
==== Front
Open Life Sci
Open Life Sci
biol
Open Life Sciences
2391-5412
De Gruyter

biol-2022-0959
10.1515/biol-2022-0959
Research Article
Hypomethylation in promoters of PGC-1α involved in exercise-driven skeletal muscular alterations in old age
Li Qiaowei docjovylee@hotmail.com
#
Liu Qin #784786766@qq.com

Lin Zhong #1924624288@qq.com

Lin Wenwen lw18305930@163.com

Huang Feng wmhf0327@126.com

Zhu Pengli zpl7755@hotmail.com

Shengli Clinical Medical College of Fujian Medical University, Fuzhou, 350001, P. R. China
Fujian Provincial Institute of Clinical Geriatrics, Fujian Provincial Hospital, Fuzhou, 350001, P. R. China
Fujian Key Laboratory of Geriatrics, Fuzhou, 350001, P. R. China
Fujian Provincial Center for Geriatrics, Fuzhou, 350001, P. R. China
Shengli Clinical Medical College of Fujian Medical University, 134 East Street, Fuzhou, 350001, P. R. China
Fujian Provincial Institute of Clinical Geriatrics, Fujian Provincial Hospital134 East Street, Fuzhou, 350001, P. R. China
Fujian Key Laboratory of Geriatrics, 134 East Street, Fuzhou, 350001, P. R. China
Fujian Provincial Center for Geriatrics, 134 East Street, Fuzhou, 350001, P. R. China
# These authors have contributed equally to this work.

tel: +86-13850170520
tel: +86-13799957755, fax: +86-591-87532356
10 9 2024
2024
19 1 2022095928 5 2024
30 7 2024
12 8 2024
© 2024 the author(s), published by De Gruyter
2024
the author(s), published by De Gruyter
https://creativecommons.org/licenses/by/4.0/ This work is licensed under the Creative Commons Attribution 4.0 International License.

Abstract

Exercise training can significantly improve skeletal muscle mitochondrial function and has been proven to be highly relevant to alterations in skeletal muscle DNA methylation. However, it remains unclear whether late-in-life exercise has an effect on promoter methylation of PGC-1α, a key regulator of mitochondrial biogenesis. Here we employed two distinct exercise modalities, constant medium intensity exercise training (CMIT) and high-intensity interval exercise training (HIIT), to investigate their impacts on PGC-1α expression and methylation regulation in skeletal muscle of aged mice. The results revealed a notable decrease in PGC-1α expression in skeletal muscle of aged mice, accompanied by elevated methylation levels of the PGC-1α promoter, and increased DNA methyltransferase (DNMT) protein expressions. However, both forms of exercise training significantly corrected PGC-1α epigenetic changes, increased PGC-1α expression, and ameliorated skeletal muscle reduction. Furthermore, exercise training led to elevated expression of proteins related to mitochondrial biogenesis and energy metabolism in skeletal muscle, improving mitochondrial structure and function. In conclusion, late-in-life exercise improved skeletal muscle function, morphology, and mitochondria biogenesis, which may be associated with hypomethylation in promoters of PGC-1α and increased content of skeletal muscle PGC-1α. Notably, there was no clear difference between HIIT and CMIT in PGC-1α expression and skeletal muscle function.

Graphical abstract

Keywords

exercise
PGC-1α
DNA methylation
sarcopenia
==== Body
pmc1 Introduction

The morphological changes and functional decline of skeletal muscle in old age have a great impact on life quality of the elderly [1]. The feasibility, safety, and effectiveness of long-term exercise training for the elderly to improve skeletal muscle function have been confirmed in clinical studies [2–4]. A small number of studies have suggested that high-intensity interval exercise training (HIIT) may be superior to the traditional constant medium intensity exercise training (CMIT), because it is a time-saving and effective strategy for improving exercise capacity [5,6].

Exercise training is intricately linked to changes in DNA methylation patterns and subsequent alterations in gene expression [7,8]. Recent studies indicate that HIIT, acute and chronic resistance exercise training, detraining, and retraining all induce modifications in methylome of human skeletal muscle [9,10]. Aging-related muscle loss is primarily attributed to mitochondrial dysfunction [11]. Peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) serves as a core regulator of mitochondrial energy metabolism and plays a fundamental role in maintaining a proper mitochondrial biogenesis, thereby playing a crucial role in ensuring normal energy metabolism in skeletal muscle [12]. Previous studies have suggested that exercise training or electrical stimulation may affect transcription levels by regulating the epigenetic modification of PGC-1α [13,14], while the effects of acute or short-term exercise on the promoter methylation of PGC-1α were still contradictory [14,15]. Furthermore, it remains unclear whether long-term exercise beginning in old age has an effect on promoter methylation of PGC-1α.

Therefore, this study aimed to explore the differences in DNA methylation level of PGC-1a promoter between CMIT and HIIT in aged mice, as well as its effects on skeletal muscle and mitochondrial function. Our findings will help to understand the underlying mechanisms by which exercise training affects skeletal muscle in old age and provide possible directions for the development of alternative therapies.

