
==== Front
Genetics
Genetics
genetics
Genetics
0016-6731
1943-2631
Oxford University Press US

37768175
10.1093/genetics/iyad176
iyad176
Brief Investigation
Genome Integrity and Transmission
AcademicSubjects/SCI01180
AcademicSubjects/SCI01140
High levels of intra-strain structural variation in Drosophila simulans X pericentric heterochromatin
https://orcid.org/0000-0001-5849-8014
Courret Cécile Department of Biology, University of Rochester, Rochester, NY 14627, USA

https://orcid.org/0000-0001-5944-5686
Larracuente Amanda M Department of Biology, University of Rochester, Rochester, NY 14627, USA

Bateman J Editor
Corresponding author: Department of Biology, University of Rochester, Rochester, NY 14627, USA. Email: cecile.courret@rochester.edu
Corresponding author: Department of Biology, University of Rochester, Rochester, NY 14627, USA. Email: alarracu@bio.rochester.edu
Conflicts of interest The author(s) declare no conflict of interest.

12 2023
28 9 2023
28 9 2023
225 4 iyad17612 8 2023
14 9 2023
01 11 2023
© The Author(s) 2023. Published by Oxford University Press on behalf of The Genetics Society of America.
2023
https://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Large genome structural variations can impact genome regulation and integrity. Repeat-rich regions like pericentric heterochromatin are vulnerable to structural rearrangements although we know little about how often these rearrangements occur over evolutionary time. Repetitive genome regions are particularly difficult to study with genomic approaches, as they are missing from most genome assemblies. However, cytogenetic approaches offer a direct way to detect large rearrangements involving pericentric heterochromatin. Here, we use a cytogenetic approach to reveal large structural rearrangements associated with the X pericentromeric region of Drosophila simulans. These rearrangements involve large blocks of satellite DNA—the 500-bp and Rsp-like satellites—which colocalize in the X pericentromeric heterochromatin. We find that this region is polymorphic not only among different strains, but between isolates of the same strain from different labs, and even within individual isolates. On the one hand, our observations raise questions regarding the potential impact of such variation at the phenotypic level and our ability to control for such genetic variability. On the other hand, this highlights the very rapid turnover of the pericentric heterochromatin most likely associated with genomic instability of the X pericentromere. It represents a unique opportunity to study the dynamics of pericentric heterochromatin, the evolution of associated satellites on a very short time scale, and to better understand how structural variation arises.

structural variation
pericentromeric heterochromatin
satellite repeats
Drosophila
==== Body
pmcIntroduction

Structural variants are duplicated, deleted, transposed, or inverted sequences, that can contribute to complex traits (Sudmant et al. 2015; Chakraborty et al. 2019), diseases (Stankiewicz and Lupski 2010), and genome evolution (Chakraborty et al. 2021). Variants involving rearrangements of large genome regions, such as chromosomal translocations and inversions, are associated with diseases involving intellectual disabilities and cancers (Weischenfeldt et al. 2013). Pericentric heterochromatin is rich in repetitive sequences like transposable elements and satellite DNAs (Charlesworth et al. 1986) and may be particularly prone to structural rearrangements from replication stress, nonhomologous recombination, transposable element activity, and a decreased efficiency of some DNA repair pathways (reviewed in Janssen et al. 2018). Structural rearrangements in pericentric heterochromatin may have consequences: although the density of conventional protein-coding genes is low, these regions have roles in genome defense (Andersen et al. 2017), coordinating chromosome segregation and nuclear organization (Folco et al. 2008; Peng and Karpen 2009), and genomic stability (Janssen et al. 2018).

Repeats in the pericentric heterochromatin are highly dynamic over long evolutionary time periods (Lohe and Roberts 1988), as species tend to have their own unique profiles of pericentric repeats. This divergence in the pericentric heterochromatin can lead to genetic incompatibilities between closely related species (Ferree and Barbash 2009; Cattani et al. 2012; Jagannathan et al. 2017; Jagannathan and Yamashita 2021). We know less about the dynamics of pericentric heterochromatin and its functional consequences over short evolutionary timescales, although satellite DNA copy number varies within species (e.g. Wei et al. 2014) and can be associated with chromosome rearrangements (Flynn et al. 2023). However, some functional variation within species maps to highly heterochromatic regions of the genome. For example, variation in Y-linked heterochromatin can impact gene expression across the genome and affect male fertility (Dimitri and Pisano 1989; Chippindale and Rice 2001; Lemos et al. 2008; Sackton et al. 2011; Brown et al. 2020).

The repetitive nature of pericentric heterochromatin makes it difficult to study at the genomic level (Treangen and Salzberg 2012), although the relatively compact genomes of Drosophila species make them mighty models for repeat biology. Drosophila species have a large genetic toolkit and many Drosophila species can be isogenized and inbred, making the genome homozygous and amenable to experiments (Hoskins et al. 2015; Hales et al. 2015). High quality genome assemblies exist for species of the melanogaster clade [e.g. Drosophila melanogaster (Chang and Larracuente 2019), Drosophila simulans, Drosophila mauritiana, and Drosophila sechellia (Chakraborty et al. 2021; Chang et al. 2022)]. Comparing these assemblies revealed structural divergence between species that may contribute to important phenotypes. Structural rearrangements involving pericentric heterochromatin are difficult to ascertain with genomic approaches—the most densely repetitive regions of the genome including large blocks of tandem satellite repeats are not yet fully assembled (Chakraborty et al. 2021; Chang et al. 2022). However, cytogenetic approaches indicate that the distribution and type of heterochromatic satellite repeats differ even between these closely related species (Larracuente 2014; Jagannathan et al. 2017; Sproul et al. 2020), implying that large structural variations in repetitive regions contribute to species divergence. Large structural rearrangements in pericentromeric satellite repeats within species are less well documented.

