
==== Front
Mol Biol Cell
Mol Biol Cell
molbiolcell
mboc
Molecular Biology of the Cell
1059-1524
1939-4586
The American Society for Cell Biology

38758663
E24-04-0154
10.1091/mbc.E24-04-0154
Articles
new_hypothesis
new_methods
Highlights from MBoC SelectionTubulin glycylation controls ciliary motility through modulation of outer-arm dyneins
Kubo Tomohiro a *
Sasaki Rinka a
Oda Toshiyuki a *
a Department of Anatomy and Structural Biology, Graduate School of Medicine, University of Yamanashi, 1110 Shimokato, Chuo, Yamanashi, 409-3898, Japan
Pazour Gregory Monitoring Editor
University of Massachusetts Medical School
ORCID ID: Tomohiro Kubo, 0000-0002-4341-5631

*Address correspondence to: Tomohiro Kubo (tkubo@yamanashi.ac.jp); Toshiyuki Oda (toda@yamanashi.ac.jp)
01 7 2024
01 7 2024
35 7 ar9009 4 2024
07 5 2024
10 5 2024
© 2024 Kubo et al. “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology.
2024
https://creativecommons.org/licenses/by/4.0/ This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution 4.0 International Creative Commons CC-BY 4.0 License.

Tubulins undergo several kinds of posttranslational modifications (PTMs) including glutamylation and glycylation. The contribution of these PTMs to the motilities of cilia and flagella is still unclear. Here, we investigated the role of tubulin glycylation by examining a novel Chlamydomonas mutant lacking TTLL3, an enzyme responsible for initiating glycylation. Immunostaining of cells and flagella revealed that glycylation is only restricted to the axonemal tubulin composing the outer-doublet but not the central-pair microtubules. Furthermore, the flagellar localization of TTLL3 was found to be dependent on intraflagellar transport. The mutant, ttll3(ex5), completely lacks glycylation and consequently exhibits slower swimming velocity compared with the wild-type strain. By combining the ttll3(ex5) mutation with multiple axonemal dynein-deficient mutants, we found that the lack of glycylation does not affect the motility of the outer-arm dynein lacking mutations. Sliding disintegration assay using isolated axonemes revealed that the lack of glycylation decreases microtubule sliding velocity in the normal axoneme but not in the axoneme lacking the outerarm dyneins. Based on our recent study that glycylation occurs exclusively on β-tubulin in Chlamydomonas, these findings suggest that tubulin glycylation controls flagellar motility through modulating outer-arm dyneins, presumably by neutralizing the negative charges of glutamate residues at the C-terminus region of β-tubulin.

Tubulins undergo various posttranslational modifications (PTMs), including glycylation, but the role of this PTM in ciliary and flagellar motility remains unclear.

In this study, the authors generated a novel Chlamydomonas mutant lacking the monoglycylase TTLL3 to investigate the significance of tubulin glycylation in ciliary function. Their findings reveal that glycylated tubulin regulates ciliary motility by modulating outer arm dyneins.

These results highlight the substantial impact of glycylation on ciliary motility, potentially by neutralizing the negative charges on β-tubulin. This insight paves the way for further exploration of cellular motility mechanisms and their implications in diseases associated with ciliary dysfunction.
==== Body
pmcINTRODUCTION

Alpha- and β-tubulin undergo several posttranslational modifications (PTMs) including acetylation, tyrosination, detyrosination, glutamylation, and glycylation (Westermann and Weber, 2003; Janke and Bulinski, 2011). These PTMs increase the functional diversity of microtubule-based cell organelles such as eukaryotic cilium (or flagellum), a hair-like appendage on cell surfaces. Because α- and β-tubulin constitute the major components of the ciliary axoneme, cilia provide a remarkable model for studying tubulin PTMs.

Glutamylation and glycylation take place at γ-carboxyl group of glutamate residues located near the tubulin C-termini (Eddé et al., 1990; Mary et al., 1996). They are catalyzed by enzymes belonging to the tubulin tyrosine ligase-like (TTLL) protein family (Janke et al., 2005; Wloga et al., 2009). In mammals, 13 types of TTLL proteins exist, with TTLL 1, 4, 5, 6, 7, 9, and 11 responsible for glutamylation (Dijk et al., 2007; Konno et al., 2016), and TTLL 3, 8, and 10 responsible for glycylation (Ikegami and Setou, 2009; Rogowski et al., 2009; Wloga et al., 2009). These modifications are likely to be reversible, as deglutamylases performing the removal of glutamylation have been identified as members of the cytosolic carboxypeptidase (CCP; Rogowski et al., 2010) and tubulin metallocarboxypeptidase (TMCP; Nicot et al., 2023). TTLLs, deglutamylases, and unidentified deglycylases should exhibit distinct specificities for both substrate and reaction activity, most likely resulting in the production of variable lengths of side chains for either polyglutamylation or polyglycylation.

The importance of tubulin polyglutamylation for ciliary function has been explored using several organisms. We and others have demonstrated that tubulin glutamylation affects ciliary motility (Ikegami et al., 2010; Kubo et al., 2010; Suryavanshi et al., 2010). Through an investigation of Chlamydomonas mutant tpg1 harboring a mutation in the gene encoding TTLL9, we have established that the negative charges of tubulin polyglutamylation modulates the activity of an axonemal structure called the nexin-dynein regulatory complex (N-DRC) (Kubo et al., 2012; Alford et al., 2016; Kubo and Oda, 2017). This concept gains further support from a recent structural study indicating that polyglutamylated tubulin is specifically localized to the protofilament 9 of the outer-doublet micro­tubules in both Chlamydomonas and mouse (Viar et al., 2023). This location should enable a direct interaction between polyglutamylated tubulin and the N-DRC.

Tubulin glycylation for ciliary function has also been extensively studied. A study on Tetrahymena mutants possessing a mutation in the gene encoding TTLL3 revealed that tubulin glycylation plays a crucial role in regulating ciliary assembly (Wloga et al., 2009). Similarly, glycylation was shown to be essential for the stability and maintenance of ependymal cilia (Bosch Grau et al., 2013), as well as the control of primary cilia length (Gadadhar et al., 2017). More recently, glycylation was found to be important for flagellar motility, as demonstrated in sperm analysis of TTLL3–/– TTLL8–/– double-knockout mouse (Gadadhar et al., 2021) and Chlamydomonas mutant lacking TTLL3 (Viar et al., 2023). These studies suggest that glycylated tubulin significantly influences the function of the axonemal dyneins. However, the biochemical properties of TTLL3 and which dynein’s function is mostly affected by glycylation are still obscure. In this study, we generated Chlamydomonas strains lacking TTLL3 by a CRISPR/Cas9 mediated gene editing. By investigating several dynein-lacking mutants combined with the ttll3 mutation, we found that the motilities of mutants lacking outer-dynein arm are not affected by tubulin glycylation. This result suggests that tubulin glycylation affects the function of outer-arm dynein. Our study thus shed light on a novel aspect of tubulin glycylation in cilia and flagella.

