
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

96643
10.7554/eLife.96643
version of record
Research Article
Structural Biology and Molecular Biophysics
PPI-hotspotID for detecting protein–protein interaction hot spots from the free protein structure
Chen Yao Chi https://orcid.org/0000-0003-0205-6078
backy2010.chen@gmail.com
1
Sargsyan Karen karen.sarkisyan@gmail.com
1
Wright Jon D 1†
Chen Yu-Hsien https://orcid.org/0000-0002-0475-1042
1
Huang Yi-Shuian https://orcid.org/0000-0001-9000-7748
1
Lim Carmay https://orcid.org/0000-0001-9077-7769
carmay@gate.sinica.edu.tw
1†
1 https://ror.org/05bxb3784 Institute of Biomedical Sciences, Academia Sinica Taipei Taiwan
Haider Shozeb Reviewing Editor https://ror.org/02jx3x895 University College London United Kingdom

Cui Qiang Senior Editor https://ror.org/05qwgg493 Boston University United States

† Immunwork, Inc, Taipei, Taiwan.

16 9 2024
2024
13 RP9664315 2 2024
This manuscript was published as a preprint.19 2 2024

This manuscript was published as a reviewed preprint.28 5 2024

The reviewed preprint was revised.07 8 2024

© 2024, Chen et al
2024
Chen et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Experimental detection of residues critical for protein–protein interactions (PPI) is a time-consuming, costly, and labor-intensive process. Hence, high-throughput PPI-hot spot prediction methods have been developed, but they have been validated using relatively small datasets, which may compromise their predictive reliability. Here, we introduce PPI-hotspotID, a novel method for identifying PPI-hot spots using the free protein structure, and validated it on the largest collection of experimentally confirmed PPI-hot spots to date. We explored the possibility of detecting PPI-hot spots using (i) FTMap in the PPI mode, which identifies hot spots on protein–protein interfaces from the free protein structure, and (ii) the interface residues predicted by AlphaFold-Multimer. PPI-hotspotID yielded better performance than FTMap and SPOTONE, a webserver for predicting PPI-hot spots given the protein sequence. When combined with the AlphaFold-Multimer-predicted interface residues, PPI-hotspotID yielded better performance than either method alone. Furthermore, we experimentally verified several PPI-hotspotID-predicted PPI-hot spots of eukaryotic elongation factor 2. Notably, PPI-hotspotID can reveal PPI-hot spots not obvious from complex structures, including those in indirect contact with binding partners. PPI-hotspotID serves as a valuable tool for understanding PPI mechanisms and aiding drug design. It is available as a web server (https://ppihotspotid.limlab.dnsalias.org/) and open-source code (https://github.com/wrigjz/ppihotspotid/).

PPI-hot spots
AutoGluon
AlphaFold-Multimer
protein binding
machine learning
free protein structure
Research organism

None
http://dx.doi.org/10.13039/501100001869 Academia Sinica AS-IA-107-L03 Lim Carmay http://dx.doi.org/10.13039/501100002701 Ministry of Education MOST-98-2113-M-001-011 Lim Carmay http://dx.doi.org/10.13039/501100016004 Institute of Biomedical Sciences, Academia Sinica Huang Yi-Shuian The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementPPI-hotspotID, trained using an automated machine-learning framework, AutoGluon, on the largest PPI-hot spot dataset to date, detects hot spots beyond protein–protein interfaces, uncovering druggable interactions to aid design of PPI-modulating therapeutics.
publishing-routeprc
==== Body
pmcIntroduction

Protein–protein interactions (PPIs) play a crucial role in cellular physiology, and their dysregulation is associated with various diseases (David et al., 2012) such as cancer (Nero et al., 2014), infectious diseases, and neurodegenerative diseases (Blazer and Neubig, 2009). Identifying residues critical for PPIs (termed PPI-hot spots) is important for elucidating protein function and designing targeted biomedical interventions (Cukuroglu et al., 2014; Rosell and Fernández-Recio, 2018). Conventionally, PPI-hot spots are defined as residues whose mutations to alanine cause ≥2 kcal/mol drop in the protein binding free energy (Clackson and Wells, 1995; Bogan and Thorn, 1998; DeLano, 2002; Li et al., 2004; Keskin et al., 2005; Moreira et al., 2007). However, this definition, based on measuring the binding free energy change upon mutation to alanine, limits the number of experimentally determined PPI-hot spots. Hence, PPI-hot spots have been more broadly defined to include residues whose mutations, not necessarily to alanine, significantly impair/disrupt PPIs (Fischer et al., 2003; Chen et al., 2022), as detected by experimental methods such as coimmunoprecipitation and yeast two-hybrid screening. As each mutant must be purified and analyzed separately, experimental detection of PPI-hot spots is time-consuming, costly, and labor-intensive.

To enable large-scale detection of PPI-hot spots, high-throughput PPI-hot spot prediction methods have been developed. They generally fall into two categories (Rosário‐Ferreira et al., 2022): (1) methods that compute the binding energy/free energy difference between the wild-type protein and a mutant using classical force fields or empirical scoring functions (Moreira et al., 2007; Massova and Kollman, 1999; Huo et al., 2002; Guerois et al., 2002; Kortemme and Baker, 2002; González-Ruiz and Gohlke, 2006; Grosdidier and Fernández-Recio, 2008; Yogurtcu et al., 2008; Barlow et al., 2018; Ibarra et al., 2019). (2) Methods that employ classifiers such as nearest neighbor, support vector machines, decision trees, Bayesian/neural networks, random forest, and ensemble machine-learning models using various features including conservation, secondary structure, solvent-accessible surface area (SASA), and atom density (Rosário‐Ferreira et al., 2022; Darnell et al., 2007; Cho et al., 2009; Assi et al., 2010; Xia et al., 2010; Lise et al., 2011; Wang et al., 2012; Ye et al., 2014; Munteanu et al., 2015; Melo et al., 2016; Moreira et al., 2017; Qiao et al., 2018; Sitani et al., 2021; Ovek et al., 2022). Most of the PPI-hot spot prediction methods rely on the protein complex structure and some are accessible via webservers; for example, Hotpoint (Tuncbag et al., 2010), KFC2 (Zhu and Mitchell, 2011), PredHS (Deng et al., 2014), and PredHS2 (Wang et al., 2018a). Fewer methods use only the free protein structure (Higa and Tozzi, 2009; Zerbe et al., 2012; Ozbek et al., 2013; Agrawal et al., 2014; Kozakov et al., 2015) or sequence (Qiao et al., 2018; Ofran and Rost, 2007; Chen et al., 2013; Nguyen et al., 2013; Huang and Zhang, 2016; Hu et al., 2017; Jiang et al., 2017; Liu et al., 2018; Preto and Moreira, 2020; Yao et al., 2022), and SPOTONE (hot SPOTs ON protein complexes with Extremely randomized trees) is available as a web server. SPOTONE (Preto and Moreira, 2020) predicts PPI-hot spots from the protein sequence using residue-specific features such as atom type, amino acid (aa) properties, secondary structure propensity, and mass-associated values to train an ensemble of extremely randomized trees.

The PPI-hot spot prediction methods have mostly been trained, validated, and tested on data from the Alanine Scanning Energetics database (ASEdb) (Thorn and Bogan, 2001) and/or the Structural Kinetic and Energetic database of Mutant Protein Interactions (SKEMPI) 2.0 database (Jankauskaite et al., 2019). However, antibody–antigen interactions have different sequence and structural characteristics compared to non-antibody PPIs (Wang et al., 2018b). Therefore, our focus is exclusively on non-antibody proteins in this study. The ASEdb contains 96 PPI-hot spots from 26 proteins. SKEMPI 2.0, which includes single-point mutations not necessarily to alanine that decrease the protein binding free energy by ≥2 kcal/mol, has 343 PPI-hot spots from 117 distinct proteins, 40 of which overlap with ASEdb. Altogether, ASEdb and SKEMPI contain 399 distinct PPI-hot spots in 132 proteins. To increase this number of distinct PPI-hot spots, we have expanded the definition of PPI-hot spots to include mutations in UniProtKB (UniProt Consortium, 2018) that have been manually curated as significantly impairing/disrupting PPIs (Chen et al., 2022). This expanded definition led to the creation of the PPI-HotspotDB database, which contains 4039 experimentally determined PPI-hot spots in 1893 proteins. To calibrate PPI-hot spot prediction methods using the free protein structure, a benchmark was derived from PPI-HotspotDB (Chen et al., 2022). This benchmark called PPI-Hotspot+PDBBM contains nonredundant proteins with free structures and known PPI-hot spots. The proteins in PPI-Hotspot+PDBBM share <60% sequence identity, which has been shown to be a reasonable threshold for grouping domains with similar functions (Chen et al., 2022).

Our aim is to develop a method for identifying PPI-hot spots in non-antibody proteins using free protein structures. First, we updated the PPI-Hotspot+PDBBM benchmark and constructed a dataset comprising 158 nonredundant proteins with free structures harboring 414 experimentally known PPI-hot spots and 504 PPI-nonhot spots (see ‘Materials and methods’). Using this dataset, we applied an automatic machine-learning framework that automates the machine-learning pipeline to detect PPI-hot spots using the aa type as well as structural, energetic, and evolutionary features of each residue in a protein. The resulting prediction model, named PPI-hotspotID, identifies PPI-hot spots using an ensemble of classifiers and only four residue features (conservation, aa type, SASA, and gas-phase energy, ΔGgas). We explored the possibility of detecting PPI-hot spots using the FTMap server in the PPI mode, which identifies hot spots on protein–protein interfaces from free protein structures (Kozakov et al., 2015). These hot spots are identified by consensus sites − regions that bind multiple probe clusters (Zerbe et al., 2012; Kozakov et al., 2015; Kozakov et al., 2011). Such regions are deemed to be important for any interaction involving that region of the target, independent of partner protein (Zerbe et al., 2012). PPI-hot spots were identified as residues in van der Waals (vdW) contact with probe ligands within the largest consensus site containing the most probe clusters. We also explored the possibility of detecting PPI-hot spots using the interface residues predicted by AlphaFold-Multimer (Evans et al., 2021), which has been shown to outperform current docking methods in predicting protein–protein complexes. Finally, we illustrated the utility of PPI-hotspotID by applying it to detect PPI-hot spots of eukaryotic elongation factor 2 (eEF2), a translation factor essential for peptide elongation, and experimentally verified the predictions.

