
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0310565
PONE-D-24-28006
Research Article
Biology and life sciences
Biochemistry
Proteins
RNA-binding proteins
Biology and life sciences
Molecular biology
Macromolecular structure analysis
RNA structure
Biology and life sciences
Biochemistry
Nucleic acids
RNA
RNA structure
Biology and life sciences
Molecular biology
Macromolecular structure analysis
RNA structure
RNA stem-loop structure
Biology and life sciences
Biochemistry
Nucleic acids
RNA
RNA structure
RNA stem-loop structure
Physical Sciences
Chemistry
Chemical Compounds
Chlorides
Magnesium Chloride
Medicine and Health Sciences
Pharmacology
Drug Interactions
Physical Sciences
Materials Science
Material Properties
Solubility
Research and analysis methods
Spectrum analysis techniques
NMR spectroscopy
Physical Sciences
Chemistry
Polymer Chemistry
Monomers
Glycerol
Peptide nucleic acids can form hairpins and bind RNA-binding proteins
PNAs bind RBPs
Zhong Yichen Conceptualization Formal analysis Investigation Methodology Writing – original draft Writing – review & editing 1
Wilkinson-White Lorna Investigation Methodology Writing – original draft Writing – review & editing 2
Zhang Esther Formal analysis Investigation Methodology Writing – original draft 1
https://orcid.org/0000-0002-6921-343X
Mohanty Biswaranjan Formal analysis Investigation Methodology Writing – original draft Writing – review & editing 2
https://orcid.org/0009-0001-4886-1198
Zhang Belinda B. Formal analysis Investigation Methodology Writing – original draft 1
McRae Madeline S. Formal analysis Investigation Methodology 1
Luo Rachel Investigation Methodology 1
Allport Thomas A. Investigation Methodology 1
Duff Anthony P. Investigation Methodology Writing – review & editing 3
Zhao Jennifer Investigation Methodology 1
El-Kamand Serene Methodology 4
Du Plessis Mar-Dean Methodology 4
Cubeddu Liza Investigation 1 4
https://orcid.org/0000-0003-1095-2569
Gamsjaeger Roland Conceptualization Formal analysis Investigation Methodology Writing – original draft Writing – review & editing 1 4
https://orcid.org/0000-0003-1807-5708
Ataide Sandro F. Conceptualization Formal analysis Funding acquisition Investigation Methodology Supervision Writing – original draft Writing – review & editing 1 *
https://orcid.org/0000-0002-1506-2226
Kwan Ann H. Conceptualization Formal analysis Funding acquisition Investigation Methodology Project administration Supervision Writing – original draft Writing – review & editing 1 *
1 Currently or formerly at School of Life and Environmental Sciences, The University of Sydney, Sydney, NSW, Australia
2 Sydney Analytical Core Research Facility, The University of Sydney, Sydney, NSW, Australia
3 National Deuteration Facility, ANSTO, Lucas Heights, NSW, Australia
4 School of Science, Western Sydney University, Penrith, NSW, Australia
Comas-Garcia Mauricio Editor
Universidad Autónoma de San Luis Potosi, MEXICO
Competing Interests: NO authors have competing interests.

* E-mail: ann.kwan@sydney.edu.au (AHK); sandro.ataide@sydney.edu.au (SFA)
16 9 2024
2024
19 9 e03105658 7 2024
29 8 2024
© 2024 Zhong et al
2024
Zhong et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

RNA-binding proteins (RBPs) are a major class of proteins that interact with RNAs to change their fate or function. RBPs and the ribonucleoprotein complexes they constitute are involved in many essential cellular processes. In many cases, the molecular details of RBP:RNA interactions differ between viruses, prokaryotes and eukaryotes, making prokaryotic and viral RBPs good potential drug targets. However, targeting RBPs with small molecules has so far been met with limited success as RNA-binding sites tend to be extended, shallow and dynamic with a mixture of charged, polar and hydrophobic interactions. Here, we show that peptide nucleic acids (PNAs) with nucleic acid-like binding properties and a highly stable peptide-like backbone can be used to target some RBPs. We have designed PNAs to mimic the short RNA stem-loop sequence required for the initiation of prokaryotic signal recognition particle (SRP) assembly, a target for antibiotics development. Using a range of biophysical and biochemical assays, the designed PNAs were demonstrated to fold into a hairpin structure, bind the targeted protein and compete with the native RNA hairpin to inhibit SRP formation. To show the applicability of PNAs against other RBPs, a PNA was also shown to bind Nsp9 from SARS-CoV-2, a protein that exhibits non-sequence-specific RNA binding but preferentially binds hairpin structures. Taken together, our results support that PNAs can be a promising class of compounds for targeting RNA-binding activities in RBPs.

ANSTO NDF9615 https://orcid.org/0000-0002-1506-2226
Kwan Ann H. The University of Sydney Drug Discovery Initiative Seed Funding https://orcid.org/0000-0002-1506-2226
Kwan Ann H. The University of Sydney Drug Discovery Initiative (DDI) seed funding The production of 2H13C15N FtsYNG was supported by grant NDF9615 from the National Deuteration Facility, which is partly supported by the National Collaborative Research Infrastructure Strategy – an initiative of the Australian Government. The funders of Drug Discovery Initiative Seed Grant and ANSTO National Dueteration Facility (NDF) Grant had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. NDF staff scientist, Dr Anthony Duff, is a co-author and led the production of isotopically labelled FtsY and proofread the manuscript. Data AvailabilityAll relevant data are within the manuscript and its Supporting Information files.
Data Availability

All relevant data are within the manuscript and its Supporting Information files.
==== Body
pmcIntroduction

RNA-binding proteins (RBPs) are a major class of proteins with over 2000 members. RBPs participate in diverse cellular functions and have been implicated in cell homeostasis, growth, division, differentiation, and cell fate determination through their interactions with RNA and other proteins [1, 2]. However, despite the abundance and importance of RBPs, delineating the exact role and mechanism of RBP:RNA interactions is challenging due to the lack of specific and robust molecules that target RNA-binding interfaces. If such compounds exist, they can be used to abrogate RBP:RNA interactions in assays to understand their effect in biology and to assess new putative RBP drug targets. In contrast, many small-molecule antagonists and agonists have been discovered for major protein classes such as enzymes and receptors [3, 4], as well as engineered peptides and proteins (including antibodies) that specifically recognise protein-interaction interfaces [5, 6]. Understanding RBP:RNA interactions would offer new avenues to probe bacterial and viral biology and may yield new antimicrobial strategies, as these interactions often differ substantially in molecular details and component compositions between lower and higher organisms, even in functionally conserved pathways [1, 2]. While some basal RBP:RNA interactions remain universal, such as the use of ribosomal protein and ribosomal RNA (rRNA) interactions for protein synthesis [7], higher level gene control elements typically have notable distinctions between viruses, prokaryotes and eukaryotes [8].

Unlike enzymes with small well-defined active site pockets that can easily be inhibited by small molecules, RNA-binding sites on RBPs are typically large, shallow and dynamic with a mixture of charged, polar and hydrophobic interactions [9], making them hard to target using traditional high-throughput screening approaches with small molecules. Despite the abundance of RBPs with ~1500 members encoded by the human genome [10], the difficulty of targeting is evident in the bias of candidates towards enzymes, with 90% of over 800,000 unique chemical structures interacting with only the top 278 enzymatic or receptor targets [11]. Therefore, the development of RNA mimics that can bind RBPs may help to overcome the lack of success with high-throughput screening strategies and lead to new and easy-to-use tool molecules to target RBPs. These molecules also have the potential to be developed into novel drug leads.

Peptide nucleic acids (PNAs) are compounds developed with nucleic acid-like binding properties and exceptional biological stability that can even surpass cyclic peptides. Discovered by Nielsen et al. in 1991, PNAs are synthetic, comprise of nucleobases covalently attached to an achiral polyamide (peptide-like) backbone as opposed to the ribose phosphate backbones of RNA [12]. The lack of phosphate groups on PNAs results in a removal of electrostatic repulsion as a major factor impeding hybridisation and base-pairing, making PNA duplexes stable even in solutions of high ionic strength [12, 13]. The amide backbone makes PNAs completely acid and base stable, and additionally not recognisable by nucleases [14], resulting in a greater chemical and biological stability. PNAs can form parallel and antiparallel duplexes with itself, generating a P-form helical structure with both a deeper and wider major groove compared to RNA and DNA A and B-form helices [15]. PNA applications so far have exploited its ability to hybridise double-stranded DNA or RNA, forming a triplex-invasion complex and eventually displacing one of the strands [16]. Previous studies have only reported uses of PNAs as a gene knockdown agent, as opposed to target RBPs interfaces. Whilst PNAs have been used as RNA-mimicking inhibitors of human telomerase [17], the use of PNAs as RNA-mimicking inhibitors of RBPs has remained unexplored.

We propose that PNAs may represent a suitable class of molecules that can be used to target a subset of RBPs, in particular, where RBPs display shallow, dynamic and transient binding to RNAs over an extended binding interface with low to medium binding affinities (in the μM range). This type of binding is particuarly common where RBPs participate in conformational switching mechanisms and bind multiple RNA sites or sequences as in anti-terminators like EutV among others [18]. In many instances, the recognition of sequence and structural features (single stranded, stem-loops and double stranded) are the major contributers to binding of RBPs and ribonucleoprotein (RNP) formation with the negative charges of the RNA backbone playing only a relatively minor role. In addition, PNAs can be engineered to contain glutamates in selected locations to mimic the negative charge in the RNA backbone. We hypothesized one of the dynamic protein-RNA interactions that can be targeted is the signal recognition particle (SRP) and its SRP receptor (SR), an essential RNP complex responsible for protein sorting in the cell [19]. In prokaryotes, the SR (FtsY) switches between interacting with the tetraloop and distal loop of the 4.5S RNA. The binding to the tetraloop, i.e., a protein:RNA interaction, promotes complex formation with the SRP protein (Ffh), which forms heterodimers with FtsY through the N-terminal helical bundle and GTPase domains (NG domain). In contrast, eukaryotic SRP and SR are composed of multiple proteins and the SRP:SR complex formation is mediated through protein-protein interactions [20]. As the protein sorting pathway is essential for cell survival, selective targeting of the protein-RNA interaction in prokaryotes may enable the development of potent antibiotics [19, 21, 22]. Here we explore whether PNAs containing the tetraloop sequence can mimic the 4.5S RNA tetraloop to inhibit the FtsYNG:4.5S RNA interaction. Using a combination of biophysical and biochemical experiments, we have shown that the designed PNAs based on the 4.5S RNA tetraloop can fold into a stemloop structure and bind FtsYNG. Using electrophoretic mobility shift assay (EMSA) and microscale thermophoresis (MST) assays, we have shown that the PNAs with the tetraloop sequence can prevent SRP:SR complex formation.