RESULTS

A novel Chlamydomonas mutant harboring an insertion in the TTLL3 encoding gene

In the Chlamydomonas genomic database, we found a gene encoding potential homologue of mouse TTLL3, a monoglycylase. Interestingly, among the glycylation enzymes TTLL3, TTLL8, and TTLL10 reported in other organisms, only TTLL3 is present in Chlamydomonas. The absence of TTLL10 responsible for elongation of polyglycylated chains likely explains the lack of polyglycylation in Chlamydomonas (Kubo et al., 2023). To explore the role of TTLL3 in Chlamydomonas, we transformed the wild-type strain (cc124) by integrating a hygromycin-resistant cassette into the TTLL3 gene (Cre03.g145447) using a CRISPR/Cas9-mediated gene editing (Figure 1A). Genotyping with a specific primer set identified several transformants with a hygromycin-resistant cassette inserted into exon 5 of TTLL3 (Figure 1A). Gene sequencing revealed that several transformants have a premature stop codon in the exon 5, indicating that the transcription of full-length TTLL3 is hindered (Figure 1A). The TTLL3 protein and thereby tubulin glycylation were found to be missing in the flagella of this mutant as we will describe later. We, therefore, refer to this strain as ttll3(ex5). Daily measurements of cell concentration showed that ttll3(ex5) has normal cell growth (Supplemental Figure 1), suggesting that TTLL3 is not involved in the cell proliferation and survival.

FIGURE 1: Generation of the ttll3(ex5) mutant (A) The structure of the TTLL3 (Cre03.g145447) gene. Exons are indicated in dark red, and untranslated regions are shown in greenish blue. As confirmed by gene sequencing and PCR using a specific primer set, a hygromycin-resistant gene cassette (dark gray) was integrated into exon 5 of the TTLL3 gene. (B) Flagellar regeneration kinetics of wild type (cc124) and ttll3(ex5). Cells were deflagellated by pH shock, and flagellar lengths were measured every 15 min for up to 180 min. (C) Flagellar elongation of wild type (cc124) and ttll3(ex5) induced by 25 mM LiCl. (D) NaPPi-induced flagellar shortening of wild type (cc124) and ttll3(ex5). In (B–D), at least 50 flagella were measured for each time points. The average values and standard deviations are shown.

Because tubulin polyglycylation was reported to affect ciliary assembly (Wloga et al., 2009; Bosch Grau et al., 2013; Gadadhar et al., 2017), we were interested in the characteristics of flagellar assembly and disassembly in ttll3(ex5). Initially, we found that the kinetics of flagellar regeneration is normal in this mutant (Figure 1B). Subsequently, we determined that flagellar elongation triggered by LiCl treatment is also unaffected (Figure 1C). Furthermore, we found that rate of flagellar shortening induced by NaPPi treatment remained normal (Figure 1D). Therefore, these results suggest that tubulin glycylation does not critically affect polymerization nor depolymerization of axonemal microtubules in Chlamydomonas.

The lack of the TTLL3 gene may cause a defect in the intraflagellar transport (IFT), even though the flagellar regeneration kinetics is normal in ttll3(ex5; Figure 1C). To investigate the function of IFT in ttll3(ex5), we examined the amounts of IFT-particle proteins in isolated ttll3(ex5) flagella. Our findings indicate that the flagellar levels of IFT172, IFT139, IFT81, and IFT57 are normal in the ttll3(ex5) mutant (Supplemental Figure 2A). Immunostaining of cells further showed that the localization of these IFT-particle proteins remains unchanged in ttll3(ex5) (Supplemental Figure 2B). These results confirm that the mutation in the TTLL3 gene does not impact the function of IFT.

The mutant ttll3(ex5) completely lacks axonemal tubulin glycylation

To investigate the level of glycylation in the cellular and axonemal microtubules, we performed indirect fluorescence microscopy of the nuclear-flagellar apparatuses (NFAps) using gly-pep1 antibody recognizing mono or bi-glycylated tubulin (Gadadhar et al., 2017). In the wild-type axonemes, the gly-pep1 signal sharply increases towards the midsection, then progressively decreases towards the distal tips (Figure 2A). Interestingly, the staining was absent in the microtubules of the cytoplasm and the basal body, indicating that tubulin glycylation is only restricted to the axoneme. This differs from some ciliates such as Paramecium (Bré et al., 1998) and Tetrahymena (Xia et al., 2000) that have glycylated tubulin in the cytoplasmic microtubules. In contrast to the wild-type axoneme, however, the ttll3(ex5) axoneme exhibited a complete absence of the gly-pep1 staining (Figure 2A). This confirms that TTLL3 is the only monoglycylase expressed in Chlamydomonas (Viar et al., 2023), and its defect causes complete loss of tubulin glycylation.

FIGURE 2: The ttll3(ex5) axoneme completely lacks tubulin glycylation Immunostaining of NFAp of wild type (cc124), ttll3(ex5), ttll9(ex8), and ttll3(ex5) ttll9(ex8) using (A) antiglycylated tubulin (Gly-pep1) and (B) antipolyglutamylated tubulin (polyE#2) antibodies. One cilium each on at least 100 cells was investigated and the average signal intensities with standard deviations were obtained.

The levels of tubulin glycylation and polyglutamylation were believed to have an inverse correlation, as evidenced by studies showing that mutants lacking glycylation sites has increased polyglutamylation, and vice versa (Redeker et al., 2005; Kubo et al., 2023). To investigate whether a similar interplay exists in the Chlamydomonas TTLL mutants, we generated ttll9(ex8) strain deficient in the gene encoding TTLL9 glutamylase. Because we verified that the axonemes of ttll9(ex8) display greatly reduced polyglutamylation (Figures 2B and 3), this strain most likely is a null allele of TPG1 locus (Kubo et al., 2010). The decreased level of polyglutamylation, and consequently the reduced swimming velocity (Figure 7B), is identical to that observed in tpg1, a strain previously isolated (Kubo et al., 2010). Surprisingly, we did not observe any increase in glycylation in the axonemes lacking glutamylation, nor did we detect any increase in glutamylation in the axonemes lacking glycylation (Figure 2, A and B). Instead, the novel ttll9(ex8) mutant showed slightly reduced level of glycylation in the axoneme (Figures 2, A and 3), and the ttll3(ex5) displayed slightly decreased or normal level of polyglutamylation in the axoneme (Figures 2B and 3). It appears that, at least in Chlamydomonas, the inverse correlation of these two modifications only takes place in strains that possess point mutations at the sites of modification on the C-terminus region of tubulin.

FIGURE 3: Amounts of modified tubulins in the ttll3(ex5) axoneme CBB-stained gel and Western blotting of cc124, ttll3(ex5), ttll9(ex8), and ttll9(ex8) ttll3(ex5) axonemes. The quantification of the band intensities, normalized to those of α-tubulin, is shown in brackets and is based on at least five experiments.

These results of the immunostaining were confirmed by Western blotting of isolated axonemes using several antibodies targeting modified tubulin (Figure 3). Our findings reveal a nearly complete absence of the gly-pep1 signal in the ttll3(ex5) axonemes. Additionally, we observed a reduction of polyglutamylation in the ttll9(ex8) axonemes. However, other PTMs of tubulin, such as acetylation, tyrosination, and detyrosination, remained almost unchanged in both the ttll3(ex5) and ttll9(ex8) axonemes. These results indicate that in Chlamydomonas, the loss of TTLL3 leads to a total loss of tubulin glycylation, while having a minimal effect on other tubulin modifications.