Results

Evaluating the performance of PPI-hot spot detection methods

The goal of PPI-hotspotID is to detect true PPI-hot spots rather than true PPI-nonhot spots in proteins. Hence, we assessed the performance of PPI-hotspotID by computing the sensitivity/recall (the fraction of true PPI-hot spots correctly identified),(1) Sensitivity=TPTP+FN

the fraction of predicted PPI-hot spots that are true PPI-hot spots; that is,(2) Precision=TPTP+FP

and the F1-score, which combines recall and precision:(3) F1=2×(sensitivity×precision)(sensitivity + precision)=2TP2TP+FP+FN

Since our dataset also contains true PPI-nonhot spots, we calculated the specificity (the fraction of true PPI-nonhot spots correctly identified):(4) Specificity=TNTN+FP

In Equations 1–4, TP (true positives) or TN (true negatives) is the number of correctly predicted PPI-hot spots or PPI-nonhot spots, and FP (false positives) or FN (false negatives) is the number of wrongly predicted PPI-hot spots or PPI-nonhot spots.

Performance of PPI-hotspotID vs. FTMap and SPOTONE

We compared the performance of PPI-hotspotID, FTMap (Kozakov et al., 2015), and SPOTONE (Preto and Moreira, 2020) using a dataset containing 414 true PPI-hot spots and 504 nonhot spots. Source data 1 lists the UniProt codes of the PPI-hot spot-containing protein and its binding partner, the PDB code(s) and chain of the free protein structure, the UniProt and PDB numbering of the PPI-hot spot, the wild-type→mutant residue, the corresponding protein binding free energy change and source given by the PubMed reference number, and the PPI-hotspotID assignment, where P indicates PPI-hot spot and N indicates nonhot spot. Source data 2 lists the UniProt codes of the PPI-hot spot-containing protein A and binding partner protein B, the PDB code-chain and length of the free and bound protein A structures, the PDB code-chain of the bound protein B structure, the sequence identity between free and bound protein A structures, and the PPI-hot spots of protein A. Note that the 414 true PPI-hot spots represent only 2% of the total number of residues (21,722) in the 158 proteins.

Given the free protein structure, PPI-hotspotID and SPOTONE (Preto and Moreira, 2020) predict PPI-hot spots based on a probability threshold (>0.5). FTMap, in the PPI mode, detects PPI-hot spots as consensus sites/regions on the protein surface that bind multiple probe clusters (Kozakov et al., 2011). Residues in vdW contact with probe molecules within the largest consensus site were compared with PPI-hotspotID/SPOTONE predictions. Residues not classified as PPI-hot spots by each method were considered as PPI-nonhot spots. Table 1 summarizes the results for our dataset, with the F1 score in parentheses representing the mean validation F1 score. Compared to FTMap/SPOTONE, PPI-hotspotID detected a much higher fraction of true positives (0.67 vs. 0.07/0.10) and achieved a significantly higher F1 score (0.71 vs. 0.13/0.17).

Table 1. Performance of the PPI-hotspotID vs. FTMap and SPOTONE.

Method	PPI-hotspotID	FTMap	SPOTONE		
TP	278	30	40		
FN	136	384	374	
TN	417	487	481	
FP	87	17	23	
Sensitivity	0.67	0.07	0.10	
Precision	0.76	0.64	0.64	
F1	0.71 (0.66)*	0.13	0.17	
Specificity	0.83	0.97	0.95	
Each method was tested using the same dataset comprising 414 experimentally known PPI-hot spots (TP + FN) and 504 PPI-nonhot spots (TN + FP).

TP = true positive; FP = false positive; TN = true negative; FN = false negative.

* The F1 score in parentheses corresponds to the validation F1 score.

To elucidate the differences between the PPI-hot spots predicted by PPI-hotspotID and those by FTMap or SPOTONE, we compared their respective true-positive predictions. The Venn diagram in Table 1 shows a substantial overlap in true positives between FTMap or SPOTONE and PPI-hotspotID: FTMap shared 23/30 true positives with PPI-hotspotID, whereas SPOTONE shared 34/40 with PPI-hotspotID, but only 3 with FTMap. Only three true positives were predicted by all three methods. PPI-hotspotID identified many true positives that were not detected by FTMap or SPOTONE probably because it employed aspects not considered by FTMap or SPOTONE such as the gas-phase energy, ΔGgas (see ‘Discussion’). Furthermore, SPOTONE defined true negatives as residues whose mutation to alanine led to protein binding free energy changes (ΔΔGbind) of ≤2.0 kcal/mol, whereas we defined true negatives as residues whose alanine/nonalanine mutations resulted in negligible protein binding free energy changes (ΔΔGbind < 0.5 kcal/mol) or did not perturb PPIs in immunoprecipitation or GST pull-down assays (see ‘Materials and methods’).

Interface vs. noninterface PPI-hot spots

We can estimate the fraction of PPI-hot spots at the protein interface for 74 of the 158 nonredundant proteins in our dataset with complex structures. These 74 proteins harboring 243 true PPI-hot spots form 78 PPI pairs. Using the UniProt codes of each protein and its binding partner, we identified all complex structures in the PDB. Based on the complex structures of each PPI pair, we classified a PPI-hot spot as an interface one if it formed hydrogen bonds or vdW contacts with the partner protein (Laskowski et al., 2018); otherwise, it was deemed a noninterface PPI-hot spot. Among the 243 true PPI-hot spots, 67 (27.6%) lacked such contacts across the protein interface. For these 74 proteins, PPI-hotspotID predicted 240 PPI-hot spots, out of which 43 (18%) are noninterface PPI-hot spots, SPOTONE identified only five noninterface PPI-hot spots, whereas FTMap did not predict any. For example, the complex structure of interleukin-4 bound to interleukin-4 receptor subunitα (PDB: 1IAR) (Hage et al., 1999) in Figure 1 revealed three interface PPI-hot spots (E13, R92, and N93) and two noninterface ones (K127 and Y128). Based on the free structure of interleukin-4 (PDB: 1BBN) (Powers et al., 1992), PPI-hotspotID identified all five true positives, SPOTONE detected an interfacial PPI-hot spot (N93), whereas FTMap failed to identify any true positives.

Figure 1. Interface vs. noninterface PPI-hot spots.

(Top left) The X-ray structure (PDB: 1IAR) of interleukin-4 (gray) in complex with interleukin-4 receptor subunit alpha (wheat) with five PPI-hot spots; interface PPI-hot spots (E13, R92, and N93) are in blue and the noninterface ones (K127 and Y128) are in green. The PPI-hot spot numberings are based on the interleukin-4 free structure (PDB: 1BBN). The correct predictions of PPI-hotspotID (top right), FTMap (bottom left), and SPOTONE (bottom right) are mapped to the corresponding residues of the complex structure.

Performance of AlphaFold-Multimer, PPI-hotspotID and their combination in predicting PPI-hot spots

To assess the possibility of detecting PPI-hot spots using the interface residues predicted by AlphaFold-Multimer (Evans et al., 2021) as PPI-hot spots when complex structures are unavailable, we focused on 48 ‘unsolved’ AB complex structures involving 47 proteins in the PPI-Hotspot+PDBBM(1.1), as one of the proteins, human neurotrophin (UniProtID P20783, PDB 1nt30A) interacted with two different proteins (UniProtID Q16288 and P17643). These 48 unsolved complex structures contain 90 PPI-hot spots and 45 nonhot spots. We employed the protein A structure sequence from the PPI-Hotspot+PDBBM(1.1) and the entire protein B sequence from UniProtKB (UniProt Consortium, 2018) as inputs for the AlphaFold-Multimer module in ColabFold (Mirdita et al., 2022). This generated model structures for each AB complex. Interface residues were defined based on the AMBER-relaxed model structure with the highest pTM score using a cutoff distance of 5 Å reflecting residues in close contact. Interface residues were predicted as PPI-hot spots and noninterface residues as nonhot spots.

In identifying PPI-hot spots using PPI-hotspotID, we first excluded 90 true PPI-hot spots and 45 nonhot spots belonging to 47 proteins lacking complex PDB structures from our dataset. We then used an automatic machine-learning framework to train an ensemble of machine-learning models using four features (kC, aa residue type, SASAi, and ΔGigas) on the true PPI-hot spots and nonhot spots in the remaining 111 proteins in our dataset. The final ensemble model was used to identify PPI-hot spots in the 47 proteins lacking complex structures in our dataset. The resulting sensitivity (0.58) and F1 score (0.66) in Table 2 were lower than those in Table 1 using the full dataset. Nevertheless, they were greater than those achieved using AlphaFold-Multimer-predicted interface residues as PPI-hot spots (0.41 and 0.54). When we combined the PPI-hotspotID-predicted PPI-hot spots with the AlphaFold-Multimer-predicted interface residues, the resulting sensitivity (0.70) and F1 values (0.72) were higher than those obtained by each method alone. This indicates that PPI-hotspotID can identify true PPI-hot spots that reside outside the protein–protein interface.

Table 2. Performance of AlphaFold-Multimer, PPI-hotspotID, and their combination for 48 ‘unsolved’ complex structures.

Method	AlphaFold2-Multimer	PPI-hotspotID	AlphaFold2-Multimer+PPI-hotspotID	
TP	37	52	63	
FN	53	38	27	
TN	35	29	24	
FP	10	16	21	
Sensitivity	0.41	0.58	0.70	
Precision	0.79	0.77	0.75	
F1	0.54	0.66*	0.72	
Specificity	0.78	0.64	0.53	
Each method was tested using the same dataset comprising 90 experimentally known PPI-hot spots (TP+FN) and 45 PPI-nonhot spots (TN+FP) in 48 protein complexes with no known structures.

TP = true positive; FP = false positive; TN = true negative; FN = false negative.

* No validation F1 score is provided since AutoGluon was used to train an ensemble of machine-learning models on a dataset that excludes the 48 ‘unsolved’ complex structures (see text).

