76]. We then measured cell survival in the presence or absence of the RIPK1 inhibitor Nec-1. THP-1 macrophages and hMDMs underwent RIPK1 activity-independent cell death in response to TNF+IKKi treatment (Fig 5A and 5B), and hMDMs exhibited RIPK1 activity-independent caspase-8 cleavage (S5A Fig). These data demonstrate that in human macrophages, IKK blockade-induced cell death downstream of both LPS and TNF is RIPK1 activity-independent. Moreover, TNF+IKKi treatment in Jurkat cells (Figs 5C and S5B) and PANC-1 cells (Figs 5D and S5C) also induced caspase-8 cleavage and cell death that was not blocked by Nec-1, indicating that RIPK1 activity is dispensable for cell-extrinsic apoptosis in multiple human cell types in response to IKK blockade in the setting of TLR or TNF stimulation.

10.1371/journal.ppat.1012469.g005 Fig 5 Multiple human cell types undergo RIPK1 activity-independent cell death following IKK blockade.

Cells were pre-treated with inhibitors or vehicle control (DMSO) and then stimulated with TNF. Viability was measured by ATP levels in the following cell types: (A) THP-1 macrophages, 22–25 h, N = 6, (B) hMDMs, 5–6 h, N = 4, (C) Jurkat cells, 12–15 h, N = 3, (D) PANC-1 cells, 14–16 h, N = 3. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001 by Tukey’s multiple comparisons test. Graphs depict mean + SD.

The E3 ubiquitin ligases cIAP1/2 ubiquitylate RIPK1 to form a scaffold for recruitment of signaling proteins, including IKKα/β and TAK1 [8,9,51,15]. SMAC mimetics (SM), which disrupt cIAPs and induce their degradation, are used extensively to induce RIPK1-dependent apoptosis. Interestingly, both THP-1 macrophages and hMDMs were resistant to cell death following TNF+SM treatment (S5D and S5E Fig), consistent with recent findings that non-polarized human macrophages are resistant to SM-induced cell death [77]. In contrast, both Jurkat T cells and PANC-1 cells were highly susceptible to caspase-8 cleavage and cell death following TNF+SM treatment, which were both reduced by Nec-1 treatment (S5B, S5C, S5F and S5G Fig). Collectively, these data indicate that distinct factors mediate cell-extrinsic apoptosis in different human cell types in response to IKK blockade or disruption of cIAPs.

Discussion

Here, we report that unlike in murine macrophages, RIPK1 is dispensable for cell-extrinsic apoptosis in human macrophages during Yersinia infection or pharmacological blockade of IKK. Furthermore, overexpression of cFLIP partially protected human macrophages from IKK blockade-induced apoptosis, indicating that this cell death pathway is regulated by cFLIP downregulation. Additionally, we uncovered that in human Jurkat T cells and pancreatic epithelial cells, RIPK1 activity is also dispensable for IKK-blockade induced apoptosis. Overall, our findings illustrate that multiple human cell types undergo RIPK1 activity-independent apoptosis following IKK blockade.

Interestingly, contrary to murine macrophages, we found that human macrophages do not undergo cell death in response to Yersinia pseudotuberculosis (Yptb) infection. In contrast, Y. enterocolitica (Ye) induced robust cell death in human macrophages, which was dependent on YopP, a homolog of YopJ in Yptb. Notably, Yptb expressing YopP did not induce cell death (S1C Fig), indicating that other Yops in Yptb suppress death in human macrophages. Indeed, our recent studies indicate that Yptb effectors YopE/H/K synergistically suppress pyroptosis in both human IECs and macrophages, and that YopJ does not induce RIPK1-dependent apoptosis in human cells [78]. Why this does not occur with Ye, which in principle has highly overlapping effectors with Yptb, remains to be determined.

Studies examining extrinsic apoptosis following Checkpoint 1 blockade in human cells have largely investigated SMAC mimetic treatment in epithelial cell lines and report that RIPK1 mediates apoptosis in this context [13,17,42,79], which we observed in Jurkat T cells and PANC-1 pancreatic epithelial cells as well (S5 Fig). Previous studies also established that RIPK1 is required for apoptosis following membrane-bound FasL treatment in human T cells [42,74,80]. In contrast, our findings demonstrate that RIPK1 is not required for cell-extrinsic apoptosis following IKK blockade in human macrophages, T cells, and pancreatic epithelial cells, indicating that distinct regulatory mechanisms exist in human cells to mediate cell-extrinsic apoptosis.

Within its role as a scaffold within Complex I, RIPK1 mediates canonical NF-κB signaling and promotes host cell survival in numerous systems [40,42,64,81]. However, our data demonstrate that in the absence of RIPK1, human macrophages do not exhibit basal susceptibility to necroptosis, in contrast to previous reports [8,17,40,41,65,66,82], and these cells can still release substantial, albeit reduced, levels of TNF (Fig 3A), suggesting that RIPK1 is not entirely required for pro-inflammatory and pro-survival signaling. Furthermore, human macrophages did not undergo cell death in response to cIAP1/2 inhibition (S5D and S5E Fig). Given that cIAP1/2 contribute to pro-survival signaling via RIPK1, cIAP1/2 inhibition was not cytotoxic to human macrophages, and RIPK1-/- cells are not basally susceptible to necroptosis and can release TNF, it is possible that pro-survival signaling complexes in human macrophages are partially independent of cIAP1/2 and RIPK1. Overall, combined with our findings that IKK blockade induces RIPK1-independent cell death in human macrophages (Fig 3), our studies also suggest the possibility that a RIPK1-independent checkpoint promotes pro-survival NF-κB signaling and protects human macrophages from aberrant cell death. We cannot exclude the possibility that human macrophages can undergo RIPK1-dependent apoptosis in response to different stimuli. Nonetheless, our findings demonstrate that human and murine macrophages exhibit distinct requirements for RIPK1 in IKK blockade-induced apoptosis.

PANC-1 and Jurkat cells underwent apoptosis in response to treatment with SMAC mimetic and TNF, and this death was partially RIPK1-dependent (S5 Fig). In contrast, upon TNF+IKKi treatment, PANC-1 and Jurkat cells underwent RIPK1 activity-independent apoptosis (Fig 5). We speculate that in these cells, blocking cIAP1/2 destabilizes Complex I and releases RIPK1 to form Complex II and mediate apoptosis, whereas blocking IKK does not release RIPK1 but directly targets downstream NF-κB signaling. This is in contrast to murine cells, wherein blockade of TAK1 or IKK releases RIPK1 to mediate Complex II formation and apoptosis [15,34]. Overall, these findings reveal cell type- and species-specific differences in regulation of cell-extrinsic apoptosis in response to blockade of immune signaling.

The adaptor protein FADD is canonically understood to stabilize the caspase-8:cFLIP pro-survival complex as well as assemble the caspase-8:caspase-8 Complex II following cell-extrinsic apoptosis stimuli. In agreement with the field, we found that FADD protects human macrophages from necroptosis and is largely required for IKK blockade-induced apoptosis. In order to characterize the molecular regulation of this apoptosis pathway, further studies will be required to dissect the composition of the FADD-assembled cell death complex, both in the presence and absence of RIPK1.

RIPK1 is implicated in a broad range of human diseases [43,44,46], and there is significant interest in development of therapeutics to target RIPK1 kinase activity in a variety of human inflammatory diseases, neurodegenerative conditions, and cancer metastasis [46–48]. Extensive analyses in murine models highlight a key role for RIPK1 activity in promoting cell-extrinsic apoptosis and downstream responses. In contrast, our results indicate that there are key differences in the contribution and function of RIPK1 activity in human cells in a cell type- and stimulus-specific manner. Our findings highlight the need to further dissect the contributions of RIPK1 to cell death in different contexts in human cells.

Materials and methods

Ethics statement

All studies involving primary human macrophages were performed in compliance with the requirements of the US Department of Health and Human Services and the principles expressed in the Declaration of Helsinki. Samples were obtained from the University of Pennsylvania Human Immunology Core. These samples are considered to be a secondary use of de-identified human specimens and are exempt via Title 55 Part 46, Subpart A of 46.101 (b) of the Code of Federal Regulations. All experiments performed with mouse bone marrow-derived macrophages were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania (protocol 804523).