Here, we describe striking structural variation in the pericentric heterochromatin of the X chromosome in D. simulans. We use a cytogenetic approach to document high levels of structural polymorphism in satellite DNAs in the X pericentromere: Rsp-like and 500-bp satellites. Rsp-like is a complex satellite specific to the X pericentromere in D. simulans (Sproul et al. 2020) and the 500-bp satellite is associated with the centromere and pericentromere of the X chromosome and the autosomes in D. simulans (Talbert et al. 2018; Courret et al. 2023a). The structural polymorphisms we detect involve large blocks of satellite repeats and occur between different strains, within a strain, and even within individual isolates of strains kept in a single lab. This extreme structural polymorphism may not be conspicuous at the DNA sequencing level, but affects large regions of the pericentromere, and could conceivably have functional impacts.

Materials and methods

Fly strains

We use “strain” to refer to a genotype and give a unique name to “isolates”, which are lineages of a strain from a particular lab. We have 3 isolates of the w501 strains that originated from 3 different laboratories as follows: Larracuente (w501-i1), Presgraves (w501-i2), and Andolfatto (w501-i3). w501-i1 and w501-i2 have a common origin, but have been maintained separately for 7 years. We have 2 isolates of the wXD1 strain that originated from 2 different labs as follows: Presgraves (wXD1-i1) and Meiklejohn (wXD1-i2). The wXD1-i2 isolate originated from the wXD1-i1 isolate ∼10 years ago. We also used other non-white isofemale D. simulans strains as follows: SR (collected from Seychelles in 1981), ST8 (collected from Tunisia in 1983), C167.4 (collected from Kenya in 1973), sim006 (collected from California in 1961) (described in Courret et al. 2023b).

Fluorescence in situ hybridization

We performed FISH using primary oligopaint probes for Rsp-like and 500-bp (Courret et al. 2023a) coupled with sec6 and sec5 adaptors (Beliveau et al. 2014). Sec5 is coupled with Cy5 while sec6 is coupled with Cy3. We dissected brains from third instar larvae in PBS, incubated 8 min in 0.5% sodium citrate. We fixed for 6 min in 4% formaldehyde, 45% acetic acid before squashing. We squashed the brains between the slide and coverslip and before immersing in liquid nitrogen. After 10 min in 100% ethanol, we air dried slides for at least 1 hour before proceeding to the hybridization. For the hybridization, we used 20 pmol of primary probes and 80 pmol of the secondary probes in 50 μL of hybridization buffer (50% formamide, 10% dextran sulfate, 2xSSC). We heated slides for 5 min at 95°C to denature and incubated them overnight at 37°C in a humid chamber. We then washed the slides 3 times for 5 min with 4XSSCT and 3 times for 5 min with 0.1SSC before mounting in slowfade DAPI. We imaged using a LEICA DM5500 microscope and cropped and pseudocolored the images using Fiji.

We analyzed 4–10 mitotic spreads for each individual brain to determine without ambiguity the number of foci carried by the X chromosomes. We confirmed that all spreads within an individual brain had the same number of foci. To estimate the allele frequency in each isolate, around 20 individual brains were tested, both male and female (full genotype details in Supplementary Table 1). The frequency reported in Table 1 corresponds to the frequency of each type of X chromosome among all individual brains tested.

Table 1. A summary of structural variation involving the 500-bp and Rsp-like satellites in the X chromosome pericentric heterochromatin within and between isolates of D. simulans strains.

Strain (isolate)	No. of individuals	X chromosome frequencies	
1-Foci	2-Foci	3-Foci	
w501 (w501-i1)	22	0	0.34	0.66	
w501 (w501-i3)	19	0	0.93	0.07	
w501 (w501-i2)	19	0.21	0.79	0	
wXD1 (wXD1-i2)	40	0.14	0	0.86	
wXD1 (wXD1-i1)	22	0	0	1	
SR	18	1	0	0	
C167.4	18	1	0	0	
ST8	20	1	0	0	
Sim006	20	1	0	0	
The isolate identities for w501 and wXD1 are indicated in parentheses. We report the number of individuals (i.e. brains, which includes both males and females) tested: all spreads examined within an individual brain were consistent (see Materials and methods). We report the proportion of 1-, 2-, or 3-focus X chromosomes among individuals from each isolate. The detailed genotype of each individual tested is presented in Supplementary Table 1.

Genotyping and genome analysis

We designed primers around SNPs located on the X chromosome. The primer position—alleles on Segkk236 from the reference genome in Chang et al. (2022) and sequences are as follows: 9814904-T/G (forward primer—GCAAAGTCTTTTAAGCGCGC and reverse primer—CCGGGGGAAAATCTGCTTCT); 17904265-A/G (forward primer—GTTGTCGCTCTCCTTGACCA and reverse primer—GCTGGCCATCTTCACCATCT); and 18025547-C/T (forward primer—CTGCTCCGCGTGTATATGGT and reverse primer—ACAGTTCGCGATGAGCTTCT). For each primer pair, we performed a PCR with NEB Taq polymerase (NEB #M0495) following the manufacturer's instructions (hybridization temperature: 53°). We sequenced each PCR product using the Sanger method (ACGT company) and visualized sequence profiles using Geneious.

We downloaded reads for wXD1 (SRR8247551; Meiklejohn et al. 2018), ST8, SR, and C167.4 (PRJNA905841; Courret et al. 2023b), and w501 (SRR520334; Hu et al. 2013), trimmed and processed reads with trimgalore (v0.6.2) (Krueger et al. 2021) (–paired –nextera –length 75 –phred33 –fastqc). We mapped reads with BWA-MEM (v0.17 default parameters) to the D. simulans genome assembly (Chang et al. 2022) and estimated coverage (in reads per million) with bamCoverage (-bs 1000) in deeptools (v3.5.1) (Ramírez et al. 2016) across the X chromosome. We plotted in R to look for large-scale differences in coverage that would suggest structural polymorphisms.

