
==== Front
J Assist Reprod Genet
J Assist Reprod Genet
Journal of Assisted Reproduction and Genetics
1058-0468
1573-7330
Springer US New York

39017772
3202
10.1007/s10815-024-03202-w
Genetics
Male infertility is associated with differential DNA methylation signatures of the imprinted gene GNAS and the non-imprinted gene CEP41
http://orcid.org/0000-0002-6413-1988
Ozkocer Suheyla Esra 12
http://orcid.org/0000-0002-8098-2483
Guler Ismail 3
http://orcid.org/0000-0002-3204-7562
Ugras Dikmen Asiye 4
http://orcid.org/0000-0002-1107-9629
Bozkurt Nuray 3
http://orcid.org/0000-0002-5002-943X
Varol Nuray 5
http://orcid.org/0000-0001-5129-2515
Konac Ece ecemercanoglu@yahoo.com

15
1 https://ror.org/054xkpr46 grid.25769.3f 0000 0001 2169 7132 Department of Medical Biology and Genetics, Institute of Health Sciences, Gazi University, Kavaklıdere Çankaya, 06540 Ankara, Turkey
2 https://ror.org/054xkpr46 grid.25769.3f 0000 0001 2169 7132 Department of Histology and Embryology, Faculty of Medicine, Gazi University, Besevler, 06500 Ankara, Turkey
3 https://ror.org/054xkpr46 grid.25769.3f 0000 0001 2169 7132 Department of Obstetrics and Gynecology, Faculty of Medicine, Gazi University, Besevler, 06500 Ankara, Turkey
4 https://ror.org/054xkpr46 grid.25769.3f 0000 0001 2169 7132 Department of Public Health, Faculty of Medicine, Gazi University, Besevler, 06500 Ankara Turkey
5 https://ror.org/054xkpr46 grid.25769.3f 0000 0001 2169 7132 Department of Medical Biology, Faculty of Medicine, Gazi University, Besevler, 06500 Ankara, Turkey
17 7 2024
17 7 2024
9 2024
41 9 22892300
14 5 2024
8 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Purpose

To investigate whether the DNA methylation profiles of GNAS(20q13.32), MEST(7q32.2), MESTIT1(7q32.2), IGF2(11p15.5), H19 (7q32.2), and CEP41(7q32.2) genes are related to the transcriptomic and epigenomic etiology of male infertility.

Methods

The DNA methylation levels of spermatozoa were obtained from fertile (n = 30), oligozoospermic (n = 30), and men with normal sperm count (n = 30). The methylation status of each CpG site was categorized as hypermethylated or hypomethylated. Expression levels of target gene transcripts were determined using real-time PCR.

Results

The oligozoospermia showed a higher frequency of hypermethylation at GNASAS 1st, 3rd, and 5th CpG dinucleotides (66.7%, 73.3%, 73.3%) compared to the fertile group (33.3%, 33.3%, 40%, respectively). The normal sperm count exhibited a higher frequency of hypermethylation at the 3rd CpG of CEP41 (46.7%) than the fertile group (16.7%). Normal sperm count was predicted by CEP41 hypermethylation (OR = 1.750, 95%CI 1.038–2.950) and hypermethylation of both CEP41 and GNASAS (OR = 2.389, 95%CI 1.137–5.021). Oligozoospermia was predicted solely by GNASAS hypermethylation (OR = 2.460, 95%CI 1.315–4.603). In sperms with decreased IGF2 expression in the fertile group, we observed hypomethylation in the 2nd CpG of IGF2 antisense (IFG2AS), and hypermethylation in the 1st, 2nd, and 4th CpGs of H19. No significant relationship was found between IGF2 expression and methylation status of IGF2AS and H19 in infertile groups.

Conclusion

The disappearance of the relationship between IGF2 expression and IGF2AS and H19 methylations in the infertile group provides new information regarding the disruption of epigenetic programming during spermatogenesis. A better understanding of sperm GNASAS and CEP41 hypermethylation could advance innovative diagnostic markers for male infertility.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10815-024-03202-w.

Keywords

CEP41
DNA methylation
Epigenetic
Expression levels
GNASAS
Male infertility
http://dx.doi.org/10.13039/501100003356 Gazi Üniversitesi TDK-2021-7023 Konac Ece Gazi UniversityOpen access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK).

issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Infertility is the problem of a couple who cannot achieve pregnancy after unprotected sexual intercourse [1]. Male infertility prevalence can differ over time and contributes to almost half of the cases [2]. Semen analysis is the initial test to evaluate male infertility, with the World Health Organization (WHO) establishing the 5th percentile values of the population as limits for parameters like sperm count, motility, and morphology. Poor semen parameters are categorized based on conditions such as oligozoospermia (low sperm count), teratozoospermia (abnormal morphology), and asthenozoospermia (low sperm motility). While poor semen parameters indicate reduced chances of spontaneous pregnancy, normal values do not exclude infertility. Oligozoospermia indicates sperm concentrations lower than the WHO’s criteria; normozoospermia means the values are within normal limits [3]. Since over one-third of male infertility cases are idiopathic [2], genetic and epigenetic factors have the potential to identify underlying causes [4, 5].

Assisted reproductive techniques (ART) help couples to have healthy children by mimicking physiological events. As intracytoplasmic sperm injection (ICSI) has been widely practiced among ARTs, sperm selection has become more relevant [6]. Sperm selection for intracytoplasmic sperm injection (ICSI) based on morphology and motility needs to be improved to increase ART’s success rate [7]. Since the genome and epigenome of spermatozoa are transmitted to the embryo, their impact on the embryo’s health is a topic of debate. Y chromosome microdeletions, aneuploidy, decreased protamination, and DNA methylome abnormalities can decrease embryo quality. Poor embryo quality decreases ART success rates and causes comorbidities among ART babies. Therefore, identifying molecular markers for sperm selection could increase ART success while reducing comorbidities [8].

Epigenetic modifications during testicular differentiation and spermatogenesis regulate sperm function and male fertility [9]. Primordial germ cells (PGC) are differentiated during testicular development. After puberty, spermatogenesis occurs, and spermatogonia starts a series of mitotic and meiotic divisions to give rise to spermatozoa. Sperm maturation in epididymis and capacitation in female genital tracts facilitate sperm function. All of these have an impact on the sperm epigenome [10, 11]. The alterations of sperm epigenome are related to the number, structure, and function of the sperm. Therefore, clinical research focuses on epigenetic alterations of the sperm and their relations with male infertility to develop personalized treatments [12, 13].

DNA methylation is a well-established epigenetic modification. DNA methyl transferases add a methyl group (-CH3) to the fifth carbon of cytosine. DNA methylation of the promoter inhibits gene expression [14, 15]. Genomic imprinting is the monoallelic gene expression from paternal or maternal chromosomes. Differentially methylated regions of the paternally imprinted gene are highly methylated on paternal chromosomes, and the maternal allele is used for gene expression [9, 16]. H19 is a paternally imprinted gene transcribed to the long noncoding RNA (lncRNA). When the imprinting control region (ICR) of H19 is methylated on the paternal chromosome, H19 cannot be expressed. However, the same ICR methylation allows IGF2 expression, a paternally expressed gene [17–19]. H19/IGF2 methylation reduction is observed in the sperm of individuals with oligozoospermia and recurrent pregnancy loss. IGF2 antisense (IFG2AS) is a lncRNA which is paternally expressed. Promotor methylation of IGF2AS at placental villi is associated with early pregnancy loss (EPL) [20]. A meta-analysis showed that sperm’s H19 differently methylated region (DMR) methylation levels were significantly lower in infertile than fertile males. Conversely, MEST methylation was significantly higher in the infertile [21]. Despite the heterogeneity among the studies, MEST and H19 have become the most prominent candidates for evaluating male infertility. During spermatogenesis, the methylation patterns of paternal and maternal imprinting genes change among spermatogenic cells. H19 methylation appears in adult spermatogonia and is maintained in spermatozoa. MEST is a paternally expressed gene, is demethylated during fetal spermatogonia, and remains demethylated in spermatozoa [22]. MESTIT1, an intronic transcript of MEST, is an antisense RNA and also a paternally expressed gene. MESTIT1 is an antisense RNA and a paternally expressed gene. Since MESTIT1 is highly expressed in the testis and sperm, it is believed that it can have a regulatory function for fertility [23, 24]. Testis-specific gene A14 (TSGA14) and MEST are 7q autism susceptibility locus genes. Epigenetic modifications of the 7q locus are suggested to play a role in the etiopathogenesis of autism spectrum disorder [25]. TSGA14 is not an imprinted gene [26] and is expressed into centrosomal protein 41 (CEP41). CEP41 is found in primary cilia, and its mutations are associated with the ciliopathy syndromes [27]. Although CEP41 is highly expressed in human testis [26], the association with male infertility remains unknown. Another imprinted gene locus is GNAS, which contains multiple genes. XLαs, A/B, and GNAS antisense 1 (GNASAS1) are paternally expressed genes, but NESP55 is maternally expressed from the GNAS locus. Although the impact of methylation of these genes on male infertility remains unclear, it was shown that ARTs affect the methylation of these genes in children [28–31].