To show the potential applicability of PNAs against other RBPs with a dynamic and transient binding mechanism, we demonstrated that a PNA could also bind to the Nsp9 protein from SARS-CoV-2. Nsp9 is an essential RBP that is known to bind RNA with low to moderate affinity in a non-sequence specific manner [23, 24]. However, more recently Nsp9 has been shown to recognise RNA hairpin structures with a much higher affinity [25]. Taken together, we have demonstrated for the first time that PNAs have the potential to be used in a combination of sequence and structural mimics of RNA moieties to target RBPs and inhibit RNA binding. Furthermore, the high structural, chemical and biological stability of PNAs offer many practical benefits and enable a range of assays under experimental conditions where RNA cannot be used.

Materials and methods

In vitro transcription and purification of 4.5S RNA

The plasmids for transcribing full length 4.5S and RNAs4.5S (5’ TGTTGGTTCTCCCGCACGGAAGTGCCGGGATGTAGCTGGCA 3’) are constructed as described in [26]. Briefly, the DNA templates was flanked by a hammerhead ribozyme at the 5′ end and a hepatitis delta virus (HDV) ribozyme at the 3′ end, each of which self-cleave during transcription to yield product RNA with homogeneous termini. A sequence comprising an EcoRI restriction site for cloning and a T7 RNA polymerase promoter was added to the 5′ end of the DNA template, whereas the 3′ end includes a BamHI restriction site for cloning and the terminus of the HDV ribozyme. The entire sequence was then cloned into EcoRI and BamHI sites of pUC19 vector.

Cloned pUC19 plasmids was digested overnight with BamHI-HF (150 U per mg of DNA) at 37°C. On the next day, the linearised DNA was purified with phenol-chloroform extraction followed by chloroform extraction and then ethanol precipitation. The DNA resolubilized in MilliQ water is used as template (0.5 mg per 10 mL reaction) for in vitro transcription by mixing with 40 mM HEPES-KOH, pH 7.5, 40 mM MgCl2, 0.1 mg/mL BSA, 2 mM Spermidine, 40 mM DTT, 7.5 mM of each NTP, 0.01 mg/mL Pyrophosphatase, 0.02 U RiboSafe RNase inhibitor (Bioline, Cat. No.: BIO-65028) and 0.1 mg/mL T7 RNA polymerase (produced in-house). The reaction was incubated at 37°C for 2 h, followed by another 2 h of incubation at 42°C.

For ribozyme self-cleavage, the transcription products were replenished with additional 20 mM MgCl2, then incubated at 95°C for 2 min and immediately on ice for 3 min. Repeat the heating cycles three times in total. After mixing with 2× RNA loading dye (80% (v/v) formamide, 1× TBE, xylene cyanole FF and bromophenol blue), the sample was heated at 95°C for 2 min before loading onto a 6% denaturing urea gel consisting of 7 M urea, 6% (19:1) pre-mixed acrylamide-bisacrylamide and 1× TBE. The gel was pre-run until reaching ~50°C, and the sample was resolved on gel by running at 25 W for 2−3 h at room temperature. The RNA band was visualised by UV shadowing, the correct band excised, and eluted by crushing the gel and incubating in ddH2O with shaking overnight at 4°C. The resulting suspension was filtered to remove the gel pieces and exchanged into MWQ and concentrated using ethanol precipitation. The RNA was stored at −80°C until use.

Cy5-labelling of RNA

4.5S and RNAs4.5S were labelled using 5’ EndTag™ DNA/RNA Labeling Kit (Vector Laboratory, MB-9001) and Cy5-maleimide (Kerafast lnc., MA, USA) by following manufacturer’s protocol. Briefly, 0.6 nmol of RNA was mixed with alkaline phosphatase in universal reaction buffer (supplemented in the kit) and incubated for 30 min at 37°C. T4 polynucleotide kinase and ATPγS (supplemented in the kit) were then added to the mixture, followed by 30 min incubation at 37°C. The mixture was then reacted with Cy5-maleimide dissolved in DMSO for 2 h at room temperature in the dark. The RNA was purified by phenol-chloroform extraction and concentrated by ethanol precipitation. The labelled RNA was redissolved in water and stored at −80°C until use.

Preparation and refolding of PNAtet and variants, RNAtet, moRNAtet and 4.5S RNA

PNAtet (NH2-GUCC G^GAA GGAC-AEEA-CONH2), PNAtetS (NH2-GCC G^GAA GGC-AEEA-CONH2), PNAtetL (NH2-GAUCC G^GAA GGAUC-AEEA-CONH2) and PNAtetN (NH2-GAUCC T^UCG GGAUC-AEEA-CONH2) were ordered from PANAGENE (South Chungcheong, South Korea). G^ is Glu-gamma-Guanine, T^ is Glu-gamma-Thymine and AEEA is a2-aminoethoxy-2-ethoxy acetic acid linker. To enhance the stem stability, a GC pair is placed at the terminal ends. For PNAtetL, the addition intervening base-pairs were chosen to be AU and UA pairs to aid with potential Nuclear Magnetic Resonance (NMR) spectral interpretation and assignment and lower the GC content. Biotinylated PNAtet with an N-terminal biotin group as well as PNAtet without the AEEA-linker (NH2-GUCC G^GAA GGAC-CONH2) were also ordered from PENAGENE. RNAtet and moRNAtet (5ʹ- rG*rC*rG rCrCrG rGrArA rGrGrC* rG*rC -3ʹ, where rN* = modified nucleotide with phosphorothioate backbone) and IN3E3_LSA (20-base RNA with a 5-base-paired stem, phosphorothioate backbone and 2’-OMe-modified nucleosides [27]) was ordered from IDT (Singapore). The lyophilised PNAs and RNA oligos were solubilised in nuclease-free water to 100 μM and 750 μM, respectively and stored at -80°C. Before using, the PNA or RNA were freeze-dried and reconstituted in a buffer containing 20 or 50 mM HEPES, pH 7.5, 150 mM NaCl and 3 mM MgCl2. The PNA and RNA samples were then refolded by two cycles of incubation at 95°C for 1 min followed by 10 min on ice.

4.5S RNA and RNAs4.5S were stored in nuclease-free water at -80°C. For refolding, HEPES, pH 7.5 was added to 50 mM, followed by heat treatment in the same manner.

Nuclease and proteinase degradation assays

In a 10-μL reaction, PNAtet (100 μM) or RNAtet (80 μM) was incubated with 0.1 mg/mL each of DNase I (Sigma-Aldrich, Cat. No.: D7291), RNase A (ThermoFisher, Cat. No.: EN0531) and proteinase K (NEB, Cat. No.: P8107S) in the refolding buffer for 60 min at 37°C. Control samples containing the same amount of PNAtet and RNAtet was treated in the same manner as per legend.

Following incubation, samples for reverse-phased High Performance Liquid Chromatography (rpHPLC) were diluted 100-fold into Buffer A (100% MQW, 0.1% trifluoroacetic acid), centrifuged at 15,000 rpm for 5 mins and the supernatant injected into an Agilent 1260 series HPLC system fitted with an Eclipse-XDB C18 5 μm × 230 mm reverse-phase HPLC column (Agilent). A linear gradient from 5‒90% Buffer B (100% acetonitrile, 0.1% trifluoroacetic acid) in Buffer A over 20 min was used to elute the sample components. The total run time including equilibration and ramping back to 5% Buffer B was 30 min with a flow rate of 1 mL/min. UV detector wavelengths were set to 215, 260 and 280 nm. Note the rpHPLC trace for PNAtet alone terminated at ~20 min due to an instrument error.

For RNAtet and moRNAtet samples used for RNA gel electrophoresis, 5 μM RNA oligo was treated with each enzyme separately (0.3 mg/mL DNase I, 0.3 mg/mL RNase A, or 2 mg/mL proteinase K) for 60 min at 37°C. The reaction products were mixed with 2× RNA loading dye and separated on a 16% denaturing TBE gel by electrophoresis at 300 V for 25 min at room temperature. The gel was imaged by SYBR™ Gold stain.

Recombinant expression of unlabelled FtsYNG and Ffh

The NG domain of FtsY (residues 196‒498, referred to as FtsYNG) and C-terminal truncation of Ffh (residues 1‒432) containing an N-terminal His6-tag were inserted between the NcoI and BamHI sites of pET15b vectors as described in [28]. The plasmids were transformed into BL21 Rosetta cells and the freshly transformed cells were grown in 1 L LB medium supplemented with 100 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C until the absorbance at 600 nm reached 0.6. Protein expression was induced with 0.5 mM IPTG, and the cells were grown at 28°C for an additional 3.5 h, before harvested by centrifugation (5,000×g for 20 min at 4°C).

Recombinant expression of 2H13C15N-labelled FtsYNG

Isotopically labelled FtsYNG, used for 15N-1H-TROSY-HSQC titrations and assignments, was expressed as previously described [29] with 10 g/L 13C glucose as the sole carbon source and 5.2 g/L 15N ammonium chloride as the sole nitrogen source in 100% 2H2O. Protein expression was induced with 1 mM IPTG at an optical density (OD600) of 3, and cells were harvested after exhaustion of the carbon source, as indicated by a small rise in pH, at an OD600 of 10.2. The non-exchangeable deuteration level of the 2H13C15N-labelled FtsYNG was determined, by partial trypsin digest MALDI-TOF, to be 87%.

Purification of FtsYNG, Ffh and Nsp9

Ffh pellet from 1L of cell culture was resuspended in 30 mL of lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 10 mM MgCl2, 0.1% Triton-X 100, 5 mM imidazole, 1 mM DTT, 1 mM PMSF and 1× cOmplete™ Protease Inhibitor Cocktail, Roche), and lysed by sonication. The lysate was clarified by centrifugation at 15,000×g for 30 min at 4°C and the soluble fraction was mixed with 5 mL Ni-NTA Agarose resin (Invitrogen, Cat. No.: R901-15) pre-equilibrated in Ffh lysis buffer. After incubating for 1 h on a shaker at 4°C, the beads were washed 3 times with 5× CV of wash buffer 1 (50 mM HEPES pH 7.5, 300 mM NaCl, 5% glycerol, 10 mM MgCl2, 10 mM imidazole, 1 mM TCEP) and then 3 times with wash buffer 2 (same as wash buffer 1 but with 20 mM imidazole). The protein was eluted with elution buffer (same as wash buffer 1 but with 400 mM imidazole). The eluted protein was pooled and mixed with TEV protease, followed by dialysis against 20 mM HEPES pH 7.5, 300 mM NaCl, 5% glycerol, 1 mM TCEP overnight at 4°C. The cleaved protein was separated from the uncleaved and TEV protease by reverse Ni-NTA chromatography and buffer exchange into 20 mM HEPES pH 7.5, 100 mM NaCl, 5% glycerol, 1 mM TCEP with dialysis. Ffh was further purified with cation exchange chromatography using a HiTrap™ SP HP column (Cytvia), with a gradient across 0−1 M NaCl over 20 CV. The eluted peak containing Ffh was concentrated and injected onto a HiLoad 16/600 Superdex 75 pg SEC column (Cytiva) pre-equilibrated in RNase Free SEC buffer (50 mM HEPES pH 7.4, 10 mM MgCl2, 300 mM NaCl, 10% glycerol, 1 mM TCEP). The final purified protein was concentrated and stored at -80°C.