2 Materials and methods

2.1 Experimental animals

Healthy male C57BL/6 mice, weighing 30–40 g, were obtained from SPF Shanghai Slaughter Laboratory Animal Co. C57BL/6 mice were accommodated in the Experimental Animal Center of Fujian Medical University under consistent conditions of temperature (25°C), humidity (55 ± 5%), and 12 h artificial light and dark cycles. Unrestricted access to food and water was provided for 24 h. The mice were nourished and hydrated by the Experimental Animal Center of Fujian Medical University. The animal experiments were planned and executed in accordance with the relevant regulations of Fujian Medical University and were examined by the Experimental Animal Ethics Committee of Fujian Medical University (No. 2021-0363).

2.2 Grouping and exercise protocol

In this experiment, a total of 120 male C57BL/6 mice were used, with 30 being 3-month-old SPF-grade healthy males and 90 being 18-month-old SPF-grade healthy males. These mice were divided into four groups, each consisting of 30 mice (n = 30). The groups were named as follows: young group (Young group): normal feeding, 60 min per day on a stationary animal running platform; elderly stationary control group (Con group): normal feeding, 60 min per day on a stationary animal running platform; elderly continuous moderate intensity exercise training group (CMIT group): based on normal feeding, 8 weeks of a moderate intensity running platform training, each time the speed was set to 12 m/min and each training time was 46 min; and HIIT group: on the basis of normal feeding, 8 weeks of HIIT, at a speed of 17 m/min for 4 min and followed by intervals at a speed of 8 m/min for 3 min, repeated for six cycles, with a total distance of exercise which was equal to that of the CMIT group. All of the above lasted for 8 weeks.

2.3 Rotarod and grip strength tests

Mice were tested before and after the experiment for rotarod and forelimb grip strength. The animals were placed on the Panlab rotarod LE8505, and the trial started with the spindle rotating at 5 revolutions per minute (rpm) and gradually increased to 40 rpm over a period of 5 min. The time when the animal fell off the rotarod was recorded as the score. Each animal was tested three times, and the average score was used for analysis. The BIOSEB-BIO-GS3 grip strength meter measures the maximum forelimb grip strength in mice. The subjects were lifted from their cage by their tail base and hung above the grid until they firmly held onto the grid with their forepaws. The grid was slowly moved horizontally away from the mouse’s grip by pulling its tail. The maximal force was recorded. Every animal underwent six tests, with a 2 min break between each one. The average of the five tests was utilized for analysis.

2.4 Histological and immunohistochemical (IHC) staining

Fresh skeletal muscle tissue sections were stained with HE, Masson, and IHC. For IHC staining, the presence of brownish-yellow granules in the interstitium of skeletal muscle cells was observed under light microscopy as positive expression. The expression of PGC-1α in skeletal muscle tissues was assessed by measuring the area of positively stained area out of the total area using Image J software. The average percentage of the positively stained area (positively stained area/total area) was then calculated.

2.5 Average cross-sectional area (CSA) of gastrocnemius muscle fibers

Fresh skeletal muscle tissue was preserved with 4% paraformaldehyde and sliced into 5 µm sections. The tissue sections were deparaffinized, rehydrated, and HE stained to examine the morphological changes and damage to the gastrocnemius muscle. The images were observed using a light microscope with a 400× magnification. Image J software was utilized to determine the total area (µm2) of the skeletal muscle fibers in the gastrocnemius muscle. The average CSA of gastrocnemius fibers was determined by dividing the total muscle fiber area (µm2) by the number of muscle fibers.

2.6 Transmission electron microscopy

Samples of gastrocnemius muscle with a volume of 1 mm3 were obtained, fixed, washed, cut to 60–80 nm, and stained. Under an electron microscope, the ultrastructure of the mouse gastrocnemius muscle was examined.

2.7 Reverse transcription polymerase chain reaction (RT-PCR)

Mouse skeletal muscle total RNA was isolated and reverse transcribed into cDNA for RT-PCR analysis. RT-PCR was carried out using the 2−ΔΔCt method to measure gene expression. The primer sequences were as follows:

PGC-1α-F: CGCTGCTCTTGAGAATGGATAT;

PGC-1α-R: GTCATACTTGCTCTCTTGGTGGAA;

ACTB-F: TGTCCACCTTCCAGCAGATGT;

ACTB-R: AGCTCAGTAACAGTCCGCCTAG.

2.8 Western blot

Western blot was performed on mouse gastrocnemius muscle samples. Primary antibodies used included PGC-1α, DNA methyltransferase (DNMT1), DNMT3A, DNMT3B, β-Tubulin, ERR, NRF1, CPT1B, GLUT4 (Abclonal, Wuhan, China), TFAM (Proteintech, Wuhan, China), and AMPK (Immunoway, Suzhou, China). Exposure was evaluated using a chemiluminescence imager and the grayscale values of each protein band were quantitatively analyzed using ImageJ software; the relative ratios were calculated by the optical density values of the bands of the target proteins in each group against the optical density values of the internal reference proteins.

2.9 Methylation-specific PCR (MSP)

The CpG islands in the mouse PGC-1α promoter region were retrieved using the Online MetPrimer software (http://www.urogene.org/methprimer/). Mouse skeletal muscle genomic DNA was extracted and used for bisulfite conversion in the MSP assay. The MSP primers designed by Methprimer were as follows:

methylated-F: TGGAATGGTTGAGAAGGTAGTTATC;

methylated-R: ACGTCTATTTAAAAAACTCACCGAA;

unmethylated-F: GGAATGGTTGAGAAGGTAGTTATTG;

unmethylated-R: ACATCTATTTAAAAAACTCACCAAA.