Cell cultures

All cells were maintained in a humidified incubator kept at 37°C with 5% CO2. Murine bone marrow-derived macrophages (BMDMs) were isolated and differentiated as previously described [83] and replated in a 96-well tissue culture (TC)-treated plate at 0.5×105 cells/well. Primary human monocyte-derived macrophages (hMDMs) were differentiated as previously described [37] and replated in a 96-well TC-treated plate at 0.3×105 cells/well, or a 48-well tissue culture-treated plate at 1×105 cells/well. THP-1 monocytes (TIB-202; American Type Culture Collection) were maintained, differentiated, and replated as previously described [38] in a 96-well TC-treated plate at 0.5×105 cells/well, or a 48-well TC-treated plate at 2×105 cells/well. Jurkat T cell clone E6-1 (TIB-152; American Type Culture Collection) was kindly provided by Will Bailis (University of Pennsylvania, Philadelphia). Cells were maintained in THP-1 media [38] as recommended. The day before the experiment, cells were replated in media without antibiotics in a 96-well TC-treated plate at 0.5×105 cells/well. PANC-1 pancreatic epithelial carcinoma cells (CRL-1469; American Type Culture Collection) were maintained in DMEM supplemented with 10% (vol/vol) heat-inactivated fetal bovine serum (FBS), 100 IU/mL penicillin, and 100 μg/mL streptomycin. The day before the experiment, cells were detached with trypsin-EDTA (0.25%) and replated in media without antibiotics in a 96-well TC-treated plate at 0.5×105 cells/well.

Generation of CRISPR/Cas9 THP-1 knockout cell lines

RIPK1-/-, CFLAR-/-, FADD-/-, and TRADD-/- cells were generated using the CRISPR/Cas9 system as previously described [38]. Briefly, pLentiCRISPR v2 plasmids encoding the desired guide RNA (gRNA) and Cas9 were purchased from GenScript. The following target sequences were used (5’ to 3’):

RIPK1 gRNA 1: CGGCTTTCAGCACGTGCATC;

CFLAR gRNA 3: TGCCAATGCAATCGATTATC;

FADD gRNA 1: AGTCGTCGACGCGCCGCAGC;

TRADD gRNA 1: GGTGCGCGTAGGCATCCGAC.

Production of lentiviral particles, transduction of target cells, single-cell clone selection, and sequence validation were performed as previously described [38]. DNA was isolated from clones using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). The genomic region containing the target sequence was amplified by PCR using the following primers (all 5’ to 3’): RIPK1 Forward: CGTGGGAGTGATGTGTTGGA, RIPK1 Reverse: ATCCTCCTGCCAAAAGTGCT, CFLAR Forward: ATGAACTTGTCTGGTTTGCAG, CFLAR Reverse: GCCTGCTTCCCTCTCTCTGTA. All RIPK1-/- and CFLAR-/- clones were sequence-validated and both alleles of each clone contained mutations which resulted in premature stop codons.

Generation of mCherry- and CFLAR-overexpressing THP-1 cell lines

Human CFLAR was cloned into the pTwist Lenti SFFV Puro WPRE lentiviral vector backbone (Twist Bioscience). As a negative control, mCherry was cloned into pTwist Lenti SFFV Puro WPRE vector with a C-terminal Streptag II (Twist Bioscience) [84]. Production of lentiviral particles, transduction, and selection of target cells were performed as previously described [38].

Bacterial strains and growth conditions

Yersinia strains described in Table 1 were grown and induced as previously described [85]. All cultures were washed and resuspended in pre-warmed serum-free media prior to infection. In all experiments, control cells were mock-infected with serum-free media.

10.1371/journal.ppat.1012469.t001 Table 1 Bacterial Strains.

Strain name	Reference/Source	
IP2666 (WT Yptb)	From James Bliska [86,87]	
IP26 (ΔyopJ Yptb)	From James Bliska [29]	
IP26 pACYC184-YopP	[88]	
JB580v (WT Ye)	From Virginia Miller [89]	
YVM1612 (JB580v ΔyopP Ye)	From Virginia Miller	

Stimulations and Infections

Cell media was replaced with fresh media containing inhibitors (S1 Table) and centrifuged at 300 x g for 1 min. 1–2 h following addition of inhibitors, cells were stimulated (S1 Table) or infected (Table 1). For priming conditions, cells were treated with 100 ng/mL E. coli LPS for 4 h before stimulation/infection. Cells were infected at a multiplicity of infection (MOI) of 20:1, unless otherwise indicated, centrifuged at 300 x g for 5 min, and incubated at 37°C. At 1 h post-infection, cells were treated with 100 μg/mL of gentamicin. At the indicated harvest time points, cells were centrifuged at 300 x g for 5 min prior to sample collection. All raw datasets are available on Dryad [90].

siRNA-mediated knockdown

The Silencer Select siRNA oligo targeting human BID mRNA were purchased from Thermo Fisher Scientific (s1986, Catalog #4390824). The two Silencer Select negative control siRNAs (Silencer Select Negative Control No. 1 siRNA and Silencer Select Negative Control No. 2 siRNA) were purchased from Life Technologies (Ambion). The day before the transfection, THP-1 macrophages were differentiated and replated in a 48-well tissue culture-treated plate at 2–3×105 cells/well. siRNA-mediated knockdown was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) and 7 pmol of total siRNA were transfected into cells according to the manufacturer’s instructions. After four days of incubation, cells were harvested and/or treated for an experiment.

LDH release

Cell supernatants were assayed for cytotoxicity by measuring loss of plasma membrane integrity via lactate dehydrogenase release, quantified using LDH Cytotoxicity Detection Kit (Sigma) according to the manufacturer’s directions. % cytotoxicity was calculated by subtracting background (untreated/mock infected) and normalizing to maximal LDH release (1% Triton X-100).

PI uptake

Propidium iodide (PI) (Thermo Fisher, Waltham, MA, USA) uptake was performed as previously described [91] and detected on a BioTek Synergy HT Multi-Detection Microplate Reader (BioTek, Winooski, VT) at 485/20 excitation and 590/35 emission every 10 min for the indicated time points. % PI uptake was calculated by subtracting background (untreated) and normalizing to maximal PI uptake (1% Triton X-100).

Cell viability

Cells were plated in a white-walled, clear-bottom TC-treated 96 well plate and treated as indicated. ATP was detected using the CellTiter-Glo 2.0 Assay Kit (Promega) according to the manufacturer’s instructions, and the reaction was incubated in the dark for 30–60 min. Luminescence was read on a Gen5 plate reader (BioTek). % survival was calculated by subtracting background (1% Triton X-100) and normalizing to maximal ATP levels (untreated).

Caspase-3/7 activity

Cells were plated in serum-free media in a white-walled, clear-bottom TC-treated 96 well plate and treated as indicated. Caspase-3/7 activity was detected using the Caspase-Glo 3/7 Assay Kit (Promega) according to the manufacturer’s instructions. The reaction was incubated in the dark for 3 h. Luminescence was read on a Gen5 plate reader (BioTek) and values were normalized to cell signal read by ATP detection.

Immunoblot analysis

Cells were lysed in SDS/PAGE sample buffer (50 mM Tris-HCl pH 6.8, 2% w/v SDS, 10% v/v glycerol, 0.1% Bromophenol Blue, 2 mM DTT). Lysates were boiled and centrifuged prior to running on 4–12% Bis-Tris gels (Thermo Fisher) and transferred to PVDF membranes. Membranes were immunoblotted using primary antibodies at 1:1000 dilution and HRP-linked secondary antibodies at 1:5000 dilution (S1 Table). Membranes were developed using Pierce ECL Plus and SuperSignal West Femto Maximum Sensitivity Substrate according to the manufacturer’s instructions (Thermo Fisher).

qRT-PCR

THP-1 cells were replated and differentiated as described above in a 48-well tissue culture-treated plate at a concentration of 2×105 cells/well. The next day, RNA was harvested (2 wells/condition) and isolated with RNeasy kit according to manufacturer instructions (Qiagen). cDNA synthesis was performed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). qPCR was performed using SYBR Green SuperMix (VWR International) on a QuantStudio Flex6000 (Thermo Fisher). The following primer sequences were used (all 5’ to 3’):

RIPK1 Forward: TTACATGGAAAAGGCGTGATACA

RIPK1 Reverse: AGGTCTGCGATCTTAATGTGGA

Cytokine release

Supernatants were harvested and cytokine levels were assayed using ELISA kits for human TNF and IL-18 (R&D Systems).