Epigenetic changes in spermatozoa have an impact on fertilization and beyond. DNA methylation and transcripts of spermatozoa are part of epigenetic modifications [32, 33]. Methylation anomalies of the H19, IGF2, GNAS, GNASAS, and MEST imprinted genes have not previously been associated with male infertility based on transcriptome data. While MESTIT1 and the non-imprinted gene CEP41 are highly expressed in the testis, their effects on male fertility are still not fully understood. This study aims to evaluate how DNA methylation changes in CEP41, MEST, MESTIT1, H19, IGF2AS, and GNASAS of spermatozoa impact transcripts and male fertility.

Materials and methods

Study design

The study was conducted with the approval of the Gazi University Clinical Research Ethics Committee (25/02/2021, 04). Thirty males who had spontaneously impregnated spouses within 2 years were recruited to the fertile group. Sixty infertile males admitted to the Gazi University Hospital Assisted Reproductive Techniques Centre were divided into two groups based on sperm count: oligozoospermic (n = 30) and normal sperm count (n = 30). After assessing the total sperm count in infertile men, those with a total sperm count below 39 million were classified into the oligozoospermia group, while those with a count of 39 million or above were included in the normal sperm count group. Known male infertility etiologies, such as karyotype anomalies, hypogonadism, infections, testicular surgery, and irradiation, were exclusion criteria for both groups. After collecting demographic data, semen samples from the volunteers were used for semen analysis and further evaluations.

Semen analysis and sperm isolation

Semen analysis was conducted according to the WHO guidelines [34]. Semen volume, sperm concentration, and motility were evaluated. Sperm morphology was assessed with Spermac stain [35]. Sperm concentrations were adjusted to less than 10 million/ml. The seminal plasma was discarded after centrifugation for 15 min at 2000 g. The pellet was then mixed with 1 ml PBS and centrifuged at 1600 g for 10 min. Subsequently, the pellet was incubated with SCLB (0.5% TritonX-100 in 0.1% SDS) for 30 min on ice. After centrifugation for 15 min at 1600 g, the supernatant was discarded. The pellet was rinsed with PBS before being separated into two for RNA and DNA extraction [36].

Gene expression analysis

RNA extraction was conducted using TRIzol (Invitrogen, Thermo Fisher Scientific, MA, USA) according to the manufacturer’s protocol [37]. Sperm were mixed with 1 ml TRIzol and incubated at room temperature for 5 min. Subsequently, 200 μl chloroform was added and vortexed for 15 s. The mixture was allowed to rest for 2 min at room temperature and then centrifuged at 12, 000 g at + 4 °C for 15 min. The upper clear phase was transferred to the new tube. After adding 0.5 ml of isopropanol, the mixture was incubated overnight at − 20 °C. Centrifugation at 12,000 g was performed at + 4 °C for 10 min. After discarding the supernatant, 1 ml of 75% ethanol was added to the pellet and mixed by pipetting. The mixture was centrifuged at 7500 g at + 4 °C for 5 min. Following ethanol removal, the pellet was air-dried for 5 min. Finally, the RNA was dissolved in DEPC water. Qualification and quantification of RNA were conducted using the NanoDrop (Thermo Fisher Scientific, MA, USA).

To synthesize cDNA, the SensiFAST™ cDNA Synthesis Kit (Bioline, UK) was used. Up to 1 μg of RNA was mixed with 4 μl of TransAmp buffer and 1 μl of reverse transcriptase for each reaction. The mixture was then brought to a total volume of 20 μl with nuclease-free water. The synthesis occurred in three steps: 10 min at 25 °C for primer annealing, 15 min at 42 °C for reverse transcription, and 5 min at 85 °C for enzyme inactivation. Real-time PCR was performed using SensiFAST™ SYBR No-ROX Kit (Bioline, UK). For each reaction, 5 μl cDNA, 5 μl forward and reverse primers, and 10 μl of SensiFAST™ SYBR No-ROX mix were used. The primer sequences and melting temperatures are provided in Table 1. A two-step reaction protocol was applied. Following a 5-min polymerase activation at 95 °C, denaturation (95 °C, 10 s) and 30-s binding/elongation steps were repeated for 40 cycles at a separate temperature for each target gene (as indicated in Table 1). β-actin gene was used as the housekeeping gene. Gene expression analysis was performed among three groups using the Relative Expression Software Tool (REST©) [38]. Table 1 The primer sequences and melting temperatures for RT-PCR

Target gene	Forward sequence (5′–3′)	Reverse sequence (5′–3′)	Tm (°C)	
MESTIT1	ACAACACAGGCCAGAAACAC	TCCAGTCTGCCCACTTGAT	65	
MEST	TGTCAAATGGAGGTATCTTT	AAGTTCATCAGTCGTGTG	65	
GNASAS	GAGATGAGTTTCTGAGGAT	CAGGTGAAATGAGGGTAG	62.5	
CEP41	GATCATCCAAGTTGCTTCC	GCAGAATCATTGTCTTCCA	57	
H19	CCTTCCTGAACACCTTAG	GTAGCACCATTTCTTTCAT	59	
IGF2AS	GAAACAGCACTCCTCAAC	CAGACACCAATGGGAATC	61	
ACTB	TGAAGATCAAGATCATTGCT	ATACTCCTGCTTGCTGAT	59	

DNA methylation analysis

Sperm DNA was extracted using the QuickGene DNA isolation kit (FUJIFILM, Japan). The spermatozoa suspension was mixed with 180 µl of tissue lysis buffer (MDT) solution. Later, 20 µl proteinase K was added. The mixture was vortexed for 15 s and incubated at 56 °C for 1 h. Then, 180 µl lysis buffer (LDT) was added and vortexed. The mixture was incubated at 70 °C for 10 min. Next, 240 µl 100% ethanol was added and mixed. The mixture was transferred to the tube of the Kurabo (FUJI) QuickGene Mini80 and was filtered. The filtered lysate was washed three times with 750 µl wash buffer (WDT). The extracted DNA was collected with 50 µl of elution buffer. DNA quality and quantity assessment were conducted using the NanoDrop (Thermo Fisher Scientific, MA, USA).

The EZ DNA Methylation-GoldTM kit (Zymo Research, USA) was used for DNA bisulfite modification [39]. Twenty microliters of DNA containing 200 to 300 ng was mixed with 130 µl CT converting reagent. The conversion took place at 98 °C for 10 min and 64 °C for 150 min. The mixture was then transferred after adding 600 µl M-binding buffer to the spin column and centrifuged at 10,000 g for 30 s. Subsequently, 100 µl M-washing buffer was added to the column and centrifuged at 10, 000 g for 30 s. After incubating with 200 µl M-desulphonation buffer for 15 min at room temperature, the mixture was centrifuged at 10,000 g for 30 s. The column was centrifuged at 10, 000 g for 30 s with M-wash buffer twice. DNA was collected using a 15 µl elution buffer (CTD).

The DNA methylation of targeted CpG regions was evaluated with pyrosequencing [39]. Bisulphite-modified DNA was amplified with PyroMark PCR kits (Qiagen, Germany). The reaction was initiated at 95 °C for 15 min and 45 cycles (substantially at 94 °C, 55 °C, and 72 °C for 30 s each). PyroMark CpG assays were utilized for PCR and pyrosequencing (Table 2). Once the amplicons were loaded onto the sepharose beads, sequence primers and beads were mixed in the annealing buffer. PyroMarkQ24 (Qiagen, Germany) was employed for pyrosequencing. The methylation percentage was determined using PyromarkQ24 Advanced Software (Qiagen, Germany). Table 2 Pyromark CpG assay

Gene name	Gene globe ID	Sequence to analyze (5′–3′)	CpG #	
MESTIT1	PM00685489	GACGGCTTTCGCAAAGCACCGGAGGCTCAGGGCCGCGTGTTTGGGGAAAACGGTTAGTCCTTTGAGCCGGC	7	
MEST	PM00126742	AGCGCATGCGCAACCGGTTCTCCGA	4	
GNASAS	PM00081039	CGGCGTCGCTGCAAGCCAAAGAAGCCCACCCGCCGT	5	
CEP41	PM00126728	CCGTGAGGCTAGAACCCCGAACGTGGTCGGT	4	
H19	PM00046830	TGGCSCGSCRGGGCGGTCTGGGCAGGGCCGCGT	4	
IGF2AS	PM00046011	CGCGAGTTCGGTCTCGGGGGCCACCACGA	5	

Data analysis and statistics

DNA methylation cutoff values were obtained from ROC analysis for each gene to distinguish between infertility and fertility. The methylation status of each CpG site was categorized as either hypermethylated or hypomethylated based on these established cutoff values. Statistical tests were conducted using SPSS 28.0 (IBM, USA). ANOVA or Kruskal–Wallis tests were employed to determine differences between groups based on data distribution, with Bonferroni and Tamhane post-hoc tests applied. Correlations between parameters were assessed using Spearman’s test. Multinomial logistic regression was performed to determine the association between infertility and hypermethylation of the genes. A significance level of p < 0.05 was considered statistically significant.