Afterward, the MSP product were examined on a 2% agarose gel, exposed for development on the chemiluminescence imager, and densitometric analysis was performed using ImageJ software.

2.10 Mitochondrial DNA (mt DNA) content assay

Mouse skeletal muscle genomic DNA was extracted for mt DNA assay. The copy number of mt DNA was quantified by measuring NADH dehydrogenase subunit 1(ND1) and normalized to the nuclear DNA lipoprotein lipase (LPL) gene using RT-PCR. The primer sequences were as follows:

ND1-F: CACTATTCGGAGCTTTACG;

ND1-R: TGTTCTGCTAGGGTTGA;

LPL-F: GAAAGGGCTGCCTGAGTT;

LPL-R: TAGGGCATCTGAGAGAGCGAGT.

2.11 Statistical analysis

The following results were analyzed for the surviving mice and calculated using SPSS24.0 statistical software. The mean ± standard deviation was used for the measurement data conforming to normal distribution and the paired t-test was used for the before–after comparison between the same groups, the group t-test was used for the comparison between two groups and the one-way ANOVA was used for the comparison between multiple groups. p < 0.05 was considered statistically significant.

3 Results

3.1 Late-in-life exercise enhances skeletal muscle function and improves its morphology

The test for forelimb grip strength directly reflects the muscular strength of mice, while the rotarod test assesses their motor coordination and fatigue endurance. After 8 weeks, mice in the Con group showed a decline in both maximum grip strength and rotarod performance, while those in the CMIT and HIIT groups exhibited increases in both measures. Interestingly, mice in the HIIT group displayed no significant difference compared to the CMIT group in terms of grip strength and rotarod performance (Figure 1a and b).

Figure 1 Late-in-life exercise enhances skeletal muscle function and morphology. (a) Change of forelimb grip strength after intervention. (b) Change of the Rotarod test time after intervention. (c) Representative images of H&E, average CSA, Masson staining, and TEM analysis of mouse gastrocnemius muscle tissue. Scale bar = 100 μm for H&E and Masson; scale bar = 20 μm for CSA; scale bar = 1 μm for TEM. (d) Relative quantification of average CSA of mouse gastrocnemius muscle. (e) Relative quantification of the degree of fibrosis of mouse skeletal muscle tissue (collagen fiber staining area/total area). *P < 0.05, **P < 0.01, ns represents no significant difference. CSA: cross-sectional area; TEM: transmission electron microscopy.

HE staining showed minor myocyte lysis and fragmentation at the periphery of skeletal muscle tissues in the Con group, accompanied by a slight infiltration of inflammatory cells in the interstitium (black arrowhead). Both the CMIT and HIIT groups exhibited marked improvement in skeletal muscle organization, myocyte lysis, and inflammation infiltration (Figure 1c). The CSA of gastrocnemius muscle fibers is a critical determinant of muscle strength [16]. Compared to the Young group, mice in the Con group exhibited a decrease in the average CSA of gastrocnemius fibers. However, both exercise modes significantly increased the average CSA of gastrocnemius fibers compared to the Con group, with the CMIT group showing a notably higher average CSA than the HIIT group (Figure 1c and d). Masson staining revealed that fibrosis in the skeletal muscle of the aged mice was increased markedly relative to that of its younger counterparts. However, both the CMIT and HIIT groups showed a significant reduction in skeletal muscle fibrosis compared to the Con group. Although the degree of fibrosis was lower in the HIIT group than in the CMIT group, the disparity did not reach statistical significance (Figure 1c and e). The transmission electron microscopy (TEM) analysis of Con group showed swollen mitochondria with disrupted crista and decreased electron density, as well as increased lipid droplets around mitochondria. In contrast, the mitochondrial structure of CMIT and HIIT groups displayed significantly improved mitochondrial structure, with noticeable mitochondrial aggregation compared to the Con group (Figure 1c).

3.2 Impact of late-in-life exercise on expression of PGC-1a via DNA methylation regulation

The mRNA and protein levels of PGC-1α in skeletal muscle of mice from the Con group were significantly lower than those in the Young group. Conversely, both the CMIT and HIIT groups exhibited a notable increase of the mRNA and protein levels of PGC-1α in the skeletal muscle compared to the Con group. Although the PGC-1α mRNA expression in the skeletal muscle of mice in the HIIT group surpassed that of the CMIT group significantly, there was no significant variance in PGC-1α protein expression between the two groups (Figure 2a and b). IHC analysis of the mouse skeletal muscle confirmed the heightened protein levels of PGC-1α in the CMIT and HIIT groups (Figure 2c).