We then investigated whether tubulin glycylation is confined to specific axonemal microtubules. To accomplish this, we conducted double staining on frayed axonemes isolated from the wild-type strain using two sets of antibodies: one set with antibodies against α-tubulin and glycylated tubulin, and another set with antibodies against acetylated-α-tubulin and glycylated tubulin. We found that microtubule bundles of the outer doublets are stained by the gly-pep1 antibody. However, the central-pair microtubules, characterized by their strongly curved shape in contrast to the less curved outer doublets (Kamiya, 1982), are not stained by the gly-pep1 antibody (Figure 4). These observations contradict the findings of Orbach and Howard (2019), who stated that all axonemal micro­tubules including the central-pair microtubules are glycylated.

FIGURE 4: Glycylated tubulin is restricted to the outer-doublet microtubules Frayed axonemes were double stained with antibodies targeting the indicated tubulins. The positions of the central-pair microtubules were marked with orange arrowheads.

Acquisition of tubulin glycylation on stable axonemal microtubules

The gametes of opposite mating types undergo cell fusion immediately after being mixed together, resulting a singular cell possessing four flagella and two nuclei. This specific cell type is called a “dikaryon” as described by Starling and Randall (1971). To investigate the process of glycylation on the stable axonemal microtubules, we undertook the mating of the wild-type (cc125) and ttll3(ex5) gametes to generate dikaryon cells. We assessed the dikaryons at time points 10, 30, and 60 min after the gamete mixing. Our observation revealed that the flagella of ttll3(ex5) underwent gradual acquisition of glycylation along the entire length within 30 min of cell fusion and nearly complete recovery within 60 min (Figure 5A). This pattern resembles the acquisition of tubulin polyglutamylation observed in the dikaryon between cc125 and ttll9(ex8; Figure 6A) as we previously reported (Kubo et al., 2014).

FIGURE 5: Recovery of tubulin glycylation on the axonemal microtubules (A) Immunostaining of the NFAp in dikaryons formed between wild type (cc125) and ttll3(ex5), using the Gly-pep1 antibody (upper panel), or between cc125 and ttll9(ex8), using polyE#2 antibody (lower panel). (B) Immunostaining of NFAp in dikaryons formed between wild type (cc125) and ttll9(ex8) ttll3(ex5) using the Gly-pep1 antibody (upper panel) or polyE#2 (lower panel). Dikaryons were isolated at 10, 30, and 60 min after mixing the opposite mating types.

FIGURE 6: Flagellar localization of TTLL3 depends on the IFT (A) Characterization of peptide antibodies against the N-terminus and C-terminus of TTLL3. Flagellar proteins were subjected to Western blot analysis using anti-TTLL3N#2 (left panel) and TTLL3C#1 (right panel) antibodies. Red arrowheads indicate the specific bands for TTLL3, while black arrowheads indicate non-specific bands. (B) CBB staining (upper panel) and Western blot analysis (lower panel) of flagellar fractions. Most of the TTLL3 proteins is present in the axonemal fraction. (C) Western blot analysis of axonemes from wild-type (cc124) and ttll3(ex5) strains using anti-TTLL3N#2 and TTLL3C#1 antibodies. The quantification of the band intensities, normalized to those of α-tubulin, is shown in the brackets. (D) CBB-stained gel and Western blot analysis of flagella isolated from fla10-1, a temperature-sensitive mutant affecting IFT-dependent flagellar assembly, incubated with or without exposure to 33°C. The quantification of the band intensities, normalized to those of α-tubulin, is shown in the brackets. (E) Western blot analysis (left panel) and CBB staining (right panel) were performed on flagella from both steady-state and regenerated flagella. The quantification of the band intensities, normalized to those of tubulin intensities, is shown in the brackets.

We than produced dikaryons between cc125 and the double mutant ttll9(ex8) ttll3(ex5) to investigate whether the acquisitions of glycylation and glutamylation occur simultaneously. Immunostaining of dikaryons using gly-pep1 and polyE#2 antibodies revealed that the recovery of both glycylation and glutamylation occur gradually within 30 min (Figure 5B) with no noticeable delay compared with the dikaryons produced between cc125 and either ttll3(ex5) or ttll9(ex8). These results indicate that both glycylation and glutamylation are a dynamic process that occurs on stable microtubules, and that both modifications do not interfere with each other.

Axonemal localization of TTLL3 depends on the IFT

To study biochemical properties of TTLL3 in cells and flagella, we generated peptide antibodies targeting two distinct regions of TTLL3. Two antibodies against the N-terminal region (amino acids 4-24) were produced, referred to as anti-TTLL3N#1 and #2, respectively. Similarly, two antibodies against the C-terminal region (amino acids 1301–1319) were produced, referred to as anti-TTLL3C#1 and #2, respectively. When these antibodies were used for Western blot analysis of wild-type cytoplasm, no specific bands for TTLL3 were observed. Instead, several non-specific bands were detected (Supplemental Figure 3A). However, in Western blot of flagellar proteins, specific bands were detected in the range between 150 and 250 kDa with every antibody used (Figure 6A; Supplemental Figure 3B). Although the predicted molecular weight of TTLL3 is 146 kDa, the bands in the 150∼250 kDa range are likely to be signals of TTLL3. This is based on two key observations: (i) the specific bands at the same height are detected using two sets of antibodies targeting different amino-acid sequences, and (ii) the specific bands are not detected in the ttll3(ex5) axoneme as described below. The detection of specific bands exclusively in the flagella and not in the cytoplasm suggests that TTLL3 is predominantly enriched in the flagella. This concept is further supported by the observation that glycylation is confined to the axonemal microtubules but not to the cytoplasmic microtubules (Figure 2A). Despite the high specificity of these antibodies, however, the localization of TTLL3 proved challenging with both conventional immunofluorescence microscopy and confocal microscopy presumably due to its low expression level (unpublished data).

Western blotting of the flagellar fraction revealed that the majority of TTLL3 is localized to the axonemal fraction (Figure 6B). This property is identical to that of TTLL9, a tubulin polyglutamylase (Kubo et al., 2010). Similar to TTLL9, TTLL3 might associate relatively strongly with the axonemal microtubules. Also, TTLL3 was found to be completely absent in the ttll3(ex5) axoneme (Figure 6C). This suggests that the mutant flagella do not contain truncated version of the TTLL3 protein, although a possibility remains that a shorter form is expressed in the cytoplasm of ttll3(ex5).

To investigate whether the flagellar localization of TTLL3 depends on IFT, we studied the flagella of fla10-1, a temperature-sensitive mutant that affects IFT-driven flagellar assembly due to a point mutation in the kinesin-homologous KHP1 protein (Huang et al., 1977; Kozminski et al., 1995). Although fla10-1 assembles normal-length flagella at the room temperature, it shortens and eventually loses flagella at 33°C. A culture of fully grown fla10-1 cells was divided into two halves: one half was maintained at 25°C (room temperature) and the other half was treated at 33°C for 150 min. Their flagella were subsequently isolated and processed for Western blotting to determine the amounts of IFT139 (a component of IFT-A complex), IFT57 (a component IFT-B complex), and TTLL3 (Figure 6D). We found that along with IFT139 and IFT57, the signals of TTLL3 were clearly detected at room temperature but nearly undetectable at the sensitive temperature. This result indicates that the flagellar localization of TTLL3 is dependent on the IFT.