Results

The demographic characteristics of the fertile, oligozoospermic, and normal sperm count groups are represented in Table 3. The differences in age and body mass index (BMI) between the groups were statistically insignificant. Additionally, there was no significant difference between the groups in terms of sexual abstinence and semen volumes. The age-matched groups showed significant differences in semen analysis (Table 3). The oligozoospermic group had significantly lower total sperm count and sperm concentration than the fertile and normal sperm count groups. All groups were within the normal limits regarding motility. The normal sperm count group had significantly higher motility than the fertile and oligozoospermic groups. The fertile group had significantly higher normal morphology than the oligozoospermic and normal sperm count groups. Table 3 Comparisons of the fertile, the oligozoospermic, and the normal sperm count groups regarding demographic characteristics and semen analysis

	Fertile	Oligozoospermic	Normal sperm count	p values	p1	p2	p3	
Agea, year	37.63 ± 4.72	35.26 ± 7.26	34.43 ± 6.21	0.119				
Body Mass Indexa, kg/m2	25.81 ± 1.68	26.03 ± 2.07	25.70 ± 2.17	0.803				
Sexual abstinenceb, days	3 (1)	3 (1)	3 (2)	0.295				
Semen volumeb, ml	3 (1)	3 (1.38)	3 (2)	0.118				
Sperm concentrationb, million/ml	35.5 (33.75)	10.5 (10)	50 (15)	0.0001	0.0001	0.0001	0.232	
Total sperm countb, million	101.5 (112.38)	27.5 (35.38)	130.25 (87.63)	0.0001	0.0001	0.0001	0.150	
Sperm motilityb, %	55 (9.75)	56 (10)	64(15)	0.009	0.367	0.037	0.003	
Normal morphologyb, %	5 (2)	0 (0.75)	0 (2)	0.0001	0.0001	0.232	0.0001	
aNormally distributed data is presented as mean ± standard deviation, and ANOVA was used for statistical analysis

bNon-normally distributed data is presented as median (interquartile range), and the Kruskal–Wallis test was used for statistical analysis

P values were determined using Tamhane’s test and are represented as p. Specifically, p compares all groups, p1 compares fertile vs oligozoospermic, p2 compares oligozoospermic vs normal sperm count, and p3 compares fertile vs normal sperm count. P values < 0.05 are bolded

The methylation cutoff values for each gene were determined using ROC analysis based on fertile or infertile subjects (Table 4). The area under the ROC curve was statistically significant for each gene. Methylation levels below 87.5% of each CpG site of the paternally imprinted H19 were categorized as hypomethylated. CpGs of MEST (4.5%), MESTIT1 (14.5%), GNASAS (6.5%), CEP41 (3.5%), and IGF2AS (5.5%) were categorized as hypermethylated if methylation levels were above their respective cutoff values. The frequency of hypomethylated H19 and hypermethylated genes was compared among the fertile, oligozoospermic, and normal sperm count groups (Fig. 1). GNASAS was significantly hypermethylated at the 1st (66.7%), 3rd (73.3%), and 5th (73.3%) CpG sites in the oligozoospermic group compared to the fertile group (1st 33.3%; 3rd 33.3%; and 5th 40%). CEP41 was significantly hypermethylated at the 3rd CpG site in the normal sperm count group (46.7%) compared to the fertile group (16.7%). Methylation changes at MEST, MESTIT1, H19, and IGF2AS CpG sites among groups were statistically insignificant. Multinomial logistic regression analysis was performed to predict infertility with hypermethylation of GNASAS and CEP41 (Table 5). Infertility with normal sperm count was predicted by CEP41 hypermethylation (OR = 1.750, 95% CI 1.038–2.950) and hypermethylation of both CEP41 and GNASAS (OR = 2.389, 95% CI 1.137–5.021). Oligozoospermic infertility was predicted solely by GNASAS hypermethylation (OR = 2.460, 95% CI 1.315–4.603). Table 4 The cutoff methylation level, sensitivity, specificity, AUC, 95% CI, and P values of each gene to distinguish fertility and infertility were determined by the ROC analysis

Gene	Cutoff methylation level	Sensitivity	Specificity	AUC	95% CI	P values	
MESTIT1	0.145	0.56	0.533	0.554	0.506–0.601	0.027	
MEST	0.045	0.567	0.492	0.567	0.504–0.630	0.039	
GNASAS	0.065	0.617	0.54	0.589	0.535–0.644	0.002	
CEP41	0.035	0.642	0.483	0.597	0.535–0.659	0.003	
H19	0.875	0.543	0.513	0.558	0.501–0.615	0.044	
IGF2AS	0.055	0.623	0.507	0.580	0.523–0.638	0.005	
AUC, area under curve; CI, confidence interval

P values < 0.05 are bolded

Fig. 1 Frequencies of hypermethylation (dark color) and hypomethylation (light color) for each CpG dinucleotides. Blue bars represent the fertile group, orange bars represent the oligozoospermic group, and green bars represent the normal sperm count group. The statistically significant changes are compared with the fertile group indicated with “*p < 0.05” and “†p < 0.01.”

Table 5 Multinominal logistic regression analysis to predict infertility

Groupa	B	SE	Wald	p-value	OR	95% confidence interval
Lower bound
Upper bound	
Oligozoospermic	Intercept	−0.588	0.211	7.774	0.005				
GNASAS hypermethylation	0.900	0.320	7.931	0.005	2.460	1.315	4.603	
CEP41 hypermethylation	0.237	0.261	0.829	0.363	1.268	0.761	2.113	
GNASAS hypermethylation plus CEP41 hypermethylation	0.176	0.343	0.264	0.608	1.192	0.609	2.334	
Normal sperm count	Intercept	−0.100	0.183	0.300	0.584				
GNASAS hypermethylation	−0.305	0.342	0.799	0.371	0.737	0.377	1.440	
CEP41 hypermethylation	0.560	0.266	4.412	0.036	1.750	1.038	2.950	
GNASAS hypermethylation plus CEP41 hypermethylation	0.871	0.379	5.280	0.022	2.389	1.137	5.021	
aThe reference category is fertile. P values < 0.05 are bolded

Abbreviations: B, the logistic coefficient; SE, standard error; OR, odds ratioss

Comparison CEP41, MEST, MESTIT1, H19, IGF2AS, and GNASAS gene expressions are demonstrated in Fig. 2. The normal sperm count group exhibited significantly lower expression (approximately 3.4-fold change) of MEST compared to the fertile group. While MESTIT1, GNASAS, CEP41, and IGF2AS transcripts were lower in the normal sperm count group compared to the fertile group, these differences were statistically insignificant. H19 expression was higher in the normal sperm count group than in the fertile group. The oligozoospermic group showed statistically insignificant increases in H19 and MESTIT1 expressions compared to the fertile group. MEST, GNASAS, CEP41, and IGF2AS mRNA expression levels were lower in the oligozoospermic group than in the fertile group. However, these decreased expressions were not found to be statistically significant. Although the gene expressions of all genes were decreased in the normal sperm count group compared to the oligozoospermic group, it was not statistically significant.Fig. 2 Comparison of CEP41, MEST, MESTIT1, H19, IGF2AS, and GNASAS gene expression fold changes between oligozoospermic and normal sperm count individuals with the fertile group. *p = 0.021

The correlations between parameters were evaluated among the fertile, oligozoospermic, and normal sperm count groups (Supplementary Table 1). mRNA expression of MEST was significantly negatively correlated with the 1st (r =  − 0.517) and 2nd (r =  − 0.510) CpGs of MEST in the normal sperm count groups. Conversely, these associations were absent in the fertile and oligozoospermic groups. In the fertile group, mRNA expression of IGF2 was significantly negatively correlated with H19 methylation at the 1st (r =  − 0.367), 2nd (r =  − 0.379), and 4th (r =  − 0.469) CpGs. These significant correlations were not observed among the infertile groups. Additionally, IGF2 mRNA expression in the fertile group was significantly correlated with IGF2AS methylation at the 2nd CpG (r = 0.388), while this correlation was not present in the infertile groups. In the fertile group, there was no significant correlation found between the mRNA expressions of GNAS, MESTIT1, and CEP41 and the methylation levels of these genes. mRNA expressions of MESTIT1, MEST, and CEP41 were significantly positively correlated among all groups. IGF2 and H19 mRNA expressions were also significantly correlated among all groups. mRNA expression of GNASAS was significantly correlated with H19 in the oligozoospermic group (r = 0.641), but not in the normal sperm count or fertile groups (Table 6). Table 6 Correlation coefficients (r) of different parameters among the fertile, the oligozoospermic, and the normal sperm count groups