Figure 2 Impact of late-in-life exercise on expression of PGC-1α via DNA methylation regulation. (a) Western blot for protein levels of PGC-1α in mouse skeletal muscle. Representative images are shown on the left; quantitative data for the PGC-1α protein level are shown on the right. (b) PGC-1α mRNA relative expression. (c) IHC staining of PGC-1α in mouse skeletal muscle tissue. Representative images (red arrow is PGC-1α-positive staining area) are shown on the left; quantitative data are shown on the right. Scale bars = 100 μm. (d) Prediction of CpG islands of PGC-1α promoter (−2,000–0) in mouse skeletal muscle. (e) The MSP method was applied to examine the methylation status of PGC-1α promoter in mouse skeletal muscle. Representative agarose gel analyses of MSP products are shown on the left; quantitative data are shown on the right. (f) Western blot for protein levels of DNMT family (DNMT1, DNMT3A, and DNMT3B) in mouse skeletal muscle. (g) Relative quantitative expression of DNMT proteins. *P < 0.05, **P < 0.01, ns represents no significant difference. DNMT: DNA methyltransferase.

CpG islands situated in the promoter region are prone to methylation alterations, which diminish transcription factor binding and consequently affect gene expression [17]. To investigate the reason for high PGC-1α expression in the CMIT and HIIT groups, we determined the presence of CpG islands within the PGC-1α promoter sequence using the MethPrimer software. Three CpG islands (CpG1-3) were found in the promoter region of the mouse PGC-1α gene, and the current MSP primers were designed targeting CpG1-2 (−1,377−1,835 bp) (Figure 2d). The MSP method was applied to assess the methylation status of specific position in the PGC-1α promoter. The results revealed an elevation in PGC-1α promoter methylation in skeletal muscle tissues of mice in the Con group relative to the Young group. The methylation level of the PGC-1α promoter in skeletal muscle tissues of mice in both CMIT and HIIT groups exhibited a noteworthy decline compared to the Con group, with no statistically significant disparity between the CMIT and HIIT groups (Figure 2e).

Given that DNA methylation is mediated by its key enzyme DNMT, we subsequently detected the protein expressions of DNMT family, including DNMT1, DNMT3A, and DNMT3B in skeletal muscle tissues. The research observed increased expression of DNMT1, DNMT3A, and DNMT3B proteins in the skeletal muscle tissues of mice in the Con group in comparison to the Young group. However, these protein alterations were reversed in both groups of aged mice following different exercise training interventions, and there were no statistically significant differences in the expression levels of DNMT proteins between the CMIT and HIIT groups (Figure 2f and g).

3.3 Impact of late-in-life exercise on mitochondrial biogenesis and energy metabolism

To further investigate the impact of increased PGC-1α expression on mitochondrial function during late-in-life exercise, the research measured the expression levels of protein related to mitochondrial biogenesis (NRF1, TFAM, and ERR) and energy metabolism (AMPK, GLUT4, and CPT1B) in skeletal muscle tissues of mice. It was found that the protein levels of NRF1, TFAM, ERR, AMPK, GLUT4, and CPT1B in skeletal muscle tissues of mice in the Con group were lower in comparison to those in the Young group. Conversely, CMIT and HIIT groups showed elevated expression levels of these proteins compared to the Con group. The levels of mitochondrial biogenesis and energy metabolism-related proteins were not statistically different between the CMIT and HIIT groups (Figure 3a, b, d, and e). Subsequently, mt DNA was detected. The skeletal muscle mt DNA content of mice in the Con group decreased compared to the Young group; conversely, it increased in both the CMIT and HIIT groups compared to the Con group. Remarkably, the skeletal muscle mt DNA content of mice in the HIIT group surpassed that of the CMIT group significantly (Figure 3c).

Figure 3 Impact of late-in-life exercise on mitochondrial biogenesis and energy metabolism. (a) Western blot for protein levels of NRF1, TFAM, and ERR in mouse skeletal muscle. (b) Western blot for protein levels of AMPK, GLUT4, and CPT1B in mouse skeletal muscle. (c) mt DNA content of mouse skeletal muscle. (d) Relative quantification of mitochondrial biogenesis-related proteins. (e) Relative quantification of energy metabolism-related proteins. *P < 0.05, **P < 0.01, ns represents no significant difference.

4 Discussion

In this research, we observed that late-in-life exercise can ameliorate aging-related morphological changes in skeletal muscle and enhance skeletal muscle function, which may be associated with its effect on PGC-1α expression via PGC-1α promoter methylation regulation. In addition, exercise-training intervention reversed the mitochondria structural abnormalities of skeletal muscle in aged mice and significantly increased the expression levels of proteins related to mitochondrial biogenesis and energy metabolism. There seemed no clear difference between HIIT and CMIT in PGC-1α expression and skeletal muscle function.

PGC-1α has attracted considerable attention as a pivotal regulator of mitochondrial function, playing a central role in maintaining normal energy metabolism and mitochondria homeostasis in skeletal muscle. Previous studies have shown age-related decreases in PGC-1α protein content along with decreased numbers and impaired function of mitochondria in skeletal muscle in rats, mice, and humans [18–20], which were also observed in our study.