FtsYNG was purified in a similar manner. Except the protein eluted from Ni-NTA affinity chromatography was dialysed against 50 mM MES pH 6, 100 mM NaCl, 1 mM TCEP, 5% glycerol without TEV protease. On the next day, the protein was loaded onto a HiTrap™ SP HP column, and cation exchange chromatography was performed using 50 mM MES pH 6, 1 mM TCEP, 5% glycerol with and without 1 M NaCl. The later peak eluted from cation exchange column with a lower A260:280 ratio was mixed with TEV protease and digested while dialysing against 100 mM HEPES, pH 7.4, 200 mM NaCl, 5% glycerol, 1 mM TCEP for 48 h at 4°C. The cleaved FtsYNG was separated using two rounds of reverse Ni-NTA chromatography and injected onto Superdex 75 column using the same SEC buffer. The purification protocols are the same for triple labelled and unlabelled FtsYNG. NMR buffer used for FtsYNG HSQC titration experiments was 50 mM sodium phosphate, 3 mM MgCl2, 150 mM NaCl, 1 mM DTT.

Nsp9 was expressed and purified as described in [30]. Briefly, 15N-labelled 6xHis-Nsp9 from SARS-CoV-2 was expressed in Escherichia coli BL21(DE3) cells in a bio-fermenter using the protocol described in [31]. Cells were lysed by sonication in lysis buffer (20 mM Tris pH 8.0, 50 mM NaCl, 3 mM TCEP, 0.5 mM PMSF, 0.1% Triton X-100), were centrifuged, and the supernatant was subjected to Ni-NTA affinity chromatography followed by thrombin cleavage for 1 h at 25°C and then 15 h at 4°C to remove the His6-tag. The eluate from Ni-NTA affinity chromatography was subjected to size exclusion chromatography using a Superdex 75 column (120 mL) equilibrated with NMR buffer (25 mM sodium phosphate pH 6.0, 150 mM NaCl, 1 mM DTT).

Circular dichroism (CD) spectroscopy

CD samples were prepared by refolding RNAtet and moRNAtet at 30 μM in 10 mM HEPES, pH 7.0 and 0.5 mM MgCl2. Experiments were conducted using a JASCO J-815 CD Spectrometer with 0.1-cm pathlength quartz cuvettes. CD spectra at 20°C and 90°C were recorded over 200–300 nm at a rate of 50 nm/min with a bandwidth of 1 nm and a D.I.T of 1 sec. Spectra shown were averaged over three scans. Melt curves from 20–90°C was recorded at 265 nm and 210 nm with a ramp of 1°C/min, collected in 2°C intervals with a bandwidth of 1 nm and D.I.T of 4 sec.

NMR spectroscopy

All NMR spectra were recorded on Bruker Avance III 600 or 800 MHz Spectrometers equipped with a TCI cryogenic probehead. Acquisition temperatures ranged from 2–25°C and are stated in the methods, results and/or legends. All NMR samples were loaded into 3- or 5- mm NMR tubes with 0.5–1.5 mM DSS and 5% (v/v) D2O added to each sample prior to acquisition.

NMR samples were prepared as described in the respective sections. The PNAtet presented in S1 Fig in S1 File was the version without the AEEA-linker. For NMR experiments, purified FtsYNG and Nsp9 proteins were dialysed in NMR buffers for at least 2 h at 4°C using a 10-kDa MWCO dialysis membrane. PNA/RNA was added to isotopically labelled FtsYNG/Nsp9 at 0.5 to 2 molar ratio as indicated and NMR spectra collected at 25°C before and after the PNA/RNA addition. As Nsp9 gave high quality NMR spectra at concentrations as low as 40 μM, the PNAtet used in the titration did not contain the AEEA-linker. For FtsYNG titrations, sample concentrations ranged from 80‒120 μM. 1D 1H spectra were acquired using the standard zgesgp program (SW = 20 ppm) from Bruker pulse library to suppress the water peak. 2D 15N-1H TROSY-HSQC (Transverse Relaxation Optimised Spectroscopy Heteronuclear Single-Quantum Coherence) spectra were acquired using b_trosyetf3gpsi.3 (SW = 12 and 26 ppm, for 1H- and 15N-dimensions, respectively) from the Bruker pulse library. Relaxation delay for the 1D 1H and 2D 15N-1H TROSY-HSQC was set to 1 s and 0.3 s, respectively. The spectra were processed and analysed using Topspin 3.6.x or 4.1.x (Bruker, Biospin) with the 1H chemical shift of the DSS trimethylsilyl group used as the reference. Number of scans (NS) were adjusted depending on concentration of the proteins after dialysis to obtain sufficient signal intensity and ranged from 64‒256 scans.

1D 1H spectra were collected after each HSQC experiment as quality control experiment to ensure the protein/PNAtet/RNAtet/moRNAtet have not been degraded during acquisition of the 2D 15N-1H TROSY-HSQC spectra.

For assignment of FtsYNG in 2D 15N-1H TROSY-HSQC spectra, 3D TROSY HNCA, HN(CO)CA, HNCB, HNCACB, HN(CO)CACB spectra were collected on an 800 MHz spectrometer at 25°C from multiple 2H13C15N-FtsYNG samples ranging from 150‒300 μM in FtsYNG NMR buffer for manual assignments by CARA (http://cara.nmr.ch/doku.php). The assigned chemical shifts were deposited in BMRB (ID 52588). The backbone assignments of the RNA binding site were further validated when they corresponded to amide chemical shift changes in the various titration experiments.

For assignment of imino and imide signals for PNAtetL, 2D 1H-1H NOESY spectra (Bruker sequence noesyesgpph) were collected at 10°C with 4096 and 400 points in the time domain for F2 and F1, respectively, with a NOE mixing time of 100–200 ms and NS of 96 scans. NMR data were processed using Topspin (Bruker) and analysed with SPARKY (T. D. Goddard and D. G. Kneller, University of California at San Francisco).

Surface plasmon resonance (SPR)

All measurements were collected on a Biacore T200 (Cytiva), and all data analysed using the Biacore Insight Evaluation Software. Biotinylated PNAtet was immobilised to an SA chip (Cytiva) at 10°C in 20 mM HEPES, 150 mM NaCl, 3 mM MgCl2 to levels of 510 RU. FtsYNG (1.6–100 μM) was titrated onto immobilised PNAtet at 10°C in 20 mM HEPES, 150 mM NaCl, 3 mM MgCl2, 1 mM TCEP, 1% (v/v) glycerol, 0.005% (v/v) Tween pH 7.5.

Avi-FtsYNG or Avi-Nsp9 were coupled to a streptavidin surface, which was prepared by amine coupling streptavidin to a CM5 chip (Cytiva) using standard methods. Briefly, the surface was activated with a 1:1 mixture of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (0.4 M) and N-hydroxysuccinimide (0.1 M). Streptavidin (2 μg/ml) in 10 mM sodium acetate (pH 5) was injected for 450 s at 2 μl/min. The surface was then blocked with an injection of 1 M ethanolamine (pH 8.5). Avi-FtsYNG was immobilised at 25°C in 20 mM HEPES, 150 mM NaCl, 3 mM MgCl2 pH 7.5 to levels of 4650 RU, and Avi-Nsp9 to levels of 520 RU PNAtet (0.28‒17.5 μM) and moRNAtet (0.8‒50 μM), along with GDP (0.1‒375 μM) and IN3E3_LSA (0.1‒50 μM) as positive controls were titrated over immobilised Avi-FtsYNG and Avi-Nsp9 at 10°C, in 20 mM HEPES pH 7.5, 150 mM NaCl, 3 mM MgCl2, 1 mM TCEP, 1% glycerol, 0.005% Tween. Note higher concentration points (> 20 μM) for titration of PNAtet into Avi-FtsYNG were removed from the fitting as the sensorgram shape was poor, possibly due to PNAtet aggregation and/or precipitation upon interaction with Avi-FtsYNG on the chip surface.

Electrophoretic mobility shift assay (EMSA)

Cy5-labelled RNA, PNAtet and moRNA were prepared as described above. Each reaction contained 20 nM of Cy5-labelled RNA, 50 mM HEPES, pH 7.5, 150 mM KCl, 1.5 mM MgCl2, 10% glycerol, 0.01% (v/v) Igepal and 1 mM GMP-PNP. Ffh was added to 200 nM first and incubated for 10 min at room temperature. FtsYNG was pre-mixed and incubated with 20 μM of refolded PNAtet separately at room temperature for 30 min, before adding to the Ffh-RNA mixture to final concentration of 400 nM. The samples were loaded onto a 1× TBE 6% polyacrylamide gel containing 2.5 mM MgCl2 after exaction. Following a 5-min incubation, and the gel was run in 0.5× TBE buffer containing 2.5 mM MgCl2 at 1 W/10 mL gel for 2 h at 4°C. The gel was then imaged on an FLA-9000 laser scanner.

Microscale thermophoresis (MST)

Cy5-labelled RNAs4.5S and PNAtet and variants were prepared and refolded as described above. FtsYNG was buffer exchanged into MST buffer (50 mM HEPES, pH 7.5, 100 mM NaCl, 1.5 mM MgCl2, 10% glycerol) and concentrated to ~750 μM using Amicon Ultra-0.5 mL Centrifugal Filters (10 K MWCO, Merck Millipore). For each replicate, a set of titration points FtsYNG was prepared by 1:2 serial dilution using the same MST buffer, then mixed with 50 nM Cy5-labelled RNAs4.5S and 0.01% (v/v) Igepal, with or without 5 μM PNAtet and variants. Following 10 min incubation at room temperature, the samples were loaded into standard capillary tubes (Nanotemper) before undergoing MST in a Monolith™ NT.115 instrument. Thermophoresis was conducted at 90% LED power, and 20% MST power. Thermophoresis data were then analysed with MO Affinity Analysis software v2.3.

Results

Design of PNA constructs to mimic the 4.5S tetraloop

RNA hairpins are a common folded structure consisting of a Watson-Crick base-paired stem structure and an unpaired loop sequence. Hairpins are typically found in transcription termination and for displaying certain bases for sequence-specific interaction with RBPs. The 4.5S RNA has a tetraloop displaying a GNRA (GGAA) sequence followed by a base-paired stem region and the tetraloop is responsible for the initial interaction with FtsY. Furthermore, the crystal structure of 4.5S RNA tetraloop binding to the FtsY:Ffh NG heterodimer indicates that a short stem of the hairpin structure is sufficient for the initial assembly of the complex [32]. As the 4.5S RNA recognition site mainly covers the GGAA tetraloop and the two most adjacent CC-GG base-paired stem, the designed PNA constructs contain this core sequence with an additional one to three base pairs (termed PNAtetS, PNAtet and PNAtetL, respectively; Fig 1A) at the end to promote the stability of the stem. We also tested PNAtetN which has the same stem as PNAtet and a loop with a non-binding sequence UUCG (in our PNA is TUCG) [33]. As positive controls, RNAtet and moRNAtet (modified RNAtet) with a five base pairs stem were used since this is the minimum length in our experience to achieve reliable hairpin formation and FtsY binding. A major motivation for using PNAs as RNA mimics for RBP binding is the increased stability under a range of conditions, including a non-RNase-free setup. Therefore, moRNAtet, which has the first and last two phosphodiester bonds replaced by phosphorothioate bonds (Fig 1B) with increased degradation resistance over RNAtet, is used as a comparison to PNAs. RNAtet and moRNAtet share nearly identical circular dichroism (CD) spectra as well as thermal melt profiles indicating similar structures and thermal stability (S1 Fig in S1 File).