To estimate the per-site heterozygosity, we called SNPs using bcftools (v1.6) (Li 2011) mpileup and call commands, keeping all sites. We filtered the vcf file using vcftools (v0.1.15/b1) (Danecek et al. 2011) (–remove-indels –minQ 30 –minDP 10 –maxDP 200) and then extracted the number of homozygous and heterozygous sites using the bcftools stats command.

Results

We focus our study on 2 commonly used D. simulans lab strains as follows: w501 and wXD1. Both carry a white mutation on the X chromosome, conferring the white-eyed phenotype. These inbred strains are frequently used for genetic manipulation (Stern et al. 2017) or genetic mapping (Matute and Ayroles 2014; Meiklejohn et al. 2018) and have abundant genomic resources (Garrigan et al. 2012; Hu et al. 2013; Chakraborty et al. 2021; Chang et al. 2022).

We collected isolates of the w501 strain from 3 different laboratories (w501-i1; w501-i2, and w501-i3). w501-i1 and w501-i2 have a common origin but have been maintained separately for 7 years (91–119 generations). The w501-i3 isolate was maintained independently. We also collected isolates of the wXD1 strains from 2 different labs as follows: wXD1-i1 and wXD1-i2. The wXD1-i2 originated from the wXD1-i1 strains 10 years ago (130–170 generations).

The 2 satellites that we use as markers for pericentric structural variation, 500-bp and Rsp-like, are adjacent on the X chromosome and their localization pattern is always similar (i.e. in adjacent blocks). We did not observe any genotypes where 500-bp and Rsp-like did not co-vary in the number of foci. We show that these blocks are highly variable both within and between strains. We observe 3 general colocalization patterns for 500-bp and Rsp-like at 1, 2, or 3 foci in the X pericentric heterochromatin.

Structural variation within and between isolates of a single strain

The 3 isolates of the w501 strain appear to be polymorphic both between and within isolates. The w501-i1 and w501-i3 isolates are polymorphic for 2- and 3-focus X chromosomes (Fig. 1a and c). Within the w501-i1 isolate, we estimated the frequency of the 3-focus and 2-focus X chromosomes at 66 and 34%, respectively (Table 1); while the w501-i3 has estimated frequencies of 93 and 7%, respectively (Table 1). w501-i2 shows both 2- and 1-focus X chromosomes (Fig. 1b), at estimated frequencies of 79 and 21%, respectively (Table 1).

Fig. 1. FISH on mitotic chromosomes from larval brain in (a) w501-i1, (b) w501-i2, and (c) w501-i3 strains. We used oligopaint probes targeting the Rsp-like (first inset row) and 500-bp (second inset row) satellites. The scale bar represents 5 µm. The inset zooms in on the X chromosome revealing a heterozygote for a 2-focus (1) and a 3-focus (2) X chromosome in w501-i1 (a), a heterozygote for a 2-focus (1) and a 1-focus (2) X chromosome in w501-i2 (b), and a heterozygote for a 3-focus (1) and a 2-focus (2) X chromosome in w501-i3. The arrows within the inset point to each foci associated with the X chromosome.

This degree of polymorphism and divergence within a single strain is surprising, as the w501-i1 isolate originated from the w501-i2 isolate only 7 years ago (91–119 generations). This suggests that duplication events in the pericentromeric region happened recently and may happen recurrently.

We observe similarly striking structural variation in the pericentromeric region of the wXD1 X chromosomes. Consistent with previous observations (Sproul et al. 2020), we find that the wXD1-i1 X chromosome pericentromere has a 3-focus pattern (Fig. 2a). However, the wXD1-i2 X chromosome pericentromeric region appears to be polymorphic for the 1-focus and 3-focus patterns (Fig. 2b), with estimated frequencies of 14 and 86%, respectively (Table 1).

Fig. 2. FISH on mitotic chromosomes from larval brains of (a) wXD1-i1 and (b) wXD1-i2 strains. We used oligopaint probes targeting the Rsp-like (first inset row) and 500-bp (second inset row) satellites. The scale bar represents 5 µm. The inset zooms in on the X chromosome revealing a 3-focus X chromosome in wXD1-i1 (a) and a heterozygote for a 1-focus (1) and a 3-focus (2) X chromosome in wXD1-i2 (b). The arrows within the inset point to each focus associated with the X chromosome.

Structural polymorphisms involving large blocks of the Rsp-like and 500-bp satellite repeats may generally be detectable through differences in read depth (Larracuente 2014). However, when these polymorphisms exist within a single isolate, they are not obvious in genomic data (Supplementary Fig. 1). In our analysis of sequencing libraries created from pooled individuals, detecting alternative alleles based on read depth is extremely challenging, as it will depend on the frequency of alternative alleles in the pools. Biases in library preparation, tissue, and DNA extraction can all contribute to variation in read mapping in repetitive sequences between biological replicates (Shinde 2003; Aird et al. 2011; Ross et al. 2013; Wei et al. 2018). We suggest that true structural polymorphisms, either between individuals of a single isolate or between tissue and cells within an individual, can also contribute to variable read coverage. We would need multiple biological replicates from the same isolates and, ideally, a contiguous assembly of pericentric heterochromatin to assess the potential for recovering information about these structural rearrangements in genomic data. Currently, a cytogenetic approach is necessary to characterize such structural polymorphisms, especially within isolates.