Barrès et al. [21] provided a systematic study about methylation of PGC-1α in skeletal muscle from patients with diabetes. They used whole-genome promoter methylation to identify hypermethylation of PGC-1α. They also reported DNMT3B rather than DNMT1 or DNMT3A related to fatty-acid-induced methylation of PGC-1α promoter. Our results were generally consistent with previous findings in human being that both acute [15] and chronic [22] exercise altered the promoter methylation of PGC-1α. When exploring the potential cause, we found a global decrease of DNMT family, which was different with Romain’s finding. However, the current result was partly in line with other studies where exercise has been shown to repress DNMT expression levels in human plasma and in human and mouse femurs [23–26]. Although our finding led to a hypothesis that exercise training could ameliorate aging-related muscle loss by reducing PGC-1α promoter methylation and enhancing PGC-1α expression, the expression of DNMTs were still far from to conclude the causality of methylation. And we also had to consider enzymatic activity and other regulators’ expression, such as ten-eleven translocation enzymes, when interpreting the mechanism.

Numerous studies have demonstrated that PGC-1α in skeletal muscle enhances skeletal muscle mitochondrial biogenesis and energy metabolism as well as improves mitochondrial structure and function [27–30]. In this study, we detected the expression levels of proteins related to these processes, alongside assessing mitochondrial structure in all groups of mice. The current findings suggested that late-in-life exercise upregulated expression of protein crucial for mitochondrial biogenesis and energy metabolism, improved mitochondrial ultrastructure and increased mt DNA content in aged mouse skeletal muscle, potentially linked to increased PGC-1α expression. This is consistent with existing study results [18,31], indicating that exercise-induced improvement of skeletal muscle mitochondria in aged mice is partially reliant on increased content of skeletal muscle PGC-1α.

Herein, we employed two common exercise modalities, CMIT and HIIT, to investigate their effects on PGC-1α expression and methylation levels in skeletal muscle of aged mice. Although some studies have indicated the potential superiority of HIIT over CMIT in improving skeletal muscle mitochondrial quantity, mitochondrial adaptability, and oxidative capacity [32–34], our study merely observed significant differences in skeletal muscle average CSA and mt DNA content between CMIT and HIIT. Moreover, we found no notable distinctions between the two exercise modalities in terms of PGC-1α expression, mitochondria mobilization, and improvement of skeletal muscle morphology and function in old age. Thus, currently we did not recommend specific exercise type over another in older adults.

The present study has several limitations. It was a preliminary exploration of the role of PGC-1α methylation in mitigating muscle loss in aged mice through exercise, yet it does not directly elucidate the causal relationship and exact mechanism of altered PGC-1α methylation on exercise-driven skeletal muscular alterations in old age. In addition, the study did not explore the possible effects of other epigenetic modifications on PGC-1α transcription, such as histone modification and non-coding RNA, nor did it explore the effects of exercise on fat content, or on other organ function. Therefore, it cannot be concluded that HIIT and CMIT have similar effects in all aspects in old age.

5 Conclusion

Late-in-life exercise improves skeletal muscle function and morphology, reverses the mitochondria structural abnormalities of skeletal muscle in aged mice, and affects the expression levels of proteins related to mitochondrial biogenesis and energy metabolism, which may be linked to its effect on hypomethylation in promoters of PGC-1a and elevated protein and mRNA expression of PGC-1α. Notably, there was no clear difference between HIIT and CMIT in PGC-1α expression and skeletal muscle function.

Acknowledgements

The authors are grateful to Geriatric Center Construction Program of Fujian Provincial Medical Creating Double-high Project, Fujian Provincial Key Laboratory of Geriatric Disease Construction Project, and Research Project on Exercise to Improve Frailty in Older Adults.

Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals, and has been approved by the Experimental Animal Ethics Committee of Fujian Medical University (No. 2021-0363).

Funding information: This research was supported by Fujian Provincial health technology project of youth (grant number: 2020QNA001), Major Scientific Research Special Project (grant number: 2022ZD01006) from Fujian Health Committee, Startup Fund for Scientific Research from Fujian Medical University (grant number: 2020QH1143), Fujian Provincial Science and Technology Innovation Joint Fund Project (grant number: 2023Y9276) and Fujian Natural Science Foundation (grant numbers: 2021J01358, 2020J02058) from Fujian Provincial Department of Science and Technology.

Author contributions: Q.W.L. and P.L.Z. designed this study; Q.W.L. and Q.L. wrote the manuscript; Q.W.L., Q.L., and Z.L. carried out the experiment and analyzed the data; W.W.L. aided in establishing exercise model and interpreting the results; F.H. and P.L.Z. supervised the project. All authors contributed to reviewing the manuscript and approved the final manuscript.

Conflict of interest: Authors state no conflict of interest.

Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
==== Refs
References

[1] Najm A, Niculescu AG, Grumezescu AM, Beuran M. Emerging therapeutic strategies in sarcopenia: an updated review on pathogenesis and treatment advances. Int J Mol Sci. 2024;25(8):4300.
Najm A Niculescu AG Grumezescu AM Beuran M Emerging therapeutic strategies in sarcopenia: an updated review on pathogenesis and treatment advances Int J Mol Sci 2024 25 8 4300 38673885
[2] Shen Y, Shi Q, Nong K, Li S, Yue J, Huang J, et al. Exercise for sarcopenia in older people: a systematic review and network meta-analysis. J Cachexia Sarcopenia Muscle. 2023;14(3):1199–211.
Shen Y Shi Q Nong K Li S Yue J Huang J Exercise for sarcopenia in older people: a systematic review and network meta-analysis J Cachexia Sarcopenia Muscle 2023 14 3 1199 211 37057640
[3] Sánchez-Sánchez JL, He L, Morales JS, de Souto Barreto P, Jiménez-Pavón D, Carbonell-Baeza A, et al. Association of physical behaviours with sarcopenia in older adults: a systematic review and meta-analysis of observational studies. Lancet Healthy Longev. 2024;5(2):e108–19.
Sánchez-Sánchez JL He L Morales JS de Souto Barreto P Jiménez-Pavón D Carbonell-Baeza A Association of physical behaviours with sarcopenia in older adults: a systematic review and meta-analysis of observational studies Lancet Healthy Longev 2024 5 2 e108 19 38310891
[4] Negm AM, Lee J, Hamidian R, Jones CA, Khadaroo RG. Management of sarcopenia: a network meta-analysis of randomized controlled trials. J Am Med Dir Assoc. 2022;23(5):707–14.
Negm AM Lee J Hamidian R Jones CA Khadaroo RG Management of sarcopenia: a network meta-analysis of randomized controlled trials J Am Med Dir Assoc 2022 23 5 707 14 35183490
[5] Qin Y, Kumar Bundhun P, Yuan ZL, Chen MH. The effect of high-intensity interval training on exercise capacity in post-myocardial infarction patients: a systematic review and meta-analysis. Eur J Prev Cardiol. 2022;29(3):475–84.
Qin Y Kumar Bundhun P Yuan ZL Chen MH The effect of high-intensity interval training on exercise capacity in post-myocardial infarction patients: a systematic review and meta-analysis Eur J Prev Cardiol 2022 29 3 475 84 34279621
[6] Liang W, Liu C, Yan X, Hou Y, Yang G, Dai J, et al. The impact of sprint interval training versus moderate intensity continuous training on blood pressure and cardiorespiratory health in adults: a systematic review and meta-analysis. PeerJ. 2024;12:e17064.
Liang W Liu C Yan X Hou Y Yang G Dai J The impact of sprint interval training versus moderate intensity continuous training on blood pressure and cardiorespiratory health in adults: a systematic review and meta-analysis PeerJ 2024 12 e17064 38495758
[7] Haupt S, Niedrist T, Sourij H, Schwarzinger S, Moser O. The impact of exercise on telomere length, DNA methylation and metabolic footprints. Cells. 2022;11(1):153.
Haupt S Niedrist T Sourij H Schwarzinger S Moser O The impact of exercise on telomere length, DNA methylation and metabolic footprints Cells 2022 11 1 153 35011715
[8] Wang K, Liu H, Hu Q, Wang L, Liu J, Zheng Z, et al. Epigenetic regulation of aging: implications for interventions of aging and diseases. Signal Transduct Target Ther. 2022;7(1):374.
Wang K Liu H Hu Q Wang L Liu J Zheng Z Epigenetic regulation of aging: implications for interventions of aging and diseases Signal Transduct Target Ther 2022 7 1 374 36336680
[9] Seaborne RA, Strauss J, Cocks M, Shepherd S, O’Brien TD, Someren KAV, et al. Methylome of human skeletal muscle after acute & chronic resistance exercise training, detraining & retraining. Sci Data. 2018;5:180213.
Seaborne RA Strauss J Cocks M Shepherd S O’Brien TD Someren KAV Methylome of human skeletal muscle after acute & chronic resistance exercise training, detraining & retraining Sci Data 2018 5 180213 30375987
[10] Jacques M, Landen S, Romero JA, Hiam D, Schittenhelm RB, Hanchapola I, et al. Methylome and proteome integration in human skeletal muscle uncover group and individual responses to high-intensity interval training. Faseb J. 2023;37(10):e23184.
Jacques M Landen S Romero JA Hiam D Schittenhelm RB Hanchapola I Methylome and proteome integration in human skeletal muscle uncover group and individual responses to high-intensity interval training Faseb J 2023 37 10 e23184 37698381
[11] Bellanti F, Lo Buglio A, Vendemiale G. Mitochondrial impairment in Sarcopenia. Biology (Basel). 2021;10(1):31–47.
Bellanti F Lo Buglio A Vendemiale G Mitochondrial impairment in Sarcopenia Biology (Basel) 2021 10 1 31 47 33418869
[12] Kubat GB, Bouhamida E, Ulger O, Turkel I, Pedriali G, Ramaccini D, et al. Mitochondrial dysfunction and skeletal muscle atrophy: causes, mechanisms, and treatment strategies. Mitochondrion. 2023;72:33–58.