Experimental verification of PPI-hotspotID’s predictions in human eEF2

We experimentally verified predictions made by PPI-hotspotID by using it to detect the PPI-hot spots of eEF2, an essential translation factor that hydrolyzes GTP to catalyze peptide elongation. Binding of cytoplasmic polyadenylation element-binding protein-2 (CPEB2) to eEF2 may interfere with conformational changes of eEF2 on ribosomes, thereby affecting the efficiency of eEF2-mediated GTP hydrolysis, and slowing down translation of hypoxia-inducible factor (HIF)–1α mRNA (Chen and Huang, 2012). No eEF2-CPEB2 complex structure has been solved, but a 5 Å electron microscopy structure of eEF2 (PDB 4v6x-A) (Anger et al., 2013) is available. Using the CPEB2 N-terminus for a yeast two-hybrid screen, a positive clone containing the eEF2 residues 717–803 had been identified and subsequent co-IP assay revealed a CPEB2-binding domain comprising eEF2 residues 743–817 (Chen and Huang, 2012). Thus, we focused on this domain, which shares ≤20% sequence identity with the 158 nonredundant proteins in our dataset, in predicting PPI-hot spots. Based on the free eEF2 structure (PDB 4v6x-A) (Anger et al., 2013), PPI-hotspotID predicted F794 as the PPI-hot spot with the highest probability of 0.67. So, we chose to test F794 and seven other predicted PPI-hot spots (L763, R767, G768, G778, T779, R801, A808) that were >12 Å from F794, as well as four predicted PPI-nonhot spots (E773, P789, V790, Q807).

To validate PPI-hotspotID’s predictions, we mutated the aforementioned predicted PPI-hot spots and PPI-nonhot spots in mouse eEF2 (meEF2), which shares 99% sequence identity with human eEF2. The generated eEF2 mutants (L763A, 766AAA768, E773Q, 778AAA780, 789AA790, F794A, R801A, Q807E, A808S, and D815A), along with wild-type eEF2 and negative control (enhanced green fluorescent protein [EGFP]), were then screened for interaction with CPEB2 by co-immunoprecipitation (co-IP). This assay identified F794 as a critical eEF2 residue for binding to CPEB2. To confirm the initial screening result, we selected three mutants (778AAA780, F794A, and D815A designated as mut1, mut2, and mut3) for further analysis (Figure 2a). The interaction of wild-type and mutant eEF2 with CPEB2 was analyzed again by reciprocal co-IP. The results in Figure 2b show that the F794A mutation (mut2) abolished binding to CPEB2.

Figure 2. Evaluation of the predicted CPEB2-interacting amino acid residues in eEF2.

(a) Salient features of mouse eEF2, showing the various domains and the mutated amino acids in domain V. mut 1, G778A, T779A, and P780A; mut 2, F794A; mut 3, D815A. (b) Reciprocal co-immunoprecipitation (co-IP). The 293T cells expressing myc-CPEB2 along with wt or mutant flag-eEF2 or control GFP were harvested and then precipitated with flag or myc IgG. The precipitated substances were used for western blotting with myc and flag antibodies. IP, immunoprecipitation; IB, immunoblotting; IgG H.C., IgG heavy chain. (c) HeLa cells transfected with the plasmid expressing shRNA against human eEF2 (siheEF2) were harvested after 4-day puromycin selection for western blotting. HeLa cells transfected with the eEF2 knockdown plasmid along with flag-tagged wt or mutant mouse eEF2 after 4-day selection with puromycin and G418 were used for (d) S35 -met/cys-labeling of synthesized proteins or (e) western blotting with the denoted antibodies. The normalized HIF-1α protein level (HIF-1α/β-actin signal) was calculated and expressed as mean ± SEM from three independent experiments. Two-tailed Student’s t-test, *<0.05.

Figure 2—source data 1. Containing uncropped images of the membranes for Figure 2b, c and e and phosphoimager file for Figure 2d.

Figure 2—source data 2. Containing the original files of the full raw unedited blots.

Figure 2—source data 3. Listing primer sequences.

Figure 2—figure supplement 1. Uncropped immunoblot images.

The uncropped images for Figure 2b, c, and e are shown with indicated molecular weight marker.

Next, we investigated whether disrupting the association between CPEB2 and eEF2 affects HIF-1α expression in vivo. Because eEF2 is an essential and abundant translational factor, its ectopic expression alone was insufficient to override the function of endogenous eEF2. Thus, we tested the F794A mutant under knockdown of endogenous eEF2 condition. HeLa cells were transfected with plasmids lacking (siCtrl) or containing a short hairpin sequence for human eEF2 (siheEF2) and subjected to puromycin selection. Both shRNA sequences, specifically knocking down human but not mouse eEF2, decreased endogenous eEF2 after 4 days (Figure 2c). HeLa cells were then transfected with the siheEF2 and flag-meEF2 (wild-type, mut2, or mut3) plasmids and subjected to puromycin and G418 selection for 4 days. Cells that survived were incubated with S35-methionine/cysteine to metabolically label synthesized proteins. The expression of the F794A or D815A mutant did not affect general protein synthesis (Figure 2d). However, the level of HIF-1α, but not CPEB2 or β-actin, was selectively increased in HeLa cells reconstituted with the F794A mutant (Figure 2e). Figure 2—figure supplement 1 shows full-length gels and blots in Figure 2, and Figure 2—source data 1 shows the uncropped immunoblot images, and Figure 2—source data 2 contains raw unedited blots. Thus, the eEF2 F794A mutation influences the translation of CPEB2-targeted HIF-1α mRNA without affecting general translation function.

Discussion

Identifying PPI-hot spots is challenging especially when the complex structure is lacking. A key hurdle is the lack of experimental data on PPI-hot spots, which hampers the training of accurate machine-learning models for their prediction. Here, we introduced two novel elements that have helped to identify PPI-hot spots using the unbound structure. First, we have constructed a dataset comprising 414 experimentally known PPI-hot spots and 504 nonhot spots, and carefully checked that PPI-hot spots have no mutations resulting in ΔΔGbind < 0.5 kcal/mol, whereas nonhot spots have no mutations resulting in ΔΔGbind ≥ 0.5 kcal/mol or impact binding in immunoprecipitation or GST pull-down assays (see ‘Materials and methods’). In contrast, SPOTONE (Preto and Moreira, 2020) employed nonhot spots defined as residues that upon alanine mutation resulted in ΔΔGbind < 2.0 kcal/mol. Notably, previous PPI-hot spot prediction methods did not employ PPI-hot spots whose mutations have been curated to significantly impair/disrupt PPIs in UniProtKB (see ‘Introduction’). Second, we introduced novel features derived from unbound protein structures such as the gas-phase energy of the target protein relative to its unfolded state. The importance test results indicated the gas-phase energy as an important feature. This finding can be rationalized by considering how PPI-hot spots make significant contributions to the overall binding free energy, ΔGbind. PPI-hot spots can enhance favorable enthalpic contributions to the ΔGbind through hydrogen bonds or vdW contacts across the protein’s interface. This makes them energetically unstable in the absence of the protein’s binding partner and solvent; hence, the gas-phase energy was found to be an important input feature. Alternatively, PPI-hot spots can counteract unfavorable entropic loss upon protein binding by maintaining an optimal binding scaffold; hence, they are energetically stable.

Methods that rely on complex structures generally predict residues that make multiple contacts across the protein–protein interface as PPI-hot spots. Some of these methods assume that PPI-hot spots are exclusively located at the interface and aim to spot them among the interface residues (Wang et al., 2018a). In contrast, PPI-hotspotID leverages evolutionary conservation, residue type, and stability principles based on the free protein structure to detect PPI-hot spots, including those lacking direct contact with the partner protein. Such noninterface PPI-hot spots may serve to maintain an optimal scaffold for protein binding and are not uncommon: from our analysis of the 243 true PPI-hot spots in proteins with the complex structures, we found 67 ‘noninterface’ PPI-hot spots with no hydrogen bonds and/or vdW contacts across the protein interface. PPI-hotspotID identified 43 of these 67 noninterface PPI-hot spots. An illustrative example is the binding of Golgi resident protein (GCP60) with phosphatidylinositol 4-kinase β (PI4K-β). PPI-hotspotID correctly predicted all four experimentally known GCP60 PPI-hot spots including F19 and Y46, which do not form hydrogen bonds across the interface with PI4K-β (Figure 3). These results highlight the ability of PPI-hotspotID to identify PPI-hot spots involved in indirect interactions with partner proteins.

Figure 3. Interface and noninterface PPI-hot spots of Golgi resident protein (GCP60).

(Top) The structure (PDB 2N73) (Wright et al., 2024) of GCP60 (green) in complex with PI4K-β (cyan) with the GCP60–PI4K-β interface encircled. (Bottom) The four experimentally known PPI-hot spots of GCP60 are shown in red. H45 and Y49 form hydrogen bonds across the interface with PI4K-β. Although F19 and Y46 do not directly contact PI4K-β, F19 is in van der Waals (vdW) contact with Q42, which in turn forms vdW contacts with H45, whereas Y46 is in vdW contact with both H45 and Y49.

Proteins typically interact with multiple partners, but their PPI-hot spots may have been experimentally characterized for only a few partners. In some cases where PPI-hotspotID predicted residues that were absent in the PPI-Hotspot+PDBBM(1.1) as PPI-hot spots, the protein’s complex structures with other binding partners show intermolecular hydrogen bonds between PPI-hotspotID-predicted residues and residues of the respective partner proteins. This suggests that some of the PPI-hotspotID-predicted residues might be potential PPI-hot spots for other binding partners. For example, the death domain of CRADD (caspase-recruitment domain and death domain-containing adaptor protein) contains 7 experimentally known PPI-hot spots (N121, Q125, Y146, R147, K149, V156, Q169) critical for its interaction with PIDD (p53-induced death domain-containing protein). Based on the free crystal structure of CRADD (PDB 2O71-A) (Park and Wu, 2006), PPI-hotspotID correctly predicted three true positives (Y146, R147, and Q169), as well as G128. In the oligomeric structure (PDB 2OF5) (Park et al., 2007) of seven CRADD proteins in complex with five PIDD proteins, G128 shows no hydrogen-bonding interactions, but its neighbor, L127, forms a backbone – side chain hydrogen bond with R147 in another CRADD chain (Figure 4). A positively charged G128R mutation would repel the nearby positively charged R147 in another CRADD chain, thus disrupting the CRADD–CRADD interface and decreasing CRADD’s affinity for PIDD. Experimental data showed that the G128R CRADD mutant did not co-immunoprecipitate the PIDD death domain, and patients who have non-syndromic mental retardation possess the G128R mutant (Puffenberger et al., 2012). Thus, PPI-hotspotID could unveil a PPI-hot spot, G128, that is not apparent from the 2OF5 complex structure: although G128 does not directly interact with PIDD, its mutation, especially to an Arg, might perturb the CRADD–CRADD interface and thus CRADD’s oligomeric structure and binding affinity for PIDD.