10.1371/journal.pone.0310565.g001 Fig 1 Structure and stability assessments of folded PNAtet and moRNAtet.

(A) Sequence (left) and schematic (right) comparison of PNA and RNA molecules used in this study. The core FtsY-binding region in 4.5S RNA, consisting of the GGAA tetraloop (red italic) and the two base pairs adjacent are highlighted in bold. Bases shown in green in moRNAtet indicate phosphotioester backbone modification. Blue indicates glutamic acid side chain on the gamma carbon of the first G. (B) Predicted folded structure of PNAtet and moRNAtet and their backbone modifications. (C) 1D 1H NMR spectra of 100 μM folded PNAtet and moRNAtet at various temperatures. (D) Particle distribution of 50 μM folded PNAtet in 50 mM HEPES pH 7.5, 150 mM NaCl, 3 mM MgCl2, measured by DLS at 25°C.

Because PNA base-pairing is thought to be more robust than in RNA, fewer than five base-pairs in the stem might be sufficient for hairpin formation. In addition, all PNAtet variants contain a glutamic acid side chain on the gamma carbon of the first G in GGAA or the first T in TUGG (since the modification available on Gs and Us only) (Fig 1B) to mimic the electrostatic interactions between the negatively charged backbone in 4.5S RNA and the basic residue patch (K399, R402, K405 and K406) on FtsY [32]. We also included AEEA-linkers at the C-terminal of the PNAs to enhance solubility (Fig 1B).

PNAs can fold into a stable hairpin structure

Most of the reported PNA structures and applications thus far correspond to PNA-PNA or PNA-NA duplexes/triplexes [15, 16], even though the ability of PNAs to form stable hairpins was demonstrated in the 1990s [34]. Typically, PNAs adopt a P-form helix in a PNA-PNA or PNA-NA base pairing, which is more conformationally restrictive than standard NA backbones adopting the more common B-helix [35]. Therefore, we first tested if the designed PNAs could fold into a hairpin and sufficiently mimic the 4.5S RNA stem-loop for FtsY binding. When Watson-Crick base-pairing occurs, the imino protons of Guanosine and Uracil bases are in hydrogen bonding with Cytosine and Adenine bases, respectively, and are protected from exchange with water. As such, only protected hydrogen-bonded imino protons can be detected as peaks between 10 and 15 ppm in one-dimensional (1D) 1H Nuclear Magnetic Resonance (NMR) spectra [36]. As other hydrogen atoms in nucleic acids do not feature in this region, the presence of signals between 10‒15 ppm (imino region) can be used to indicate the formation of Watson-Crick base-pairing. In addition, the position of NMR peaks on the chemical shift scale is sensitive to the local chemical environment experienced by the hydrogen atoms. Therefore, an imino proton participating in a stable hydrogen bond in a well-folded duplex structure would be expected to give rise to one sharp peak, and the number of imino peaks can be used to indicate the number of Watson-Crick base pairs present [37].

When PNAtet was initially resuspended in water, the NMR spectrum showed no clear peaks in the imino region (S2 Fig in S1 File) indicating the absence of stable base-pairing. After refolding PNAtet, PNAtetS, PNAtetL, PNAtetN and moRNAtet using heat-cooling cycles in refolding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 3 mM MgCl2), 1D 1H NMR spectra of all samples display clear imino signals (Fig 1C and S3 Fig in S1 File). Compared with the PNAtet spectra, the imino peaks in the moRNAtet spectra are broader (Fig 1C), suggesting a range of local chemical environments are experienced by the imino hydrogens and conformational exchange in moRNAtet. The overlapping imino peaks of moRNAtet are clustered at 12‒13.2 ppm, consistent with published imino chemical shifts from other short dsRNA where the imino peaks of G and U generally occurring in the ~10–13 ppm and ~13‒14 ppm regions, respectively [38, 39]. In contrast, sharp and discrete imino signals, albeit at different intensities, can be observed in the PNAtet, PNAtetS, PNAtetL and PNAtetN spectra (S3 Fig in S1 File), indicating that the PNAs have folded into a stem loop with base pairing observed for all bases in the stem. At 25°C, generally one to two fewer imino peaks were observed consistent with the expectation that the two ends of the hairpin are likely to experience some opening and closing in solution at the higher temperatures (Fig 1C and S3 Fig in S1 File). From the NMR results, large-scale synthesis of PNAtet and PNAtetL was ordered for further investigations as these PNAs display at least three well-protected imino groups in the stem region at 2–25°C.

We attempted to prepare PNAtet and PNAtetL samples at >200 μM to collect 2D 1H-1H NOESY spectra. While PNAtet generally appeared more soluble than PNAtetL and was able to dissolve at ~220 μM, precipitation was apparent during NOESY collection and this impacted spectral quality. PNAtetL was only able to be dissolved at ~150 μM and some precipitation was also observed during NOESY acquisition. However, the NOESY spectra of PNAtetL were of better quality than for PNAtet and were therefore used for sequence-specific partial assignments of the imino and imide signals (S4A Fig in S1 File). A number of NOEs from hydrogens in the base-paired nucleobases can be detected (e.g., G11H2-U3H3, A2H6-U13H3, C4H5-G11H1, C14H5-G1H1, see S4B Fig in S1 File for a schematic of the proposed basepairing). The linewidths of the imino groups also agree well with their positions in the stem loop, with the middle bases (U13, U3, G11) displaying the sharpest imino signals, while the G10 (adjacent to the tetraloop bulge) displaying a broad imino signal (S4C Fig in S1 File).

Since NMR spectra of all PNAs displayed sharp and discrete signals corresponding to the expected number of base pairs at least at lower temperatures and PNA duplexes have previously been shown to have much lower mismatch tolerance than RNA and DNA [40], the possibility of PNAs to form alternative base pairing is considered low. Subsequent experiments requiring a high PNA concentration were conducted on PNAtet as it is generally more soluble than PNAtetL. To determine whether the observed base-pairing was intra- or inter-molecular, dynamic light scattering (DLS) measurements were conducted on PNAtet (Fig 1D) to identify the population of species in solution after refolding. Clearly, one dominant species (98.5% by intensity, 100% by the number of molecules) is present after refolding. As intermolecular base pairing of PNAtet will cause unpaired bases to interact with other PNA molecules and lead to oligomerization, the DLS result supports that PNAtet exists as a monomer after refolding, consistent with the sharp signals observed in the imino region. The estimated hydrodynamic radius of the dominant species from DLS is ~17 Å, also agreeing with an intramolecular hairpin stem loop formed from 12 bases.

PNAtet and PNAtetL inhibit FtsYNG interaction with 4.5S RNA and disrupt SRP:FtsYNG complex formation

Given PNAtet and variants can form stable hairpins, we tested if they can sufficiently mimic the 4.5S tetraloop and compete for FtsYNG binding in in vitro assays including MicroScale Thermophoresis (MST) and EMSA.

MST competition assays were adopted to evaluate the inhibition activity of PNAtet and variants. In this assay, a short 41-nt RNA displaying the GGAA tetraloop, described in [32], and carrying a 5ʹ Cy5-tag, named shortened 4.5S RNA (RNAs4.5S), was used. The affinity between FtsYNG and RNAs4.5S was measured in the absence and presence of PNAtet or variants at 5 μM in triplicates (Fig 2A) and the fold change in KD calculated (Fig 2B). PNAtet and PNAtetL increased the KD between RNAs4.5S and FtsY substantially suggesting that PNAtet and PNAtetL, but not PNAtetS and PNAtetN, can compete with RNAs4.5S for binding to FtsYNG.

10.1371/journal.pone.0310565.g002 Fig 2 PNAtet showed inhibitory effect on SRP:FtsYNG assembly.

(A) MST showing that folded PNAtet and PNAtetL reduces the affinity between FtsYNG and RNAs4.5S. Cy5-labelled RNAs4.5S was titrated with FtsYNG with or without the presence of 5 μM folded PNAtet or PNAtetL. Three technical replicates (error bar = Stdev) and a fitting curve to a 1:1 binding isotherm are shown, and KD values are indicated. (B) The effect of folded PNAtet and variants on KD between FtsYNG and RNAs4.5S. Three technical replicates (error bar = SD) of each experiments were shown, the apparent KD of each PNA is normalised against KD without PNA. (C) An EMSA gel showing PNAtet inhibiting interaction between SRP and FtsYNG. Each lane contains 20 nM of Cy5-labelled RNA4.5S and 1 mM GMP-PNP. Ffh was incubated with RNA for 10 min at room temperature, before mixing with 400 nM FtsYNG with or without pre-incubating with 20 μM PNAtet.

Next, we tested the ability of PNAtet to prevent the complex formation between FtsY and the SRP by competing with 4.5SRNA tetraloop for the open complex formation. The protein component of SRP, Ffh, binds tightly to 4.5S RNA via its M-domain and together they bind to FtsY. Upon the initial FtsY:4.5S tetraloop interaction, also known as open complex, the Ffh:FtsY NG domain heterodimer complex forms in the presence of GTP to generate the SRP:FtsY complex. In this experiment, FtsYNG was pre-incubated with or without 20 μM of PNA before adding SRP and GMPPNP. GMPPNP, a non-hydrolysable GTP analogue, was used to lock in the formation of a Ffh:FtsYNG heterodimer, a GTP-mediated process, so the complex could be detected using EMSA [41, 42]. As shown in Fig 2C, we observed that 4.5S RNA was fully shifted by Ffh protein, which was then super shifted by the addition of FtsYNG. However, in the presence of PNAtet, the amount of ternary complex formation was reduced, indicating that PNAtet disrupted the binding of SRP to its receptor. Similarly, moRNAtet also displayed a similar level of inhibition on SRP:FtsYNG complex formation, and the inhibition by PNAtet/moRNAtet was dose dependent (S5 Fig in S1 File). It is worth noting that in the presence of GMPPNP, the complex formation is biased towards the accumulation of SRP:FtsYNG over time and PNAtet/moRNAtet only acts to slow down SRP:FtsYNG formation. Therefore, their inhibitory activities were not quantified in this assay. Overall, the in vitro assays supported that PNAtet can inhibit the assembly of SRP:FtsYNG complex by competing with the binding of the GGAA tetraloop in 4.5S RNA to FtsYNG.

Folded PNAtet and moRNAtet bind to the RNA-binding face of FtsYNG

One major advantage of using PNAs over RNAs in RBP interaction studies is PNAs are completely resistant to RNase, DNase and proteinase K attacks. We have confirmed that PNAtet maintained A260 peak intensity in reverse-phase high pressure liquid chromatography (rpHPLC) spectra after one hour of enzyme challenge (S6A Fig in S1 File) while the A260 peak from RNAtet decreased significantly. As expected, moRNAtet was also more resistant to degradation than RNAtet according to RNA gel electrophoresis (S6B Fig in S1 File) and hence was used in subsequent assays to compare with PNAtet.