1st parameter	2nd parameter	Fertile	Oligozoospermic	Normal sperm count	
MEST expression	MEST_ CpG1 methylation	r = 0.180	r =  − 0.280	r =  − 0.517**	
MEST expression	MEST _ CpG2 methylation	r =  − 0.019	r =  − 0.175	r =  − 0.510**	
MEST expression	MEST _ CpG3 methylation	r = 0.206	r =  − 0.252	r =  − 0.080	
MEST expression	MEST _ CpG4 methylation	r = 0.089	r =  − 0.252	r =  − 0.092	
IGF2 expression	IGF2AS_ CpG1 methylation	r = 0.088	r = 0.236	r =  − 0.249	
IGF2 expression	IGF2AS_ CpG2 methylation	r = 0.388*	r = 0.189	r =  − 0.342	
IGF2 expression	IGF2AS_ CpG3 methylation	r = 0.252	r = 0.324	r =  − 0.187	
IGF2 expression	IGF2AS_ CpG4 methylation	r = 0.196	r = 0.131	r =  − 0.010	
IGF2 expression	IGF2AS_ CpG5 methylation	r = 0.091	r = 0.264	r = 0.032	
IGF2 expression	H19_ CpG1 methylation	r =  − 0.367*	r =  − 0.185	r =  − 0.193	
IGF2 expression	H19_ CpG2 methylation	r =  − 0.379*	r = 0.152	r =  − 0.290	
IGF2 expression	H19_ CpG3 methylation	r =  − 0.326	r =  − 0.050	r =  − 0.128	
IGF2 expression	H19_ CpG4 methylation	r =  − 0.469**	r =  − 0.011	r =  − 0.116	
H19 expression	H19_ CpG1 methylation	r =  − 0.269	r =  − 0.054	r =  − 0.170	
H19 expression	H19_ CpG2 methylation	r =  − 0.257	r = 0.261	r =  − 0.016	
H19 expression	H19_ CpG3 methylation	r =  − 0.210	r = 0.073	r =  − 0.132	
H19 expression	H19_ CpG4 methylation	r =  − 0.283	r = 0.032	r =  − 0.071	
GNAS expression	GNASAS_ CpG1 methylation	r = 0.155	r = 0.291	r = 0.241	
GNAS expression	GNASAS_ CpG2 methylation	r = 0.155	r = 0.325	r = 0.130	
GNAS expression	GNASAS_ CpG3 methylation	r = 0.155	r = 0.109	r =  − 0.058	
GNAS expression	GNASAS_ CpG4 methylation	r = 0.032	r =  − 0.116	r = 0.000	
GNAS expression	GNASAS_ CpG5 methylation	r =  − 0.071	r = 0.218	r =  − 0.166	
CEP41 expression	CEP41_ CpG1 methylation	r = 0.214	r =  − 0.013	r = 0.351	
CEP41 expression	CEP41_ CpG2 methylation	r = 0.170	r =  − 0.155	r = 0.144	
CEP41 expression	CEP41_ CpG3 methylation	r =  − 0.165	r = 0.000	r = 0.259	
CEP41 expression	CEP41_ CpG4 methylation	r =  − 0.237	r = 0.263	r = 0.024	
IGF2 expression	H19 expression	r = 0.613**	r = 0.808**	r = 0.534**	
MESTIT1 expression	MEST expression	r = 0.553**	r = 0.839**	r = 0.705**	
MESTIT1 expression	CEP41 expression	r = 0.577**	r = 0.670**	r = 0.409*	
CEP41 expression	MEST expression	r = 0.888**	r = 0.789**	r = 0.495**	
GNAS expression	MEST expression	r = 0.888**	r = 0.841**	r = 0.445**	
GNAS expression	H19 expression	r = 0.212	r = 0.641**	r = 0.190	
The statistically significant correlations are signed with *p < 0.05 and **p < 0.01

Discussion

The relationship between male infertility and the DNA methylation of spermatozoa is the topic of various research [40]. In the face of the diverse factors influencing the DNA methylome of the spermatozoa, there are not any findings which have yet been confirmed by multiple studies [41]. El Hajj et al. [42] compared spermatozoa from infertile males with controls and found that the methylation levels of NESPAS, also known as GNASAS, which is a member of the GNAS locus, as well as MEST and H19, did not show statistically significant differences. In our study, the methylation levels of MEST and H19 did not change significantly among the three groups, consistent with the findings of El Hajj et al. [42]. On the other hand, we found significant hypermethylation of three CpGs in GNASAS in the oligozoospermic group compared to the fertile group. Our different findings may be related to inclusion criteria; for example, we included fertile males as controls, whereas the control group in El Hajj et al. [42] consisted of presumably fertile males who underwent infertility treatment due to female factor infertility and repeatedly exhibited normal semen parameters without a cause for male infertility. On the other hand, we observed that El Hajj et al. [42] used a previous edition of the guidelines compared to ours, leading to the application of different reference values [42]. Moreover, we determined the hypermethylation rates based on a cutoff value, whereas El Hajj et al. [42] used the methylation percentage directly. To determine the cutoff value with the ROC analysis, we choose higher sensitivity and lower specificity to more accurately evaluate the infertile individuals [43]. Based on the cutoff value we utilized, we found that GNASAS hypermethylation could serve as a significant predictor of oligozoospermic infertility. Even though we demonstrated no significant difference in MEST methylation among groups, similar to El Hajj et al. [42], the significant downregulation of MEST in the normal sperm count group in our study was a novel finding not reported in the literature. Decreased levels of MEST mRNA might result from methylation abnormalities of different CpGs in the MEST promoter region or chromatin remodelling errors that inhibit transcription factor binding in the spermatogonia subpopulation of our normal sperm count group. Post-transcriptional mRNA degradation is another possible explanation for our findings. It is our understanding that spermatozoa of men with normal sperm count may fail in fertilization or embryo development due to differences in mRNA expression levels, specifically in their downregulation, which do not affect sperm count.

Becker et al. [44] found lower CEP41 expression of the spermatozoa in oligoasthenozoospermia than in the controls. Unlike Becker et al. [44], we observed no significant downregulation of CEP41 expression in both the oligozoospermic and normal sperm count groups compared to the control group. The discrepancy between our results and Becker’s findings may stem from variations in inclusion criteria. Their experiment group included solely oligoastenozoospermic males while we had normal sperm count and oligozoospermic group separately. Additionally, while Becker et al. [44] demonstrated miRNA-mediated downregulation of gene expression in spermatozoa, our study focused on investigating CEP41 methylation as a distinct epigenetic control mechanism. In our study, although the downregulation of CEP41 expression in the normal sperm count group was not statistically significant, CEP41 was significantly hypermethylated in the normal sperm count group compared to the controls (p < 0.05). We believe that the decrease in GNASAS and CEP41 transcription in both normal sperm count and oligozoospermia groups may be attributed to the statistically significant hypermethylation percentage of these genes that we identified. Additionally, various epigenetic factors during spermatogenesis, such as histone modifications, chromatin restructuring, or methylation changes at CpGs different from those we detected, may also have contributed to the decrease in transcription levels. We demonstrated that CEP41 hypermethylation alone and in combination with GNASAS hypermethylation is a marker for assessing infertility with normal sperm count. On the other hand, for assessing oligozoospermic infertility, CEP41 hypermethylation did not increase the predictive value of GNASAS hypermethylation. GNASAS hypermethylation might affect spermatozoa number, whereas CEP41 hypermethylation might instead affect sperm function.

Oligozoospermic patients have lower live birth rates, and it is believed that sperm methylome anomalies have an impact on the success of assisted reproductive technology (ART) [45]. Although we demonstrated that oligozoospermic males had GNASAS hypermethylation, its impact on embryos was beyond the scope of our research. Several studies have shown that babies born through ART may exhibit DNA methylation abnormalities, but not all findings were statistically significant [46, 47]. Katari et al. [48] showed that GNAS methylation changes due to ART were detected in cord blood but not in the placenta. Melamed et al. [49] also showed that GNAS in cord blood of ART babies exhibited three differentially methylated CpG sites. Among naturally conceived babies, Tobi et al. [45] showed that GNASAS methylation levels did not change significantly between babies who were small for gestational age (SGA) and the appropriate for gestation age. Given the frequent use of ART for oligozoospermic patients, further research is needed to elucidate the effects of GNASAS hypermethylation, which we detected in the oligozoospermic group, on pregnancy outcomes.

Unlike significant hypermethylation of CEP41 and GNASAS in infertile males, we did not find statistically significant methylation differences of MEST, MESTIT1, IGF2AS, and H19. Marques et al. [50] detected aberrant methylation of H19 and MEST in sperm from oligozoospermic patients; however, they did not include a fertile group for comparison. They showed abnormalities in H19 and MEST methylation in testicular spermatozoa, but again, the study did not include a fertile control group [51]. Unlike our findings, which are derived from four CpGs of MEST, Hammond et al. [52] reported significant hypermethylation of MEST on one of eighteen CpG sites in oligozoospermic males compared to fertile males. Amjadian et al. [53] found higher MEST methylation in oligoasthenoteratospermia than in asthenospermia and normospermia; however, their groups were constructed differently from ours. On the other hand, in contrast to Amjadian et al. [53], Song et al. [54] demonstrated significant MEST hypomethylation in the asthenozoospermic group compared to normozoospermic infertile males. Montjean et al. [55] identified methylation abnormalities in MEST and H19 among infertile males, but unlike us, they did not enroll fertile males for comparison. The differences in our findings could be attributed to various factors such as sample size, group composition, and the specific CpGs we evaluated. Recent meta-analyses focusing on MEST [56] and H19 [9] indicated that methylation studies in male infertility reveal diverse results due to the heterogeneity among the studies.