These white-eyed lab strains have independent origins and therefore, these structural mutations should also be independent. To be sure that the structural variation is not due to strain contamination and/or recombination between the 2 white-eyed lab strains, we genotyped the X chromosomes. We designed primers to genotype 3 SNPs that allow us to differentiate wXD1 and w501 X chromosomes by PCR re-sequencing. As expected, if pericentromeric variation is due to structural polymorphisms within an X chromosome, the different w501 isolates carry the same alleles and the wXD1 isolates carry the same alternative alleles at all 3 sites. This suggests that the structural variants arose on their respective X chromosome backgrounds and that the X pericentric heterochromatin is likely unstable in these white-eyed lab strains.

Within-isolate structural variation seems limited to lab strains

To understand if the chromosomal instability is strain or species specific, we studied satellite organization in 4 different D. simulans strains that do not carry white mutations as follows: SR, ST8, sim006, and C167.4. Each of these strains has a single focus of Rsp-like and 500-bp in their X pericentric heterochromatin (Fig. 3). While more strains should be tested in the future, this pattern suggests that the large structural variations may be limited to the w501 and wXD1 strains.

Fig. 3. FISH on mitotic chromosomes from larval brains of (a) SR, (b) ST8, (c) sim006, and (d) C167.4 strains. We used oligopaint probes targeting the Rsp-like (first inset row) and 500-bp (second inset row) satellites. The scale bar represents 5 µm. The inset zooms in on the X chromosome with a single focus of Rsp-like and 500-bp in each strain. The arrows within the insets point to each focus associated with the X chromosome.

Isogenization should purge any segregating sequence variants (including structural ones) within strains, although sequence variation may exist due to: (1) mutations that accumulate over time while strains are maintained in labs (Lack et al. 2016); and (2) residual heterozygosity from incomplete inbreeding or linkage to balanced deleterious mutations that cannot be made homozygous. To determine if the structural polymorphism correlates with the extent of inbreeding of each strain, we estimate the per-site heterozygosity (H) of the X chromosome in available genomic data (Hu et al. 2013; Meiklejohn et al. 2018; Courret et al. 2023b). Despite being polymorphic in the X pericentromere, we estimate very low levels of per-site heterozygosity across the X chromosome arm in wXD1-i2 (H = 1.254 × 10−5) and w501-i3 (H = 5.93 × 10−5). The nonwhite strains appear less inbred—ST8 (H = 0.000468), SR (H = 0.000733), and C167.4 (H = 0.000459), and similar to a previous estimate for the sim006 strain (H = 0.00039) (Kim et al. 2021).

Therefore, the structural polymorphism is in the strains with the lowest heterozygosity across the X chromosome arm, further supporting our hypothesis that the structural variants arose recently and may be associated with genomic instability in the X pericentromere.

Discussion

In summary, we find large X-linked structural polymorphisms segregating within single isolates of 2 commonly used lab strains of D. simulans. These types of polymorphisms are not obvious in genomic data, although they may contribute to variation in read depth between biological replicates in repetitive regions. Because we observe different variants even within single isolates of the same strain (i.e. within single vials of flies), we hypothesize that this region of the X pericentromere is unstable and associated with recurrent structural rearrangements. We cannot completely rule out the possibility that these variants were already segregating in the original strains and then sorted differently between lab isolates. Labs may differ in their maintenance conditions, which may impose different selection pressures. Different isolates of the same strain maintained in different labs can accumulate isolate-specific TE landscapes (Rahman et al. 2015). Further experiments are necessary to determine the mutation rate in the X pericentromere. A recent origin for these structural variants appears more likely based on multiple observations. First, if there was a pre-existing variation, we would expect more similarity between the w501-i1 and w501-i2 isolates, based on their recent history, than between w501-i1 and w501-i3. Second, 2 independent strains (w501 and wXD1) exhibit structural polymorphism in the same region, suggesting that this X pericentric heterochromatin may experience genomic instability. Finally, the 2 white strains where we see the variation are highly inbred compared to the 4 nonwhite strains which do not have detectable structural polymorphisms.

The structural variation we observe may have functional implications, as pericentric heterochromatin has effects on chromosome dynamics (Dernburg et al. 1996; Karpen et al. 1996), genome stability (Peng and Karpen 2009), genome structure (Falk et al. 2019; Lee et al. 2020), and nuclear organization. These regions also contain, or flank, essential genetic elements, including the centromeres. For example, variation in pericentromeres may affect adjacent centromeres (Kumon et al. 2021; Jagannathan and Yamashita 2021), chromosome structures that are essential for coordinating chromosome segregation during cell divisions (Allshire and Karpen 2008). In most species, the rDNA are also embedded in heterochromatin (McStay 2016) and in Drosophila species, the rDNA locus is generally located in the X pericentromere (Stage and Eickbush 2007). Variation in rDNA copy number is associated with reduced translation capacity in D. melanogaster (Mohan and Ritossa 1970; Terracol and Prud’homme 1986). Pericentric heterochromatin may also contain piRNA clusters—discrete loci rich in fragments of transposable elements and other repeats that generate precursors for the small RNAs that are important for the silencing of transposable element activity all over the genome (Brennecke et al. 2007; Aravin et al. 2008). Complex satellite DNAs like those involved in these rearrangements also generate piRNAs that may play a role in establishing heterochromatin in the early embryo (Wei et al. 2021). Finally, while gene density in heterochromatin is generally low, species like D. melanogaster do contain hundreds of protein-coding genes in these regions (Marsano et al. 2019), some of which are essential (Devlin et al. 1990; Gatti and Pimpinelli 1992). For some of these genes, a heterochromatic environment is essential for their proper expression and structural rearrangements can disrupt their function (Wakimoto and Hearn 1990; Eberl et al. 1993) and the function of nearby euchromatic genes (Elgin and Reuter 2013).