The mechanism by which PNAtet interferes with SRP:FtsYNG formation was assessed using surface plasmon resonance (SPR) and NMR experiments. In SPR assays, RNase-free conditions are particularly hard to establish but no longer a concern for titrating PNAtet and moRNAtet over immobilised FtsYNG. Binding of moRNAtet and PNAtet to FtsYNG was observed (Fig 3A and 3C), however, for both molecules the binding curves were not complete over the assayed concentration range. Using GDP binding as a control to allow fix fitting [19], for moRNAtet an estimated dissociation constant (KD) of 160 ± 20 μM (average ± stdev from three replicate experiments, Fig 3B) and for PNAtet an estimated KD of 440 ± 30 μM were calculated (fit and error for one independent experiment, Fig 3D). When the orientation of the experiment was reversed (i.e., biotinylated PNAtet was immobilised and FtsYNG added in increasing concentrations), dose-dependent responses were also observed with a linear response over the assayable concentration range (Fig 3E).

10.1371/journal.pone.0310565.g003 Fig 3 Folded PNAtet and moRNAtet interact with FtsYNG RNA-binding face in similar manners.

SPR sensorgram and fit to equilibrium response shown for PNAtet (0.28–17.5 μM, A-B) or moRNAtet (0.1–25 μM, C-D) binding to immobilised Avi-FtsYNG. (E) SPR sensorgram of FtsYNG (1.6–100 μM) binding to immobilised biotinylated PNAtet. (F) 15N-1H-TROSY-HSQC spectra of 2H13C15N-FtsYNG alone (red) and following addition of 1:0.5, 1, 1.3 and 2 molar equivalence of PNAtet (blue). (G) 15N-1H-TROSY-HSQC spectra of 2H13C15N-FtsYNG alone (red) and following addition of 1:0.5, 1, 1.5, and 2 molar equivalence of moRNAtet (blue). Arrows indicate some of the perturbed residues.

To assess whether PNAtet binds to FtsYNG in the targeted RNA-binding site, Transverse Relaxation-Optimised Spectroscopy Heteronuclear Single Quantum Coherence (TROSY-HSQC) NMR experiments were performed similar to those previously conducted for fragment screening against FtsYNG [19]. As shown in Fig 3F, the addition of the PNAtet into isotopically labelled 2H13C15N-FtsYNG at 0.5 to 2 molar equivalence resulted in a subset of the peaks losing intensity or moving in the 15N-1H-TROSY-HSQC spectra indicative of perturbations of specific residues. Encouragingly, the addition of moRNAtet produced similar spectral changes (Fig 3G) indicating the same binding mode and similar binding residues for both molecules. While the perturbations are smaller for PNAtet than for moRNAtet titrations consistent with the affinity difference as measured by SPR, the smaller changes are also likely contributed by the limited solubility of PNAtet and a fine precipitation was observed at later titration points for PNAtet. We note that the peaks that experienced the largest intensity changes upon PNAtet and moRNAtet additions corresponded to some of the most perturbed peaks when 4.5S RNA was titrated previously [19]. The specific binding of PNAtet to the FtsYNG RNA-binding interface is further supported by partial assignments of backbone amide resonances of FtsYNG in the 15N-1H-TROSY-HSQC spectrum. For example, S360, V403 and K405 on the RNA-binding site are some of the assigned residues that showed perturbations upon PNAtet and/or moRNAtet additions (Fig 3F and 3G). Note that only ~70% of amide groups are visible on the 15N-1H-TROSY-HSQC spectrum of FtsYNG presumably due to buried amide groups (produced as 2H15N) have not been back-exchanged with 1HN. Attempts to unfold and refold the protein in varying concentrations of urea were unsuccessful. Therefore, a more complete assignment of FtsYNG peaks could not be achieved and only unambiguous assignments are indicated in S7A Fig in S1 File. However, reassuringly, the assigned residues correspond mostly to surface residues, including some RNA-binding residues (S7B Fig in S1 File). CAn and CAn-1 connectivities for the residues at the RNA-binding site in the HNCA are shown in S8 Fig in S1 File.

PNAtet binds SARS-CoV-2 Nsp9

Having established that folded PNAtet can bind FtsYNG and disrupt the FtsYNG:SRP interaction, we next wanted to know if PNAs can act as an RNA mimic for other RBPs. Nsp9 (non-structural protein 9) from SARS-CoV-2 was chosen as Nsp9 is a highly conserved and an essential component of the viral replication/transcription complex in coronaviruses [43, 44]. In addition, it is a dimeric protein that binds single-stranded RNA (ssRNA) non-specifically with weak affinity [23, 24]. However, recent results have revealed that it has a preference for binding hairpin structures [25] comparing to its weak affinity to ssRNA [23, 24, 44]. Therefore, we hypothesized that folded PNAtet might also bind Nsp9.

We have examined whether Nsp9 can bind to refolded PNAtet using SPR and NMR titration experiments. For SPR analysis, Nsp9 was immobilised, and increasing concentrations of PNAtet titrated. A binding response was observed (Fig 4A), however, a saturable binding curve was not observed over the assayable concentration range. Using IN3E3_LSA (an RNA hairpin designed to bind Nsp9 from [27], S9 Fig in S1 File) as a positive control, an estimate KD of 80 ± 7 μM was calculated for PNAtet (Fig 4B), which is ~5–10 fold higher than the KD for single-stranded RNA as previously published [23, 24] and from our own work [30].

10.1371/journal.pone.0310565.g004 Fig 4 PNAtet showing binding to Nsp9.

(A-B) Sensorgram and fit to equilibrium response shown for PNAtet (0.6–80 μM) binding to immobilised Avi-Nsp9. (C) 15N-1H-TROSY-HSQC spectra of 15N-Nsp9 alone (blue) and following addition of 1:1 molar equivalence of PNAtet (red). Arrows indicate some of the perturbed residues.

To further delineate which Nsp9 residues are involved in binding PNAtet, a 15N-1H-TROSY-HSQC titration study was conducted using uniformly 15N-labelled Nsp9. Minor movement (as indicated in Fig 4B), and disappearance of several Nsp9 peaks were observed, confirming that PNAtet is indeed interacting with the protein. Comparison with the published data [30] on RNA binding of Nsp9 reveals that the binding interfaces of PNA and RNA overlap to some extent, suggesting that Nsp9 recognise PNA in a similar manner to ssRNA.

Conclusion and discussion

PNA is a synthetic molecule that replaces ribose phosphate backbone of nucleic acid with polyamide, providing resistance to nucleases and protease attacks while retaining the hybridization property of base complementarity [45]. Compared with DNA and RNA, the Watson-Crick interactions in PNAs are not interfered by the electronegative repulsion from the backbone, and this property has been exploited to interfere with native base pairing. In addition, the biostability of PNA makes it a promising therapeutic agent and it has been used as an antisense inhibitor to control gene/protein expression in vivo [46]. However, previous studies have only explored the base complementarity approach to inhibit transcription or block translation [47–49]. In this study, we have shown engineered PNAs that mimic the 4.5S tetraloop and can fold into a hairpin structure despite the differences in the backbone between RNA and PNA. In addition, the folded PNAtet has been shown to bind two RBPs. Encouragingly, despite a 3-fold reduction in binding affinity, PNAtet can readily compete with the native 4.5S RNA and prevent SRP:FtsYNG complex formation benchmarking our new concept that PNAs can be used to abrogate RBP:RNA interactions in assays, especially those that would be difficult to carry out under RNase-free conditions. The ability for PNAtet to compete for 4.5S RNA despite its lower binding affinity possibly result from its more robust hairpin structure. However, for PNAs to become useful tool compounds and drugs, further developments are needed to improve the solubility, affinity, specificity and cell permeability.

The MST results indicated that PNA with longer stem, such as PNAtetL, is more effective in terms of interfere FtsY-RNA interaction. However, PNAs intrinsically have low aqueous solubility due to the charge-neutral backbone and the solubility of PNA tends to decrease as the oligomer length (e.g., a longer stem) and purine:pyrimidine ratio increase [50] and this was also observed with the tested PNAs. Thus, the effectiveness of PNA inhibition can likely benefit from improving the solubility of longer PNA molecules. Indeed, backbone modifications as well as internal or terminal linkers have been successfully used to improve PNA aqueous solubility. Unmodified PNA molecules have an achiral polyamide backbone consisting of N-(2 aminoethyl) glycine (AEG). The glycyl α carbon can be linked to the acetamido β carbon on the same PNA unit via a methylene bridge, creating a N-(2 aminoethyl) prolyl (AEP) backbone, thus increasing water solubility by introducing positive charges [51]. Similarly, adding a hydrophilic (R)-diethylene glycol [52] or lysine side chain [53] to the γ carbon of the AEG backbone can also enhance solubility and reduce PNA self-aggregation. However, backbone modifications have the drawback of increasing conformational rigidity and/or chirality to the molecule, which may disrupt PNA folding. Therefore, a more common approach is to include terminal tags or internal linkers, which improve aqueous solubility by adding hydrophilic moieties. Such as the AEEA-linker used in this study, as well as X or E linkers, which are PNA units with nucleotide bases replaced by branched carboxylic acid derivatives. Since most cellular experiments only require PNA at micromolar to nanomolar concentrations, these modifications offer sufficient solubility enhancement.

Due to the chemical properties of PNAs, not all RBPs are suitable targets. While the addition of glutamic acid side chain on the gamma carbon of Gs and Ts in PNAs can compensate for the negative charge in the ribose-phosphate backbone, RBPs that bind RNAs with a very high affinity and mainly through interactions with the backbone are unsuitable for PNA targeting. As shown in our study, RBPs that bind to nucleobases with structure and sequence specificity at low to moderate affinities (in the μM range) can likely be targeted by PNAs. In this study, we based our PNA design on the native 4.5S RNA tetraloop to target the FtsY. While PNAtet and variants bind FtsYNG and displays inhibitory activity in competition assays in vitro, it is possible that the native GNRA tetraloop sequence might not be the best sequence for the PNA design. Systematic evolution of ligands by exponential enrichment (SELEX) experiments have demonstrated for many RBPs that evolved sequences often surpass the native binding sequence in binding affinity and selectivity [54, 55]. The RNA-binding UP1 domain of heterogeneous nuclear ribonucleoproteins, for example, specifically recognises a native 5′- UUAGGG -3′ sequence on pre-mRNA for 3′ splicing [56, 57]. However, high-throughput affinity analysis studies showed a strong affinity to 5′- GUAGGAG -3′ sequence [58]. Affinity distribution analyses, which analyse the RNA association kinetics and affinity for all possible sequence combinations of a given length have been successfully used to identify “hidden” binding sequences. For instance, the C5 subunit of Escherichia coli RNase P does not have a known consensus sequence but its affinity distribution is similar to those of specific RBPs, indicating that C5 has inherent specificity [59]. Therefore, if higher affinity and specificity is required for a particular application, PNA design can include an optimised RNA sequence for the nucleobases while maintaining the advantages of more stable base pairing, due to the lack of backbone repulsion [60]. Furthermore, our results demonstrated that the refolded PNAs were highly stable structurally and could maintain hairpin structures after freeze-thawing as well as freeze-drying as well as reconstitution and long-term storage in aqueous solutions.