Statistical analysis

Data were graphed and analyzed using GraphPad Prism 9 (San Diego, CA, USA) and presented as mean values + SD. Mean values were compared across conditions and P values were determined using one- or two-way analysis of variance (ANOVA) or t test, as indicated.

Dryad DOI

10.5061/dryad.hmgqnk9rz.

Supporting information

S1 Fig Characterization of Yersinia-induced cell death in human macrophages.

Cells were pre-treated with Nec-1 and then infected with the following strains of Yersinia: WT Y. pseudotuberculosis (Yptb), ΔyopJ Yptb, ΔyopJ pYopP Yptb, WT Y. enterocolitica (Ye), or ΔyopP Ye. Cytotoxicity was measured by LDH release. (A) BMDMs were infected for 4–6 h at MOI 20. N = 3. (B–C) hMDMs were infected for 16–22 h. Each data point represents the mean of triplicate wells for each of 7–12 different human donor hMDMs. (D) Immunoblot analysis was performed on hMDM lysates for caspase-9 and β-actin. Representative of 2–3 independent experiments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by (A) Šídák’s or (B) Tukey’s multiple comparisons test. Graphs depict mean + SD.

(TIF)

S2 Fig Characterization of cell death signaling downstream of IKK blockade in human macrophages.

Cells were pre-treated with inhibitors and then stimulated with LPS or infected with Ye. (A) hMDM cytotoxicity was measured by LDH release 5–7 h after stimulation, N = 3–6. (B) Immunoblot analysis was performed on hMDM lysates at various time points for phospho-RIPK1 (S166), RIPK1, and β-Actin. Representative of 2–4 independent experiments. (C,D) hMDM cytotoxicity was measured by LDH release after 10 h of stimulation. N = 3. THP-1 cell cytotoxicity was measured by LDH release 17–24 h after stimulation. N = 3–7. (E) Immunoblot analysis was performed on hMDM lysates for caspase-9 and β-Actin. Representative of 2–3 independent experiments. (F–G) THP-1 macrophages were transfected with siRNA specific for BID (siBid) or scrambled siRNA (siCTL) for 4 days, pre-treated with IKKi, and then stimulated with LPS. (F) Immunoblot analysis was performed on lysates 22 h after mock-treatment for BID and β-Actin. Representative of 4 independent experiments. (G) Cytotoxicity was measured by LDH release 22 h after stimulation. N = 4. (H) Depending on condition, THP-1 macrophages were LPS-primed (Lpr), pre-treated with IKKi, Nec-1, and/or MCC950, and then stimulated with LPS or Nigericin or infected with WT Ye for 23–24 h. IL-18 levels were measured by ELISA in the supernatant. N = 3. (I–J) Three independent FADD-/- THP-1 single-cell clonal cell lines were generated with CRISPR-Cas9. (I) Schematic representation of the FADD gene with exons (arrows), created using Benchling and BioRender. gRNA target sequence is highlighted in pink text. (J) Immunoblot analysis was performed on WT and FADD-/- THP-1 cell lysates for FADD and β-actin. (K,L) WT and FADD-/- THP-1 macrophages were pre-treated with inhibitors and then stimulated with LPS. Cytotoxicity was measured by LDH release 24–25 h post-stimulation. Representative of two independent experiments. (M) WT and FADD-/- THP-1 macrophages were infected with Ye. Caspase-3/7 activity was detected and quantified by Caspase-Glo 3/7 24–25 h post-infection. N = 3. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by (A,D,F) Šídák’s, (C,G) Tukey’s, or (K–M) Dunnett’s multiple comparisons test. Graphs depict mean + SD.

(TIF)

S3 Fig Characterization of RIPK1-/- and TRADD-/- THP-1 macrophages.

Two independent RIPK1-/- single-cell clonal cell lines were generated with CRISPR-Cas9. (A) Schematic representation of the RIPK1 gene with exons (arrows), created using Benchling and BioRender. gRNA target sequence is highlighted in pink text. (B) Sequence alignments of WT THP-1 and RIPK1-/- Clones 1 and 2 are shown for both alleles. Graphic was created using Benchling and BioRender. Red highlighting represents the mutated region. (C) Immunoblot analysis was performed on WT and RIPK1-/- THP-1 cell lysates for RIPK1 and β-actin. (D) RT-qPCR was performed on WT and RIPK1-/- THP-1 cell lysates for RIPK1 expression relative to HPRT. (E) Immunoblot analysis was performed on WT and RIPK1-/- THP-1 cell lysates 5–6 h after stimulation or infection for caspase-3 and β-actin. Representative of 2–3 independent experiments. (F) Immunoblot analysis was performed on WT murine BMDM, hMDM, and THP-1 cell lysates for RIPK1, TRADD, and β-actin. (G–H) Bulk TRADD-/- THP-1 macrophages were generated with CRISPR-Cas9. (G) Schematic representation of the TRADD gene with exons (arrows), created using Benchling and BioRender. gRNA target sequence is highlighted in pink text. (H) Immunoblot analysis was performed on WT and bulk TRADD-/- THP-1 cell lysates for TRADD and β-actin.

(TIF)

S4 Fig Characterization of CFLAR-/- and plenti-CFLAR THP-1 macrophages.

(A) hMDMs were pre-treated with IKKi or Chx and then stimulated with LPS. Immunoblot analysis was performed on lysates at various time points for cFLIP and β-actin. Representative of 2 independent experiments. (B–D) 2 independent CFLAR-/- single-cell clonal cell lines were generated with CRISPR-Cas9. (B) Schematic representation of the CFLAR gene with exons (arrows), created using Benchling and BioRender. gRNA target sequence is highlighted in pink text. (C) Sequence alignments of WT THP-1 and CFLAR-/- Clones 1 and 2 are shown for both alleles. Red highlighting represents the mutated region. (D) Immunoblot analysis was performed on WT and CFLAR-/- THP-1 cell lysates for cFLIP and β-actin. (E) Immunoblot analysis was performed for cFLIP on lysates from plenti-mCherry and plenti-CFLAR stably-overexpressing THP-1 monocytes and PMA-differentiated macrophages. (F) plenti-mCherry and plenti-CFLAR stably-overexpressing THP-1 macrophages were pre-treated with IKKi and then stimulated with LPS. Immunoblot analysis was performed on lysates 5 h after stimulation for cleaved caspase-8, caspase-9, and β-actin, representative of 2–3 independent experiments.

(TIF)

S5 Fig Jurkat and PANC-1 cells undergo RIPK1-dependent cell death following cIAP1/2 blockade.

Cells were pre-treated with inhibitors or vehicle control (DMSO) and then stimulated with TNF. (A–C) Immunoblot analysis was performed on lysates 5–6 h after stimulation for cleaved caspase-8 and β-actin in the following cell types, representative of 2–3 independent experiments: (A) hMDMs, (B) Jurkat cells, and (C) PANC-1 cells. (D–G) Viability was measured by ATP signal in the following cell types: (D) THP-1 macrophages, 22–25 h, N = 4, (E) hMDMs, 5–6 h, N = 3, (F) Jurkat cells, 12–15 h, N = 4, and (G) PANC-1 cells, 14–16 h, N = 4. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by Tukey’s multiple comparisons test. Graphs depict mean + SD.

(TIF)

S1 Table Reagents.

(XLSX)

We thank Drs. Virginia Miller and Kimberly Walker for generously providing JB580v (WT Y. enterocolitica) [89] and YVM1612 (JB580v ΔyopP) for our studies. We thank members of the Shin and Brodsky labs for scientific discussion.

10.1371/journal.ppat.1012469.r001
Decision Letter 0
Sebbane Florent Guest Editor
Skurnik David Section Editor
© 2024 Sebbane, Skurnik
2024
Sebbane, Skurnik
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
18 Sep 2023

Dear Drs Brodsky and Shin,

Thank you very much for submitting your manuscript "Blockade of IKK signaling induces RIPK1-independent apoptosis in human cells" for consideration at PLOS Pathogens.