Structural variation in pericentric heterochromatin can also have global effects on genome stability and regulation. Large blocks of heterochromatin can act as a sink for heterochromatin proteins, titrating them away from other genomic locations (Tartof et al. 1984; Dimitri and Pisano 1989; Eissenberg et al. 1990; Wallrath and Elgin 1995; Francisco and Lemos 2014; Brown et al. 2020). One potential consequence of this sink effect is through its impact on the transcription of euchromatin genes and transposable elements, both which may ultimately impact individual fitness (Francisco and Lemos 2014; Abramov et al. 2016; Nguyen and Bachtrog 2021; Huang et al. 2022).

On the one hand, our observation is concerning. Having different variants of the pericentric heterochromatin segregating in a single isolate might introduce both genetic and phenotypic variation to experiments. It also raises the question of the reproducibility of the results between laboratories. It is important to keep track of, and report, the origin of each isolate. Because the variation we described here is not easy to assay and thus difficult to control for, we recommend limiting potential variation within isolates by periodically re-isogenizing strains. We caution researchers to consider the impact this structural variation may have on their experiments.

On the other hand, this is an intriguing observation. While we expect structural rearrangements in heterochromatic sequences within and between species, these X pericentromeres we study here are highly dynamic even within a single isolates of inbred D. simulans strains. Our observations raise several questions. Why is this region particularly unstable? Is this instability specific to the X pericentromere? Is it specific to D. simulans? Further investigation will be necessary to better understand the dynamics of structural variation in pericentric heterochromatin and its consequences. The structural rearrangements we describe here are likely associated with genome instability and may represent a unique opportunity to better understand factors promoting the disruption of heterochromatin structure in general. The mechanisms involved in generating these structural rearrangements may be similar to those associated with structural variations involved in human diseases.

Supplementary Material

iyad176_Supplementary_Data

iyad176_Peer_Review_History

Acknowledgments

We are grateful to Colin Meiklejohn, Daven Presgraves, Peter Andolfatto, and Catherine Montchamp-Moreau for generously sharing fly stocks and to Grace Lee and members of the Larracuente lab for discussion.

Data availability

Strains are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables.

Supplemental material available at GENETICS online.