In conclusion, our results benchmark the potential of PNAs as a new class of compounds that can be used to specifically target the RNA-binding sites of RBPs in biochemical and biophysical assays, especially those impractical to perform under RNase-free conditions. Together with improvements in PNA solubility, cell permeability and structure-activity relationship that are under development, modified PNA molecules may also have potential to be developed into new drugs from anti-microbials to anti-cancer agents given the importance of RBPs:nucleobase interactions in biology. In addition, folded PNA may offer additional advantages as it can prevent off-target effects that arise from non-intentional base complementarity with endogenous RNA and DNA sequences in vivo.

Supporting information

S1 Raw images This file includes all raw gel images.

(PDF)

S1 File This file includes S1 to S9 Figs with legends.

(PDF)

S2 File This folder includes all raw files in folders grouped by methods.

(ZIP)

S3 File This file includes a description of the supplementary data/files for figures.

(DOCX)

The authors acknowledge the Sydney Analytical Core Research Facility for access to SPR and NMR infrastructure and Rezwan Siddiquee for assisting with FtsYNG purification.

10.1371/journal.pone.0310565.r001
Decision Letter 0
Comas-Garcia Mauricio Academic Editor
© 2024 Mauricio Comas-Garcia
2024
Mauricio Comas-Garcia
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
6 Aug 2024

PONE-D-24-28006Peptide Nucleic Acids can form hairpins and bind RNA-binding proteinsPLOS ONE

Dear Dr. Kwan,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

As you will see one Reviewer suggested minor revisions, while the other one suggested a major revision. However, based on the comments from both Reviewers I think that a minor revision is the most appropriate choice. Reviewer 1, who is an expert in RNA-ligand and protein-ligand interaction, as well as in structural biology, is extremely satisfied with the set of experiments used to prove most of your claims. Nonetheless, I will ask you to correct the manuscript by addressing all of their concerns:

1. Add a discussion of the future directions of how to improve the PNA/protein binding strength and specificity. In particular, what kind of PNA SL modifications: structural, chemical, sequence (?) could make it a better competitor for the cognate RNA SL?

2. It is not clear what role glutamate has in binding, if any at all. Please explain it.

3. What is the OO linker?

4. Fig 2A: why are the three black lines different in the three panels?

5. Line 472: It is not clear what the authors mean by “using GDP binding as a positive control”. Do they mean competitive inhibitor?

6. The RNA-FtsY interaction is well-known to be a transient interaction. Does the PNA have any meaningful inhibitory role in a functional SRP assay (GTP hydrolysis, protein targeting, secretion etc?)

Reviewer 2 also suggested to compare one PNA without glutamate to assess this. I would strongly encourage you to perform this experiment; however, if not possible please justify it. Also, I would ask you to address to the best of your abilities if Ffh-RNA binding can be similarly inhibited by the synthesized PNA. It would be ideal to have experimental data to support this answer.

Al the best,

==============================

Please submit your revised manuscript by Sep 20 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Mauricio Comas-Garcia

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that this submission includes NMR spectroscopy data. We would recommend that you include the following information in your methods section or as Supporting Information files:

a) The make/source of the NMR instrument used in your study, as well as the magnetic field strength. For each individual experiment, please also list: the nucleus being measured; the sample concentration; the solvent in which the sample is dissolved and if solvent signal suppression was used; the reference standard and the temperature.

b) A list of the chemical shifts for all compounds characterised by NMR spectroscopy, specifying, where relevant: the chemical shift (δ), the multiplicity and the coupling constants (in Hz), for the appropriate nuclei used for assignment.

c)The full integrated NMR spectrum, clearly labelled with the compound name and chemical structure.

We also strongly encourage authors to provide primary NMR data files, in particular for new compounds which have not been characterised in the existing literature. Authors should provide the acquisition data, FID files and processing parameters for each experiment, clearly labelled with the compound name and identifier, as well as a structure file for each provided dataset. See our list of recommended repositories here: https://journals.plos.org/plosone/s/recommended-repositories

3. Please note that funding information should not appear in any section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript.

4. Thank you for stating the following financial disclosure: 

   "The University of Sydney Drug Discovery Initiative (DDI) seed funding 

The production of 2H13C15N FtsYNG was supported by grant NDF9615 from the National Deuteration Facility, which is partly supported by the National Collaborative Research Infrastructure Strategy – an initiative of the Australian Government."

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." 

If this statement is not correct you must amend it as needed. 

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. In this instance it seems there may be acceptable restrictions in place that prevent the public sharing of your minimal data. However, in line with our goal of ensuring long-term data availability to all interested researchers, PLOS’ Data Policy states that authors cannot be the sole named individuals responsible for ensuring data access (http://journals.plos.org/plosone/s/data-availability#loc-acceptable-data-sharing-methods).

Data requests to a non-author institutional point of contact, such as a data access or ethics committee, helps guarantee long term stability and availability of data. Providing interested researchers with a durable point of contact ensures data will be accessible even if an author changes email addresses, institutions, or becomes unavailable to answer requests.

Before we proceed with your manuscript, please also provide non-author contact information (phone/email/hyperlink) for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If no institutional body is available to respond to requests for your minimal data, please consider if there any institutional representatives who did not collaborate in the study, and are not listed as authors on the manuscript, who would be able to hold the data and respond to external requests for data access? If so, please provide their contact information (i.e., email address). Please also provide details on how you will ensure persistent or long-term data storage and availability.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. 

7. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.   

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Dear Prof. Kwan,

I want to thank your for your submission. As you will see one Reviewer suggested minor revisions, while the other one suggested a major revision. However, based on the comments from both Reviewers I think that a minor revision is the most appropriate choice. Reviewer 1, who is an expert in RNA-ligand and protein-ligand interaction, as well as in structural biology, is extremely satisfied with the set of experiments used to prove most of your claims. Nonetheless, I will ask you to correct the manuscript by addressing all of their concerns:

1. Add a discussion of the future directions of how to improve the PNA/protein binding strength and specificity. In particular, what kind of PNA SL modifications: structural, chemical, sequence (?) could make it a better competitor for the cognate RNA SL?

2. It is not clear what role glutamate has in binding, if any at all. Please explain it.

3. What is the OO linker?

4. Fig 2A: why are the three black lines different in the three panels?

5. Line 472: It is not clear what the authors mean by “using GDP binding as a positive control”. Do they mean competitive inhibitor?

6. The RNA-FtsY interaction is well-known to be a transient interaction. Does the PNA have any meaningful inhibitory role in a functional SRP assay (GTP hydrolysis, protein targeting, secretion etc?)

Reviewer 2 also suggested to compare one PNA without glutamate to assess this. I would strongly encourage you to perform this experiment; however, if not possible please justify it. Also, I would ask you to address to the best of your abilities if Ffh-RNA binding can be similarly inhibited by the synthesized PNA. It would be ideal to have experimental data to support this answer.

Al the best,

Prof. Mauricio Comas-Garcia

Handling Editor

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Review in the manuscript “Peptide Nucleic Acids can form hairpins and bind RNA-binding proteins” by Yichen Zhong et.al.

In this manuscript the authors explore an innovative idea that the peptide nucleic acids (PNAs) can be used as a drug that will compete with the RNA for its functional partner protein binding. They hypothesize that the short PNA molecule of the same sequence as prototype RNA can fold into the same secondary structure and bind the same protein partner via the same interface. This is far from obvious, and the authors managed to prove this hypothesis for the short stem loop (SL) structure by using the impressive array of experimental approaches, including NMR, SPR, CD, EMSA, and MST. This work is convincing as a proof of principle. The authors have shown quite convincingly by a combination of approaches that their PNA SL folds in the same hairpin structure as analogous RNA and binds protein with the same surface. The big advantage of the PNA vs RNA drug is that PNA is not degradable by the cellular nucleases.

However, the efficiency of such PNA mimic of RNA SL in competing for its partner protein at least in the case studied by authors is relatively low. Thus, the competition binding experiments presented in Fig. 2 suggest that even the best competitor PNAtelL of the RNA SL for binding the partner protein I only weakly effective. Indeed, addition of 5 �M of this competitor PNA SL to the protein makes the cognate RNA SL bind to it only ~2.5-fold weaker, with Kd changing from ~100nM to ~300nM. Based on that result we can roughly estimate that the PNAtelL Kd for that protein is ~50-fold weaker that the RNA Kd for the same protein. However, maybe the PNA can be further modified to improve its cognate protein binding. This seems possible, as according to the same competition studies, the strength of PNA/protein interaction is strongly affected by the length of the PNA stem, the sequence of its loop, type of the PNA or modified RNA backbone used. I believe this paper would benefit from discussion of the future directions of how to improve the PNA/protein binding strength and specificity. What kind of PNA SL modifications: structural, chemical, sequence (?) could make it a better competitor for the cognate RNA SL?

Reviewer #2: This communication by Kwan and coworkers reports the use of peptide nucleic acids (PNAs) as RNA mimics for competitive inhibition of RNA-protein interactions. The authors have demonstrated this with the help of two examples, including that of SRP inhibition.

Overall, the text is well written and is worthy of publication. However, there are a few queries that need to be carefully addressed before the paper can be considered suitable for publication.

It is not clear what role glutamate has in binding, if any at all. The authors should compare one PNA without glutamate to assess this.

What is OO linker?

Fig 2A: why are the three black lines different in the three panels? I understand that they are all measuring RNA-FtsY binding in the absence of PNA. As Ffh is also well-known to bind to RNA, the authors must check whether Ffh-RNA binding can be similarly inhibited by the synthesized PNA.

Lin2 472: It is not clear what the authors mean by “using GDP binding as a positive control”. Do they mean competitive inhibitor?

The RNA-FtsY interaction is well-known to be a transient interaction. Does the PNA have any meaningful inhibitory role in a functional SRP assay (GTP hydrolysis, protein targeting, secretion etc?)

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Ioulia Rouzina

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0310565.r002
Author response to Decision Letter 0
Submission Version1
25 Aug 2024

Editorial comments summarising comments from Reviewer 1 and 2:

Reviewer 1’s comments:

1. Add a discussion of the future directions of how to improve the PNA/protein binding strength and specificity. In particular, what kind of PNA SL modifications: structural, chemical, sequence (?) could make it a better competitor for the cognate RNA SL?

We agree with the reviewer that the strength of PNA/protein interaction is strongly affected by the length of the PNA stem, the sequence of its loop, type of the PNA or modifications used. The longer PNA performed better in competition assays, but at the cost of solubility. We have expanded on the discussion about general strategies to improve PNA solubility in the manuscript text. Please refer to the section from Lines 547 to 565.