Your manuscript was reviewed by three independent experts in your field of research. They are all enthusiastic about your work. All agree that the question raised by your work is very important, timely, and of general interest. However, all three raise major questions (conceptual, methodological and mechanistic). One reviewer requests to perform some experiments at early time points than the one used in your study to support your conclusions. From a mechanistic point of view, the importance of TRADD (between species), the contribution of caspase 9, and the possibility that caspase 8 is activated by a protein complex other than the one proposed are also raised by the reviewers. One reviewer also highlights the benefits of using RIPK1-deficient cells for your study. Overall, the reviewers provided key experiments to support your conclusions and reinforce the mechanistic aspect of your study. Below you'll find the three reviews with detailed concerns.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript will be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Florent Sebbane

Guest Editor

PLOS Pathogens

Karla Satchell

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Dear Drs Brodsky and Shin,

Three experts in your field of research have reviewed your manuscript. They are all enthusiastic about your work. All agree that the question raised by your work is very important, timely, and of general interest. However, all three raise major questions (conceptual, methodological and mechanistic). One reviewer request to perform some experiments at early time points than the one used in your study to support your conclusions. From a mechanistic point of view, the importance of TRADD (between species), the contribution of caspase 9, and the possibility that caspase 8 is activated by a protein complex other than the one proposed are also raised by the reviewers. One reviewer also highlights the benefits of using RIPK1-deficient cells for your study. Overall, the reviewers provided key experiments to support your conclusions and reinforce the mechanistic aspect of your study. Below you'll find the three reviews with detailed concerns.

Please return your revised manuscript within 2 months; if you need more time to respond to the reviewers’ comments, please contact us.

Thank you for submitting your manuscript to PLoS Pathogens

Sincerely,

Florent Sebbane

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: In the manuscript by Nataraj et al, the authors discovered that in human cells RIPK1 is not required for the induction of apoptosis triggered by IKK inhibition, either pharmacologic or by the Yersinia virulence factor YopJ. Indeed, they show that, unlike in mouse cells, in human cells, including human monocyte-derived macrophages and THP-1, Yersinia infection or LPS treatment combined with IKK pharmacologic inhibition induce RIPK1-independent apoptosis. Of note, neither the kinase nor the scaffolding activity of RIPK1 is required for apoptosis induction in these settings. Instead, IKK inhibition-mediated cell death could be partially rescue by cFLIP overexpression, consistently with the fact that IKK inhibition leads to cFLIP downregulation.

Over the past decade, mouse studies have highlighted the role of RIPK1 kinase activity in a number of cell death-driven inflammatory pathologies, including Yersinia infection, Sharpin mutant-driven dermatitis and TNF-driven lethal sepsis. However, it is still not clear the contribution of RIPK1 kinase activity to inflammatory syndromes in human and whether RIPK1 kinase inhibition represents a valid therapeutic approach to treat inflammation-related diseases. Therefore, there is the need to elucidate the role of RIPK1 kinase activity in the execution of cell death downstream of immune receptors such as TNFR1 and TLRs in human cells. Hence, the notion that RIPK1 is not involved in apoptosis upon IKK blockade is of general interest for the entire cell death and inflammation field. In addition, the evidence provided in this study suggest that RIPK1 inhibition would not interfere with the ability of the host to clear Yersinia.

Overall, the experiments are well performed, with the most appropriate controls. The results are clearly presented and conclusions justified. However, some additional experiments would be required to strengthen the mechanistic aspect of the study.

Reviewer #2: The study of Neha Nataraj and colleagues concerns a potentially important issue. By applying Yersinia enterocolitica as tool for mediating infection-related cell death the role of IKK in controlling the cytotoxic activity of RIPK1 was investigated in human cells. Yersinia is well characterized to induce apoptosis in murine macrophages and the exploration of the mechanisms involved had previously provided valuable new insights into the regulation of cellular life and death during infection. However, it is less clear whether the findings obtained on murine cells correspond well with human cell infection. Surprisingly, the current work now indicates that RIPK1, which has been identified as critical control element in the cell death modalities of mouse cells, is dispensable for Yersinia-induced death of human macrophages. It is thus suggested that RIPK1 may fulfil distinct tasks in human cell biology which could potentially be relevant for therapeutic targeting of RIPK1 in human diseases.

The study addresses a timely and interesting question. There are, however, some conceptual and methodological concerns that should be specified to substantiate the conclusions of the study.

Reviewer #3: The manuscript by N. Nataraj et al. addresses species-specific differences in host response to Yersinia infection, particularly effector-mediated arrest imposed by bacteria on the inflammatory response in macrophages. Key differences in host response between humans and mice need to be explored, which is a very interesting question thus making significant the presented studies. The rationale is provided by their own observations as well as from reports by other groups. Instrumental in this paper Y. enterocolitica species of bacteria that disrupts inflammatory signaling via inhibition of IKK-complex. In summary, my impression of the novelty and significance is very positive.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: 1) The authors clearly showed that in hMDM Yersinia- and LPS/IKKi-induced apoptosis is RIPK1 independent and Caspase-8-dependent. Accordingly, they observed cleaved Caspase-3. In absence of RIPK1, the only known DD-containing protein that can nucleate FADD and Caspase-8 for this last to get activated is TRADD. The authors should compare RIPK1 and TRADD expression between mBMDMs and hMDM to role in or out the possibility that the difference between human and mouse is due to the different expression levels of RIPK1 and TRADD. Once can indeed envisage the scenario where in human macrophages, unlike mouse cells, TRADD is significantly more abundant than RIPK1 and therefore it is the main molecule responsible for Caspase-8 activation.

Furthermore, the authors should address whether TRADD deletion or downregulation blocks/attenuate IKK-inhibition mediated death.

2) Yersinia infection and LPS/IKKi treatments also induce Caspase-9 activation. The authors should determine the contribution Caspase-9 activation to the apoptotic phenotype, for example by deleting/downregulating Bid or by over-expressing Bcl-2.

3) In figure 4 it would be useful to have the cleaved-Caspase-8 and cleaved-Caspase-9 immunoblotting for the cFLIP overexpressing cells infected with Yersinia or treated with LPS/IKKi. This would indicate whether the rescue of the apoptotic phenotype is partial only because of incomplete inhibition of Caspase-8 by cFLIP.

4) In figure 5, the cleaved-Caspase-8 immunoblotting should be added for all the 4 cell lines.

Reviewer #2: 1. The time courses of the investigated events require more precise synchronization. It seems that Yersinia- / IKK inhibition-induced cell death starts already at around 5 to 7 h (Fig. 1C, 2A, 2B, S1D). However, processing of caspase-8 and caspase-3 was investigated at much later time points (18 h). As caspase-8 is supposed to be the upstream initiator caspase it should be analysed whether capase-8 activation precedes onset of apoptosis and processing of caspase-9 (5 h, Fig S1D).

2. Similarly, the role of RIPK1 investigated in Fig. 3 should be evaluated also in the early phase of cell death initiation. At the late time points in Fig. 3 the cells may already have switched to RIPK1-independent cell death modes and a potential involvement of RIPK1 in cell death initiation may have been missed.

3. In the same line, the phosphorylation of RIPK1 should be assessed at early time points, as the RIPK1 kinase activity and phosphorylation is supposed to be relevant for the initiation of cell death. It does not become clear from the manuscript at which time point RIPK1 phosphorylation was analysed in Fig. 2D. Fig. 2D and 2E are not correctly assigned in the figure caption.

Reviewer #3: I wish there were more data in characterization of RIPK1-deficient THP1 cell line, which is my major concern. In short, I would like to see figure 2 to be done in RIPK1-deficient cells. Another major concern is lack of any characterization (or attempt to characterize) of what would be the alternative complex responsible for activation of caspase 8. To start with RIPK1-KO cells, caspase 8 is inactive in unstimulated cells. If it is not complexed with RIPK1, it must be bound to cFLIP? Does FADD get involved with caspase 8 in stimulated cells? For instance, caspase 8 could be pulled down and examined on the presence of FADD or cFLIP. Similarly, in kinase inhibited conditions (Figure 2), does RIPK1 bind caspase 8? As one of the ways to improve the manuscript, I would recommend confining it to the knockout instead of the kinase inactive conditions, which would release some space thus making the story more focused.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: N/A

Reviewer #2: 4. As the study indicates that RIPK1 is dispensable for Yersinia- / IKK inhibition-induced apoptosis in human macrophages it could be worth to address experimentally whether the cell death-related, so called “ripoptosome”, known from mouse cell death models, forms in human cells in the investigated conditions.

5. The results shown in Fig. 4 suggest that downregulation of cFLIP-L expression is a major event responsible for Yersinia- / IKK inhibition-mediated apoptosis. To substantiate a possible coherence between protein synthesis blockade and initiation of cell death following Yersinia / LPS / TNF stimulation the data obtained with the cFLIP-L-knockout and -overexpressing cells could be complemented by experiments using cycloheximide instead of IKKi as protein synthesis inhibitor. Fig. 4C, which displays caspase activities, has an incorrect figure caption.