In our study, MEST expression was significantly downregulated in the normal sperm count male; even the MEST methylation did not change significantly between groups. While MEST expression was significantly downregulated in individuals with MEST hypermethylation in the normal sperm count group, this correlation was not found in the fertile and oligozoospermic groups. Leitao et al. [57] investigated MEST methylation changes over 200 CpGs and showed altered methylation ranges in oligozoospermic men. Methylation of other CpGs in MEST, which we did not investigate, could be effective for MEST expression in our fertile group. Decreased MEST mRNA levels might result from increased mRNA degradation, as well as from inhibition of gene expression by non-coding RNAs. The mRNAs of spermatozoa had a testicular origin, and some of them were degraded by miRNAs throughout sperm’s transit within the male and female genital tract [32]. In addition, spermatozoa may become transcriptionally inactive after chromatin condensation [33]. Laurentino et al. [58] suggested that defects in MEST demethylation in primordial germ cells (PGCs) after migration during embryological development or aberrations in remethylation during spermatogenesis might lead to abnormal spermatozoa subpopulations. Marques et al. [59] showed that MEST demethylation continues in all spermatogenic cells from spermatogonia to spermatids. Another hypothesis to explain the findings in the normal sperm count group of our study could be the presence of an abnormally methylated spermatogenic subpopulation.

There have been studies investigating the impact of gene methylation and expression imprinting on pregnancy outcomes. Placental MEST hypermethylation and downregulation of gene expression were revealed among the early onset preeclampsia patients [60]. Similar to that, IGF2AS methylation was increased, and expression was downregulated in embryonic villi samples from early pregnancy loss [20]. Alterations in IGF2AS methylation were found in groups with deficient birth weight, persisting even after years [61]. In our study, IGF2AS methylation was not significantly different among the fertile, oligozoospermic, and normal sperm count groups. However, IGF2 expression was significantly upregulated in fertile individuals whose 2nd CpG of IGF2AS was hypermethylated, unlike in the infertile group. Darbandi et al. [62] stated that H19 differentially methylated region (DMR) methylation of the paternal chromosome has a reciprocal effect as downregulated H19 expression and upregulated IGF2 expression. In contrast to Darbandi et al. [62], we found a significant negative correlation between IGF2 expression and H19 methylation in the fertile group. These relations were lost among infertile groups. The positive correlation between H19 and IGF2 transcripts in our three groups suggested that spermatozoa might be associated with other epigenetic modifications rather than DNA methylation. Since H19 methylated during spermatogenesis to transfer paternal imprinting for offsprings, H19 and IGF2 transcription should be completed ahead of DNA methylation [32]. The absence of significant correlations within the infertile groups in our study might be related to other disrupted epigenetic mechanisms, such as changes in ncRNAs, which are also important for embryo development and transgenerational inheritance.

In conclusion, the DNA methylome of spermatozoa significantly impacts male infertility. Despite limitations such as the scarcity of CpG sites in methylation analysis, our study is the first to demonstrate hypermethylation of GNASAS and CEP41 in spermatozoa and to demonstrate the variable relationship between DNA methylation and gene expression in infertile men. GNASAS and CEP41 hypermethylation should be evaluated in the further studies in order to develop more effective molecular markers in the diagnosis of male infertility, to elucidate the epigenetic regulation during spermatogenesis, and to reveal the effects of paternal epigenome on ART’s success and the health of new generations.

Supplementary Information

Below is the link to the electronic supplementary material.Supplementary file1 (XLSX 185 KB)

Author contribution

SEO, EK, NB, and IG conceptualized the study and participated in the study design. SEO performed the experiments. IG and NB contributed to sample data acquisition. SEO, EK, and NB interpreted the data. NV contributed insights on pyrosequencing. AUD, EK, and SEO carried out the statistical analysis. EK wrote the manuscript. EK performed project administration, funding acquisition, and supervision. All authors approved the paper.

Funding

Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK). The present study was conducted with financial support from the Gazi University Research Fund (Project ID: TDK-2021–7023).

Data availability

All of the data of our study are available in Tables 1, 2, 3, 4, 5 and 6, Figures 1 and 2 and our supplementary file, and can be used by reference after our publication is published in the literature.

Declarations

Competing interests

The authors declare no competing interests.

Highlights

1.GNASAS hypermethylation frequency is significantly higher in the oligozoospermic infertile males than in the age-matched fertile controls.

2.GNASAS hypermethylation may be a potentially useful marker in detecting oligozoospermic infertility in men.

3.CEP41 hypermethylation frequency is significantly higher in the infertile males with normal sperm count than the age-matched fertile controls.

4.The combination of CEP41 and GNASAS hypermethylations may be an important marker in detecting infertile men with normal sperm count.

5.MEST expression is significantly downregulated in males with normal sperm count compared to fertile males.

6.In the fertile male spermatozoa IGF2 expression is decreased with IGF2AS hypomethylation and H19 hypermethylation. These findings are not observed in the infertile groups.

7.High H19 mRNA expression levels in spermatozoa of the fertile and infertile groups are accompanied by high IGF2 mRNA expression.