Kubat GB Bouhamida E Ulger O Turkel I Pedriali G Ramaccini D Mitochondrial dysfunction and skeletal muscle atrophy: causes, mechanisms, and treatment strategies Mitochondrion 2023 72 33 58 37451353
[13] Bajpeyi S, Covington JD, Taylor EM, Stewart LK, Galgani JE, Henagan TM. Skeletal muscle PGC1α-1 nucleosome position and -260 nt DNA methylation determine exercise response and prevent ectopic lipid accumulation in men. Endocrinology. 2017;158(7):2190–9.
Bajpeyi S Covington JD Taylor EM Stewart LK Galgani JE Henagan TM Skeletal muscle PGC1α-1 nucleosome position and -260 nt DNA methylation determine exercise response and prevent ectopic lipid accumulation in men Endocrinology 2017 158 7 2190 9 28398573
[14] Petrie MA, Sharma A, Taylor EB, Suneja M, Shields RK. Impact of short- and long-term electrically induced muscle exercise on gene signaling pathways, gene expression, and PGC1a methylation in men with spinal cord injury. Physiol Genomics. 2020;52(2):71–80.
Petrie MA Sharma A Taylor EB Suneja M Shields RK Impact of short- and long-term electrically induced muscle exercise on gene signaling pathways, gene expression, and PGC1a methylation in men with spinal cord injury Physiol Genomics 2020 52 2 71 80 31869286
[15] Barrès R, Yan J, Egan B, Treebak JT, Rasmussen M, Fritz T, et al. Acute exercise remodels promoter methylation in human skeletal muscle. Cell Metab. 2012;15(3):405–11.
Barrès R Yan J Egan B Treebak JT Rasmussen M Fritz T Acute exercise remodels promoter methylation in human skeletal muscle Cell Metab 2012 15 3 405 11 22405075
[16] Otsuka Y, Yamada Y, Maeda A, Izumo T, Rogi T, Shibata H, et al. Effects of resistance training intensity on muscle quantity/quality in middle-aged and older people: a randomized controlled trial. J Cachexia Sarcopenia Muscle. 2022;13(2):894–908.
Otsuka Y Yamada Y Maeda A Izumo T Rogi T Shibata H Effects of resistance training intensity on muscle quantity/quality in middle-aged and older people: a randomized controlled trial J Cachexia Sarcopenia Muscle 2022 13 2 894 908 35187867
[17] Marchal C, Defossez PA, Miotto B. Context-dependent CpG methylation directs cell-specific binding of transcription factor ZBTB38. Epigenetics. 2022;17(13):2122–43.
Marchal C Defossez PA Miotto B Context-dependent CpG methylation directs cell-specific binding of transcription factor ZBTB38 Epigenetics 2022 17 13 2122 43 36000449
[18] Carter HN, Pauly M, Tryon LD, Hood DA. Effect of contractile activity on PGC-1α transcription in young and aged skeletal muscle. J Appl Physiol (1985). 2018;124(6):1605–15.
Carter HN Pauly M Tryon LD Hood DA Effect of contractile activity on PGC-1α transcription in young and aged skeletal muscle J Appl Physiol (1985) 2018 124 6 1605 15 29543139
[19] de Smalen LM, Börsch A, Leuchtmann AB, Gill JF, Ritz D, Zavolan M, et al. Impaired age-associated mitochondrial translation is mitigated by exercise and PGC-1α. Proc Natl Acad Sci U S A. 2023;120(36):e2302360120.
de Smalen LM Börsch A Leuchtmann AB Gill JF Ritz D Zavolan M Impaired age-associated mitochondrial translation is mitigated by exercise and PGC-1α Proc Natl Acad Sci U S A 2023 120 36 e2302360120 37639610
[20] Neto IVS, Pinto AP, Muñoz VR, de Cássia Marqueti R, Pauli JR, Ropelle ER, et al. Pleiotropic and multi-systemic actions of physical exercise on PGC-1α signaling during the aging process. Ageing Res Rev. 2023;87:101935.
Neto IVS Pinto AP Muñoz VR de Cássia Marqueti R Pauli JR Ropelle ER Pleiotropic and multi-systemic actions of physical exercise on PGC-1α signaling during the aging process Ageing Res Rev 2023 87 101935 37062444
[21] Barrès R, Osler ME, Yan J, Rune A, Fritz T, Caidahl K, et al. Non-CpG methylation of the PGC-1alpha promoter through DNMT3B controls mitochondrial density. Cell Metab. 2009;10(3):189–98.
Barrès R Osler ME Yan J Rune A Fritz T Caidahl K Non-CpG methylation of the PGC-1alpha promoter through DNMT3B controls mitochondrial density Cell Metab 2009 10 3 189 98 19723495
[22] Krammer UDB, Sommer A, Tschida S, Mayer A, Lilja SV, Switzeny OJ, et al. PGC-1α methylation, miR-23a, and miR-30e expression as biomarkers for exercise- and diet-induced mitochondrial biogenesis in capillary blood from healthy individuals: a single-arm intervention. Sports (Basel). 2022;10(5):73.
Krammer UDB Sommer A Tschida S Mayer A Lilja SV Switzeny OJ PGC-1α methylation, miR-23a, and miR-30e expression as biomarkers for exercise- and diet-induced mitochondrial biogenesis in capillary blood from healthy individuals: a single-arm intervention Sports (Basel) 2022 10 5 73 35622482
[23] Chen X, Zhu X, Wei A, Chen F, Gao Q, Lu K, et al. Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. Bone Res. 2021;9(1):15.