6. It is concluded from Fig. 5 that IKK blockade alone does not release the cytotoxic activity of RIPK1 in human cells. As it is known that other kinases besides IKK may prevent RIPK1 from signalling cell death it could be useful to analyse a TAK1 inhibitor in the experiments of Fig. 5. TAK1 acts upstream of IKK and controls additional survival-promoting signals that may be more important for controlling RIPK1 in human cells than in mouse cells. The inhibition of TAK1 would further more closely resemble the cellular YopP/YopJ effects than IKK blockade alone.

7. Is there an explanation why a high MOI may apparently impede Yersinia in triggering cell death (Fig. S1B)?

8. The title suggests that blockade of IKK signalling in general mediates RIPK1-independent apoptosis in human cells. However, this has been formally addressed only for THP-1 cells by using Nec-1 and RIPK1-knockout cells. The experiments on the other human cell types solely rely on Nec-1 application which does not rule out that presence of RIPK1 by itself may be required for cell death induction independently from its kinase activity.

Reviewer #3: there are several minor issues left to be addressed after the major issues are addressed.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

10.1371/journal.ppat.1012469.r002
Author response to Decision Letter 0
Submission Version1
5 Jun 2024

Attachment Submitted filename: Response to Reviewers - FINAL.pdf

10.1371/journal.ppat.1012469.r003
Decision Letter 1
Sebbane Florent Guest Editor
Skurnik David Section Editor
© 2024 Sebbane, Skurnik
2024
Sebbane, Skurnik
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
3 Jul 2024

Dear Drs Brodsky and Shin,

As you will read below, the three reviewers who examined the first version of your manuscript are very enthusiastic about your revised manuscript. You have addressed all their concerns. However, you will need to address two new minor points raised by one of the reviewers. Therefore, we are likely to accept your manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Florent Sebbane

Guest Editor

PLOS Pathogens

Florent Sebbane

Guest Editor

PLOS Pathogens

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Dear Drs Brodsky and Shin,

As you will read below, the three reviewers who examined the first version of your manuscript are very enthusiastic about your revised manuscript. You have addressed all their concerns. However, you will need to address two new minor points raised by one of the reviewers.

Sincerely,

Florent Sebbane

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: Over the past decade, mouse studies have highlighted the role of RIPK1 kinase activity in a number of cell death-driven inflammatory pathologies, including Yersinia infection, Sharpin mutant-driven dermatitis and TNF-driven lethal sepsis. However, it is still not clear the contribution of RIPK1 kinase activity to inflammatory syndromes in human and whether RIPK1 kinase inhibition represents a valid therapeutic approach to treat inflammation-related diseases. Therefore, there is the need to elucidate the role of RIPK1 kinase activity in the execution of cell death downstream of immune receptors such as TNFR1 and TLRs in human cells. Hence, the notion that RIPK1 is not involved in apoptosis upon IKK blockade is of general interest for the entire cell death and inflammation field. In addition, the evidence provided in this study suggest that RIPK1 inhibition would not interfere with the ability of the host to clear Yersinia.

Reviewer #2: Neha Nataraj and colleagues resubmitted a revised manuscript of their study on the role of RIPK1 in mediating human macrophage cell death following Yersinia infection. The authors have addressed the comments previously raised by the reviewers and consequently provided additional data and information. This increased the plausibility and significance of the work. I thus feel that all major and relevant issues were convincingly resolved.

Reviewer #3: This is a revised submission of the manuscript by by Dr. Igor E Brodsky and colleagues, which fully addressed all the concerns raised in the initial submission. I have no further question and enthusiastically recommend its acceptance

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: The authors addressed experimentally all my concerns and points of criticism and significantly improved the quality of the study compared to the first submission.

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: (No Response)

Reviewer #2: There are only two minor points originating from the revision that may require additional attention:

1. Fig. S2B indicates that RIPK1 is rapidly processed and cleaved by caspases following LPS and IKKi treatment. Did the authors consider that the independency of the described death of human macrophages from RIPK1 may result from rapid RIPK1 degradation, consequently entailing RIPK1-independent cell death?

2. Are the authors sure that the TRADD antibody applied in Fig. S3F is cross-species-reactive to mouse and human as proposed in the comment to point #1 of reviewer one? The antibody listed in Table 2 seems to be produced from human TRADD and specificity is stated just for human TRADD, according to the information provided by the manufacturer.

Reviewer #3: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

10.1371/journal.ppat.1012469.r004
Author response to Decision Letter 1
Submission Version2
23 Jul 2024

Attachment Submitted filename: Response to Reviewers.pdf

10.1371/journal.ppat.1012469.r005
Decision Letter 2
Sebbane Florent Guest Editor
Skurnik David Section Editor
© 2024 Sebbane, Skurnik
2024
Sebbane, Skurnik
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
31 Jul 2024

Dear Dr. Brodsky,

We are pleased to inform you that your manuscript 'Blockade of IKK signaling induces RIPK1-independent apoptosis in human macrophages' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Florent Sebbane

Guest Editor

PLOS Pathogens

Florent Sebbane

Guest Editor

PLOS Pathogens

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

10.1371/journal.ppat.1012469.r006
Acceptance letter
Sebbane Florent Guest Editor
Skurnik David Section Editor
© 2024 Sebbane, Skurnik
2024
Sebbane, Skurnik
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
21 Aug 2024

Dear Dr. Brodsky,

We are delighted to inform you that your manuscript, "Blockade of IKK signaling induces RIPK1-independent apoptosis in human macrophages," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064
==== Refs
References