Figure 4. Based on the free CRADD X-ray structure (PDB 2O71-A), PPI-hotspotID predicted G128 as a PPI-hot spot for CRADD–CRADD interactions.

(Left) The structure (PDB 2OF5) (Park et al., 2007) of seven CRADD proteins in complex with fuve PIDD proteins. The circle shows the CRADD–CRADD interface between chains C (cyan) and G (orange), whereas the other five CRADD chains are in gray, and the five PIDD proteins are in green. (Right) G128 (red) in CRADD (chain C) participates indirectly in CRADD–CRADD interactions via a backbone – side chain hydrogen bond between its neighbor, L127, and R147 in another CRADD (chain G).

The ability of PPI-hotspotID to detect PPI-hot spots provides biologists with a useful tool, as alanine-scanning mutagenesis and protein–protein complex structure determination to identify PPI-hot spots are laborious, time-consuming, and costly. Conventional methods based on complex structures might miss nonobvious PPI-hot spots with no direct interactions with the protein’s partner. AlphaFold-Multimer and future improved protein–protein complex prediction methods require knowledge of interacting partners and independent calculations for each known partner, which reduces the overall efficiency. Moreover, solved/modeled protein–protein complex structures only reveal the interface residues. In contrast, PPI-hotspotID can reveal nonobvious PPI-hot spots as well as potential PPI-hot spots for other protein partners, thus helping to elucidate the different PPI mechanisms.

Materials and methods

Dataset: True PPI-hot spots

We updated the PPI-Hotspot+PDBBM benchmark by removing two fused protein structures and adding new PPI-hot spots by (i) reviewing references in ASEdb (Thorn and Bogan, 2001) to include nonalanine mutations with ΔΔGbind > 2 kcal/mol, and (ii) checking the experimental data of certain mutations in UniProtKB (UniProt Consortium, 2018). For example, the PPI-Hotspot+PDBBM benchmark included R43A in aprataxin (UniProtID Q7Z2E3), annotated as ‘loss of interaction with MDC1’, but not K52A, annotated as ‘impairs interaction with MDC1’. However, when we checked the experimental data in the UniProtKB reference, the binding bands were absent for both R43A and K52A mutants; therefore, we added K52A as a PPI-hot spot. The updated benchmark, termed PPI-Hotspot+PDBBM(1.1), contains 414 PPI-hot spots. Among these, 104 PPI-hot spots in 32 nonredundant proteins are based on mutations resulting in ΔΔGbind ≥ 2 kcal/mol from ASEdb (Thorn and Bogan, 2001) and SKEMPI2.0 (Jankauskaite et al., 2019) with no known mutations resulting in ΔΔGbind < 0.5 kcal/mol. The remaining 310 PPI-hot spots in 128 nonredundant proteins are based on mutations that are manually curated in UniProtKB (UniProt Consortium, 2018) to significantly impair/disrupt PPIs. Two of the proteins have PPI-hot spots from ASEdb/SKEMPI2.0 and UniProtKB, resulting in a total of 158 nonredundant proteins with free structures harboring 414 PPI-hot spots.

True PPI-nonhot spots

To obtain PPI-nonhot spots for the 158 nonredundant proteins with true PPI-hot spots, we identified residues from ASEdb (Thorn and Bogan, 2001) and SKEMPI2.0 (Jankauskaite et al., 2019) databases where mutations to alanine/nonalanine resulted in protein ΔΔGbind < 0.5 kcal/mol. We also identified residues in the UniProtKB where mutations to alanine/nonalanine were curated not to perturb PPIs. We manually checked each reference to ensure that mutations of these residues did not lead to ΔΔGbind changes ≥0.5 kcal/mol or impact binding in immunoprecipitation or GST pull-down assays. PPI-nonhot spots in non-native proteins or regions with missing structures were excluded.

Input features

To distinguish PPI-hot spots from PPI-nonhot spots, we input sequence, structural, and stability features of each residue in the protein for training various machine-learning classifiers. The input features for each residue i of a protein included its aa type, conservation score, secondary structure, SASA, gas-phase energy, and respective components, polar solvation free energy, and nonpolar solvation free energy. The secondary structure, SASA, and energy components of each residue were computed using the DSSP program (Kabsch and Sander, 1983), FreeSasa (Mitternacht, 2016), and AmberTools version 20 (Case, 2020), respectively, using default parameters.

Per-residue free energy contributions

For a given free protein structure, the Reduce program (Word et al., 1999) was used to add hydrogens and assign the protonation states of ionizable residues. Additional missing heavy and hydrogen atoms were added using the AmberTools version 20 (Case, 2020) and the Amber FF19SB forcefield (Tian et al., 2020). To eliminate any steric clashes, we performed a conjugate gradients minimization with constraints on the heavy atoms using the Generalized Born model for 500 steps. The resulting structure was used to compute the per-residue energy/free energy contributions using the Molecular Mechanics Poisson–Boltzmann Surface Area module in AmberTools (Case, 2020). For each residue i in the protein, we computed the (i) molecular mechanics energy Eigas = EiMM,int + EiMM,vdW + EiMM,ele, where EiMM,int includes contributions from bonded terms, EiMM,vdW is the vdW interaction energy, and EiMM,ele is the electrostatic interaction energy as well as (ii) the polar (ΔGisolv,pol) and nonpolar (ΔGisolv,npl) solvation free energies relative to the corresponding values of residue i in an extended reference state where the residues do not interact with one another (Chen et al., 2007).

Per-residue conservation score

To calculate the conservation score, kiC, of residue i in a protein, we implemented a method similar to ConSurf (Glaser et al., 2003; Landau et al., 2005) to run in parallel with the energy evaluation code. First, we searched the UNIREF-90 database (Wu et al., 2006) using HMMER (Johnson et al., 2010) to find sequences similar to the target sequence. Near-duplicates were removed by clustering matched sequences with ≥95% pairwise sequence identity using CD-hit (Li and Godzik, 2006) and keeping only one representative. Since HMMER (Johnson et al., 2010) may only find good matches for a small proportion of the target sequence, we compared the HMMER sequences with the target sequence. We kept only those with >60% overlap with the target sequence and discarded sequences that were dissimilar (≤35% sequence identity) or nearly identical (≥95% sequence identity). Next, we pairwise aligned the remaining sequences, and if two sequences overlapped by >10% of the sequence, we rejected the shorter sequence. After this filtering process, the resulting HMMER hits were used, or if the number of hits exceeded 300, we selected the top 300 hits. These sequences were then aligned to the target sequence using MAFFT-LINSi (Nakamura et al., 2018). We then used the Rate4Site program (Pupko et al., 2002) to compute position-specific evolutionary rates from the generated multiple sequence alignment. These rates were normalized and grouped into ConSurf grades ranging from 1 to 9, where kC = 1 represents the most rapidly evolving residues, and kC = 9 indicates the most conserved residues.

Generating PPI-hot spot predictive model using AutoGluon

We provided all the aforementioned residue features including the conservation score, kiC, aa type, DSSP secondary structure, SASAi, EiMM,int, EiMM,vdW, EiMM,ele, EiMM, ΔGisolv,pol, andΔGisolv,npl to the Tabular module in AutoGluon v0.8.2 (https://auto.gluon.ai/stable/index.html). AutoGluon was chosen for model training and validation due to its robustness and user-friendly interface, allowing for the simultaneous and automated exploration of various machine-learning approaches and their combinations. Instead of using a single training set to train the model and a separate test set to evaluate its performance, we employed cross-validation as it utilizes the entire dataset for both training and testing, making efficient use of the limited data on PPI-hot spots and PPI-nonhot spots. AutoGluon-Tabular automatically chose a random partitioning of our dataset into multiple subsets/folds for training and validation. Notably, the training and validation data share insignificant homology as the average pairwise sequence identity in our dataset is 26%. Each fold was used once as a test set, while the remaining folds served as the training set. For each test set, the model’s performance was measured using the F1 score.

AutoGluon then trained individual ‘base’ models, including LightGBM, CatBoost, XGBoost, random forests, extremely randomized trees, neural networks, and K-nearest neighbors. Using the aggregated predictions of the base models as features in addition to the original features, AutoGluon trained multiple ‘stacker’ models, whose predictions were fed as inputs to additional higher layer stacker models in an iterative process called multilayer stacking. The output layer used ensemble selection to aggregate the predictions of the stacker models. To improve stacking performance, AutoGluon used all the data for both training and validation through repeated k-fold bagging of all models at all layers of the stack, where k is determined by best precision. We refer the reader to the original study by Erickson et al., 2020, which provides details on the methodology including the types of ‘base’ models, multilayer stack ensembling, and repeated k-fold bagging. Based on the highest mean F1 score, AutoGluon yielded a final PPI-hot spot predictive model that is a weighted regularized ensemble comprising more than a dozen different models (https://auto.gluon.ai/dev/api/autogluon.tabular.models.html).

Selecting key features

Next, we evaluated the importance of each feature by performing a permutation-based test (part of the AutoGluon package), in which a feature in a column was randomly shuffled across different residues (rows), and the F1 score was evaluated. The importance test results revealed the four most important residue features, which in order of their importance are (i) kC, (ii) aa residue type, (iii) SASAi, and (iv) ΔGigas. These four features were used to train an ensemble of machine-learning models using the entire dataset, consisting of 414 true PPI-hot spots and 504 nonhot spots. The resulting PPI-hot spot prediction model, named PPI-hotspotID, yielded an F1 score comparable to the F1 score obtained using the initial set of 10 features. PPI-hotspotID was implemented as a freely accessible web server (https://ppihotspotid.limlab.dnsalias.org/; Wright et al., 2024) with access to four virtual CPUs and 8 GB of memory. Calculations for a 539-residue protein (PDB 1c2bA) took 35 min. The source code for PPI-hotspotID is available at https://github.com/wrigjz/ppihotspotid/ (Wright, 2024).