Funding

National Science Foundation grant number MCB-1844693.
==== Refs
Literature cited

Abramov  YA, Shatskikh  AS, Maksimenko  OG, Bonaccorsi  S, Gvozdev  VA, Lavrov  SA. 2016. The differences between Cis- and Trans-gene inactivation caused by heterochromatin in Drosophila. Genetics. 202 (1 ):93–106. doi:10.1534/genetics.115.181693.26500261
Aird  D, Ross  MG, Chen  W-S, Danielsson  M, Fennell  T, Russ  C, Jaffe  DB, Nusbaum  C, Gnirke  A. 2011. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Biol. 12 (2 ):R18. doi:10.1186/gb-2011-12-2-r18.21338519
Allshire  RC, Karpen  GH. 2008. Epigenetic regulation of centromeric chromatin: old dogs, new tricks?  Nat Rev Genet. 9 (12 ):923–937. doi:10.1038/nrg2466.19002142
Andersen  PR, Tirian  L, Vunjak  M, Brennecke  J. 2017. A heterochromatin-dependent transcription machinery drives piRNA expression. Nature. 549 (7670 ):54–59. doi:10.1038/nature23482.28847004
Aravin  AA, Sachidanandam  R, Bourc’his  D, Schaefer  C, Pezic  D, Toth  KF, Bestor  T, Hannon  GJ. 2008. A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. Mol Cell. 31 (6 ):785–799. doi:10.1016/j.molcel.2008.09.003.18922463
Beliveau  BJ, Apostolopoulos  N, Wu  C. 2014. Visualizing genomes with oligopaint FISH probes. Curr Protoc Mol Biol. 105 (1 ):23. doi:10.1002/0471142727.mb1423s105.
Brennecke  J, Aravin  AA, Stark  A, Dus  M, Kellis  M, Sachidanandam  R, Hannon  GJ. 2007. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128 (6 ):1089–1103. doi:10.1016/j.cell.2007.01.043.17346786
Brown  EJ, Nguyen  AH, Bachtrog  D. 2020. The Drosophila Y chromosome affects heterochromatin integrity genome-wide. Mol Biol Evol. 37 (10 ):2808–2824. doi:10.1093/molbev/msaa082.32211857
Cattani  MV, Kingan  SB, Presgraves  DC. 2012. Cis- and trans-acting genetic factors contribute to heterogeneity in the rate of crossing over between the Drosophila simulans clade species. J Evol Biol. 25 (10 ):2014–2022. doi:10.1111/j.1420-9101.2012.02578.x.22817673
Chakraborty  M, Chang  C-H, Khost  DE, Vedanayagam  J, Adrion  JR, Liao  Y, Montooth  KL, Meiklejohn  CD, Larracuente  AM, Emerson  JJ. 2021. Evolution of genome structure in the Drosophila simulans species complex. Genome Res. 31 (3 ):380–396. doi:10.1101/gr.263442.120.33563718
Chakraborty  M, Emerson  JJ, Macdonald  SJ, Long  AD. 2019. Structural variants exhibit widespread allelic heterogeneity and shape variation in complex traits. Nat Commun. 10 (1 ):4872. doi:10.1038/s41467-019-12884-1.31653862
Chang  C-H, Gregory  LE, Gordon  KE, Meiklejohn  CD, Larracuente  AM. 2022. Unique structure and positive selection promote the rapid divergence of Drosophila Y chromosomes. eLife. 11 :e75795. doi:10.7554/eLife.75795.34989337
Chang  C-H, Larracuente  AM. 2019. Heterochromatin-enriched assemblies reveal the sequence and organization of the Drosophila melanogaster Y chromosome. Genetics. 211 (1 ):333–348. doi:10.1534/genetics.118.301765.30420487
Charlesworth  B, Langley  CH, Stephan  W. 1986. The evolution of restricted recombination and the accumulation of repeated DNA sequences. Genetics. 112 (4 ):947–962. doi:10.1093/genetics/112.4.947.3957013
Chippindale  AK, Rice  WR. 2001. Y chromosome polymorphism is a strong determinant of male fitness in Drosophila melanogaster. Proc Natl Acad Sci U S A. 98 (10 ):5677–5682. doi:10.1073/pnas.101456898.11320221
Courret C, Hemmer L, Wei X, Patel PD, Santinello B, Geng X, Chang C-H, Mellone B, Larracuente AM. 2023a. Rapid turnover of centromeric DNA reveals signatures of genetic conflict in Drosophila. Evol Biol. doi:10.1101/2023.08.22.554357.
Courret  C, Ogereau  D, Gilbert  C, Larracuente  AM, Montchamp-Moreau  C. 2023b. The evolutionary history of Drosophila simulans Y chromosomes reveals molecular signatures of resistance to sex ratio meiotic drive. Mol Biol Evol. 40 (7 ):msad152. doi:10.1093/molbev/msad152.37401458
Danecek  P, Auton  A, Abecasis  G, Albers  CA, Banks  E, DePristo  MA, Handsaker  RE, Lunter  G, Marth  GT, Sherry  ST, et al  2011. The variant call format and VCFtools. Bioinformatics. 27 (15 ):2156–2158. doi:10.1093/bioinformatics/btr330.21653522
Dernburg  AF, Sedat  JW, Hawley  RS. 1996. Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell. 86 (1 ):135–146. doi:10.1016/S0092-8674(00)80084-7.8689681
Devlin  RH, Bingham  B, Wakimoto  BT. 1990. The organization and expression of the light gene, a heterochromatic gene of Drosophila melanogaster. Genetics. 125 (1 ):129–140. doi:10.1093/genetics/125.1.129.2111263
Dimitri  P, Pisano  C. 1989. Position effect variegation in Drosophila melanogaster: relationship between suppression effect and the amount of Y chromosome. Genetics. 122 (4 ):793–800. doi:10.1093/genetics/122.4.793.2503420
Eberl  DF, Duyf  BJ, Hilliker  AJ. 1993. The role of heterochromatin in the expression of a heterochromatic gene, the rolled locus of Drosophila melanogaster. Genetics. 134 (1 ):277–292. doi:10.1093/genetics/134.1.277.8514136
Eissenberg  JC, James  TC, Foster-Hartnett  DM, Hartnett  T, Ngan  V, Elgin  SC. 1990. Mutation in a heterochromatin-specific chromosomal protein is associated with suppression of position-effect variegation in Drosophila melanogaster. Proc Natl Acad Sci U S A. 87 (24 ):9923–9927. doi:10.1073/pnas.87.24.9923.2124708
Elgin  SCR, Reuter  G. 2013. Position-effect variegation, heterochromatin formation, and gene silencing in Drosophila. Cold Spring Harb Perspect Biol. 5 (8 ):a017780–a017780. doi:10.1101/cshperspect.a017780.23906716