1 Takeuchi O , Akira S . Pattern Recognition Receptors and Inflammation. Cell. 2010 Mar 19;140 (6 ):805–20. doi: 10.1016/j.cell.2010.01.022 20303872
2 Kawai T , Akira S . Signaling to NF-κB by Toll-like receptors. Trends Mol Med. 2007 Nov 1;13 (11 ):460–9.18029230
3 Brodsky IE , Medzhitov R . Targeting of immune signalling networks by bacterial pathogens. Nat Cell Biol. 2009 May;11 (5 ):521–6. doi: 10.1038/ncb0509-521 19404331
4 Van Avondt K , van Sorge NM , Meyaard L . Bacterial Immune Evasion through Manipulation of Host Inhibitory Immune Signaling. PLoS Pathog. 2015 Mar 5;11 (3 ):e1004644. doi: 10.1371/journal.ppat.1004644 25742647
5 Micheau O , Tschopp J . Induction of TNF Receptor I-Mediated Apoptosis via Two Sequential Signaling Complexes. Cell. 2003 Jul 25;114 (2 ):181–90. doi: 10.1016/s0092-8674(03)00521-x 12887920
6 Newton K. Multitasking Kinase RIPK1 Regulates Cell Death and Inflammation. Cold Spring Harb Perspect Biol. 2020 Mar 1;12 (3 ):a036368. doi: 10.1101/cshperspect.a036368 31427374
7 Peterson LW , Brodsky IE . To catch a thief: regulated RIPK1 post-translational modifications as a fail-safe system to detect and overcome pathogen subversion of immune signaling. Curr Opin Microbiol. 2020 Apr 1;54 :111–8. doi: 10.1016/j.mib.2020.01.015 32092691
8 O’Donnell MA , Legarda-Addison D , Skountzos P , Yeh WC , Ting AT . Ubiquitination of RIP1 Regulates an NF-κB-Independent Cell-Death Switch in TNF Signaling. Curr Biol. 2007 Mar 6;17 (5 ):418–24.17306544
9 Bertrand MJM , Milutinovic S , Dickson KM , Ho WC , Boudreault A , Durkin J , et al . cIAP1 and cIAP2 Facilitate Cancer Cell Survival by Functioning as E3 Ligases that Promote RIP1 Ubiquitination. Mol Cell. 2008 Jun 20;30 (6 ):689–700. doi: 10.1016/j.molcel.2008.05.014 18570872
10 Dondelinger Y , Jouan-Lanhouet S , Divert T , Theatre E , Bertin J , Gough PJ , et al . NF-κB-Independent Role of IKKα/IKKβ in Preventing RIPK1 Kinase-Dependent Apoptotic and Necroptotic Cell Death during TNF Signaling. Mol Cell. 2015 Oct;60 (1 ):63–76.26344099
11 Geng J , Ito Y , Shi L , Amin P , Chu J , Ouchida AT , et al . Regulation of RIPK1 activation by TAK1-mediated phosphorylation dictates apoptosis and necroptosis. Nat Commun. 2017 Dec;8 (1 ):359. doi: 10.1038/s41467-017-00406-w 28842570
12 Dondelinger Y , Delanghe T , Priem D , Wynosky-Dolfi MA , Sorobetea D , Rojas-Rivera D , et al . Serine 25 phosphorylation inhibits RIPK1 kinase-dependent cell death in models of infection and inflammation. Nat Commun. 2019 Dec;10 (1 ):1729. doi: 10.1038/s41467-019-09690-0 30988283
13 Feoktistova M , Makarov R , Yazdi AS , Panayotova-Dimitrova D . RIPK1 and TRADD Regulate TNF-Induced Signaling and Ripoptosome Formation. Int J Mol Sci. 2021 Jan;22 (22 ):12459. doi: 10.3390/ijms222212459 34830347
14 Weng D , Marty-Roix R , Ganesan S , Proulx MK , Vladimer GI , Kaiser WJ , et al . Caspase-8 and RIP kinases regulate bacteria-induced innate immune responses and cell death. Proc Natl Acad Sci. 2014 May 20;111 (20 ):7391–6. doi: 10.1073/pnas.1403477111 24799678
15 Dondelinger Y , Aguileta MA , Goossens V , Dubuisson C , Grootjans S , Dejardin E , et al . RIPK3 contributes to TNFR1-mediated RIPK1 kinase-dependent apoptosis in conditions of cIAP1/2 depletion or TAK1 kinase inhibition. Cell Death Differ. 2013 Oct;20 (10 ):1381–92. doi: 10.1038/cdd.2013.94 23892367
16 Liu T , Zhang L , Joo D , Sun SC . NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017 Jul 14;2 (1 ):1–9.
17 Wang L , Du F , Wang X . TNF-α Induces Two Distinct Caspase-8 Activation Pathways. Cell. 2008 May;133 (4 ):693–703.18485876
18 Bliska JB . Yop effectors of Yersinia spp. and actin rearrangements. Trends Microbiol. 2000 May 1;8 (5 ):205–8.10785635
19 Galindo CL , Rosenzweig JA , Kirtley ML , Chopra AK . Pathogenesis of Y. enterocolitica and Y. pseudotuberculosis in Human Yersiniosis. J Pathog. 2011;2011 :182051. doi: 10.4061/2011/182051 22567322
20 Viboud GI , Bliska JB . Yersinia Outer Proteins: Role in Modulation of Host Cell Signaling Responses and Pathogenesis. Annu Rev Microbiol. 2005 Oct;59 (1 ):69–89. doi: 10.1146/annurev.micro.59.030804.121320 15847602
21 Chen KW , Brodsky IE . Yersinia interactions with regulated cell death pathways. Curr Opin Microbiol. 2023 Feb 1;71 :102256. doi: 10.1016/j.mib.2022.102256 36584489
22 Monack DM , Mecsas J , Ghori N , Falkow S . Yersinia signals macrophages to undergo apoptosis and YopJ is necessary for this cell death. Proc Natl Acad Sci. 1997 Sep 16;94 (19 ):10385–90. doi: 10.1073/pnas.94.19.10385 9294220
23 Ruckdeschel K , Harb S , Roggenkamp A , Hornef M , Zumbihl R , Köhler S , et al . Yersinia enterocolitica Impairs Activation of Transcription Factor NF-κB: Involvement in the Induction of Programmed Cell Death and in the Suppression of the Macrophage Tumor Necrosis Factor α Production. J Exp Med. 1998 Apr 6;187 (7 ):1069–79.9529323
24 Orth K , Palmer LE , Bao ZQ , Stewart S , Rudolph AE , Bliska JB , et al . Inhibition of the Mitogen-Activated Protein Kinase Kinase Superfamily by a Yersinia Effector. Science. 1999 Sep 17;285 (5435 ):1920–3. doi: 10.1126/science.285.5435.1920 10489373
25 Denecker G , Declercq W , Geuijen CA , Boland A , Benabdillah R , van Gurp M , et al . Yersinia enterocolitica YopP-induced apoptosis of macrophages involves the apoptotic signaling cascade upstream of bid. J Biol Chem. 2001 Jun 8;276 (23 ):19706–14. doi: 10.1074/jbc.M101573200 11279213
26 Zhang Y , Bliska JB . Role of Toll-Like Receptor Signaling in the Apoptotic Response of Macrophages to Yersinia Infection. Infect Immun. 2003 Mar 1;71 (3 ):1513–9. doi: 10.1128/IAI.71.3.1513-1519.2003 12595470
27 Zhang Y , Ting AT , Marcu KB , Bliska JB . Inhibition of MAPK and NF-κB Pathways Is Necessary for Rapid Apoptosis in Macrophages Infected with Yersinia. J Immunol. 2005 Jun 15;174 (12 ):7939–49.15944300
28 Mukherjee S , Keitany G , Li Y , Wang Y , Ball HL , Goldsmith EJ , et al . Yersinia YopJ Acetylates and Inhibits Kinase Activation by Blocking Phosphorylation. Science. 2006 May 26;312 (5777 ):1211–4. doi: 10.1126/science.1126867 16728640
29 Lilo S , Zheng Y , Bliska JB . Caspase-1 Activation in Macrophages Infected with Yersinia pestis KIM Requires the Type III Secretion System Effector YopJ. Infect Immun. 2008 Sep;76 (9 ):3911–23. doi: 10.1128/IAI.01695-07 18559430
30 Ashida H , Mimuro H , Ogawa M , Kobayashi T , Sanada T , Kim M , et al . Cell death and infection: A double-edged sword for host and pathogen survival. J Cell Biol. 2011 Dec 12;195 (6 ):931–42. doi: 10.1083/jcb.201108081 22123830
31 Philip NH , Dillon CP , Snyder AG , Fitzgerald P , Wynosky-Dolfi MA , Zwack EE , et al . Caspase-8 mediates caspase-1 processing and innate immune defense in response to bacterial blockade of NF- B and MAPK signaling. Proc Natl Acad Sci. 2014 May 20;111 (20 ):7385–90.24799700
32 Rosadini CV , Zanoni I , Odendall C , Green ER , Paczosa MK , Philip NH , et al . A Single Bacterial Immune Evasion Strategy Dismantles Both MyD88 and TRIF Signaling Pathways Downstream of TLR4. Cell Host Microbe. 2015 Dec;18 (6 ):682–93. doi: 10.1016/j.chom.2015.11.006 26651944