8.The concurrent rise in H19 and IGF2 mRNA expression levels in sperm suggests RNA profile is not the sole infertility factor. DNA methylation and RNA expression relationship highlight epigenetic role.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Mazzilli R Rucci C Vaiarelli A Cimadomo D Ubaldi FM Foresta C Male factor infertility and assisted reproductive technologies: indications, minimum access criteria and outcomes J Endocrinol Invest. 2023 46 6 1079 85 10.1007/s40618-022-02000-4 36633791
Mazzilli R, Rucci C, Vaiarelli A, Cimadomo D, Ubaldi FM, Foresta C, et al. Male factor infertility and assisted reproductive technologies: indications, minimum access criteria and outcomes. J Endocrinol Invest. 2023;46(6):1079–85. 10.1007/s40618-022-02000-436633791 10.1007/s40618-022-02000-4
2. Agarwal A Baskaran S Parekh N Cho CL Henkel R Vij S Male infertility Lancet. 2021 397 10271 319 33 10.1016/s0140-6736(20)32667-2 33308486
Agarwal A, Baskaran S, Parekh N, Cho CL, Henkel R, Vij S, et al. Male infertility. Lancet. 2021;397(10271):319–33. 10.1016/s0140-6736(20)32667-233308486 10.1016/s0140-6736(20)32667-2
3. Eisenberg ML Esteves SC Lamb DJ Hotaling JM Giwercman A Hwang K Male infertility Nature Reviews Disease Primers 2023 9 1 1 10.1038/s41572-023-00459-w
Eisenberg ML, Esteves SC, Lamb DJ, Hotaling JM, Giwercman A, Hwang K, et al. Male infertility. Nature Reviews Disease Primers. 2023;9(1):1. 10.1038/s41572-023-00459-w10.1038/s41572-023-00459-w
4. Pathak UI Gabrielsen JS Lipshultz LI Cutting-edge evaluation of male infertility Urol Clin North Am 2020 47 2 129 38 10.1016/j.ucl.2019.12.001 32272984
Pathak UI, Gabrielsen JS, Lipshultz LI. Cutting-edge evaluation of male infertility. Urol Clin North Am. 2020;47(2):129–38. 10.1016/j.ucl.2019.12.00132272984 10.1016/j.ucl.2019.12.001
5. Calogero AE Cannarella R Agarwal A Hamoda TAA Rambhatla A Saleh R The renaissance of male infertility management in the golden age of andrology World J Mens Health 2023 41 2 237 54 10.5534/wjmh.220213 36649928
Calogero AE, Cannarella R, Agarwal A, Hamoda TAA, Rambhatla A, Saleh R, et al. The renaissance of male infertility management in the golden age of andrology. World J Mens Health. 2023;41(2):237–54. 10.5534/wjmh.22021336649928 10.5534/wjmh.220213
6. Diaz P Dullea A Chu KY Zizzo J Loloi J Reddy R Future of male infertility evaluation and treatment: brief review of emerging technology Urology 2022 169 9 16 10.1016/j.urology.2022.06.036 35905774
Diaz P, Dullea A, Chu KY, Zizzo J, Loloi J, Reddy R, et al. Future of male infertility evaluation and treatment: brief review of emerging technology. Urology. 2022;169:9–16. 10.1016/j.urology.2022.06.03635905774 10.1016/j.urology.2022.06.036
7. Baldini D, Ferri D, Baldini GM, Lot D, Catino A, Vizziello D, et al. Sperm selection for ICSI: do we have a winner? Cells. 2021;10(12).10.3390/cells10123566
8. Colaco S Sakkas D Paternal factors contributing to embryo quality J Assist Reprod Genet 2018 35 11 1953 68 10.1007/s10815-018-1304-4 30206748
Colaco S, Sakkas D. Paternal factors contributing to embryo quality. J Assist Reprod Genet. 2018;35(11):1953–68. 10.1007/s10815-018-1304-430206748 10.1007/s10815-018-1304-4
9. Cannarella R, Crafa A, Barbagallo F, Lundy SD, La Vignera S, Condorelli RA, et al. H19 sperm methylation in male infertility: a systematic review and meta-analysis. Int J Mol Sci. 2023;24(8). 10.3390/ijms24087224
10. Trost N Mbengue N Kaessmann H The molecular evolution of mammalian spermatogenesis Cells Dev 2023 175 203865. 10.1016/j.cdev.2023.203865 37336426
Trost N, Mbengue N, Kaessmann H. The molecular evolution of mammalian spermatogenesis. Cells Dev. 2023;175:203865. 10.1016/j.cdev.2023.20386537336426 10.1016/j.cdev.2023.203865
11. Ozkocer SE Konac E The current perspective on genetic and epigenetic factors in sperm maturation in the epididymis Andrologia 2021 53 3 e13989. 10.1111/and.13989 33491190
Ozkocer SE, Konac E. The current perspective on genetic and epigenetic factors in sperm maturation in the epididymis. Andrologia. 2021;53(3):e13989. 10.1111/and.1398933491190 10.1111/and.13989
12. Pollard CA Jenkins TG Epigenetic mechanisms within the sperm epigenome and their diagnostic potential Best Pract Res Clin Endocrinol Metab 2020 34 6 101481. 10.1016/j.beem.2020.101481 33358482
Pollard CA, Jenkins TG. Epigenetic mechanisms within the sperm epigenome and their diagnostic potential. Best Pract Res Clin Endocrinol Metab. 2020;34(6):101481. 10.1016/j.beem.2020.10148133358482 10.1016/j.beem.2020.101481
13. Bracke A Peeters K Punjabi U Hoogewijs D Dewilde S A search for molecular mechanisms underlying male idiopathic infertility Reprod Biomed Online. 2018 36 3 327 39 10.1016/j.rbmo.2017.12.005 29336995
Bracke A, Peeters K, Punjabi U, Hoogewijs D, Dewilde S. A search for molecular mechanisms underlying male idiopathic infertility. Reprod Biomed Online. 2018;36(3):327–39. 10.1016/j.rbmo.2017.12.00529336995 10.1016/j.rbmo.2017.12.005
14. Garrido N Boitrelle F Saleh R Durairajanayagam D Colpi G Agarwal A Sperm epigenetics landscape: correlation with embryo quality, reproductive outcomes and offspring’s health Panminerva Med 2023 65 2 166 78 10.23736/s0031-0808.23.04871-1 37335245
Garrido N, Boitrelle F, Saleh R, Durairajanayagam D, Colpi G, Agarwal A. Sperm epigenetics landscape: correlation with embryo quality, reproductive outcomes and offspring’s health. Panminerva Med. 2023;65(2):166–78. 10.23736/s0031-0808.23.04871-137335245 10.23736/s0031-0808.23.04871-1
15. Zhou S Feng S Qin W Wang X Tang Y Yuan S Epigenetic regulation of spermatogonial stem cell homeostasis: from DNA methylation to histone modification Stem Cell Rev Rep 2021 17 2 562 80 10.1007/s12015-020-10044-3 32939648
Zhou S, Feng S, Qin W, Wang X, Tang Y, Yuan S. Epigenetic regulation of spermatogonial stem cell homeostasis: from DNA methylation to histone modification. Stem Cell Rev Rep. 2021;17(2):562–80. 10.1007/s12015-020-10044-332939648 10.1007/s12015-020-10044-3
16. Kitamura A Miyauchi N Hamada H Hiura H Chiba H Okae Epigenetic alterations in sperm associated with male infertility Congenit Anom (Kyoto) 2015 55 3 133 44 10.1111/cga.12113 26212350
Kitamura A, Miyauchi N, Hamada H, Hiura H, Chiba H, Okae, et al. Epigenetic alterations in sperm associated with male infertility. Congenit Anom (Kyoto). 2015;55(3):133–44. 10.1111/cga.1211326212350 10.1111/cga.12113
17. Wang Y Hylemon PB Zhou H Long noncoding RNA H19: a key player in liver diseases Hepatology 2021 74 3 1652 9 10.1002/hep.31765 33630308
Wang Y, Hylemon PB, Zhou H. Long noncoding RNA H19: a key player in liver diseases. Hepatology. 2021;74(3):1652–9. 10.1002/hep.3176533630308 10.1002/hep.31765
18. Xiang M Ma Y Lei H Wen L Chen S Wang X In vitro fertilization placenta overgrowth in mice is associated with downregulation of the paternal imprinting gene H19 Mol Reprod Dev 2019 86 12 1940 1950 10.1002/mrd.23279 31556166
Xiang M, Ma Y, Lei H, Wen L, Chen S, Wang X. In vitro fertilization placenta overgrowth in mice is associated with downregulation of the paternal imprinting gene H19. Mol Reprod Dev. 2019;86(12):1940–50. 10.1002/mrd.2327931556166 10.1002/mrd.23279
19. Wang B Suen CW Ma H Wang Y Kong L Qin D The roles of H19 in regulating inflammation and aging Front Immunol 2020 11 579687. 10.3389/fimmu.2020.579687 33193379
Wang B, Suen CW, Ma H, Wang Y, Kong L, Qin D, et al. The roles of H19 in regulating inflammation and aging. Front Immunol. 2020;11:579687. 10.3389/fimmu.2020.57968733193379 10.3389/fimmu.2020.579687
20. Wu AH Guo LY Lu S Chen XL Wang AA Wang XY Aberrant methylation of IGF2-AS promoter in early pregnancy loss Taiwan J Obstet Gynecol 2020 59 1 109 14 10.1016/j.tjog.2019.11.017 32039776
Wu AH, Guo LY, Lu S, Chen XL, Wang AA, Wang XY, et al. Aberrant methylation of IGF2-AS promoter in early pregnancy loss. Taiwan J Obstet Gynecol. 2020;59(1):109–14. 10.1016/j.tjog.2019.11.01732039776 10.1016/j.tjog.2019.11.017
21. Santi D De Vincentis S Magnani E Spaggiari G Impairment of sperm DNA methylation in male infertility: a meta-analytic study Andrology 2017 5 4 695 703 10.1111/andr.12379 28718528
Santi D, De Vincentis S, Magnani E, Spaggiari G. Impairment of sperm DNA methylation in male infertility: a meta-analytic study. Andrology. 2017;5(4):695–703. 10.1111/andr.1237928718528 10.1111/andr.12379
22. Kerjean A Dupont JM Vasseur C Le Tessier D Cuisset L Pàldi A Establishment of the paternal methylation imprint of the human H19 and MEST/PEG1 genes during spermatogenesis Hum Mol Genet 2000 9 14 2183 7 10.1093/hmg/9.14.2183 10958657
Kerjean A, Dupont JM, Vasseur C, Le Tessier D, Cuisset L, Pàldi A, et al. Establishment of the paternal methylation imprint of the human H19 and MEST/PEG1 genes during spermatogenesis. Hum Mol Genet. 2000;9(14):2183–7. 10.1093/hmg/9.14.218310958657 10.1093/hmg/9.14.2183
23. Nakabayashi K Bentley L Hitchins MP Mitsuya K Meguro M Minagawa S Identification and characterization of an imprinted antisense RNA (MESTIT1) in the human MEST locus on chromosome 7q32 Hum Mol Genet 2002 11 15 1743 56 10.1093/hmg/11.15.1743 12095916