Falk  M, Feodorova  Y, Naumova  N, Imakaev  M, Lajoie  BR, Leonhardt  H, Joffe  B, Dekker  J, Fudenberg  G, Solovei  I, et al  2019. Heterochromatin drives compartmentalization of inverted and conventional nuclei. Nature. 570 (7761 ):395–399. doi:10.1038/s41586-019-1275-3.31168090
Ferree  PM, Barbash  DA. 2009. Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila. PLoS Biol. 7 (10 ):e1000234. doi:10.1371/journal.pbio.1000234.19859525
Flynn  JM, Hu  KB, Clark  AG. 2023. Three recent sex chromosome-to-autosome fusions in a Drosophila virilis strain with high satellite DNA content. Genetics. 224 (2 ):iyad062. doi:10.1093/genetics/iyad062.37052958
Folco  HD, Pidoux  AL, Urano  T, Allshire  RC. 2008. Heterochromatin and RNAi are required to establish CENP-A chromatin at centromeres. Science. 319 (5859 ):94–97. doi:10.1126/science.1150944.18174443
Francisco  FO, Lemos  B. 2014. How do Y-chromosomes modulate genome-wide epigenetic states: genome folding, chromatin sinks, and gene expression. J Genomics. 2 :94–103. doi:10.7150/jgen.8043.25057325
Garrigan  D, Kingan  SB, Geneva  AJ, Andolfatto  P, Clark  AG, Thornton  KR, Presgraves  DC. 2012. Genome sequencing reveals complex speciation in the Drosophila simulans clade. Genome Res. 22 (8 ):1499–1511. doi:10.1101/gr.130922.111.22534282
Gatti  M, Pimpinelli  S. 1992. Functional elements in Drosophila melanogaster heterochromatin. Annu Rev Genet. 26 (1 ):239–276. doi:10.1146/annurev.ge.26.120192.001323.1482113
Hales  KG, Korey  CA, Larracuente  AM, Roberts  DM. 2015. Genetics on the fly: a primer on the Drosophila model system. Genetics. 201 (3 ):815–842. doi:10.1534/genetics.115.183392.26564900
Hoskins  RA, Carlson  JW, Wan  KH, Park  S, Mendez  I, Galle  SE, Booth  BW, Pfeiffer  BD, George  RA, Svirskas  R, et al  2015. The Release 6 reference sequence of the Drosophila melanogaster genome. Genome Res. 25 (3 ):445–458. doi:10.1101/gr.185579.114.25589440
Hu  TT, Eisen  MB, Thornton  KR, Andolfatto  P. 2013. A second-generation assembly of the Drosophila simulans genome provides new insights into patterns of lineage-specific divergence. Genome Res. 23 (1 ):89–98. doi:10.1101/gr.141689.112.22936249
Huang  Y, Shukla  H, Lee  YCG. 2022. Species-specific chromatin landscape determines how transposable elements shape genome evolution. eLife. 11 :e81567. doi:10.7554/eLife.81567.35997258
Jagannathan  M, Warsinger-Pepe  N, Watase  GJ, Yamashita  YM. 2017. Comparative analysis of satellite DNA in the Drosophila melanogaster species complex. G3 (Bethesda) GenesGenomesGenetics. 7 (2 ):693–704. doi:10.1534/g3.116.035352.
Jagannathan  M, Yamashita  YM. 2021. Defective satellite DNA clustering into chromocenters underlies hybrid incompatibility in Drosophila. Mol Biol Evol. 38 (11 ):4977–4986. doi:10.1093/molbev/msab221.34302471
Janssen  A, Colmenares  SU, Karpen  GH. 2018. Heterochromatin: guardian of the genome. Annu Rev Cell Dev Biol. 34 (1 ):265–288. doi:10.1146/annurev-cellbio-100617-062653.30044650
Karpen  GH, Le  M-H, Le  H. 1996. Centric heterochromatin and the efficiency of achiasmate disjunction in Drosophila female meiosis. Science. 273 (5271 ):118–122. doi:10.1126/science.273.5271.118.8658180
Kim  BY, Wang  JR, Miller  DE, Barmina  O, Delaney  E, Thompson  A, Comeault  AA, Peede  D, D'Agostino  ERR, Pelaez  J, et al  2021. Highly contiguous assemblies of 101 drosophilid genomes. eLife. 10 :e66405. doi:10.7554/eLife.66405.34279216
Krueger  F, James  F, Ewels  P, Afyounian  E, Schuster-Boeckler  B. 2021. FelixKrueger/TrimGalore: v0.6.7—DOI via Zenodo.
Kumon  T, Ma  J, Akins  RB, Stefanik  D, Nordgren  CE, Kim  J, Levine  MT, Lampson  MA. 2021. Parallel pathways for recruiting effector proteins determine centromere drive and suppression. Cell. 184 (19 ):4904–4918.e11. doi:10.1016/j.cell.2021.07.037.34433012
Lack  JB, Lange  JD, Tang  AD, Corbett-Detig  RB, Pool  JE. 2016. A thousand fly genomes: an expanded Drosophila genome nexus. Mol Biol Evol. 33 (12 ):3308–3313. doi:10.1093/molbev/msw195.27687565
Larracuente  AM . 2014. The organization and evolution of the responder satellite in species of the Drosophila melanogaster group: dynamic evolution of a target of meiotic drive. BMC Evol Biol. 14 (1 ):233. doi:10.1186/s12862-014-0233-9.25424548
Lee  YCG, Ogiyama  Y, Martins  NMC, Beliveau  BJ, Acevedo  D, Wu  C-T, Cavalli  G, Karpen  GH. 2020. Pericentromeric heterochromatin is hierarchically organized and spatially contacts H3K9me2 islands in euchromatin. PLoS Genet. 16 (3 ):e1008673. doi:10.1371/journal.pgen.1008673.32203508
Lemos  B, Araripe  LO, Hartl  DL. 2008. Polymorphic Y chromosomes harbor cryptic variation with manifold functional consequences. Science. 319 (5859 ):91–93. doi:10.1126/science.1148861.18174442
Li  H . 2011. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics. 27 (21 ):2987–2993. doi:10.1093/bioinformatics/btr509.21903627
Lohe  A, Roberts  PA. 1988. Evolution of satellite DNA sequences in Drosophila. In: Verma  RS, editor. Heterochromatin, Molecular and Structural Aspects. Cambridge: Cambridge University Press. p. 148–186.
Marsano  RM, Giordano  E, Messina  G, Dimitri  P. 2019. A new portrait of constitutive heterochromatin: lessons from Drosophila melanogaster. Trends Genet. 35 (9 ):615–631. doi:10.1016/j.tig.2019.06.002.31320181
Matute  DR, Ayroles  JF. 2014. Hybridization occurs between Drosophila simulans and D. sechellia in the Seychelles archipelago. J Evol Biol. 27 (6 ):1057–1068. doi:10.1111/jeb.12391.24773151