Detecting PPI-hot spots using the AlphaFold-Multimer-predicted interface

In cases where experimental complex structures are unavailable, can the protein–protein complexes modeled by AlphaFold-Multimer (Evans et al., 2021) be used to identify PPI-hot spots using the predicted interface residues? To address this, we first identified PPI-hot spots within the PPI-Hotspot+PDBBM(1.1) dataset that lack experimentally determined protein complex structures. Not all the 414 PPI-hot spots in the PPI-Hotspot+PDBBM(1.1) have sequence information and thus UniProtID of the respective binding partners, leaving 360 PPI-hot spots in 135 proteins associated with 155 pairs of PPIs, as some proteins are involved in multiple PPIs. Also, 90 of the 155 PPI pairs have complex structures in the PDB. For the 65 PPI pairs lacking complex structures, 17 pairs contain >1100 residues, exceeding the current size limit of AlphaFold-Multimer (Evans et al., 2021). Thus, we generated structural models for the remaining 48 complexes using the AlphaFold-Multimer module in the ColabFold version 1.3.0 (Mirdita et al., 2022) with default settings. For each AB complex, the input sequence for protein A was based on the free structure sequence in the PPI-Hotspot+PDBBM(1.1), whereas that for protein B was retrieved in its entirety from the UniProtKB (UniProt Consortium, 2018) as the binding region in protein B was unknown. Based on the AMBER-relaxed model structure with the highest pTM score, interface residues were defined as residues of protein A with ≥1 atom within a 5 Å cutoff of any protein B atom.

Experimental verification of predicted eEF2 PPI-hot spots: Plasmid construction

The predicted PPI-hot spots and PPI-nonhot spots were mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). The pcDNA3.1-flag-meEF2 plasmid was used as the PCR template, and the sets of sense and antisense primers for mutagenesis are listed in Figure 2—source data 3. All constructs were sequenced to confirm the mutations. The shRNA clones, #1 TRCN0000047908 (GCGATCATGAATTTCAAGAAA) and #2: TRCN0000047910 (GCAGTACCTCAACGAGATCAA), against human eEF2 mRNA were obtained from the RNAi Core Facility (Academia Sinica).

Cell lines

HEK-293T cells (# CRL-3216) and HeLa cells (# CCL-2) were obtained from American Type Culture Collection (ATCC).

Testing eEF2-CPEB2 interactions using co-IP and reciprocal co-IP

HEK-293T cells (ATCC, # CRL-3216) were cultured in DMEM with 10% fetal bovine serum (FBS). For reciprocal co-IP, the 8 µg DNA mixture containing 3 µg myc-CPEB2 and 5 µg flag-eEF2 (or a negative control, GFP) plasmids, generated in the previous study (Chen and Huang, 2012), was transfected into a 10 cm dish of 293T cells using Lipofectamine 2000. We transfected more flag-eEF2 plasmid DNA than myc-CPEB2 plasmid because myc-CPEB2 is expressed more abundantly than flag-eEF2. Overnight transfected cells were lysed in 500 µl IP buffer (20 mM HEPES, pH 7.4, 100 mM NaCl, 1 mM MgCl2, 0.1% TritonX-100, 10% glycerol, 0.5 mM DTT, 1× protease inhibitor cocktail, and 100 µg/ml RNaseA) and centrifuged at 10,000 × g for 3 min at 4°C. The supernatant was equally divided and incubated with Protein G beads bound with myc (Abcam, 9E10 clone) or flag (Sigma-Aldrich, F1804) antibody for 3 hr at 4°C to respectively pull down myc-CPEB2 and flag-eEF2. The beads were washed five times with 300 µl IP buffer. If myc-CPEB2 and flag-eEF2 interact, myc-CPEB2 can co-precipitate with flag-eEF2 on flag antibody beads, whereas flag-eEF2 can co-precipitate with myc-CPEB2 on myc antibody beads. GFP was used as a negative control to ensure that the signals on the beads were caused by binding between flag-eEF2 and myc-CPEB2. The precipitated proteins were separated on a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) for western blot analysis. Similarly, for the initial co-IP screening, the 4 µg DNA mixture containing 1.5 µg myc-CPEB2 and 2.5 µg flag-eEF2 (or a negative control, EGFP) plasmids was transfected into a 6 cm dish of 293T cells, harvested in 200 µl IP buffer, and immunoprecipitated using flag antibody-bound beads.

Functional impact of eEF2 mutants on HIF-1α and global protein synthesis

HeLa cells (ATCC, # CCL-2) were cultured in DMEM with 10% FBS. Each 6 cm plate of HeLa cells was transfected with 2 μg human eEF2 knockdown plasmid and 2 μg flag-meEF2 wild-type/mutant plasmid. Overnight transfected cells were selected with 0.5 μg/ml puromycin and 600 μg/ml G418 for 3 days to knock down endogenous eEF2 and maintain the expression of flag-meEF2, respectively. The selected cells were incubated with 10 μM MG132 for 4 hr before harvesting for western blotting of HIF-1α or replaced with 2 ml Met/Cys-lacking DMEM with 1% FBS and 60 μCi 35S-Met/Cys (PerkinElmer, cat# NEG772002MC) for 2 hr before separation on an SDS-PAGE. Antibodies used are CPEB2, generated in house; HIF-1α (NB100-134) from Novus; eEF2 (SC-13004) from Santa Cruz Biotechnology; and β-actin (A5441) form Sigma-Aldrich.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/501100001869 Academia Sinica AS-IA-107-L03 to Carmay Lim.

http://dx.doi.org/10.13039/501100002701 Ministry of Education MOST-98-2113-M-001-011 to Carmay Lim.

http://dx.doi.org/10.13039/501100016004 Institute of Biomedical Sciences, Academia Sinica to Yi-Shuian Huang.

Acknowledgements

This research was supported by Academia Sinica (AS-IA-107-L03) and the Ministry of Science and Technology (MOST-98-2113M-001-011), Taiwan.

Additional information

Competing interests

Author contributions

Additional files

MDAR checklist

Source data 1. Dataset of experimentally confirmed PPI-hot spots and PPI-nonhot spots with free protein structures.

Source data 2. Dataset of experimentally confirmed PPI-hot spots with both free and bound protein structures.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files. The PPI-HotspotID program is available at https://github.com/wrigjz/ppihotspotid/ (Wright, 2024). A web server to perform PPI-hotspot predictions and the dataset comprising 414 experimentally known PPI-hot spots and 504 PPI-nonhot spots are available at https://ppihotspotid.limlab.dnsalias.org/.

10.7554/eLife.96643.3.sa0
eLife assessment
Haider Shozeb Reviewing Editor University College London United Kingdom

Incomplete
The article presents a machine-learning method to predict protein hotspot residues. The validation is incomplete, along with the misinterpretation of the results with other current methods like FTMap.

10.7554/eLife.96643.3.sa1
Reviewer #1 (Public review):
Reviewer
The paper describes a program developed to identify PPI-hot spots using the free protein structure and compares it to FTMap and SPOTONE, two webservers that they consider as competitive approaches to the problem. We appreciate the effort in providing a new webserver that can be tested by the community but we continue to have major concerns:

(1) The comparison to the FTMap program is problematic. The authors misinterpret the article they refer to, i.e., Zerbe et al. "Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces" J. Chem. Inf. Model. 52, 2236-2244, (2012). FTMap identifies hot spots that bind small molecular ligands. The Zerbe et al. article shows that such hot spots tend to interact with hot spot residues on the partner protein in a protein-protein complex (emphasis on "partner"). Thus, the hot spots identified by FTMap are not the hot spots defined by the authors. In fact, because the Zerbe paper considers the partner protein in a complex, the results cannot be compared to the results of Chen et al. This difference is missed by the authors, and hence the comparison of the FTMap is invalid.

(2) Chen et al. use a number of usual features in a variety of simple machine-learning methods to identify hot spot residues. This approach has been used in the literature for more than a decade. Although the authors say that they were able to find only FTMap and SPOTONE as servers, there are dozens of papers that describe such a methodology. Some examples are given here: (Higa and Tozzi, 2009; Keskin, et al., 2005; Lise, et al., 2011; Tuncbag, et al., 2009; Xia, et al., 2010). There are certainly more papers. Thus, while the web server is a potentially useful contribution, the paper does not provide a fundamentally novel approach.

10.7554/eLife.96643.3.sa2
Author response
Chen Yao Chi Author Academia Sinica Taipei Taiwan

Sargsyan Karen Author Academia Sinica Taipei Taiwan

Wright Jon D Author Immunwork, Inc. Taipei Taiwan

Chen Yu-Hsien Author Academia Sinica Taipei Taiwan

Huang Yi-Shuian Author Academia Sinica Taipei Taiwan

Lim Carmay Author Academia Sinica Taipei Taiwan

The following is the authors’ response to the original reviews.

eLife assessment

The manuscript presents a machine-learning method to predict protein hotspot residues. The validation is incomplete, along with the misinterpretation of the results with other current methods like FTMap.

We believe that validation is complete: The two most common techniques for testing and validating machine-learning methods are to split the dataset into either (1) a training set and a test set with a fixed ratio (e.g., 70% for training and 30% for testing) or (2) multiple subsets/folds; i.e., cross-validation. We did not employ a training set to train the model and a separate test set to evaluate its performance, as Reviewer 2 assumed. Instead, we employed cross-validation, as it helps reduce the variability in performance estimates compared to a single training/test split, and utilizes the entire dataset for training and testing, making efficient use of the limited data. Each fold was used once as a test set and the remaining folds as the training set - this process was repeated for each fold and the model's performance was measured using the F1 score. We had listed the mean validation F1 score in Table 1.

We have clarified our comparison with FTMAP - see reply to point 1 of reviewer 1 below.

Public Reviews:

Reviewer #1 (Public Review):

Summary:

The paper describes a program developed to identify PPI-hot spots using the free protein structure and compares it to FTMap and SPOTONE, two webservers that they consider as competitive approaches to the problem. On the positive side, I appreciate the effort in providing a new webserver that can be tested by the community but have two major concerns as follows.

(1) The comparison to the FTMap program is wrong. The authors misinterpret the article they refer to, i.e., Zerbe et al. "Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces" J. Chem. Inf. Model. 52, 2236-2244, (2012). FTMap identifies hot spots that bind small molecular ligands. The Zerbe et al. article shows that such hot spots tend to interact with hot spot residues on the partner protein in a protein-protein complex (emphasis on "partner"). Thus, the hot spots identified by FTMap are not the hot spots defined by the authors. In fact, because the Zerbe paper considers the partner protein in a complex, the results cannot be compared to the results of Chen et al. This difference is missed by the authors, and hence the comparison of the FTMap is invalid. I did not investigate the comparison to SPOTONE, and hence have no opinion.

Brenke et al. (Bioinformatics 2009 25: 621-627), who developed FTMAP, defined hot spots as regions of the binding surface that “contribute a disproportionate amount to the binding free energy”. Kozakov et al. (Proc. Natl. Acad. Sci. 2011:108, 13528-1353) used unbound protein structures as input to FTMap to predict binding hot spots for protein-protein interactions (PPIs), which are defined as regions (so-called consensus sites) on a protein surface that bind multiple probe clusters − the main hot spot is the largest consensus site binding the largest number of probe clusters.