We surmised that majority of glycylation takes place during flagellar assembly. To investigate this, wild-type cells were exposed to pH-shock treatment and allowed a 30-min incubation to regenerate flagella (Figure 6E). We then isolated the regenerated flagella and the level of TTLL3 was compared with that in the steady-state flagella (Figure 5E). We discovered that, when normalized for the total protein content, the regenerated flagella contained approximately three times more TTLL3 than the steady-state flagella. However, given that the length of flagella that underwent 30-min regeneration is about half that of the steady-state flagella (Figure 1C), this finding implies that on a per flagellum basis, a regenerated flagellum has roughly 1.5 times more TTLL3 than a steady-state flagellum. Therefore, the frequency of TTLL3 transport increases during flagellar assembly.

Tubulin glycylation plays a crucial role in the functioning of outer-arm dynein

Mouse sperm without tubulin glycylation show reduced swimming velocity (Gadadhar et al., 2021), while the Chlamydomonas mutant ttll3, also generated through CRISPR/Cas9, displays increased swimming speed but decreased flagellar beat frequency (Viar et al., 2023). The reason for the difference in the motility between these two organisms is currently unknown. To investigate the role of tubulin glycylation in ciliary motility, we conducted a comparative analysis of swimming motilities. First, we compared the swimming velocities of wild type (cc124) with those of ttll3(ex5). We discovered that our ttll3(ex5) mutant tends to swim slower than the wild type (Figure 7A), although their swimming velocity was unstable varied depending on the cell concentration, temperature, and culture media. This finding seems to be inconsistent with the swimming speed of the ttll3 mutant reported by Viar et al. (2023), although the wild-type strains used to generate the mutants were different. The reason for the observed differences in swimming behaviors of the ttll3 strains across the two research groups are yet to be determined, highlighting the complexity of flagellar motility and the need for further investigation. Nevertheless, we decided to investigate the effect of glycylation on the motilities of various axonemal dynein lacking mutants.

FIGURE 7: Swimming velocities of the ttll3(ex5) mutants Swimming velocities compared between (A) wild type (cc124) and ttll3(ex5), (B) wild type (cc124) and ttll9(ex8), (C) oda1 and oda1 ttll3(ex5), (D) oda2 and oda2 ttll3(ex5), (E) ida1 and ida1 ttll3(ex5), (F) ida4 and ida4 ttll3(ex5), (G) ida5 and ida5 ttll3(ex5), (H) ida9 and ida9 ttll3(ex5), (I) pf2 and pf2 ttll3(ex5), (J) pf3 and pf3 ttll3(ex5), (K) ida6 and ida6 ttll3(ex5), and (L) ttll9(ex8) and ttll9(ex8) ttll3(ex5). Velocities were statistically evaluated by two-tailed unpaired Student’s t test.

To determine which axonemal dynein species is most significantly affected by glycylation, we assessed the effect of ttll3(ex5) in the background of a dynein-lacking mutation. If a particular dynein is affected by glycylation in the normal conditions, the effect of ttll3(ex5) mutation will not be observed when that dynein is absent. Axonemal dyneins are generally classified into two types; the outerarm dyneins, primarily involved in the force generation, and the innerarm dyneins, mainly involved in the waveform generation (Kamiya, 2002). In Chlamydomonas, the outer-dynein arms are composed of a single species comprising three heavy chains (α, β, and γ), whereas inner-dynein arms are composed of seven major species referred to as inner-arm dynein a to g. Interestingly, strains lacking the outer-arm dyneins, such as oda1 and oda2, exhibited no discernible effects on motility from the ttll3(ex5) mutation (Figure 7, C and D). This suggests that tubulin glycylation mainly regulates the function of the outer-arm dyneins in the intact axoneme.

We then explored the effect of the ttll3(ex5) mutation in strains carrying a mutation that lacks the inner-arm dynein(s) (Figure 7, E, F, G, and H). ida1 lacks inner-arm dynein f, ida4 lacks inner-arm dynein a, c, and d, ida5 lacks inner-arm dynein a, c, d, and e, and ida9 lacks inner-arm dynein c. When combined with the ttll3(ex5) mutation, swimming velocities of all these mutants decreased, suggesting that tubulin glycylation does not affect the functions of inner-arm dynein a, c, d, e, and f. Contribution of glycylation to the other inner arm dyneins must be investigated in the future using mutants particularly lacking the inner arm dynein b and g.

We also found that the mutants lacking the N-DRC (pf2, pf3, and ida6) show reduced motility when combined with the ttll3(ex5) mutation, suggesting that glycylation does not affect the function of the N-DRC either (Figure 7, I, J, and K). Therefore, the swimming motilities of mutants lacking either the axonemal dyneins or N-DRC collectively show that tubulin glycylation plays an important role particularly in the functioning of the outer-arm dyneins.

We then explored the effect of glycylation in a mutant lacking polyglutamylation. We have previously demonstrated that tubulin polyglutamylation affects the function of the N-DRC using the mutant tpg1, which lacks TTLL9 responsible for elongating polyglutamate chains (Kubo et al., 2010; 2012). As tpg1, the novel ttll9(ex8) mutant produced in the present study also showed reduced motility (Figure 7, B and L). We found that the double mutant ttll9(ex8) ttll3(ex5) swims more slowly than the mutant ttll9(ex8) alone (Figure 7L). This result suggests that the lack of glycylation additionally contributes to the decreased motility in the ttll9(ex8) flagella, suggesting a synergistic effect on flagella of lacking both modifications.

Tubulin glycylation enhances sliding velocities of microtubule sliding in the disintegrated axonemes possessing the outer-arm dyneins

To further investigate the impact of the ttll3(ex5) mutation on ciliary motility, we assessed the sliding velocities of axonemal microtubules. We treated fragmented axonemes with ATP and protease to induce sliding disintegration. With 1 mM ATP treatment, the wild-type axonemes displayed microtubule sliding velocity of ∼20 μm/s. In contrast, the ttll3(ex5) axoneme showed a significantly reduced microtubule sliding velocity of ∼15 μm/s (Figure 8A). This finding suggests that glycylation enhances sliding of the axonemal microtubules. Importantly, in contrast to the axoneme possessing all set of the axonemal dyneins, the axonemes lacking the outer-arm dynein was not affected by the ttll3(ex5) mutation (Figure 8, C and D). These results confirm that glycylation specifically affects the function of the outer-arm dyneins.

FIGURE 8: Sliding velocities of axonemal microtubules in the mutants combined with or without the ttll3(ex5) mutation Sliding velocities of axonemal microtubule compared between(A) wild type (cc124) and ttll3(ex5), (B) wild type (cc124) and ttll9(ex8), (C) oda1 and oda1 ttll3(ex5), (D) oda2 and oda2 ttll3(ex5), (E) ida1 and ida1 ttll3(ex5), (F) ida4 and ida4 ttll3(ex5), (G) ida5 and ida5 ttll3(ex5), (H) ida9 and ida9 ttll3(ex5), (I) pf2 and pf2 ttll3(ex5), (J) pf3 and pf3 ttll3(ex5), (K) ida6 and ida6 ttll3(ex5), and (L) ttll9(ex8) and ttll9(ex8) ttll3(ex5). Velocities were statistically evaluated by two-tailed unpaired Student’s t test.