McStay  B . 2016. Nucleolar organizer regions: genomic ‘dark matter’ requiring illumination. Genes Dev. 30 (14 ):1598–1610. doi:10.1101/gad.283838.116.27474438
Meiklejohn  CD, Landeen  EL, Gordon  KE, Rzatkiewicz  T, Kingan  SB, Geneva  AJ, Vedanayagam  JP, Muirhead  CA, Garrigan  D, Stern  DL. 2018. Gene flow mediates the role of sex chromosome meiotic drive during complex speciation. eLife. 7 :e35468. doi:10.7554/eLife.35468.30543325
Mohan  J, Ritossa  FM. 1970. Regulation of ribosomal RNA synthesis and its bearing on the bobbed phenotype in Drosophila melanogaster. Dev Biol. 22 (3 ):495–512. doi:10.1016/0012-1606(70)90165-X.5463671
Nguyen  AH, Bachtrog  D. 2021. Toxic Y chromosome: increased repeat expression and age-associated heterochromatin loss in male Drosophila with a young Y chromosome. PLoS Genet. 17 (4 ):e1009438. doi:10.1371/journal.pgen.1009438.33886541
Peng  JC, Karpen  GH. 2009. Heterochromatic genome stability requires regulators of histone H3 K9 methylation. PLoS Genet. 5 (3 ):e1000435. doi:10.1371/journal.pgen.1000435.19325889
Rahman  R, Chirn  G, Kanodia  A, Sytnikova  YA, Brembs  B, Bergman  CM, Lau  NC. 2015. Unique transposon landscapes are pervasive across Drosophila melanogaster genomes. Nucleic Acids Res. 43 (22 ):10655–10672. doi:10.1093/nar/gkv1193.26578579
Ramírez  F, Ryan  DP, Grüning  B, Bhardwaj  V, Kilpert  F, Richter  AS, Heyne  S, Dündar  F, Manke  T. 2016. Deeptools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44 (W1 ):W160–W165. doi:10.1093/nar/gkw257.27079975
Ross  MG, Russ  C, Costello  M, Hollinger  A, Lennon  NJ, Hegarty  R, Nusbaum  C, Jaffe  DB. 2013. Characterizing and measuring bias in sequence data. Genome Biol. 14 (5 ):R51. doi:10.1186/gb-2013-14-5-r51.23718773
Sackton  TB, Montenegro  H, Hartl  DL, Lemos  B. 2011. Interspecific Y chromosome introgressions disrupt testis-specific gene expression and male reproductive phenotypes in Drosophila. Proc Natl Acad Sci U S A. 108 (41 ):17046–17051. doi:10.1073/pnas.1114690108.21969588
Shinde  D . 2003. Taq DNA polymerase slippage mutation rates measured by PCR and quasi-likelihood analysis: (CA/GT)n and (A/T)n microsatellites. Nucleic Acids Res. 31 (3 ):974–980. doi:10.1093/nar/gkg178.12560493
Sproul  JS, Khost  DE, Eickbush  DG, Negm  S, Wei  X, Wong  I, Larracuente  AM. 2020. Dynamic evolution of euchromatic satellites on the X chromosome in Drosophila melanogaster and the simulans clade. Mol Biol Evol. 37 (8 ):2241–2256. doi:10.1093/molbev/msaa078.32191304
Stage  DE, Eickbush  TH. 2007. Sequence variation within the rRNA gene loci of 12 Drosophila species. Genome Res. 17 (12 ):1888–1897. doi:10.1101/gr.6376807.17989256
Stankiewicz  P, Lupski  JR. 2010. Structural variation in the human genome and its role in disease. Annu Rev Med. 61 (1 ):437–455. doi:10.1146/annurev-med-100708-204735.20059347
Stern  DL, Crocker  J, Ding  Y, Frankel  N, Kappes  G, Kim  E, Kuzmickas  R, Lemire  A, Mast  JD, Picard  S. 2017. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3 (Bethesda). 7 (4 ):1339–1347. doi:10.1534/g3.116.038885.28280212
Sudmant  PH, Rausch  T, Gardner  EJ, Handsaker  RE, Abyzov  A, Huddleston  J, Zhang  Y, Ye  K, Jun  G, Hsi-Yang Fritz  M, et al  2015. An integrated map of structural variation in 2,504 human genomes. Nature. 526 (7571 ):75–81. doi:10.1038/nature15394.26432246
Talbert  PB, Kasinathan  S, Henikoff  S. 2018. Simple and complex centromeric satellites in Drosophila sibling species. Genetics. 208 (3 ):977–990. doi:10.1534/genetics.117.300620.29305387
Tartof  KD, Hobbs  C, Jones  M. 1984. A structural basis for variegating position effects. Cell. 37 (3 ):869–878. doi:10.1016/0092-8674(84)90422-7.6086148
Terracol  R, Prud’homme  N. 1986. Differential elimination of rDNA genes in bobbed mutants of Drosophila melanogaster. Mol Cell Biol. 6 (4 ):1023–1031. doi:10.1128/mcb.6.4.1023-1031.1986.3023865
Treangen  TJ, Salzberg  SL. 2012. Repetitive DNA and next-generation sequencing: computational challenges and solutions. Nat Rev Genet. 13 (1 ):36–46. doi:10.1038/nrg3117.
Wakimoto  BT, Hearn  MG. 1990. The effects of chromosome rearrangements on the expression of heterochromatic genes in chromosome 2L of Drosophila melanogaster. Genetics. 125 (1 ):141–154. doi:10.1093/genetics/125.1.141.2111264
Wallrath  LL, Elgin  SC. 1995. Position effect variegation in Drosophila is associated with an altered chromatin structure. Genes Dev. 9 (10 ):1263–1277. doi:10.1101/gad.9.10.1263.7758950
Wei  X, Eickbush  DG, Speece  I, Larracuente  AM. 2021. Heterochromatin-dependent transcription of satellite DNAs in the Drosophila melanogaster female germline. eLife. 10 :e62375. doi:10.7554/eLife.62375.34259629
Wei  KH-C, Grenier  JK, Barbash  DA, Clark  AG. 2014. Correlated variation and population differentiation in satellite DNA abundance among lines of Drosophila melanogaster. Proc Natl Acad Sci U S A. 111 (52 ):18793–18798. doi:10.1073/pnas.1421951112.25512552
Wei  KH-C, Lower  SE, Caldas  IV, Sless  TJS, Barbash  DA, Clark  AG. 2018. Variable rates of simple satellite gains across the Drosophila phylogeny. Mol Biol Evol. 35 (4 ):925–941. doi:10.1093/molbev/msy005.29361128
Weischenfeldt  J, Symmons  O, Spitz  F, Korbel  JO. 2013. Phenotypic impact of genomic structural variation: insights from and for human disease. Nat Rev Genet. 14 (2 ):125–138. doi:10.1038/nrg3373.23329113