Nakabayashi K, Bentley L, Hitchins MP, Mitsuya K, Meguro M, Minagawa S, et al. Identification and characterization of an imprinted antisense RNA (MESTIT1) in the human MEST locus on chromosome 7q32. Hum Mol Genet. 2002;11(15):1743–56.10.1093/hmg/11.15.174312095916 10.1093/hmg/11.15.1743
24. Li T Vu TH Lee KO Yang Y Nguyen CV Bui HQ An imprinted PEG1/MEST antisense expressed predominantly in human testis and in mature spermatozoa J Biol Chem 2002 277 16 13518 27 10.1074/jbc.M200458200 11821432
Li T, Vu TH, Lee KO, Yang Y, Nguyen CV, Bui HQ, et al. An imprinted PEG1/MEST antisense expressed predominantly in human testis and in mature spermatozoa. J Biol Chem. 2002;277(16):13518–27. 10.1074/jbc.M20045820011821432 10.1074/jbc.M200458200
25. Schneider E Mayer S El Hajj N Jensen L Kuss A Zischler H Methylation and expression analyses of the 7q autism susceptibility locus genes MEST, COPG2, and TSGA14 in human and anthropoid primate cortices Cytogenet Genome Res 2012 136 4 278 287 10.1159/000337298 22456293
Schneider E, Mayer S, El Hajj N, Jensen L, Kuss A, Zischler H, et al. Methylation and expression analyses of the 7q autism susceptibility locus genes MEST, COPG2, and TSGA14 in human and anthropoid primate cortices. Cytogenet Genome Res. 2012;136(4):278–87. 10.1159/00033729822456293 10.1159/000337298
26. Yamada T Kayashima T Yamasaki K Ohta T Yoshiura K Matsumoto N The gene TSGA14, adjacent to the imprinted gene MEST, escapes genomic imprinting Gene 2002 288 1–2 57 63 10.1016/s0378-1119(02)00428-6 12034494
Yamada T, Kayashima T, Yamasaki K, Ohta T, Yoshiura K, Matsumoto N, et al. The gene TSGA14, adjacent to the imprinted gene MEST, escapes genomic imprinting. Gene. 2002;288(1–2):57–63. 10.1016/s0378-1119(02)00428-612034494 10.1016/s0378-1119(02)00428-6
27. Lee JE Silhavy JL Zaki MS Schroth J Bielas SL Marsh SE CEP41 is mutated in Joubert syndrome and is required for tubulin glutamylation at the cilium Nature genetics [Internet] 2012 44 2 193 9 10.1038/ng.1078 22246503
Lee JE, Silhavy JL, Zaki MS, Schroth J, Bielas SL, Marsh SE, et al. CEP41 is mutated in Joubert syndrome and is required for tubulin glutamylation at the cilium. Nature genetics [Internet]. 2012;44(2):193–9. 10.1038/ng.107822246503 10.1038/ng.1078
28. Cannarella R Crafa A Condorelli RA Mongioì LM La Vignera S Calogero AE Relevance of sperm imprinted gene methylation on assisted reproductive technique outcomes and pregnancy loss: a systematic review Syst Biol Reprod Med 2021 67 4 251 9 10.1080/19396368.2021.1909667 34080930
Cannarella R, Crafa A, Condorelli RA, Mongioì LM, La Vignera S, Calogero AE. Relevance of sperm imprinted gene methylation on assisted reproductive technique outcomes and pregnancy loss: a systematic review. Syst Biol Reprod Med. 2021;67(4):251–9. 10.1080/19396368.2021.190966734080930 10.1080/19396368.2021.1909667
29. Li T Vu TH Zeng ZL Nguyen BT Hayward BE Bonthron DT Tissue-specific expression of antisense and sense transcripts at the imprinted Gnas locus Genomics 2000 69 3 295 304 10.1006/geno.2000.6337 11056047
Li T, Vu TH, Zeng ZL, Nguyen BT, Hayward BE, Bonthron DT, et al. Tissue-specific expression of antisense and sense transcripts at the imprinted Gnas locus. Genomics. 2000;69(3):295–304. 10.1006/geno.2000.633711056047 10.1006/geno.2000.6337
30. Turan S Bastepe M GNAS spectrum of disorders Curr Osteoporos Rep. 2015 13 3 146 58 10.1007/s11914-015-0268-x 25851935
Turan S, Bastepe M. GNAS spectrum of disorders. Curr Osteoporos Rep. 2015;13(3):146–58. 10.1007/s11914-015-0268-x25851935 10.1007/s11914-015-0268-x
31. Tierling S Souren NY Gries J Loporto C Groth M Lutsik P Assisted reproductive technologies do not enhance the variability of DNA methylation imprints in human J Med Genet 2010 47 6 371 6. 10.1136/jmg.2009.073189 19948534
Tierling S, Souren NY, Gries J, Loporto C, Groth M, Lutsik P, et al. Assisted reproductive technologies do not enhance the variability of DNA methylation imprints in human. J Med Genet. 2010;47(6):371-6. 10.1136/jmg.2009.07318919948534 10.1136/jmg.2009.073189
32. Santiago J Silva JV Howl J Santos MAS Fardilha M All you need to know about sperm RNAs Hum Reprod Update 2021 28 1 67 91. 10.1093/humupd/dmab034 34624094
Santiago J, Silva JV, Howl J, Santos MAS, Fardilha M. All you need to know about sperm RNAs. Hum Reprod Update. 2021;28(1):67-91. 10.1093/humupd/dmab03434624094 10.1093/humupd/dmab034
33. Vallet-Buisan M Mecca R Jones C Coward K Yeste M Contribution of semen to early embryo development: fertilization and beyond Hum Reprod Update 2023 29 4 395 433 10.1093/humupd/dmad006 36882116
Vallet-Buisan M, Mecca R, Jones C, Coward K, Yeste M. Contribution of semen to early embryo development: fertilization and beyond. Hum Reprod Update. 2023;29(4):395–433. 10.1093/humupd/dmad00636882116 10.1093/humupd/dmad006
34. WHO laboratory manual for the examination and processing of human semen 2021. Available from: https://www.who.int/publications/i/item/9789240030787. Accessed 29 Sept 2023
35. Menkveld R Stander FSH Kotze TJv Kruger TF Zyl JAv The evaluation of morphological characteristics of human spermatozoa according to stricter criteria Human Reproduction 1990 5 5 586 92. 10.1093/oxfordjournals.humrep.a137150 2394790
Menkveld R, Stander FSH, Kotze TJv, Kruger TF, Zyl JAv. The evaluation of morphological characteristics of human spermatozoa according to stricter criteria. Human Reproduction. 1990;5(5):586-92. 10.1093/oxfordjournals.humrep.a1371502394790 10.1093/oxfordjournals.humrep.a137150
36. Metin Mahmutoglu A Gunes S Asci R Henkel R Aydin O Association of XRCC1 and ERCC2 promoters’ methylation with chromatin condensation and sperm DNA fragmentation in idiopathic oligoasthenoteratozoospermic men Andrologia. 2021 53 2 e13925. 10.1111/and.13925 33355950
Metin Mahmutoglu A, Gunes S, Asci R, Henkel R, Aydin O. Association of XRCC1 and ERCC2 promoters’ methylation with chromatin condensation and sperm DNA fragmentation in idiopathic oligoasthenoteratozoospermic men. Andrologia. 2021;53(2):e13925. 10.1111/and.1392533355950 10.1111/and.13925
37. Roszkowski M Mansuy IM High efficiency RNA extraction from sperm cells using guanidinium thiocyanate supplemented with tris(2-carboxyethyl)phosphine Front Cell Dev Biol 2021 9 648274 10.3389/fcell.2021.648274 33968930
Roszkowski M, Mansuy IM. High efficiency RNA extraction from sperm cells using guanidinium thiocyanate supplemented with tris(2-carboxyethyl)phosphine. Front Cell Dev Biol. 2021;9:648274. 10.3389/fcell.2021.64827433968930 10.3389/fcell.2021.648274
38. Pfaffl MW Horgan GW Dempfle L Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR Nucleic acids research 2002 30 9 e36-e 10.1093/nar/30.9.e36 11972351
Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic acids research. 2002;30(9):e36-e. 10.1093/nar/30.9.e3611972351 10.1093/nar/30.9.e36
39. Karaca MZ, Konac E, Yurteri B, Bozdag G, Sogutdelen E, Bilen CY. Association between methylenetetrahydrofolate reductase (MTHFR) gene promoter hypermethylation and the risk of idiopathic male infertility. Andrologia. 2017;49(7). 10.1111/and.12698
40. Rotondo JC Lanzillotti C Mazziotta C Tognon M Martini F Epigenetics of male infertility: the role of DNA methylation Frontiers in Cell and Developmental Biology 2021 9 689624 10.3389/fcell.2021.689624 34368137
Rotondo JC, Lanzillotti C, Mazziotta C, Tognon M, Martini F. Epigenetics of male infertility: the role of DNA methylation. Frontiers in Cell and Developmental Biology. 2021;9: 689624. 10.3389/fcell.2021.68962434368137 10.3389/fcell.2021.689624
41. Åsenius F Danson AF Marzi SJ DNA methylation in human sperm: a systematic review Hum Reprod Update 2020 26 6 841 873 10.1093/humupd/dmaa025 32790874
Åsenius F, Danson AF, Marzi SJ. DNA methylation in human sperm: a systematic review. Hum Reprod Update. 2020;26(6):841–73. 10.1093/humupd/dmaa02532790874 10.1093/humupd/dmaa025
42. El Hajj N Zechner U Schneider E Tresch A Gromoll J Hahn T Methylation status of imprinted genes and repetitive elements in sperm DNA from infertile males Sex Dev 2011 5 2 60 9 10.1159/000323806 21293114
El Hajj N, Zechner U, Schneider E, Tresch A, Gromoll J, Hahn T, et al. Methylation status of imprinted genes and repetitive elements in sperm DNA from infertile males. Sex Dev. 2011;5(2):60–9. 10.1159/00032380621293114 10.1159/000323806
43. Habibzadeh F Habibzadeh P Yadollahie M On determining the most appropriate test cut-off value: the case of tests with continuous results Biochemia medica 2016 26 3 297 307 10.11613/bm.2016.034 27812299
Habibzadeh F, Habibzadeh P, Yadollahie M. On determining the most appropriate test cut-off value: the case of tests with continuous results. Biochemia medica. 2016;26(3):297–307. 10.11613/bm.2016.03427812299 10.11613/bm.2016.034
44. Becker LS, Al Smadi MA, Koch H, Abdul-Khaliq H, Meese E, Abu-Halima M. Towards a more comprehensive picture of the microRNA-23a/b-3p impact on impaired male fertility. Biology (Basel). 2023;12(6). 10.3390/biology12060800