The other strategy to improve binding affinity is by optimising the binding sequence. In Lines 573 to 586, we describe how SELEX and affinity distribution analysis may be used to find better binders. Another way to improve the PNA-Protein binding affinity is via rational design strategies using high resolution structures of the PNA-protein complex. We have attempted to crystalise the complex but have not had success so far and we suspect this is at least partially due to the limited PNA solubility and the requirement for a high concentration of PNA-protein to form crystals. It is very possible that further chemical modifications to the PNA backbone to allow H-bonding with the protein and expanding those interactions with additional residues can help. Unfortunately for this study, we are limited to a small number of commercially available modifications even though PNA modifications to enhance solubility and functions are a hot area of research with several recent publications. We are hopeful that our findings would expand the interest and demand for PNAs and this would further drive research in PNA modification and synthesis. We have recently set up a collaboration with Dr Emma Watson, University of Adelaide, who has embarked on improving PNA capabilities in her new laboratory following on from her postdoctoral work:

https://onlinelibrary.wiley.com/doi/full/10.1002/hlca.202300110

Reviewer 2’s comments:

2. It is not clear what role glutamate has in binding, if any at all. Please explain it.

The glutamate was added to the PNA at the tetraloop to mimic the phosphate from the 4.5SRNA backbone that interacts with a positive patch of amino acids from the FtsY. To test the effect of this glutamate, we have used a PNAtet variant without glutamate in MST and SPR assays. However, this variant aggregated on the SPR surface and produced noisy and uninterpretable MST results. We also tested a glutamate-free variant of PNAtetN and observed similar results. It is likely this glutamate also serves as a solubility and/or stability modification to the PNA. Note that PNAtetN, which retains the glutamate but with a different tetraloop sequence did not inhibit the FtsY and RNA interaction, indicating that the loop sequence is the main contributor.

3. What is the OO linker?

The OO linker is a 2-aminoethoxy-2-ethoxy acetic acid (AEEA) linker. OO linker is the name used by the manufacturer, and we have changed it to AEEA linker in the revised manuscript. It was added to increase the solubility of PNA.

4. Fig 2A: why are the three black lines different in the three panels?

The variations in KD observed are likely due to different batches of purified protein and/or RNA. In particular, the fluorescently labelled RNA degrades easily, and this is a major motivation for using PNAs as RNA mimics. The KD between FtsY and RNA is typically ~100−200 �M , but occasionally it has been observed to increase to ~300 �M like in panel 3. The experiments reported in panel 3 were performed a few months after those shown in the first two panels as the different PNAs were ordered and available at different times. Therefore, we have chosen to compare relative rather than absolute binding affinities in the MST assays. In this study, the affinities measured in the presence and absence of PNAs were performed on the same day using the same aliquot of protein and RNA and the ratio of affinity was presented.

Additional comment from Review 2 following on the above question

As Ffh is also well-known to bind to RNA, the authors must check whether Ffh-RNA binding can be similarly inhibited by the synthesized PNA.

PNAtet and its variants would not be able to inhibit the Ffh-4.5S RNA interaction because that interaction is much stronger and is mediated via the M domain and not the S-domain tetraloop. The M domain that binds Ffh is an asymmetrical loop located in another part of the stem and is surrounded by a different structure and sequence.

5. Line 472: It is not clear what the authors mean by “using GDP binding as a positive control”. Do they mean competitive inhibitor?

Due to the weak nature of the FtsYNG:PNA interactions and limited solubility of the PNA, the binding responses in SPR do not go to saturation even at the highest PNA concentrations used. Therefore, the Rmax parameter for the PNA binding was fixed during the curve fitting process and as estimated using the fitted maximum response for the positive control (GDP). We have modified the manuscript text to reflect this and added a reference in Line 477 to our previous paper [1] and ref 19 in manuscript main text.

6. The RNA-FtsY interaction is well-known to be a transient interaction. Does the PNA have any meaningful inhibitory role in a functional SRP assay (GTP hydrolysis, protein targeting, secretion etc?)

Given the designed PNA can inhibit the initial step of complex formation according to EMSA, we would expect inhibition of all subsequent functional steps but this remains to be tested. We are planning to carry out more assays to investigate the functions of the PNA on SRP assembly and its biological effects including in vivo activity. However, these are beyond the scope of the current study which provides proof-of-concept that PNAs can be used to specifically target the RNA-binding sites of RBPs in biochemical and biophysical assays.

1. Faoro C, Wilkinson-White L, Kwan AH, Ataide SF. Discovery of fragments that target key interactions in the signal recognition particle (SRP) as potential leads for a new class of antibiotics. PLoS One. 2018;13(7):e0200387.

Attachment Submitted filename: Response to Reviewers.docx

10.1371/journal.pone.0310565.r003
Decision Letter 1
Comas-Garcia Mauricio Academic Editor
© 2024 Mauricio Comas-Garcia
2024
Mauricio Comas-Garcia
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
30 Aug 2024

Peptide Nucleic Acids can form hairpins and bind RNA-binding proteins

PONE-D-24-28006R1

Dear Dr. Kwan,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mauricio Comas-Garcia

Academic Editor

PLOS ONE

10.1371/journal.pone.0310565.r004
Acceptance letter
Comas-Garcia Mauricio Academic Editor
© 2024 Mauricio Comas-Garcia
2024
Mauricio Comas-Garcia
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
5 Sep 2024

PONE-D-24-28006R1

PLOS ONE

Dear Dr. Kwan,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Mauricio Comas-Garcia