Zerbe et al. (J. Chem. Inf. Model. 2012:52, 2236) noted that a consensus “site is expected to be important in any interaction that involves that region of the target independent of any partner protein.” They showed that for hot spot residues found by Ala scanning not only overlapped with the probe ligands but also form consensus sites, as shown in Figure 4. They stated that “A residue can also be identified as a hot spot by alanine scanning if it contributes to creating such a favorable binding environment by being among the residues forming a consensus site on the protein to which it belongs.”

To clarify the comparison with FTmap in the revised version, we have added the following sentence in the Abstract on p. 3:

“We explored the possibility of detecting PPI-hot spots using (i) FTMap in the PPI mode, which identifies hot spots on protein-protein interfaces from the free protein structure, and (ii) the interface residues predicted by AlphaFold-Multimer.”

We have added the following sentences in the Introduction section on p. 4:

“We explored the possibility of detecting PPI-hot spots using the FTMap server in the PPI mode, which identifies hot spots on protein-protein interfaces from free protein structures.45 These hot spots are identified by consensus sites − regions that bind multiple probe clusters.42,45,59 Such regions are deemed to be important for any interaction involving that region of the target, independent of partner protein.42 PPIhot spots were identified as residues in van der Waals (vdW) contact with probe ligands within the largest consensus site containing the most probe clusters.”

and in the Results section on p. 5:

“Given the free protein structure, PPI-HotspotID and SPOTONE53 predict PPI-hot spots based on a probability threshold (> 0.5). FTMap, in the PPI mode, detects PPIhot spots as consensus sites/regions on the protein surface that bind multiple probe clusters.59 Residues in vdW contact with probe molecules within the largest consensus site were compared with PPI-hotspotID/SPOTONE predictions.”

(2) Chen et al. use a number of usual features in a variety of simple machine-learning methods to identify hot spot residues. This approach has been used in the literature for more than a decade. Although the authors say that they were able to find only FTMap and SPOTONE as servers, there are dozens of papers that describe such a methodology. Some examples are given here: (Higa and Tozzi, 2009; Keskin, et al., 2005; Lise, et al., 2011; Tuncbag, et al., 2009; Xia, et al., 2010). There are certainly more papers. Thus, while I consider the web server as a potentially useful contribution, the paper does not provide a fundamentally novel approach.

Our paper introduces several novel elements in our approach:

(1) Most PPI-hot spot prediction methods employ PPI-hotspots where mutations decrease protein binding free energy by > 2 kcal/mol (J. Chem. Inf. Model. 2022, 62, 1052). In contrast, our method incorporates not only PPI-hot spots with such binding free energy changes, but also those whose mutations have been curated in UniProtKB to significantly impair/disrupt PPIs. Because our method employs the largest collection of experimentally determined PPI-hot spots, it could uncover elusive PPI-hot spots not within binding interfaces, as well as potential PPI-hot spots for other protein partners (see point 3 below).

(2) Whereas most machine-learning methods for PPI-hot spot prediction focus on features derived from (i) primary sequences or (ii) protein-protein complexes, we introduce novel features such as per-residue free energy contributions derived from unbound protein structures. We further revealed the importance of one of our novel features, namely, the gas-phase energy of the target protein relative to its unfolded state and provided the physical basis for its importance. For example, PPI-hot spots can enhance favorable enthalpic contributions to the binding free energy through hydrogen bonds or van der Waals contacts across the protein’s interface. This makes them energetically unstable in the absence of the protein’s binding partner and solvent; hence providing a rationale for the importance of the gas-phase energy of the target protein relative to its unfolded state.

(3) As a result of these novel elements, our approach, PPI-HotspotID, could identify many true positives that were not detected by FTMap or SPOTONE (see Results and Figure 1). Previous methods generally predict residues that make multiple contacts across the proteinprotein interface as PPI-hot spots. In contrast, PPI-HotspotID can detect not only PPI-hot spots that make multiple contacts across the protein-protein interface, but also those lacking direct contact with the partner protein (see Discussion).

(4) Unlike most machine-learning methods which require feature customization, data preprocessing, and model optimization, our use of AutoGluon’s AutoTabular module automates data preprocessing, model selection, hyperparameter optimization, and model evaluation. This automation reduces the need for manual intervention.

We have revised and added the following sentences on p. 9 in the Discussion section to highlight the novelty of our approach:

“Here, we have introduced two novel elements that have helped to identify PPI-hot spots using the unbound structure. First, we have constructed a dataset comprising 414 experimentally known PPI-hot spots and 504 nonhot spots, and carefully checked that PPI-hot spots have no mutations resulting in ΔΔGbind < 0.5 kcal/mol, whereas nonhot spots have no mutations resulting in ΔΔGbind ≥ 0.5 kcal/mol or impact binding in immunoprecipitation or GST pull-down assays (see Methods). In contrast, SPOTONE53 employed nonhot spots defined as residues that upon alanine mutation resulted in ΔΔGbind < 2.0 kcal/mol. Notably, previous PPI-hot spot prediction methods did not employ PPIhot spots whose mutations have been curated to significantly impair/disrupt PPIs in UniProtKB (see Introduction). Second, we have introduced novel features derived from unbound protein structures such as the gas-phase energy of the target protein relative to its unfolded state.”

Strengths:

A new web server was developed for detecting protein-protein interaction hot spots.

Weaknesses:

The comparison to FTMap results is wrong. The method is not novel.

See reply to points 1 and 2 above.

Reviewer #2 (Public Review):

Summary:

The paper presents PPI-hotspot a method to predict PPI-hotspots. Overall, it could be useful but serious concerns about the validation and benchmarking of the methodology make it difficult to predict its reliability.

Strengths:

Develops an extended benchmark of hot-spots.

Weaknesses:

(1) Novelty seems to be just in the extended training set. Features and approaches have been used before.

The novelty of our approach extends beyond just the expanded training set, as summarized in our reply to Reviewer #1, point 2 above. To our knowledge, previous studies did not leverage the gas-phase energy of the target protein relative to its unfolded state for detecting PPI-hot spots from unbound structures. Previous studies did not automate the training and validation process. In contrast, we used AutoGluon’s AutoTabular module to automate the training of (i) individual “base” models, including LightGBM, CatBoost, XGBoost, random forests, extremely randomized trees, neural networks, and K-nearest neighbours, then (ii) multiple “stacker” models. The predictions of multiple “stacker” models were fed as inputs to additional higher layer stacker models in an iterative process called multi-layer stacking. The output layer used ensemble selection to aggregate the predictions of the stacker models. To improve stacking performance, AutoGluon used all the data for both training and validation through repeated k-fold bagging of all models at all layers of the stack, where k is determined by best precision. This comprehensive approach, including repeated k-fold bagging of all models at all layers of the stack, sets our methodology apart from previous studies, including SPOTONE (see Methods).

(2) As far as I can tell the training and testing sets are the same. If I am correct, it is a fatal flaw.

The two most common techniques for testing and validating machine-learning methods are to split the dataset into either (1) a training set and a test set with a fixed ratio (e.g., 70% for training and 30% for testing) or (2) multiple subsets/folds; i.e., cross-validation. We did not employ a training set to train the model and a separate test set to evaluate its performance. Instead, we employed cross-validation, where the model was trained and evaluated multiple times. Each fold was used once as a test set and the remaining folds serve as the training set - this process was repeated for each fold. For each test set, we assessed the model's performance using the F1 score. We had listed the mean validation F1 score in Table 1 in the original manuscript. Cross-validation helps reduce the variability in performance estimates compared to a single training/test split. It also utilizes the entire dataset for training and testing, making efficient use of the limited data. We have clarified this on p. 14 in the revised version:

“AutoGluon was chosen for model training and validation due to its robustness and userfriendly interface, allowing for the simultaneous and automated exploration of various machine-learning approaches and their combinations. Instead of using a single training set to train the model and a separate test set to evaluate its performance, we employed cross-validation, as it utilizes the entire dataset for both training and testing, making efficient use of the limited data on PPI-hot spots and PPI-nonhot spots. AutoGluonTabular automatically chose a random partitioning of our dataset into multiple subsets/folds for training and validation. Notably, the training and validation data share insignificant homology, as the average pairwise sequence identity in our dataset is 26%. Each fold was used once as a test set, while the remaining folds served as the training set. For each test set, the model's performance was measured using the F1 score.”

(3) Comparisons should state that: SPOTONE is a sequence (only) based ML method that uses similar features but is trained on a smaller dataset. FTmap I think predicts binding sites, I don't understand how it can be compared with hot spots. Suggesting superiority by comparing with these methods is an overreach.

In the Introduction on page 3, we had already stated that:

“SPOTONE53 predicts PPI-hot spots from the protein sequence using residue-specific features such as atom type, amino acid (aa) properties, secondary structure propensity, and mass-associated values to train an ensemble of extremely randomized trees. The PPIhot spot prediction methods have mostly been trained, validated, and tested on data from the Alanine Scanning Energetics database (ASEdb)55 and/or the Structural Kinetic and Energetic database of Mutant Protein Interactions (SKEMPI) 2.0 database.56”

On p. 4, we have clarified how we used FTMAP to detect hot spots - see reply to Reviewer #1, point 1.

“We explored the possibility of detecting PPI-hot spots using the FTMap server in the PPI mode, which identifies hot spots on protein-protein interfaces from free protein structures.45 These hot spots are identified by consensus sites − regions that bind multiple probe clusters.42,45,59 Such regions are deemed to be important for any interaction involving that region of the target, independent of partner protein.42 PPI-hot spots were identified as residues in van der Waals (vdW) contact with probe ligands within the largest consensus site containing the most probe clusters.”

(4) Training in the same dataset as SPOTONE, and then comparing results in targets without structure could be valuable.

We think that the dataset used by SPOTONE is not as “clean” as ours since SPOTONE employed nonhot spots defined as aa residues that upon alanine mutation resulted in ΔΔGbind < 2.0 kcal/mol. In contrast, we define nonhot spots as residues whose mutations resulted in protein ΔΔGbind changes < 0.5 kcal/mol. Moreover, we carefully checked that the nonhot spots have no mutations resulting in ΔΔGbind changes ≥ 0.5 kcal/mol or impact binding in immunoprecipitation or GST pull-down assays (see Methods). We cannot compare results in targets without structure because we require the free protein structure to compute the perresidue free energy contributions.