We also compared axonemal microtubule sliding between wild type and ttll9(ex8; Figure 8B). Previous studies have demonstrated that the tpg1 mutation lacking tubulin polyglutamylation significantly increases sliding velocity, particularly in axonemes lacking outer-arm dyneins, but to a lesser extent in intact axonemes possessing outer-arm dyneins (Kubo et al., 2010; 2012). In the present study, the ttll9(ex8) axoneme showed almost the same sliding velocity compared with the wild-type axoneme (Figure 8B). This is consistent with the previous study using the same ATP concentration (Kubo et al., 2010).

In contrast to the mutant axonemes lacking the outer-arm dyneins, however, mutant axonemes lacking the inner-arm dyneins (Figure 8, E, F, G, and H) and mutant axonemes lacking the N-DRCs (Figure 8, I, J, and K) all displayed significantly slower sliding velocities of axonemal microtubules when glycylation is absent. Furthermore, the ttll9(ex8) ttll3(ex5) axoneme displayed slower sliding velocity than ttll9(ex8) mutation alone, indicating that the lack of polyglutamylation does not recover the effect of ttll3(ex8) mutation (Figure 8L). Because glycylation predominantly occurs at the C-terminus region of β-tubulin in Chlamydomonas (Kubo et al., 2023), these results indicate that axonemal tubulin glycylation enhances the sliding velocities of axonemal microtubule, presumably by neutralizing the minus charges arising from the glutamate residues in the β-tubulin C-terminus region.

DISCUSSION

Important roles of tubulin PTMs in cilia and flagella motility

In this study, we generated a novel Chlamydomonas mutant ttll3(ex5) to investigate the role of axonemal tubulin glycylation. The ttll3(ex5) strain exhibited slightly slower swimming velocity compared with the wild-type strain (Figure 7), indicating that tubulin glycylation influences flagellar motility, consistent with previous reports (Gadadhar et al., 2021; Viar et al., 2023). Our primary discovery is that tubulin glycylation affects the functions of the outer-arm dyneins likely by influencing the sliding velocities of the axonemal microtubules. This result is in sharp contrast to the ciliary role of tubulin polyglutamylation, another tubulin PTM, regulating the function of the N-DRC (Kubo et al., 2012; Kubo and Oda, 2017).

Specific pattern of tubulin glycylation in Chlamydomonas

Many organisms undergo polyglycylation both in α- and β-tubulin as determined by mass spectrometry. Specifically, Paramecium has a maximum of 19 and 18 glycine units on α- and β-tubulin (Redeker et al., 1994; 2005); Tetrahymena has up to six and 12; sea urchin sperm have up to 11 and eight (Plessmann and Weber, 1997); and bull sperm have up to 23 and 15 (Multigner et al., 1996). However, it is unlikely that “poly” glycylation occurs in Chlamydomonas (Kubo et al., 2023) due to the absence of TTLL10, an enzyme essential for elongating glycine chains. The absence of polyglycylation is common to humans (Bré et al., 1996) expressing inactivated TTLL10 (Rogowski et al., 2009). Further, tubulin glycylation in Chlamydomonas is mostly confined to the glutamate residues in the C-terminus of β-tubulin, specifically at positions E435, E437, E439, E440, E441, and E442 (Kubo et al., 2023). Considering that TTLL3 is a monoglycylase mainly for β-tubulin (Garnham et al., 2017), the absence of α-tubulin glycylation in Chlamydomonas may be due to the lack of TTLL8, another monoglycylase. Elucidating the unique glycylation pattern of Chlamydomonas, such as determining the ratio of glycylated against unmodified β-tubulin, may present an intriguing challenge for future study. Also, because we have utilized only two types of antibodies, gly-pep1 and polyG (Kubo et al., 2023), to investigate tubulin glycylation, employing additional antibodies such as AXO49 (recognizes monoglycylation) and TAP952 (recognizes polyglycylation; Bré et al., 1996) may offer further insights.

Our finding suggests that glycylated tubulin is present at the outer-doublet microtubules and is absent from the central-pair microtubules (Figure 4). This observation contrasts with the findings of Orbach and Howard (2019), who employed a stepwise extraction method of axoneme to separate components of the central-pair from those of the outer-doublet microtubules. In the B-tubule outer doublets, glycylated tubulins are found in most of the protofilaments while polyglutamylated tubulins are present only at protofilament nine (Viar et al., 2023). In the extraction procedure of the axoneme, components from the outer rim of the B-tubules sometimes are unintentionally contaminated to the central-pair microtubule fraction (Witman et al., 1972). In Orbach and Howard (2019), this contamination may have led to the alternative interpretation that glycylated tubulin is localized to the central-pair microtubules.

It is noteworthy to mention that Tetrahymena has abundant glycylation in the outer doublet microtubules but also lacks glycylated tubulin in the central-pair microtubules (Wloga et al., 2009). However, both the central-pair microtubules and the outer doublet microtubules are highly glycylated in Drosophila sperm. Therefore, there seems to be lineage-specific variations in the distribution of this specific tubulin modification. Additionally, in ciliates, glycylation is abundant on cortical microtubules (Xia et al., 2000). These observations collectively suggest that tubulin glycylation serves additional functions beyond the regulation of ciliary motility.

Dynamic transport of TTLL3 into cilia

We found that glycylation of axonemal tubulin occurs rapidly in the dikaryon produced between the wild-type and ttll3(ex5) gametes. We also found that recovery of glycylation in the dikaryon occurs evenly from the base to the tip of the cilia. These properties of modification share similarities to polyglutamylation, as we showed in our previous study (Kubo et al., 2014), and was also confirmed in this study (Figure 5). Based on the cryoelectron microscopy presented by Viar et al. (2023), polyglutamylation is exclusive to protofilament nine of the B-tubule outer doublets, while glycylation occurs on the remaining protofilaments of the B-tubule. It is curious that TTLL3 and TTLL9, despite being needed to modify a different number of protofilaments, each recovered modification in the similar amount of time in the dikaryon. In vitro structural study showed that TTLL3 predominantly recognizes and glycylates four sites at the β-tubulin tail in a hierarchical manner (Garnham et al., 2017). The mechanisms by which TTLL3 and TTLL9 identify their respective protofilaments in the axoneme remain unclear.

We observed a significant decrease in the amount of TTLL3 in the flagella of fla10-1 when exposed to sensitive temperature. This indicates that flagellar recruitment of TTLL3 is dependent on the IFT (Figure 7D). Individual IFT proteins are often involved in the flagellar transport of particular cargoes. For example, IFT46, a core component of the IFT-B complex, plays a key role in the flagellar transport of outer-dynein arms (Hou et al., 2007; Ahmed et al., 2008). Another example is the N-termini of IFT74 and IFT81, which together transport tubulins into the flagella (Bhogaraju et al., 2013; Brown et al., 2015; Kubo et al., 2016). Because a direct TTLL-IFT protein interaction remains unreported, investigating the interaction between TTLL3 and a specific IFT-particle protein remains a challenge for the future research.

Tubulin glycylation impacts the function of outer-arm dyneins

By comparing motilities of various axonemal dynein mutants with or without the ttll3(ex5) mutation, we came up to the conclusion that tubulin glycylation affects the function of outer-arm dyneins. This is consistent with the previous study stating that tubulin polyglycylation affects the conformation change of axonemal dyneins including the outer arm dyneins (Gadadhar et al., 2021). To further clarify whether glycylation specifically impacts certain dynein heavy chains or the entire outer-arm dynein complex, it would be interesting to examine double mutants combining the ttll3 mutation with mutations in the alpha (oda11), beta (oda4-s7), and gamma (oda2-t) heavy chain motor units. Such experiments could provide precise insights into the specific dynein components most affected by tubulin glycylation. Additionally, to further explore this hypothesis, it may be necessary to perform in vitro motility assays using purified dyneins and polymerized microtubules that are reconstituted from the isolated axonemes. The ttll3(ex5) mutants generated in this study will value such experiments in the future.