45. Tobi EW Heijmans BT Kremer D Putter H Delemarre-van de Waal HA Finken MJ DNA methylation of IGF2, GNASAS, INSIGF and LEP and being born small for gestational age Epigenetics 2011 6 2 171 6 10.4161/epi.6.2.13516 20930547
Tobi EW, Heijmans BT, Kremer D, Putter H, Delemarre-van de Waal HA, Finken MJ, et al. DNA methylation of IGF2, GNASAS, INSIGF and LEP and being born small for gestational age. Epigenetics. 2011;6(2):171–6. 10.4161/epi.6.2.1351620930547 10.4161/epi.6.2.13516
46. Barberet J Binquet C Guilleman M Doukani A Choux C Bruno C Do assisted reproductive technologies and in vitro embryo culture influence the epigenetic control of imprinted genes and transposable elements in children? Hum Reprod 2021 36 2 479 92 10.1093/humrep/deaa310 33319250
Barberet J, Binquet C, Guilleman M, Doukani A, Choux C, Bruno C, et al. Do assisted reproductive technologies and in vitro embryo culture influence the epigenetic control of imprinted genes and transposable elements in children? Hum Reprod. 2021;36(2):479–92. 10.1093/humrep/deaa31033319250 10.1093/humrep/deaa310
47. Zhang G Mao Y Zhang Y Huang H Pan J Assisted reproductive technology and imprinting errors: analyzing underlying mechanisms from epigenetic regulation Human Fertility. 2023 26 4 864 78 10.1080/14647273.2023.2261628 37929309
Zhang G, Mao Y, Zhang Y, Huang H, Pan J. Assisted reproductive technology and imprinting errors: analyzing underlying mechanisms from epigenetic regulation. Human Fertility. 2023;26(4):864–78. 10.1080/14647273.2023.226162837929309 10.1080/14647273.2023.2261628
48. Katari S Turan N Bibikova M Erinle O Chalian R Foster M DNA methylation and gene expression differences in children conceived in vitro or in vivo Hum Mol Genet 2009 18 20 3769 78 10.1093/hmg/ddp319 19605411
Katari S, Turan N, Bibikova M, Erinle O, Chalian R, Foster M, et al. DNA methylation and gene expression differences in children conceived in vitro or in vivo. Hum Mol Genet. 2009;18(20):3769–78. 10.1093/hmg/ddp31919605411 10.1093/hmg/ddp319
49. Melamed N Choufani S Wilkins-Haug LE Koren G Weksberg R Comparison of genome-wide and gene-specific DNA methylation between ART and naturally conceived pregnancies Epigenetics 2015 10 6 474 483 10.4161/15592294.2014.988041 25580569
Melamed N, Choufani S, Wilkins-Haug LE, Koren G, Weksberg R. Comparison of genome-wide and gene-specific DNA methylation between ART and naturally conceived pregnancies. Epigenetics. 2015;10(6):474–83. 10.4161/15592294.2014.98804125580569 10.4161/15592294.2014.988041
50. Marques CJ Costa P Vaz B Carvalho F Fernandes S Barros A Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia Molecular Human Reproduction. 2008 14 2 67 74 10.1093/molehr/gam093 18178607
Marques CJ, Costa P, Vaz B, Carvalho F, Fernandes S, Barros A, et al. Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia. Molecular Human Reproduction. 2008;14(2):67–74. 10.1093/molehr/gam09318178607 10.1093/molehr/gam093
51. Marques CJ Francisco T Sousa S Carvalho F Barros A Sousa M Methylation defects of imprinted genes in human testicular spermatozoa Fertil Steril 2010 94 2 585 594 10.1016/j.fertnstert.2009.02.051 19338988
Marques CJ, Francisco T, Sousa S, Carvalho F, Barros A, Sousa M. Methylation defects of imprinted genes in human testicular spermatozoa. Fertil Steril. 2010;94(2):585–94. 10.1016/j.fertnstert.2009.02.05119338988 10.1016/j.fertnstert.2009.02.051
52. Hammoud SS Purwar J Pflueger C Cairns BR Carrell DT Alterations in sperm DNA methylation patterns at imprinted loci in two classes of infertility Fertil Steril 2010 94 5 1728 33 10.1016/j.fertnstert.2009.09.010 19880108
Hammoud SS, Purwar J, Pflueger C, Cairns BR, Carrell DT. Alterations in sperm DNA methylation patterns at imprinted loci in two classes of infertility. Fertil Steril. 2010;94(5):1728–33. 10.1016/j.fertnstert.2009.09.01019880108 10.1016/j.fertnstert.2009.09.010
53. Amjadian T Yaghmaei P Nasim HR Yari K Impact of DNA methylation of the human mesoderm-specific transcript (MEST) on male infertility Heliyon 2023 9 10 e21099 10.1016/j.heliyon.2023.e21099 37928396
Amjadian T, Yaghmaei P, Nasim HR, Yari K. Impact of DNA methylation of the human mesoderm-specific transcript (MEST) on male infertility. Heliyon. 2023;9(10):e21099. 10.1016/j.heliyon.2023.e2109937928396 10.1016/j.heliyon.2023.e21099
54. Song B Chen Y Wang C Li G Wei Z He X Poor semen parameters are associated with abnormal methylation of imprinted genes in sperm DNA Reprod Biol Endocrinol 2022 20 1 155 10.1186/s12958-022-01028-8 36357889
Song B, Chen Y, Wang C, Li G, Wei Z, He X, et al. Poor semen parameters are associated with abnormal methylation of imprinted genes in sperm DNA. Reprod Biol Endocrinol. 2022;20(1):155. 10.1186/s12958-022-01028-836357889 10.1186/s12958-022-01028-8
55. Montjean D Ravel C Benkhalifa M Cohen-Bacrie P Berthaut I Bashamboo A Methylation changes in mature sperm deoxyribonucleic acid from oligozoospermic men: assessment of genetic variants and assisted reproductive technology outcome Fertil Steril 2013 100 5 1241 7 10.1016/j.fertnstert.2013.06.047 23916795
Montjean D, Ravel C, Benkhalifa M, Cohen-Bacrie P, Berthaut I, Bashamboo A. Methylation changes in mature sperm deoxyribonucleic acid from oligozoospermic men: assessment of genetic variants and assisted reproductive technology outcome. Fertil Steril. 2013;100(5):1241–7. 10.1016/j.fertnstert.2013.06.04723916795 10.1016/j.fertnstert.2013.06.047
56. Cannarella R Leanza C Crafa A Barbagallo F La Vignera S Condorelli RA Sperm mesoderm specific transcript gene methylation status in infertile patients: a systematic review and meta-analysis World J Mens Health 2023 10.5534/wjmh.230094 37853535
Cannarella R, Leanza C, Crafa A, Barbagallo F, La Vignera S, Condorelli RA, et al. Sperm mesoderm specific transcript gene methylation status in infertile patients: a systematic review and meta-analysis. World J Mens Health. 2023. 10.5534/wjmh.23009437853535 10.5534/wjmh.230094
57. Leitão E Di Persio S Laurentino S Wöste M Dugas M Kliesch S The sperm epigenome does not display recurrent epimutations in patients with severely impaired spermatogenesis Clin Epigenetics. 2020 12 1 61 10.1186/s13148-020-00854-0 32375885
Leitão E, Di Persio S, Laurentino S, Wöste M, Dugas M, Kliesch S, et al. The sperm epigenome does not display recurrent epimutations in patients with severely impaired spermatogenesis. Clin Epigenetics. 2020;12(1):61. 10.1186/s13148-020-00854-032375885 10.1186/s13148-020-00854-0
58. Laurentino S Beygo J Nordhoff V Kliesch S Wistuba J Borgmann J Epigenetic germline mosaicism in infertile men Hum Mol Genet 2015 24 5 1295 1304 10.1093/hmg/ddu540 25336341
Laurentino S, Beygo J, Nordhoff V, Kliesch S, Wistuba J, Borgmann J, et al. Epigenetic germline mosaicism in infertile men. Hum Mol Genet. 2015;24(5):1295–304. 10.1093/hmg/ddu54025336341 10.1093/hmg/ddu540
59. Marques CJ João Pinho M Carvalho F Bièche I Barros A Sousa M DNA methylation imprinting marks and DNA methyltransferase expression in human spermatogenic cell stages Epigenetics 2011 6 11 1354 61 10.4161/epi.6.11.17993 22048249
Marques CJ, João Pinho M, Carvalho F, Bièche I, Barros A, Sousa M. DNA methylation imprinting marks and DNA methyltransferase expression in human spermatogenic cell stages. Epigenetics. 2011;6(11):1354–61. 10.4161/epi.6.11.1799322048249 10.4161/epi.6.11.17993
60. Deyssenroth MA Li Q Escudero C Myatt L Chen J Roberts JM Differences in placental imprinted gene expression across preeclamptic and non-preeclamptic pregnancies Genes 2020 11 10 1146 10.3390/genes11101146 33003346
Deyssenroth MA, Li Q, Escudero C, Myatt L, Chen J, Roberts JM. Differences in placental imprinted gene expression across preeclamptic and non-preeclamptic pregnancies. Genes. 2020;11(10):1146. 10.3390/genes1110114633003346 10.3390/genes11101146
61. Wehkalampi K Muurinen M Wirta SB Hannula-Jouppi K Hovi P Järvenpää AL Altered methylation of IGF2 locus 20 years after preterm birth at very low birth weight PLoS One 2013 8 6 e67379 10.1371/journal.pone.0067379 23840686
Wehkalampi K, Muurinen M, Wirta SB, Hannula-Jouppi K, Hovi P, Järvenpää AL, et al. Altered methylation of IGF2 locus 20 years after preterm birth at very low birth weight. PLoS One. 2013;8(6):e67379. 10.1371/journal.pone.006737923840686 10.1371/journal.pone.0067379
62. Darbandi M Darbandi S Agarwal A Baskaran S Dutta S Sengupta P Reactive oxygen species-induced alterations in H19-Igf2 methylation patterns, seminal plasma metabolites, and semen quality J Assist Reprod Genet 2019 36 2 241 253 10.1007/s10815-018-1350-y 30382470
Darbandi M, Darbandi S, Agarwal A, Baskaran S, Dutta S, Sengupta P, et al. Reactive oxygen species-induced alterations in H19-Igf2 methylation patterns, seminal plasma metabolites, and semen quality. J Assist Reprod Genet. 2019;36(2):241–53. 10.1007/s10815-018-1350-y30382470 10.1007/s10815-018-1350-y