(5) The paper presents as validation of the prediction and experimental validation of hotspots in human eEF2. Several predictions were made but only one was confirmed, what was the overall success rate of this exercise?

We did not test all predicted PPI-hot spots but only the PPI-hot spot with the highest probability of 0.67 (F794) and 7 other predicted PPI-hot spots that were > 12 Å from F794 as well as 4 predicted PPI-nonhot spots. Among the 13 predictions tested, F794 and the 4 predicted nonhot spots were confirmed to be correct.

Recommendations for the authors:

Reviewer #1 (Recommendations For The Authors):

Remove the comparison to FTMap, and find a more appropriate reference method, even if it requires installing programs rather than using the available web servers.

We have clarified comparison to FTMap in the revised ms - see our reply above.

No competing interests declared.

Affiliated with Immunwork, Inc; the author has no other competing interests to declare.

Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft.

Software, Validation, Investigation, Methodology, Writing – original draft.

Software, Investigation.

Data curation, Formal analysis, Investigation.

Formal analysis, Funding acquisition, Validation, Investigation, Writing – original draft.

Conceptualization, Resources, Supervision, Investigation, Methodology, Project administration, Writing – review and editing.
==== Refs
References

Agrawal NJ Helk B Trout BL 2014 A computational tool to predict the evolutionarily conserved protein-protein interaction hot-spot residues from the structure of the unbound protein FEBS Letters 588 326 333 10.1016/j.febslet.2013.11.004 24239538
Anger AM Armache JP Berninghausen O Habeck M Subklewe M Wilson DN Beckmann R 2013 Structures of the human and Drosophila 80S ribosome Nature 497 80 85 10.1038/nature12104 23636399
Assi SA Tanaka T Rabbitts TH Fernandez-Fuentes N 2010 PCRPi: Presaging critical residues in protein interfaces, a new computational tool to chart hot spots in protein interfaces Nucleic Acids Research 38 e86 10.1093/nar/gkp1158 20008102
Barlow KA Ó Conchúir S Thompson S Suresh P Lucas JE Heinonen M Kortemme T 2018 Flex ddG: Rosetta ensemble-based estimation of changes in protein-protein binding affinity upon mutation The Journal of Physical Chemistry. B 122 5389 5399 10.1021/acs.jpcb.7b11367 29401388
Blazer LL Neubig RR 2009 Small molecule protein-protein interaction inhibitors as CNS therapeutic agents: current progress and future hurdles Neuropsychopharmacology 34 126 141 10.1038/npp.2008.151 18800065
Bogan AA Thorn KS 1998 Anatomy of hot spots in protein interfaces Journal of Molecular Biology 280 1 9 10.1006/jmbi.1998.1843 9653027
Case DA 2020 Amber University of California Press
Chen YC Wu CY Lim C 2007 Predicting DNA-binding amino acid residues from electrostatic stabilization upon mutation to Asp/Glu and evolutionary conservation Proteins 67 671 680 10.1002/prot.21366 17340633
Chen PJ Huang YS 2012 CPEB2-eEF2 interaction impedes HIF-1α RNA translation The EMBO Journal 31 959 971 10.1038/emboj.2011.448 22157746
Chen P Li J Wong L Kuwahara H Huang JZ Gao X 2013 Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences Proteins 81 1351 1362 10.1002/prot.24278 23504705
Chen YC Chen YH Wright JD Lim C 2022 PPI-Hotspot DB: Database of protein–protein interaction hot spots Journal of Chemical Information and Modeling 62 1052 1060 10.1021/acs.jcim.2c00025 35147037
Cho K Kim D Lee D 2009 A feature-based approach to modeling protein-protein interaction hot spots Nucleic Acids Research 37 2672 2687 10.1093/nar/gkp132 19273533
Clackson T Wells JA 1995 A hot spot of binding energy in a hormone-receptor interface Science 267 383 386 10.1126/science.7529940 7529940
Cukuroglu E Engin HB Gursoy A Keskin O 2014 Hot spots in protein-protein interfaces: towards drug discovery Progress in Biophysics and Molecular Biology 116 165 173 10.1016/j.pbiomolbio.2014.06.003 24997383
Darnell SJ Page D Mitchell JC 2007 An automated decision-tree approach to predicting protein interaction hot spots Proteins 68 813 823 10.1002/prot.21474 17554779
David A Razali R Wass MN Sternberg MJE 2012 Protein-protein interaction sites are hot spots for disease-associated nonsynonymous SNPs Human Mutation 33 359 363 10.1002/humu.21656 22072597
DeLano WL 2002 Unraveling hot spots in binding interfaces: progress and challenges Current Opinion in Structural Biology 12 14 20 10.1016/s0959-440x(02)00283-x 11839484
Deng L Zhang QC Chen Z Meng Y Guan J Zhou S 2014 PredHS: a web server for predicting protein-protein interaction hot spots by using structural neighborhood properties Nucleic Acids Research 42 W290 W295 10.1093/nar/gku437 24852252
Erickson N Mueller J Shirkov A Zhang H Larroy P Li M Smola A 2020 AutoGluon-Tabular: Robust and Accurate AutoML for Structured Data arXiv 10.48550/arXiv.2003.06505
Evans R O’Neill M Pritzel A Antropova N Senior A Green T Žídek A Bates R Blackwell S Yim J Ronneberger O Bodenstein S Zielinski M Bridgland A Potapenko A Cowie A Tunyasuvunakool K Jain R Clancy E Kohli P Jumper J Hassabis D 2021 Protein complex prediction with AlphaFold-multimer bioRxiv 10.1101/2021.10.04.463034
Fischer TB Arunachalam KV Bailey D Mangual V Bakhru S Russo R Huang D Paczkowski M Lalchandani V Ramachandra C Ellison B Galer S Shapley J Fuentes E Tsai J 2003 The binding interface database (BID): a compilation of amino acid hot spots in protein interfaces Bioinformatics 19 1453 1454 10.1093/bioinformatics/btg163 12874065
Glaser F Pupko T Paz I Bell RE Bechor-Shental D Martz E Ben-Tal N 2003 ConSurf: identification of functional regions in proteins by surface-mapping of phylogenetic information Bioinformatics 19 163 164 10.1093/bioinformatics/19.1.163 12499312
González-Ruiz D Gohlke H 2006 Targeting protein-protein interactions with small molecules: challenges and perspectives for computational binding epitope detection and ligand finding Current Medicinal Chemistry 13 2607 2625 10.2174/092986706778201530 17017914
Grosdidier S Fernández-Recio J 2008 Identification of hot-spot residues in protein-protein interactions by computational docking BMC Bioinformatics 9 447 459 10.1186/1471-2105-9-447 18939967
Guerois R Nielsen JE Serrano L 2002 Predicting changes in the stability of proteins and protein complexes: a study of more than 1000 mutations Journal of Molecular Biology 320 369 387 10.1016/S0022-2836(02)00442-4 12079393
Hage T Sebald W Reinemer P 1999 Crystal structure of the interleukin-4/receptor alpha chain complex reveals a mosaic binding interface Cell 97 271 281 10.1016/s0092-8674(00)80736-9 10219247
Higa RH Tozzi CL 2009 Prediction of binding hot spot residues by using structural and evolutionary parameters Genetics and Molecular Biology 32 626 633 10.1590/S1415-47572009000300029 21637529
Hu SS Chen P Wang B Li J 2017 Protein binding hot spots prediction from sequence only by a new ensemble learning method Amino Acids 49 1773 1785 10.1007/s00726-017-2474-6 28766075
Huang Q Zhang X 2016 An improved ensemble learning method with SMOTE for protein interaction hot spots prediction IEEE International Conference on Bioinformatics and Biomedicine (BIBM) 1584 1589 10.1109/BIBM.2016.7822756
Huo S Massova I Kollman PA 2002 Computational alanine scanning of the 1:1 human growth hormone-receptor complex Journal of Computational Chemistry 23 15 27 10.1002/jcc.1153 11913381
Ibarra AA Bartlett GJ Hegedüs Z Dutt S Hobor F Horner KA Hetherington K Spence K Nelson A Edwards TA Woolfson DN Sessions RB Wilson AJ 2019 Predicting and experimentally validating hot-spot residues at protein-protein interfaces ACS Chemical Biology 14 2252 2263 10.1021/acschembio.9b00560 31525028
Jankauskaite J Jiménez-García B Dapkunas J Fernández-Recio J Moal IH 2019 SKEMPI 2.0: an updated benchmark of changes in protein-protein binding energy, kinetics and thermodynamics upon mutation Bioinformatics 35 462 469 10.1093/bioinformatics/bty635 30020414
Jiang J Wang N Chen P Zheng C Wang B 2017 Prediction of protein hotspots from whole protein sequences by a random projection ensemble system International Journal of Molecular Sciences 18 E1543 10.3390/ijms18071543 28718782
Johnson LS Eddy SR Portugaly E 2010 Hidden Markov model speed heuristic and iterative HMM search procedure BMC Bioinformatics 11 431 10.1186/1471-2105-11-431 20718988
Kabsch W Sander C 1983 Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features Biopolymers 22 2577 2637 10.1002/bip.360221211 6667333
Keskin O Ma BY Nussinov R 2005 Hot regions in protein--protein interactions: the organization and contribution of structurally conserved hot spot residues Journal of Molecular Biology 345 1281 1294 10.1016/j.jmb.2004.10.077 15644221
Kortemme T Baker D 2002 A simple physical model for binding energy hot spots in protein-protein complexes PNAS 99 14116 14121 10.1073/pnas.202485799 12381794
Kozakov D Hall DR Chuang G-Y Cencic R Brenke R Grove LE Beglov D Pelletier J Whitty A Vajda S 2011 Structural conservation of druggable hot spots in protein-protein interfaces PNAS 108 13528 13533 10.1073/pnas.1101835108 21808046
Kozakov D Grove LE Hall DR Bohnuud T Mottarella SE Luo L Xia B Beglov D Vajda S 2015 The FTMap family of web servers for determining and characterizing ligand-binding hot spots of proteins Nature Protocols 10 733 755 10.1038/nprot.2015.043 25855957