In Chlamydomonas, glycylation primarily occurs at the six glutamate residues in the C-terminal region of β-tubulin (Kubo et al., 2023) specifically through the attachment of glycine residues to the γ-carboxyl groups of these glutamates (Redeker et al., 1994). This occurrence of glycylation may reduce the local negative charges originating from the γ-carboxyl groups of the glutamate residues. Our sliding disintegration assay of the isolated axonemes supports this concept. We found that in glycylation-deficient axonemes, microtubule sliding is significantly slower, especially in the presence of outer-arm dyneins (Figure 8). Given that the negative charges in the tubulin C-terminal regions are thought to enhance the interactions between microtubules and dyneins in the axoneme (Kubo et al., 2010), the reduced sliding speed is likely due to stronger electrostatic interactions between the microtubules.

We were unable to reason the discrepancy of the swimming velocities of the ttll3 mutants between ours and those of Viar et al. (2023). However, we noticed that the motilities of ttll3(ex5) is relatively sensitive, being affected by varying culture conditions such as media, cell concentration, temperature, pH, and light. This suggests that the absence of glycylation largely affect the electrostatic interactions between outer-doublet microtubules and outer-arm dyneins under certain conditions, leading to variations in motility. The precise impact of glycylation on these interactions remains a compelling direction for future research, promising to deepen our understanding of the molecular mechanisms governing cellular movement.

MATERIALS AND METHODS

Request a protocol through Bio-protocol.

Strains and Cultures

The strains (Supplemental Table 1) were maintained on Tris-acetate-phosphate (TAP; Gorman and Levine, 1965) agar plates for long-term storage. For the experiments, the cells were cultured in liquid TAP medium at 25°C with a light/dark cycle of 12:12 h and aeration.

Generation of CRISPR/Cas9 mutants

The ttll3(ex5) and ttll9(ex8) mutant strains were generated following the method outlined in Kubo et al. (2023). The target sequences were identified using CRISPRdirect (http://crispr.dbcls.jp/). The crRNA (Supplemental Table 2) and tracrRNAs (fasmac) were dissolved in Nuclease-Free Duplex Buffer (Integrated DNA technologies (IDT) buffer).

To generate the guide RNA, 1 μl of crRNA (40 μM) was annealed with 1 μl of tracrRNA (40 μM) by heating the mixture to 95°C for 2 min and then gradually cooling it down to 25°C over 90 min. Subsequently, 2 μl of annealed guide RNA was combined with 0.5 μl of Cas9 protein (10 μg/ml; fasmac) and 7.5 μl IDT buffer, followed by incubation at 37°C for 15 min to produce Cas9/gRNA RNP.

The cells were treated with autolysin for 60 min while being gently rocked, followed by a gentle agitation at 40°C for 30 min. After centrifugation (2000 rpm, 3 min, at room temperature), the cells were collected and subjected to electroporation using the Cas9/gRNA RNP (10 μl) and the donor DNA (10 μl; up to 2 μg). The transformed cells were suspended in 10 ml of TAP sucrose medium and gently agitated for 24 h under low light conditions. Cells were then collected by centrifugation (2000 rpm, 3 min, at room temperature), plated on TAP-agar with 10 μg/ml hygromycin or 10 μg/ml paromomycin, and cultured for 5–7 d under continuous light. Colonies were isolated into a 96-well plate and cultured for several days. The TTLL3 mutation was confirmed using the primer set TTLL3-15-F (GCGGAATGAGCGCGGAAACAGTCAC) and TTLL3-15-R (CGTCCACCGCACGTCCTGGAAGAAC); and the TTLL9 mutation was confirmed using the primer set TTLL9-2-F (GACATGTATTCCTCTCTCTCGTGAC) and TTLL9-2-R (TCCTTCAACTAAAAATGGTGAAGAC) to check for insertion mutations.

Measurements of flagellar length

To measure flagellar regeneration kinetics, cells were first deflagellated by adjusting the pH of the liquid culture to 4.5 using 0.5 M CH3COOH. This was followed by a brief exposure period of 20 s. Subsequently, the pH was neutralized to 7.4 with 0.5 M KOH to facilitate a 180-min incubation period. At 15-min intervals, aliquots of the cells were collected and fixed by adding glutaraldehyde to achieve a final concentration of 0.3%.

To measure LiCl-induced flagellar elongation, 1 M Lithium Chloride (Nakalai Tesque) was added to the cell culture to obtain a final concentration of 25 mM. Aliquots of cells were collected every 30 min and fixed by 0.3% glutaraldehyde.

To measure NaPPi-induced flagellar shortening, 0.2 M Sodium Pyrophosphate (Sigma) was added to the cell culture to obtain a final concentration of 25 mM. Aliquots of cells were collected every 30 min and fixed by 0.3% glutaraldehyde.

For each flagellar length measurements, the fixed cells were concentrated through centrifugation at 2500 rpm for 1 min. Subsequently, ∼ 5 µl of the cells were embedded on a slide and observed under a microscope (BX53, Olympus) equipped with a 20 × UPlan FL N objective lens (Olympus). Images were captured using a CCD camera (ORCA-Flash4.0 V3 sCMOS, Hamamatsu). The images were analyzed by ImageJ, and the lengths of at least 50 flagella from individual cells were measured to obtain average length and SD.

Indirect immunofluorescence microscopy

Immunostaining of NFAps was carried out following Sanders and Salisbury (1995). Fully grown cells were suspended into 6 ml autolysin and gently agitated for 60 min to remove cell walls. The cells were washed with NB buffer (6.7 mM Tris-HCl [pH 7.2], 3.7 mM EGTA, 10 mM MgCl2, and 0.25 mM KCl) and placed on an eight well-slide glass (8-mm well; Matsunami) treated with polyethylenimine. The cells were demembranated by 1% Igepal CA-630 (Sigma) and subsequently fixed with 2% paraformaldehyde in NB buffer for 10 min. The cells were then treated with acetone at -20°C and methanol at -20°C for 5 min each. The cells were first treated with blocking buffer (1% bovine serum albumin and 3% Fish Skin gelatin in phosphate-buffered saline [PBS]) and incubated with primary antibodies (Supplemental Figure 3) followed by secondary antibodies (goat antirabbit IgG Alexa 488, 1:200, Invitrogen; goat antimouse IgG Alexa Fluor 594, 1:200, Invitrogen). The cells were treated with antifade mountant (SlowFade Diamond, Thermo Fisher Scientific) and encapsulated with a glass coverslip. The sample was examined with a microscope (BX53, Olympus) equipped with an objective lens (100 × UPlan FL N Oil objective, Olympus). Images were acquired with a CCD camera (ORCA-Flash4.0 sCMOS, Hamamatsu).