33 Peterson LW , Philip NH , DeLaney A , Wynosky-Dolfi MA , Asklof K , Gray F , et al . RIPK1-dependent apoptosis bypasses pathogen blockade of innate signaling to promote immune defense. J Exp Med. 2017 Nov 6;214 (11 ):3171–82. doi: 10.1084/jem.20170347 28855241
34 Sarhan J , Liu BC , Muendlein HI , Li P , Nilson R , Tang AY , et al . Caspase-8 induces cleavage of gasdermin D to elicit pyroptosis during Yersinia infection. Proc Natl Acad Sci. 2018 Nov 13;115 (46 ):E10888–97.30381458
35 Orning P , Weng D , Starheim K , Ratner D , Best Z , Lee B , et al . Pathogen blockade of TAK1 triggers caspase-8–dependent cleavage of gasdermin D and cell death. Science. 2018 Nov 30;362 (6418 ):1064–9. doi: 10.1126/science.aau2818 30361383
36 Mestas J , Hughes CCW . Of Mice and Not Men: Differences between Mouse and Human Immunology. J Immunol. 2004 Mar 1;172 (5 ):2731–8. doi: 10.4049/jimmunol.172.5.2731 14978070
37 Reyes Ruiz VM , Ramirez J , Naseer N , Palacio NM , Siddarthan IJ , Yan BM , et al . Broad detection of bacterial type III secretion system and flagellin proteins by the human NAIP/NLRC4 inflammasome. Proc Natl Acad Sci. 2017 Dec 12;114 (50 ):13242–7. doi: 10.1073/pnas.1710433114 29180436
38 Naseer N , Egan MS , Ruiz VMR , Scott WP , Hunter EN , Demissie T , et al . Human NAIP/NLRC4 and NLRP3 inflammasomes detect Salmonella type III secretion system activities to restrict intracellular bacterial replication. PLOS Pathog. 2022 Jan 24;18 (1 ):e1009718. doi: 10.1371/journal.ppat.1009718 35073381
39 Sakamaki K , Imai K , Tomii K , Miller DJ . Evolutionary analyses of caspase-8 and its paralogs: Deep origins of the apoptotic signaling pathways. BioEssays. 2015 Jul;37 (7 ):767–76. doi: 10.1002/bies.201500010 26010168
40 Kelliher MA , Grimm S , Ishida Y , Kuo F , Stanger BZ , Leder P . The Death Domain Kinase RIP Mediates the TNF-Induced NF-κB Signal. Immunity. 1998 Mar 1;8 (3 ):297–303.9529147
41 Cuchet-Lourenço D , Eletto D , Wu C , Plagnol V , Papapietro O , Curtis J , et al . Biallelic RIPK1 mutations in humans cause severe immunodeficiency, arthritis, and intestinal inflammation. Science. 2018 Aug 24;361 (6404 ):810–3.30026316
42 Li Y , Führer M , Bahrami E , Socha P , Klaudel-Dreszler M , Bouzidi A , et al . Human RIPK1 deficiency causes combined immunodeficiency and inflammatory bowel diseases. Proc Natl Acad Sci. 2019 Jan 15;116 (3 ):970–5. doi: 10.1073/pnas.1813582116 30591564
43 Sultan M , Adawi M , Kol N , McCourt B , Adawi I , Baram L , et al . RIPK1 mutations causing infantile-onset IBD with inflammatory and fistulizing features. Front Immunol [Internet]. 2022 [cited 2023 Mar 6];13. Available from: https://www.frontiersin.org/articles/10.3389/fimmu.2022.1041315 36466854
44 Eeckhoutte HPV , Donovan C , Kim RY , Conlon TM , Ansari M , Khan H , et al . RIPK1 kinase-dependent inflammation and cell death contribute to the pathogenesis of COPD. Eur Respir J [Internet]. 2022 Jan 1 [cited 2023 Feb 27]; Available from: https://erj.ersjournals.com/content/early/2022/12/01/13993003.01506-2022
45 Lalaoui N , Boyden SE , Oda H , Wood GM , Stone DL , Chau D , et al . Mutations that prevent caspase cleavage of RIPK1 cause autoinflammatory disease. Nature. 2020 Jan;577 (7788 ):103–8. doi: 10.1038/s41586-019-1828-5 31827281
46 Mifflin L , Ofengeim D , Yuan J . Receptor-interacting protein kinase 1 (RIPK1) as a therapeutic target. Nat Rev Drug Discov. 2020 Aug 1;19 (8 ):553–72. doi: 10.1038/s41573-020-0071-y 32669658
47 Weisel K , Berger S , Thorn K , Taylor PC , Peterfy C , Siddall H , et al . A randomized, placebo-controlled experimental medicine study of RIPK1 inhibitor GSK2982772 in patients with moderate to severe rheumatoid arthritis. Arthritis Res Ther. 2021 Mar 16;23 (1 ):85. doi: 10.1186/s13075-021-02468-0 33726834
48 Martens S , Hofmans S , Declercq W , Augustyns K , Vandenabeele P . Inhibitors Targeting RIPK1/RIPK3: Old and New Drugs. Trends Pharmacol Sci. 2020 Mar 1;41 (3 ):209–24. doi: 10.1016/j.tips.2020.01.002 32035657
49 Boland A , Cornelis GR . Role of YopP in Suppression of Tumor Necrosis Factor Alpha Release by Macrophages during YersiniaInfection. Infect Immun. 1998 May 1;66 (5 ):1878–84. doi: 10.1128/IAI.66.5.1878-1884.1998 9573064
50 Ruckdeschel K , Roggenkamp A , Lafont V , Mangeat P , Heesemann J , Rouot B . Interaction of Yersinia enterocolitica with macrophages leads to macrophage cell death through apoptosis. Infect Immun. 1997 Nov;65 (11 ):4813–21. doi: 10.1128/iai.65.11.4813-4821.1997 9353070
51 Amin P , Florez M , Najafov A , Pan H , Geng J , Ofengeim D , et al . Regulation of a distinct activated RIPK1 intermediate bridging complex I and complex II in TNFα-mediated apoptosis. Proc Natl Acad Sci. 2018 Jun 26;115 (26 ):E5944–53.29891719
52 Laurien L , Nagata M , Schünke H , Delanghe T , Wiederstein JL , Kumari S , et al . Autophosphorylation at serine 166 regulates RIP kinase 1-mediated cell death and inflammation. Nat Commun. 2020 Apr 8;11 (1 ):1747. doi: 10.1038/s41467-020-15466-8 32269263
53 Newton K , Wickliffe KE , Dugger DL , Maltzman A , Roose-Girma M , Dohse M , et al . Cleavage of RIPK1 by caspase-8 is crucial for limiting apoptosis and necroptosis. Nature. 2019 Oct;574 (7778 ):428–31.31511692
54 Tao P , Sun J , Wu Z , Wang S , Wang J , Li W , et al . A dominant autoinflammatory disease caused by non-cleavable variants of RIPK1. Nature. 2020 Jan;577 (7788 ):109–14. doi: 10.1038/s41586-019-1830-y 31827280
55 Oberst A , Dillon CP , Weinlich R , McCormick LL , Fitzgerald P , Pop C , et al . Catalytic activity of the caspase-8–FLIPL complex inhibits RIPK3-dependent necrosis. Nature. 2011 Mar;471 (7338 ):363–7. doi: 10.1038/nature09852 21368763
56 Kaiser WJ , Sridharan H , Huang C , Mandal P , Upton JW , Gough PJ , et al . Toll-like Receptor 3-mediated Necrosis via TRIF, RIP3, and MLKL. J Biol Chem. 2013 Oct 25;288 (43 ):31268–79. doi: 10.1074/jbc.M113.462341 24019532
57 Muendlein HI , Jetton D , Connolly WM , Eidell KP , Magri Z , Smirnova I , et al . cFLIP L protects macrophages from LPS-induced pyroptosis via inhibition of complex II formation. Science. 2020 Mar 20;367 (6484 ):1379–84.32193329
58 Dillon CP , Oberst A , Weinlich R , Janke LJ , Kang TB , Ben-Moshe T , et al . Survival Function of the FADD-CASPASE-8-cFLIPL Complex. Cell Rep. 2012 May;1 (5 ):401–7.22675671
59 Füllsack S , Rosenthal A , Wajant H , Siegmund D . Redundant and receptor-specific activities of TRADD, RIPK1 and FADD in death receptor signaling. Cell Death Dis. 2019 Feb 11;10 (2 ):1–19. doi: 10.1038/s41419-019-1396-5 30741924
60 Yeh WC , Mak TW . FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science. 1998 Mar 20;279 (5358 ):1954–.9506948
61 Van Antwerp DJ , Martin SJ , Kafri T , Green DR , Verma IM . Suppression of TNF-α-Induced Apoptosis by NF-κB. Science. 1996 Nov;274 (5288 ):787–9.8864120
62 Malireddi RKS , Gurung P , Kesavardhana S , Samir P , Burton A , Mummareddy H , et al . Innate immune priming in the absence of TAK1 drives RIPK1 kinase activity–independent pyroptosis, apoptosis, necroptosis, and inflammatory disease. J Exp Med. 2020 Mar 2;217 (3 ):e20191644. doi: 10.1084/jem.20191644 31869420
63 Mandal R , Barrón JC , Kostova I , Becker S , Strebhardt K . Caspase-8: The double-edged sword. Biochim Biophys Acta BBA—Rev Cancer. 2020 Apr 1;1873 (2 ):188357. doi: 10.1016/j.bbcan.2020.188357 32147543