Landau M Mayrose I Rosenberg Y Glaser F Martz E Pupko T Ben-Tal N 2005 ConSurf 2005: the projection of evolutionary conservation scores of residues on protein structures Nucleic Acids Research 33 W299 W302 10.1093/nar/gki370 15980475
Laskowski RA Jabłońska J Pravda L Vařeková RS Thornton JM 2018 PDBsum: Structural summaries of PDB entries Protein Science 27 129 134 10.1002/pro.3289 28875543
Li X Keskin O Ma B Nussinov R Liang J 2004 Protein-protein interactions: hot spots and structurally conserved residues often locate in complemented pockets that pre-organized in the unbound states: implications for docking Journal of Molecular Biology 344 781 795 10.1016/j.jmb.2004.09.051 15533445
Li W Godzik A 2006 Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences Bioinformatics 22 1658 1659 10.1093/bioinformatics/btl158 16731699
Lise S Buchan D Pontil M Jones DT 2011 Predictions of hot spot residues at protein-protein interfaces using support vector machines PLOS ONE 6 e16774 10.1371/journal.pone.0016774 21386962
Liu Q Chen P Wang B Zhang J Li J 2018 Hot spot prediction in protein-protein interactions by an ensemble system BMC Systems Biology 12 132 10.1186/s12918-018-0665-8 30598091
Massova I Kollman PA 1999 Computational alanine scanning to probe protein−protein interactions: A novel approach to evaluate binding free energies Journal of the American Chemical Society 121 8133 8143 10.1021/ja990935j
Melo R Fieldhouse R Melo A Correia JDG Cordeiro MNDS Gümüş ZH Costa J Bonvin AMJJ Moreira IS 2016 A machine learning approach for hot-spot detection at protein-protein interfaces International Journal of Molecular Sciences 17 1215 10.3390/ijms17081215 27472327
Mirdita M Schütze K Moriwaki Y Heo L Ovchinnikov S Steinegger M 2022 ColabFold: Making protein folding accessible to all Nature Methods 19 679 682 10.1038/s41592-022-01488-1 35637307
Mitternacht S 2016 FreeSASA: An open source C library for solvent accessible surface area calculations F1000Research 5 189 10.12688/f1000research.7931.1 26973785
Moreira IS Fernandes PA Ramos MJ 2007 Computational alanine scanning mutagenesis--an improved methodological approach Journal of Computational Chemistry 28 644 654 10.1002/jcc.20566 17195156
Moreira IS Koukos PI Melo R Almeida JG Preto AJ Schaarschmidt J Trellet M Gümüş ZH Costa J Bonvin AMJJ 2017 SpotOn: High accuracy identification of protein-protein interface hot-spots Scientific Reports 7 8007 10.1038/s41598-017-08321-2 28808256
Munteanu CR Pimenta AC Fernandez-Lozano C Melo A Cordeiro MNDS Moreira IS 2015 Solvent accessible surface area-based hot-spot detection methods for protein-protein and protein-nucleic acid interfaces Journal of Chemical Information and Modeling 55 1077 1086 10.1021/ci500760m 25845030
Nakamura T Yamada KD Tomii K Katoh K 2018 Parallelization of MAFFT for large-scale multiple sequence alignments Bioinformatics 34 2490 2492 10.1093/bioinformatics/bty121 29506019
Nero TL Morton CJ Holien JK Wielens J Parker MW 2014 Oncogenic protein interfaces: small molecules, big challenges Nature Reviews. Cancer 14 248 262 10.1038/nrc3690 24622521
Nguyen QT Fablet R Pastor D 2013 Protein interaction hotspot identification using sequence-based frequency-derived features IEEE Transactions on Bio-Medical Engineering 60 2993 3002 10.1109/TBME.2011.2161306 21742567
Ofran Y Rost B 2007 Protein-protein interaction hotspots carved into sequences PLOS Computational Biology 3 e119 10.1371/journal.pcbi.0030119 17630824
Ovek D Abali Z Zeylan ME Keskin O Gursoy A Tuncbag N 2022 Artificial intelligence based methods for hot spot prediction Current Opinion in Structural Biology 72 209 218 10.1016/j.sbi.2021.11.003 34954608
Ozbek P Soner S Haliloglu T 2013 Hot spots in a network of functional sites PLOS ONE 8 e74320 10.1371/journal.pone.0074320 24023934
Park HH Wu H 2006 Crystal structure of RAIDD death domain implicates potential mechanism of PIDDosome assembly Journal of Molecular Biology 357 358 364 10.1016/j.jmb.2005.12.082 16434054
Park HH Logette E Raunser S Cuenin S Walz T Tschopp J Wu H 2007 Death domain assembly mechanism revealed by crystal structure of the oligomeric PIDDosome core complex Cell 128 533 546 10.1016/j.cell.2007.01.019 17289572
Powers R Garrett DS March CJ Frieden EA Gronenborn AM Clore GM 1992 Three-dimensional solution structure of human interleukin-4 by multidimensional heteronuclear magnetic resonance spectroscopy Science 256 1673 1677 10.1126/science.256.5064.1673 1609277
Preto AJ Moreira IS 2020 SPOTONE: Hot spots on protein complexes with extremely randomized trees via sequence-only features International Journal of Molecular Sciences 21 7281 10.3390/ijms21197281 33019775
Puffenberger EG Jinks RN Sougnez C Cibulskis K Willert RA Achilly NP Cassidy RP Fiorentini CJ Heiken KF Lawrence JJ Mahoney MH Miller CJ Nair DT Politi KA Worcester KN Setton RA Dipiazza R Sherman EA Eastman JT Francklyn C Robey-Bond S Rider NL Gabriel S Morton DH Strauss KA 2012 Genetic mapping and exome sequencing identify variants associated with five novel diseases PLOS ONE 7 e28936 10.1371/journal.pone.0028936 22279524
Pupko T Bell RE Mayrose I Glaser F Ben-Tal N 2002 Rate4Site: an algorithmic tool for the identification of functional regions in proteins by surface mapping of evolutionary determinants within their homologues Bioinformatics 18 Suppl 1 S71 S77 10.1093/bioinformatics/18.suppl_1.s71 12169533
Qiao Y Xiong Y Gao H Zhu X Chen P 2018 Protein-protein interface hot spots prediction based on a hybrid feature selection strategy BMC Bioinformatics 19 14 29 10.1186/s12859-018-2009-5 29334889
Rosário‐Ferreira N Bonvin A Moreira IS 2022 Using machine‐learning‐driven approaches to boost hot‐spot’s knowledge WIREs Computational Molecular Science 12 1602 10.1002/wcms.1602
Rosell M Fernández-Recio J 2018 Hot-spot analysis for drug discovery targeting protein-protein interactions Expert Opinion on Drug Discovery 13 327 338 10.1080/17460441.2018.1430763 29376444
Sitani D Giorgetti A Alfonso‐Prieto M Carloni P 2021 Robust principal component analysis‐based prediction of protein‐protein interaction hot spots Proteins 89 639 647 10.1002/prot.26047 33458895
Thorn KS Bogan AA 2001 ASEdb: a database of alanine mutations and their effects on the free energy of binding in protein interactions Bioinformatics 17 284 285 10.1093/bioinformatics/17.3.284 11294795
Tian C Kasavajhala K Belfon KAA Raguette L Huang H Migues AN Bickel J Wang Y Pincay J Wu Q Simmerling C 2020 ff19SB: Amino-acid-specific protein backbone parameters trained against quantum mechanics energy surfaces in solution Journal of Chemical Theory and Computation 16 528 552 10.1021/acs.jctc.9b00591 31714766
Tuncbag N Keskin O Gursoy A 2010 HotPoint: hot spot prediction server for protein interfaces Nucleic Acids Research 38 W402 W406 10.1093/nar/gkq323 20444871
UniProt Consortium 2018 UniProt: the universal protein knowledgebase Nucleic Acids Research 46 2699 10.1093/nar/gky092 29425356
Wang L Liu ZP Zhang XS Chen L 2012 Prediction of hot spots in protein interfaces using a random forest model with hybrid features Protein Engineering, Design & Selection 25 119 126 10.1093/protein/gzr066 22258275
Wang H Liu C Deng L 2018a Enhanced prediction of hot spots at protein-protein interfaces using extreme gradient boosting Scientific Reports 8 14285 10.1038/s41598-018-32511-1 30250210
Wang M Zhu D Zhu J Nussinov R Ma B 2018b Local and global anatomy of antibody‐protein antigen recognition Journal of Molecular Recognition 31 e2693 10.1002/jmr.2693 29218757
Word JM Lovell SC Richardson JS Richardson DC 1999 Asparagine and glutamine: using hydrogen atom contacts in the choice of side-chain amide orientation Journal of Molecular Biology 285 1735 1747 10.1006/jmbi.1998.2401 9917408
Wright JD 2024 The source code for PPI-hotspotid 0.1 Github https://github.com/wrigjz/ppihotspotid/
Wright JD Chen YC Chen YH Sargsyan K Lim C Wright JD 2024 The PPI-hotspotID Prediction Server and Dataset Academia Sinica
Wu CH Apweiler R Bairoch A Natale DA Barker WC Boeckmann B Ferro S Gasteiger E Huang H Lopez R Magrane M Martin MJ Mazumder R O’Donovan C Redaschi N Suzek B 2006 The universal protein resource (UniProt): An expanding universe of protein information Nucleic Acids Research 34 D187 D191 10.1093/nar/gkj161 16381842
Xia JF Zhao XM Song JN Huang DS 2010 APIS: accurate prediction of hot spots in protein interfaces by combining protrusion index with solvent accessibility BMC Bioinformatics 11 174 187 10.1186/1471-2105-11-174 20377884
Yao S Zheng C Wang B Chen P 2022 A two-step ensemble learning for predicting protein hot spot residues from whole protein sequence Amino Acids 54 765 776 10.1007/s00726-022-03129-5 35098379
Ye L Kuang Q Jiang L Luo J Jiang Y Ding Z Li Y Li M 2014 Prediction of hot spots residues in protein–protein interface using network feature and microenvironment feature Chemometrics and Intelligent Laboratory Systems 131 16 21 10.1016/j.chemolab.2013.11.010
Yogurtcu ON Erdemli SB Nussinov R Turkay M Keskin O 2008 Restricted mobility of conserved residues in protein-protein interfaces in molecular simulations Biophysical Journal 94 3475 3485 10.1529/biophysj.107.114835 18227135
Zerbe BS Hall DR Vajda S Whitty A Kozakov D 2012 Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces Journal of Chemical Information and Modeling 52 2236 2244 10.1021/ci300175u 22770357
Zhu X Mitchell JC 2011 KFC2: a knowledge-based hot spot prediction method based on interface solvation, atomic density, and plasticity features Proteins 79 2671 2683 10.1002/prot.23094 21735484