Isolation of axoneme

Cilia were isolated according to Witman et al. (1972) with some modifications. Briefly, fully grown cells were collected with centrifugation (3000 rpm, 5 min) and treated with 1 mM dibucaine-HCl (Wako) to amputate their cilia. Cilia were washed and collected by centrifugation (15,000 rpm, 20 min, 4°C). Isolated cilia were suspended into HMDEK buffer (30 mM HEPES, 5 mM MgSO4. 1 mM DTT, 0.1 mM EGTA, and 25 mM CH3COOK) and demembranated by 0.1% Igepal CA-630 (Sigma) to prepare axonemal samples. For the immunofluorescence microscopy of the axonemal microtubules, isolated axonemes were placed on eight-well slide glass and treated with 0.1 mM ATP (Sigma) and 0.5 μg/ml Type VII bacterial protease (Sigma) to induce splaying. Immunostaining of the splayed axonemes were processed as described in the “Indirect immunofluorescence microscopy” section.

Western blotting

Western blot analysis was conducted as described by Towbin et al. (1979) with minor adjustments. SDS-protein samples were electrophoretically separated using handmade SDS-polyacrylamide gels (7.5 or 9% polyacrylamide) and then transferred onto a PVDF membrane (Immobilon-P, pore size 0.45 μm; Merck-Millipore). The membrane was probed with primary antibodies (Supplemental Figure 3), followed by secondary antibodies: goat antimouse IgG (H+L; Invitrogen, Catalogue#31430) or goat antirabbit IgG (H+L; Invitrogen, Catalogue#31460). After Chemi-Lumi One Super treatment (Nakalai Tesque, #02230), the membrane was visualized using the Fusion Solo S system (Vilver Bio Imaging).

Generation of the anti-TTLL3 antibodies

Two types of peptide antibodies were custom-synthesized by Bio-Synthesis (www.biosyn.com/). Peptides of N-terminus region (DSTKVNDSGAKEKSWADRNK-Cys) and C-terminus region (Cys-GLRAKTSSPIRMRTPRLSS) of TTLL3 were synthesized. The peptides were conjugated to keyhole limpet hemocyanin (KLH) to enhance immunogenicity before being injected into rabbits. The immunization protocol followed a standard procedure provided by Bio-synthesis, consisting of an initial immunization followed by three to six booster injections. Serum was collected after the final booster, and antibody titers were assessed by enzyme-linked immunosorbent assay (ELISA) using the synthesized peptides as antigens. Antibodies were purified using affinity chromatography with the corresponding peptide sequences immobilized on the column. The antibodies were eluted from the column using 0.1 M glycine-HCl (pH 2.8) and then neutralized with Tris-HCl (pH 8.0) buffer. The buffer was subsequently replaced with PBS at pH 7.4 via dialysis, and NaN3 was added to a final concentration of 0.02%. The purified antibodies were then tested for specificity and sensitivity by Western blotting using cell lysates and flagellar proteins.

Assessment of motility

Swimming velocity was acquired by tracking images of the moving cells. Briefly, the cells under the dark-field microscope equipped with 40x objective were recorded using a digital camera with a frame rate of 30 fps, and the obtained movies were processed with ImageJ.

Microtubule sliding velocity during axonemal disintegration was measured as described previously (Kurimoto and Kamiya, 1991). Briefly, fragmented axonemes (∼5 μm in length) were placed in a perfusion chamber under a dark-field microscope. Microtubule sliding was induced by a solution containing 0.5 μg/ml Type VII bacterial protease (Sigma) and ATP (Sigma). This process was recorded using a × 100 objective, an oil-immersion dark-field condenser, a light source of a mercury lamp (Olympus, U-RLF-T), and a CCD camera with a frame rate of 30 fps (Olympus, M-3204C).

Supplementary Material

We greatly appreciate Ritsu Kamiya (Chuo University, Tokyo) for critically reading the manuscript. This work was supported by Takeda Science Foundation (to T.K. and T.O.), Institute for Fermentation, Osaka (to T.K.), The Kato Memorial Bioscience Foundation (to T.K.), Human Frontier Science Program (RGP0062023 [to T.O.]), and Japan Society for the Promotion of Science (23K05829 [to T.K.], and 22H05538 [to T.O.]).

Abbreviations used:

ATP adenosine triphosphate

CBB coomassie brilliant blue

CCP cytosolic carboxypeptidase

CRISPR clustered regularly interspaced short palindromic repeats

IFT intraflagellar transport

LiCl lithium chloride

N-DRC nexin-dynein regulatory complex

NaPPi sodium pyrophosphate

NFAp nuclear-flagellar apparatus

PTM posttranslational modification

TMCP tubulin metallocarboxypeptidase

TTLL tubulin tyrosine ligase-like

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E24-04-0154) on May 17, 2024.
==== Refs
REFERENCES