64 Cusson-Hermance N , Khurana S , Lee TH , Fitzgerald KA , Kelliher MA . Rip1 Mediates the Trif-dependent Toll-like Receptor 3- and 4-induced NF-κB Activation but Does Not Contribute to Interferon Regulatory Factor 3 Activation. J Biol Chem. 2005 Nov 4;280 (44 ):36560–6.16115877
65 Buchrieser J , Oliva-Martin MJ , Moore MD , Long JCD , Cowley SA , Perez-Simón JA , et al . RIPK1 is a critical modulator of both tonic and TLR-responsive inflammatory and cell death pathways in human macrophage differentiation. Cell Death Dis. 2018 Oct;9 (10 ):973. doi: 10.1038/s41419-018-1053-4 30250197
66 Zheng L , Bidere N , Staudt D , Cubre A , Orenstein J , Chan FK , et al . Competitive Control of Independent Programs of Tumor Necrosis Factor Receptor-Induced Cell Death by TRADD and RIP1. Mol Cell Biol. 2006 May;26 (9 ):3505–13. doi: 10.1128/MCB.26.9.3505-3513.2006 16611992
67 Chen NJ , Chio IIC , Lin WJ , Duncan G , Chau H , Katz D , et al . Beyond tumor necrosis factor receptor: TRADD signaling in toll-like receptors. Proc Natl Acad Sci. 2008 Aug 26;105 (34 ):12429–34. doi: 10.1073/pnas.0806585105 18719121
68 Cao X , Pobezinskaya YL , Morgan MJ , gang Liu Z . The role of TRADD in TRAIL-induced apoptosis and signaling. FASEB J. 2011;25 (4 ):1353–8. doi: 10.1096/fj.10-170480 21187341
69 Anderton H , Bandala-Sanchez E , Simpson DS , Rickard JA , Ng AP , Di Rago L , et al . RIPK1 prevents TRADD-driven, but TNFR1 independent, apoptosis during development. Cell Death Differ. 2019 May;26 (5 ):877–89. doi: 10.1038/s41418-018-0166-8 30185824
70 Wang L , Chang X , Feng J , Yu J , Chen G . TRADD Mediates RIPK1-Independent Necroptosis Induced by Tumor Necrosis Factor. Front Cell Dev Biol [Internet]. 2020 [cited 2021 Jul 14];7. Available from: https://www.frontiersin.org/articles/10.3389/fcell.2019.00393/full 32039207
71 Xu D , Zhao H , Jin M , Zhu H , Shan B , Geng J , et al . Modulating TRADD to restore cellular homeostasis and inhibit apoptosis. Nature. 2020 Nov 5;587 (7832 ):133–8. doi: 10.1038/s41586-020-2757-z 32968279
72 Philip NH , DeLaney A , Peterson LW , Santos-Marrero M , Grier JT , Sun Y , et al . Activity of Uncleaved Caspase-8 Controls Anti-bacterial Immune Defense and TLR-Induced Cytokine Production Independent of Cell Death. Weiss D editor. PLOS Pathog. 2016 Oct 13;12 (10 ):e1005910. doi: 10.1371/journal.ppat.1005910 27737018
73 Ting AT , Pimentel-Muiños FX , Seed B . RIP mediates tumor necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis. EMBO J. 1996 Nov 15;15 (22 ):6189–96. 8947041
74 Morgan MJ , Kim YS , gang Liu Z . Membrane-bound Fas Ligand requires RIP1 for efficient activation of caspase-8 within the DISC. J Immunol Baltim Md 1950. 2009 Sep 1;183 (5 ):3278–84.
75 Ye Z , Gan YH . Flagellin Contamination of Recombinant Heat Shock Protein 70 Is Responsible for Its Activity on T Cells *. J Biol Chem. 2007 Feb 16;282 (7 ):4479–84. doi: 10.1074/jbc.M606802200 17178717
76 Demarco B , Grayczyk JP , Bjanes E , Roy DL , Tonnus W , Assenmacher CA , et al . Caspase-8–dependent gasdermin D cleavage promotes antimicrobial defense but confers susceptibility to TNF-induced lethality. Sci Adv. 2020 Nov 1;6 (47 ):eabc3465. doi: 10.1126/sciadv.abc3465 33208362
77 Ali H , Dong SXM , Gajnayaka N , Cassol E , Angel JB , Kumar A . Selective Induction of Cell Death in Human M1 Macrophages by Smac Mimetics Is Mediated by cIAP-2 and RIPK-1/3 through the Activation of mTORC. J Immunol [Internet]. 2021 Sep 24 [cited 2022 Oct 29]; Available from: https://www.jimmunol.org/content/early/2021/09/24/jimmunol.2100108 doi: 10.4049/jimmunol.2100108 34561230
78 Zhang J , Brodsky IE , Shin S . Yersinia Type III-Secreted Effectors Subvert Caspase-4-dependent Inflammasome Activation in Human Cells [Internet]. bioRxiv; 2023 [cited 2023 May 26]. p. 2023.01.24.525473. Available from: https://www.biorxiv.org/content/10.1101/2023.01.24.525473v1
79 Tanzer MC , Khan N , Rickard JA , Etemadi N , Lalaoui N , Spall SK , et al . Combination of IAP antagonist and IFNγ activates novel caspase-10- and RIPK1-dependent cell death pathways. Cell Death Differ. 2017 Mar;24 (3 ):481–91.28106882
80 Bárcia RN , Valle NSD , McLeod JD . Caspase involvement in RIP-associated CD95-induced T cell apoptosis. Cell Immunol. 2003 Dec 1;226 (2 ):78–85. doi: 10.1016/j.cellimm.2003.11.006 14962495
81 Najjar M , Saleh D , Zelic M , Nogusa S , Shah S , Tai A , et al . RIPK1 and RIPK3 Kinases Promote Cell-Death-Independent Inflammation by Toll-like Receptor 4. Immunity. 2016 Jul 19;45 (1 ):46–59. doi: 10.1016/j.immuni.2016.06.007 27396959
82 Kaiser WJ , Daley-Bauer LP , Thapa RJ , Mandal P , Berger SB , Huang C , et al . RIP1 suppresses innate immune necrotic as well as apoptotic cell death during mammalian parturition. Proc Natl Acad Sci. 2014 May 27;111 (21 ):7753–8. doi: 10.1073/pnas.1401857111 24821786
83 Brodsky IE , Palm NW , Sadanand S , Ryndak MB , Sutterwala FS , Flavell RA , et al . A Yersinia effector protein promotes virulence by preventing inflammasome recognition of the type III secretion system. Cell Host Microbe. 2010 May 20;7 (5 ):376–87. doi: 10.1016/j.chom.2010.04.009 20478539
84 Fischer NL , Boyer MA , Bradley WP , Spruce LA , Fazelinia H , Shin S . A Coxiella burnetii effector interacts with the host PAF1 complex and suppresses the innate immune response [Internet]. bioRxiv; 2022 [cited 2022 Oct 26]. p. 2022.04.20.488957. Available from: https://www.biorxiv.org/content/10.1101/2022.04.20.488957v1
85 Peterson LW , Philip NH , Dillon CP , Bertin J , Gough PJ , Green DR , et al . Cell-Extrinsic TNF Collaborates with TRIF Signaling To Promote Yersinia -Induced Apoptosis. J Immunol. 2016 Nov 15;197 (10 ):4110–7.27733552
86 Simonet M , Falkow S . Invasin expression in Yersinia pseudotuberculosis. Infect Immun. 1992 Oct;60 (10 ):4414–7. doi: 10.1128/iai.60.10.4414-4417.1992 1398952
87 Black DS , Bliska JB . Identification of p130Cas as a substrate of Yersinia YopH (Yop51), a bacterial protein tyrosine phosphatase that translocates into mammalian cells and targets focal adhesions. EMBO J. 1997 May 15;16 (10 ):2730–44.9184219
88 Brodsky IE , Medzhitov R . Reduced secretion of YopJ by Yersinia limits in vivo cell death but enhances bacterial virulence. PLoS Pathog. 2008 May 16;4 (5 ):e1000067. doi: 10.1371/journal.ppat.1000067 18483548
89 Kinder SA , Badger JL , Bryant GO , Pepe JC , Miller VL . Cloning of the YenI restriction endonuclease and methyltransferase from Yersinia enterocolitica serotype O8 and construction of a transformable R−M+ mutant. Gene. 1993 Dec;136 (1–2 ):271–5. doi: 10.1016/0378-1119(93)90478-l 8294016
90 Nataraj N , Garcia Sillas R , Herrmann B , Shin S , Brodsky IE . Blockade of IKK signaling induces RIPK1-independent apoptosis in human macrophages [Dataset]. Dryad. 2024. 10.5061/dryad.hmgqnk9rz
91 Bjanes E , Sillas RG , Matsuda R , Demarco B , Fettrelet T , DeLaney AA , et al . Genetic targeting of Card19 is linked to disrupted NINJ1 expression, impaired cell lysis, and increased susceptibility to Yersinia infection. PLOS Pathog. 2021 Oct 14;17 (10 ):e1009967. doi: 10.1371/journal.ppat.1009967 34648590