Academic Editor

PLOS ONE
==== Refs
References

1 Corley M , Burns MC , Yeo GW . How RNA-Binding Proteins Interact with RNA: Molecules and Mechanisms. Mol Cell. 2020;78 (1 ):9–29. doi: 10.1016/j.molcel.2020.03.011 32243832
2 Gerstberger S , Hafner M , Tuschl T . A census of human RNA-binding proteins. Nat Rev Genet. 2014;15 (12 ):829–45. doi: 10.1038/nrg3813 25365966
3 Rosenbaum MI , Clemmensen LS , Bredt DS , Bettler B , Stromgaard K . Targeting receptor complexes: a new dimension in drug discovery. Nat Rev Drug Discov. 2020;19 (12 ):884–901. doi: 10.1038/s41573-020-0086-4 33177699
4 Rufer AC . Drug discovery for enzymes. Drug Discov Today. 2021;26 (4 ):875–86. doi: 10.1016/j.drudis.2021.01.006 33454380
5 Lee AC , Harris JL , Khanna KK , Hong JH . A Comprehensive Review on Current Advances in Peptide Drug Development and Design. Int J Mol Sci. 2019;20 (10 ). doi: 10.3390/ijms20102383 31091705
6 Lu H , Zhou Q , He J , Jiang Z , Peng C , Tong R , et al . Recent advances in the development of protein-protein interactions modulators: mechanisms and clinical trials. Signal Transduct Target Ther. 2020;5 (1 ):213. doi: 10.1038/s41392-020-00315-3 32968059
7 Jackson RJ , Hellen CU , Pestova TV . The mechanism of eukaryotic translation initiation and principles of its regulation. Nat Rev Mol Cell Biol. 2010;11 (2 ):113–27. doi: 10.1038/nrm2838 20094052
8 Leppek K , Das R , Barna M . Functional 5’ UTR mRNA structures in eukaryotic translation regulation and how to find them. Nat Rev Mol Cell Biol. 2018;19 (3 ):158–74. doi: 10.1038/nrm.2017.103 29165424
9 Chen Y , Varani G . Engineering RNA-binding proteins for biology. FEBS J. 2013;280 (16 ):3734–54. doi: 10.1111/febs.12375 23742071
10 Mohibi S , Chen X , Zhang J . Cancer the’RBP’eutics-RNA-binding proteins as therapeutic targets for cancer. Pharmacol Ther. 2019;203 :107390. doi: 10.1016/j.pharmthera.2019.07.001 31302171
11 Southan C , Boppana K , Jagarlapudi SA , Muresan S . Analysis of in vitro bioactivity data extracted from drug discovery literature and patents: Ranking 1654 human protein targets by assayed compounds and molecular scaffolds. J Cheminform. 2011;3 (1 ):14. doi: 10.1186/1758-2946-3-14 21569515
12 Nielsen PE , Egholm M , Berg RH , Buchardt O . Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science. 1991;254 (5037 ):1497–500. doi: 10.1126/science.1962210 1962210
13 Tomac S , Sarkar M , Ratilainen T , Wittung P , Nielsen PE , Nordén B , et al . Ionic Effects on the Stability and Conformation of Peptide Nucleic Acid Complexes. J Am Chem Soc. 1996;118 (24 ):5544–52.
14 Uhlmann E , Peyman A , Breipohl G , Will DW . PNA: Synthetic Polyamide Nucleic Acids with Unusual Binding Properties. Angew Chem Int Ed. 1998;37 (20 ):2796–823. doi: 10.1002/(SICI)1521-3773(19981102)37:20&lt;2796::AID-ANIE2796&gt;3.0.CO;2-K 29711102
15 Rasmussen H , Kastrup JS , Nielsen JN , Nielsen JM , Nielsen PE . Crystal structure of a peptide nucleic acid (PNA) duplex at 1.7 A resolution. Nat Struct Biol. 1997;4 (2 ):98–101. doi: 10.1038/nsb0297-98 9033585
16 Betts L , Josey JA , Veal JM , Jordan SR . A nucleic acid triple helix formed by a peptide nucleic acid-DNA complex. Science. 1995;270 (5243 ):1838–41. doi: 10.1126/science.270.5243.1838 8525381
17 Norton JC , Piatyszek MA , Wright WE , Shay JW , Corey DR . Inhibition of human telomerase activity by peptide nucleic acids. Nat Biotechnol. 1996;14 (5 ):615–9. doi: 10.1038/nbt0596-615 9630953
18 Walshe JL , Siddiquee R , Patel K , Ataide SF . Structural characterization of the ANTAR antiterminator domain bound to RNA. Nucleic Acids Research. 2022;50 (5 ):2889–904. doi: 10.1093/nar/gkac074 35150565
19 Faoro C , Wilkinson-White L , Kwan AH , Ataide SF . Discovery of fragments that target key interactions in the signal recognition particle (SRP) as potential leads for a new class of antibiotics. PLoS One. 2018;13 (7 ):e0200387. doi: 10.1371/journal.pone.0200387 30044812
20 Wang B. Developing Antibiotics: an iterative approach towards better FtsY inhibitors.: The University of Sydney, Australia; 2020.
21 Ghosh S , Saini S , Saraogi I . Peptide nucleic acid mediated inhibition of the bacterial signal recognition particle. Chem Commun (Camb). 2018;54 (59 ):8257–60. doi: 10.1039/c8cc04715d 29989112
22 Saini S , Goel K , Ghosh S , Das A , Saraogi I . Effects of PNA Sequence and Target Site Selection on Function of a 4.5S Non-Coding RNA. Chembiochem. 2024;25 (11 ):e202400029. doi: 10.1002/cbic.202400029 38595046
23 Littler DR , Gully BS , Colson RN , Rossjohn J . Crystal Structure of the SARS-CoV-2 Non-structural Protein 9, Nsp9. iScience. 2020;23 (7 ):101258. doi: 10.1016/j.isci.2020.101258 32592996
24 Zeng Z , Deng F , Shi K , Ye G , Wang G , Fang L , et al . Dimerization of Coronavirus nsp9 with Diverse Modes Enhances Its Nucleic Acid Binding Affinity. J Virol. 2018;92 (17 ). doi: 10.1128/JVI.00692-18 29925659
25 Banerjee AK , Blanco MR , Bruce EA , Honson DD , Chen LM , Chow A , et al . SARS-CoV-2 Disrupts Splicing, Translation, and Protein Trafficking to Suppress Host Defenses. Cell. 2020;183 (5 ):1325–39 e21. doi: 10.1016/j.cell.2020.10.004 33080218
26 Batey RT , Sagar MB , Doudna JA . Structural and energetic analysis of RNA recognition by a universally conserved protein from the signal recognition particle. J Mol Biol. 2001;307 (1 ):229–46. doi: 10.1006/jmbi.2000.4454 11243816
27 Croft LV , Fisher M , Barbhuiya TK , El-Kamand S , Beard S , Rajapakse A , et al . Sequence- and Structure-Dependent Cytotoxicity of Phosphorothioate and 2’-O-Methyl Modified Single-Stranded Oligonucleotides. Nucleic Acid Ther. 2024;34 (3 ):143–55. doi: 10.1089/nat.2023.0056 38648015
28 Spanggord RJ , Siu F , Ke A , Doudna JA . RNA-mediated interaction between the peptide-binding and GTPase domains of the signal recognition particle. Nat Struct Mol Biol. 2005;12 (12 ):1116–22. doi: 10.1038/nsmb1025 16299512
29 Duff AP , Wilde KL , Rekas A , Lake V , Holden PJ . Robust High-Yield Methodologies for H-2 and H-2/N-15/C-13 Labeling of Proteins for Structural Investigations Using Neutron Scattering and NMR. Isotope Labeling of Biomolecules—Labeling Methods. 2015;565 :3–25.
30 El-Kamand S , Du Plessis MD , Breen N , Johnson L , Beard S , Kwan AH , et al . A distinct ssDNA/RNA binding interface in the Nsp9 protein from SARS-CoV-2. Proteins. 2022;90 (1 ):176–85. doi: 10.1002/prot.26205 34369011
31 Cai M , Huang Y , Sakaguchi K , Clore GM , Gronenborn AM , Craigie R . An efficient and cost-effective isotope labeling protocol for proteins expressed in Escherichia coli. J Biomol NMR. 1998;11 (1 ):97–102. doi: 10.1023/a:1008222131470 9566315
32 Voigts-Hoffmann F , Schmitz N , Shen K , Shan SO , Ataide SF , Ban N . The structural basis of FtsY recruitment and GTPase activation by SRP RNA. Mol Cell. 2013;52 (5 ):643–54. doi: 10.1016/j.molcel.2013.10.005 24211265
33 Jagath JR , Matassova NB , de Leeuw E , Warnecke JM , Lentzen G , Rodnina MV , et al . Important role of the tetraloop region of 4.5S RNA in SRP binding to its receptor FtsY. RNA. 2001;7 (2 ):293–301. doi: 10.1017/s1355838201002205 11233986
34 Armitage B , Ly D , Koch T , Frydenlund H , Orum H , Schuster GB . Hairpin-forming peptide nucleic acid oligomers. Biochemistry. 1998;37 (26 ):9417–25. doi: 10.1021/bi9729458 9649324
35 Menchise V , De Simone G , Tedeschi T , Corradini R , Sforza S , Marchelli R , et al . Insights into peptide nucleic acid (PNA) structural features: The crystal structure of a D-lysine-based chiral PNA-DNA duplex. Proceedings of the National Academy of Sciences of the United States of America. 2003;100 (21 ):12021–6. doi: 10.1073/pnas.2034746100 14512516
36 Harika NK , Paul A , Stroeva E , Chai Y , Boykin DW , Germann MW , et al . Imino proton NMR guides the reprogramming of A*T specific minor groove binders for mixed base pair recognition. Nucleic Acids Res. 2016;44 (10 ):4519–27.27131382
37 Yamaoki Y , Nagata T , Sakamoto T , Katahira M . Observation of nucleic acids inside living human cells by in-cell NMR spectroscopy. Biophys Physicobiol. 2020;17 :36–41. doi: 10.2142/biophysico.BSJ-2020006 33110737
38 Wang Y , Han G , Jiang X , Yuwen T , Xue Y . Chemical shift prediction of RNA imino groups: application toward characterizing RNA excited states. Nat Commun. 2021;12 (1 ):1595. doi: 10.1038/s41467-021-21840-x 33707433
39 Novakovic M , Olsen GL , Pinter G , Hymon D , Furtig B , Schwalbe H , et al . A 300-fold enhancement of imino nucleic acid resonances by hyperpolarized water provides a new window for probing RNA refolding by 1D and 2D NMR. Proc Natl Acad Sci U S A. 2020;117 (5 ):2449–55. doi: 10.1073/pnas.1916956117 31949004
40 Kiliszek A , Banaszak K , Dauter Z , Rypniewski W . The first crystal structures of RNA-PNA duplexes and a PNA-PNA duplex containing mismatches—toward anti-sense therapy against TREDs. Nucleic Acids Res. 2016;44 (4 ):1937–43. doi: 10.1093/nar/gkv1513 26717983
41 Egea PF , Shan SO , Napetschnig J , Savage DF , Walter P , Stroud RM . Substrate twinning activates the signal recognition particle and its receptor. Nature. 2004;427 (6971 ):215–21. doi: 10.1038/nature02250 14724630
42 Focia PJ , Shepotinovskaya IV , Seidler JA , Freymann DM . Heterodimeric GTPase core of the SRP targeting complex. Science. 2004;303 (5656 ):373–7. doi: 10.1126/science.1090827 14726591
43 de OAJ , Pinheiro S , Zamora WJ , Alves CN , Lameira J , Lima AH . Structural, energetic and lipophilic analysis of SARS-CoV-2 non-structural protein 9 (NSP9). Sci Rep. 2021;11 (1 ):23003. doi: 10.1038/s41598-021-02366-0 34837010
44 Egloff MP , Ferron F , Campanacci V , Longhi S , Rancurel C , Dutartre H , et al . The severe acute respiratory syndrome-coronavirus replicative protein nsp9 is a single-stranded RNA-binding subunit unique in the RNA virus world. Proc Natl Acad Sci U S A. 2004;101 (11 ):3792–6. doi: 10.1073/pnas.0307877101 15007178
45 Demidov VV , Potaman VN , Frank-Kamenetskii MD , Egholm M , Buchard O , Sonnichsen SH , et al . Stability of peptide nucleic acids in human serum and cellular extracts. Biochem Pharmacol. 1994;48 (6 ):1310–3. doi: 10.1016/0006-2952(94)90171-6 7945427
46 Pradeep SP , Malik S , Slack FJ , Bahal R . Unlocking the potential of chemically modified peptide nucleic acids for RNA-based therapeutics. Rna. 2023;29 (4 ):434–45. doi: 10.1261/rna.079498.122 36653113
47 Patel RR , Sundin GW , Yang CH , Wang J , Huntley RB , Yuan XC , et al . Exploration of Using Antisense Peptide Nucleic Acid (PNA)-cell Penetrating Peptide (CPP) as a Novel Bactericide against Fire Blight Pathogen Erwinia amylovora. Frontiers in Microbiology. 2017;8 . doi: 10.3389/fmicb.2017.00687 28469617
48 Alagpulinsa DA , Yaccoby S , Ayyadevara S , Shmookler Reis RJ . A peptide nucleic acid targeting nuclear RAD51 sensitizes multiple myeloma cells to melphalan treatment. Cancer Biol Ther. 2015;16 (6 ):976–86. doi: 10.1080/15384047.2015.1040951 25996477
49 Hu JX , Corey DR . Inhibiting gene expression with peptide nucleic acid (PNA)-peptide conjugates that target chromosomal DNA. Biochemistry. 2007;46 (25 ):7581–9. doi: 10.1021/bi700230a 17536840
50 Hyrup B , Nielsen PE . Peptide nucleic acids (PNA): Synthesis, properties and potential applications. Bioorganic & Medicinal Chemistry. 1996;4 (1 ):5–23. doi: 10.1016/0968-0896(95)00171-9 8689239
51 D’Costa M , Kumar VA , Ganesh KN . Aminoethylprolyl peptide nucleic acids (aepPNA): chiral PNA analogues that form highly stable DNA:aepPNA2 triplexes. Org Lett. 1999;1 (10 ):1513–6. doi: 10.1021/ol990835i 10836017
52 Sahu B , Sacui I , Rapireddy S , Zanotti KJ , Bahal R , Armitage BA , et al . Synthesis and Characterization of Conformationally Preorganized, (R)-Diethylene Glycol-Containing gamma-Peptide Nucleic Acids with Superior Hybridization Properties and Water Solubility. Journal of Organic Chemistry. 2011;76 (14 ):5614–27.21619025
53 Egholm M , Buchardt O , Nielsen PE , Berg RH . Peptide Nucleic-Acids (Pna)—Oligonucleotide Analogs with an Achiral Peptide Backbone. Journal of the American Chemical Society. 1992;114 (5 ):1895–7.
54 Fukunaga K , Yokobayashi Y . Directed evolution of orthogonal RNA-RBP pairs through library-vs-library in vitro selection. Nucleic Acids Research. 2022;50 (2 ):601–16. doi: 10.1093/nar/gkab527 34219162
55 Choi S , Park C , Kim KE , Kim KK . An in vitro technique to identify the RNA binding-site sequences for RNA-binding proteins. Biotechniques. 2017;63 (1 ):28–33. doi: 10.2144/000114567 28701145
56 Ishikawa F , Matunis MJ , Dreyfuss G , Cech TR . Nuclear Proteins That Bind the Premessenger Rna 3’ Splice-Site Sequence R(Uuag/G) and the Human Telomeric DNA-Sequence D(Ttaggg)N. Molecular and Cellular Biology. 1993;13 (7 ):4301–10.8321232
57 Burd CG , Dreyfuss G . RNA binding specificity of hnRNP A1: significance of hnRNP A1 high-affinity binding sites in pre-mRNA splicing. EMBO J. 1994;13 (5 ):1197–204. doi: 10.1002/j.1460-2075.1994.tb06369.x 7510636
58 Jain N , Lin HC , Morgan CE , Harris ME , Tolbert BS . Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution. Proc Natl Acad Sci U S A. 2017;114 (9 ):2206–11. doi: 10.1073/pnas.1616371114 28193894
59 Guenther UP , Yandek LE , Niland CN , Campbell FE , Anderson D , Anderson VE , et al . Hidden specificity in an apparently nonspecific RNA-binding protein. Nature. 2013;502 (7471 ):385–8. doi: 10.1038/nature12543 24056935
60 Aiba Y , Shibata M , Shoji O . Sequence-Specific Recognition of Double-Stranded DNA by Peptide Nucleic Acid Forming Double-Duplex Invasion Complex. Applied Sciences-Basel. 2022;12 (7 ).