Chen X Zhu X Wei A Chen F Gao Q Lu K Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis Bone Res 2021 9 1 15 33637693
[24] Hunter DJ, James L, Hussey B, Wadley AJ, Lindley MR, Mastana SS. Impact of aerobic exercise and fatty acid supplementation on global and gene-specific DNA methylation. Epigenetics. 2019;14(3):294–309.
Hunter DJ James L Hussey B Wadley AJ Lindley MR Mastana SS Impact of aerobic exercise and fatty acid supplementation on global and gene-specific DNA methylation Epigenetics 2019 14 3 294 309 30764736
[25] Horsburgh S, Todryk S, Toms C, Moran CN, Ansley L. Exercise-conditioned plasma attenuates nuclear concentrations of DNA methyltransferase 3B in human peripheral blood mononuclear cells. Physiol Rep. 2015;3(12):e12621.
Horsburgh S Todryk S Toms C Moran CN Ansley L Exercise-conditioned plasma attenuates nuclear concentrations of DNA methyltransferase 3B in human peripheral blood mononuclear cells Physiol Rep 2015 3 12 e12621 26660547
[26] Murach KA, Dimet-Wiley AL, Wen Y, Brightwell CR, Latham CM, Dungan CM, et al. Late-life exercise mitigates skeletal muscle epigenetic aging. Aging Cell. 2022;21(1):e13527.
Murach KA Dimet-Wiley AL Wen Y Brightwell CR Latham CM Dungan CM Late-life exercise mitigates skeletal muscle epigenetic aging Aging Cell 2022 21 1 e13527 34932867
[27] Kong S, Cai B, Nie Q. PGC-1α affects skeletal muscle and adipose tissue development by regulating mitochondrial biogenesis. Mol Genet Genomics. 2022;297(3):621–33.
Kong S Cai B Nie Q PGC-1α affects skeletal muscle and adipose tissue development by regulating mitochondrial biogenesis Mol Genet Genomics 2022 297 3 621 33 35290519
[28] Slavin MB, Memme JM, Oliveira AN, Moradi N, Hood DA. Regulatory networks coordinating mitochondrial quality control in skeletal muscle. Am J Physiol Cell Physiol. 2022;322(5):C913–26.
Slavin MB Memme JM Oliveira AN Moradi N Hood DA Regulatory networks coordinating mitochondrial quality control in skeletal muscle Am J Physiol Cell Physiol 2022 322 5 C913 26 35353634
[29] Mihaylov SR, Castelli LM, Lin YH, Gül A, Soni N, Hastings C, et al. The master energy homeostasis regulator PGC-1α exhibits an mRNA nuclear export function. Nat Commun. 2023;14(1):5496.
Mihaylov SR Castelli LM Lin YH Gül A Soni N Hastings C The master energy homeostasis regulator PGC-1α exhibits an mRNA nuclear export function Nat Commun 2023 14 1 5496 37679383
[30] Panajatovic MV, Singh F, Krähenbühl S, Bouitbir J. Effects of simvastatin on lipid metabolism in wild-type mice and mice with muscle PGC-1α overexpression. Int J Mol Sci. 2021;22(9):4950–65.
Panajatovic MV Singh F Krähenbühl S Bouitbir J Effects of simvastatin on lipid metabolism in wild-type mice and mice with muscle PGC-1α overexpression Int J Mol Sci 2021 22 9 4950 65 34066911
[31] Bouviere J, Fortunato RS, Dupuy C, Werneck-de-Castro JP, Carvalho DP, Louzada RA. Exercise-stimulated ROS sensitive signaling pathways in skeletal muscle. Antioxidants (Basel). 2021;10(4):537–58.
Bouviere J Fortunato RS Dupuy C Werneck-de-Castro JP Carvalho DP Louzada RA Exercise-stimulated ROS sensitive signaling pathways in skeletal muscle Antioxidants (Basel) 2021 10 4 537 58 33808211
[32] MacInnis MJ, Zacharewicz E, Martin BJ, Haikalis ME, Skelly LE, Tarnopolsky MA, et al. Superior mitochondrial adaptations in human skeletal muscle after interval compared to continuous single-leg cycling matched for total work. J Physiol. 2017;595(9):2955–68.
MacInnis MJ Zacharewicz E Martin BJ Haikalis ME Skelly LE Tarnopolsky MA Superior mitochondrial adaptations in human skeletal muscle after interval compared to continuous single-leg cycling matched for total work J Physiol 2017 595 9 2955 68 27396440
[33] Daussin FN, Zoll J, Dufour SP, Ponsot E, Lonsdorfer-Wolf E, Doutreleau S, et al. Effect of interval versus continuous training on cardiorespiratory and mitochondrial functions: relationship to aerobic performance improvements in sedentary subjects. Am J Physiol Regul Integr Comp Physiol. 2008;295(1):R264–72.
Daussin FN Zoll J Dufour SP Ponsot E Lonsdorfer-Wolf E Doutreleau S Effect of interval versus continuous training on cardiorespiratory and mitochondrial functions: relationship to aerobic performance improvements in sedentary subjects Am J Physiol Regul Integr Comp Physiol 2008 295 1 R264 72 18417645
[34] Larsen RG, Befroy DE, Kent-Braun JA. High-intensity interval training increases in vivo oxidative capacity with no effect on P(i) → ATP rate in resting human muscle. Am J Physiol Regul Integr Comp Physiol. 2013;304(5):R333–42.
Larsen RG Befroy DE Kent-Braun JA. High-intensity interval training increases in vivo oxidative capacity with no effect on P(i) → ATP rate in resting human muscle Am J Physiol Regul Integr Comp Physiol 2013 304 5 R333 42 23255590