Ahmed NTGao CLucker BFCole DGMitchell DR (2008). ODA16 aids axonemal outer row dynein assembly through an interaction with the intraflagellar transport machinery. J Cell Biol 183 , 313–322.18852297
Alford LMStoddard DLi JHHunter ELTritschler DBower RNicastro DPorter MESale WS (2016). The nexin link and B-tubule glutamylation maintain the alignment of outer doublets in the ciliary axoneme. Cytoskeleton (Hoboken) 73 , 331–340.27105591
Bhogaraju SCajanek LFort CBlisnick TWeber KTaschner MMizuno NLamla SBastin PNigg EALorentzen E (2013). Molecular basis of tubulin transport within the cilium by IFT74 and IFT81. Science 341 , 1009–1012.23990561
Bosch Grau MGonzalez Curto GRocha CMagiera MMMarques Sousa PGiordano TSpassky NJanke C (2013). Tubulin glycylases and glutamylases have distinct functions in stabilization and motility of ependymal cilia. J Cell Biol 202 , 441–451.23897886
Bré MHRedeker VQuibell MDarmanaden-Delorme JBressac CCosson JHuitorel PSchmitter JMRossler JJohnson T, et al. (1996). Axonemal tubulin polyglycylation probed with two monoclonal antibodies: widespread evolutionary distribution, appearance during spermatozoan maturation and possible function in motility. J Cell Sci 109 , 727–738.8718664
Bré MHRedeker VVinh JRossier JLevilliers N (1998). Tubulin polyglycylation: differential posttranslational modification of dynamic cytoplasmic and stable axonemal microtubules in paramecium. Mol Biol Cell 9 , 2655–2665.9725918
Brown JMCochran DACraige BKubo TWitman GB (2015). Assembly of IFT trains at the ciliary base depends on IFT74. Curr Biol 25 , 1583–1593.26051893
Eddé BRossier JLe Caer JPDesbruyères EGros FDenoulet P (1990). Posttranslational glutamylation of alpha-tubulin. Science 247 , 83–85.1967194
Gadadhar SViar GAHansen JNGong AKostarev AIaly-Radio CLeboucher SWhitfield MZiyyat ATouré A, et al. (2021). Tubulin glycylation controls axonemal dynein activity, flagellar beat, and male fertility. Science 371 , eabd4914.33414192
Gadadhar SDadi HBodakuntla SSchnitzler ABièche IRusconi FJanke C (2017). Tubulin glycylation controls primary cilia length. J Cell Biol 216 , 2701–2713.28687664
Garnham CPYu ILi YRoll-Mecak A (2017). Crystal structure of tubulin tyrosine ligase-like 3 reveals essential architectural elements unique to tubulin monoglycylases. Proc Natl Acad Sci USA 114 , 6545–6550.28576883
Gorman DSLevine RP (1965). Cytochrome f and plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardi. Proc Natl Acad Sci USA 54 , 1665–1669.4379719
Hou YQin HFollit JAPazour GJRosenbaum JLWitman GB (2007). Functional analysis of an individual IFT protein: IFT46 is required for transport of outer dynein arms into flagella. J Cell Biol 176 , 653–665.17312020
Huang BRifkin MRLuck DJ (1977). Temperature-sensitive mutations affecting flagellar assembly and function in Chlamydomonas reinhardtii . J Cell Biol 72 , 67–85.830657
Ikegami KSato SNakamura KOstrowski LESetou M (2010). Tubulin polyglutamylation is essential for airway ciliary function through the regulation of beating asymmetry. Proc Natl Acad Sci USA 107 , 10490–10495.20498047
Ikegami KSetou M (2009). TTLL10 can perform tubulin glycylation when co-expressed with TTLL8. FEBS Lett 583 , 1957–1963.19427864
Janke CBulinski JC (2011). Post-translational regulation of the microtubule cytoskeleton: Mechanisms and functions. Nat Rev Mol Cell Biol 12 , 773–786.22086369
Janke CRogowski KWloga DRegnard CKajava AVStrub JMTemurak Nvan Dijk JBoucher Dvan Dorsselaer A, et al. (2005). Tubulin polyglutamylase enzymes are members of the TTL domain protein family. Science 308 , 1758–1762.15890843
Kamiya R (1982). Extrusion and Rotation of the central-pair microtubules in detergent-treated Chlamydomonas flagella. Prog Clin Biol Res 80 , 169–173.7100176
Kamiya R (2002). Functional diversity of axonemal dyneins as studied in Chlamydomonas mutants. Int Rev Cytol, 219 , 115–155.12211628
Konno AIkegami KKonishi YYang HJAbe MYamazaki MSakimura KYao IShiba KInaba KSetou M (2016). Ttll9–/– mice sperm flagella show shortening of doublet 7, reduction of doublet 5 polyglutamylation and a stall in beating. J Cell Sci 129 , 2757–2766.27257088
Kozminski KGBeech PLRosenbaum JL (1995). The Chlamydomonas kinesin-like protein FLA10 is involved in motility associated with the flagellar membrane. J Cell Biol 131 , 1517–1527.8522608
Kubo TBrown JMBellve KCraige BCraft JMFogarty KLechtreck KFWitman GB (2016). Together, the IFT81 and IFT74 N-termini form the main module for intraflagellar transport of tubulin. J Cell Sci 129 , 2106–2119.27068536
Kubo TOda T (2017). Electrostatic interaction between polyglutamylated tubulin and the nexin-dynein regulatory complex regulates flagellar motility. Mol Biol Cell 28 , 2260–2266.28637765
Kubo TTani YYanagisawa HAKikkawa MOda T (2023). α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci 136 , jcs261070.37519241
Kubo TYagi TKamiya R (2012). Tubulin polyglutamylation regulates flagellar motility by controlling a specific inner-arm dynein that interacts with the dynein regulatory complex. Cytoskeleton (Hoboken) 69 , 1059–1068.23047862
Kubo TYanagisawa HALiu ZShibuya RHirono MKamiya R (2014). A conserved flagella-associated protein in Chlamydomonas, FAP234, is essential for axonemal localization of tubulin polyglutamylase TTLL9. Mol Biol Cell 25 , 107–117.24196831
Kubo TYanagisawa HAYagi THirono MKamiya R (2010). Tubulin polyglutamylation regulates axonemal motility by modulating activities of inner-arm dyneins. Curr Biol 20 , 441–445.20188560
Kurimoto EKamiya R (1991). Microtubule sliding in flagellar axonemes of Chlamydomonas mutants missing inner- or outer-arm dynein: velocity measurements on new types of mutants by an improved method. Cell Motil Cytoskeleton 19 , 275–281.1834352
Mary JRedeker VLe Caer JPRossier JSchmitter JM (1996). Posttranslational modifications in the C-terminal tail of axonemal tubulin from sea urchin sperm. J Biol Chem 271 , 9928–9933.8626629
Multigner LPignot-Paintrand ISaoudi YJob DPlessmann URüdiger MWeber K (1996). The A and B tubules of the outer doublets of sea urchin sperm axonemes are composed of different tubulin variants. Biochemistry 35 , 10862–10871.8718878
Nicot SGillard GImpheng HJoachimiak EUrbach SMochizuki KWloga DJuge FRogowski K (2023). A family of carboxypeptidases catalyzing alpha- and beta-tubulin tail processing and deglutamylation. Sci Adv 9 , eadi7838.37703372
Orbach RHoward J (2019). The dynamic and structural properties of axonemal tubulins support the high length stability of cilia. Nat Commun 10 , 1838.31015426
Plessmann UWeber K (1997). Mammalian sperm tubulin: an exceptionally large number of variants based on several posttranslational modifications. J Protein Chem 16 , 385–390.9246618
Redeker VLevilliers NSchmitter JMLe Caer JPRossier JAdoutte ABré MH (1994). Polyglycylation of tubulin: A posttranslational modification in axonemal microtubules. Science 266 , 1688–1691.7992051
Redeker VLevilliers NVinolo ERossier JJaillard DBurnette DGaertig JBré MH (2005). Mutations of tubulin glycylation sites reveal cross-talk between the C termini of alpha- and beta-tubulin and affect the ciliary matrix in Tetrahymena. J Biol Chem 280 , 596–606.15492004
Rogowski KJuge Fvan Dijk JWloga DStrub JMLevilliers NThomas DBré MHVan Dorsselaer AGaertig JJanke C (2009). Evolutionary divergence of enzymatic mechanisms for posttranslational polyglycylation. Cell 137 , 1076–1087.19524510
Rogowski Kvan Dijk JMagiera MMBosc CDeloulme JCBosson APeris LGold NDLacroix BBosch Grau M, et al. (2010). A family of protein-deglutamylating enzymes associated with neurodegeneration. Cell 143 , 564–578.21074048
Sanders MASalisbury JL (1995). Immunofluorescence microscopy of cilia and flagella. Methods Cell Biol 47 , 163–169.7476482
Starling DRandall J (1971). The flagella of temporary dikaryons of Chlamydomonas reinhartii. Genetical Research, Cambridge 18 , 107–113.
Suryavanshi SEddé BFox LAGuerrero SHard RHennessey TKabi AMalison DPennock DSale WS, et al. (2010). Tubulin glutamylation regulates ciliary motility by altering inner dynein arm activity. Curr Biol 20 , 435–440.20189389
Towbin HStaehelin TGordon J (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Biotechnology 24 , 145–149.
van Dijk JRogowski KMiro JLacroix BEddé BJanke C (2007). A targeted multienzyme mechanism for selective microtubule polyglutamylation. Mol Cell 26 , 437–448.17499049
Viar GAKlena NMartino FNievergelt APigino G (2023). The Tubulin Nano-Code: A protofilament-specific pattern of tubulin post-translational modifications regulates ciliary beating mechanics. bioRxiv 10.1101/2023.06.28.546853.
Westermann SWeber K (2003). Post-translational modifications regulate microtubule function. Nat Rev Mol Cell Biol 4 , 938–947.14685172
Witman GBCarlson KBerliner JRosenbaum JL (1972). Chlamydomonas flagella. I. Isolation and electrophoretic analysis of microtubules, matrix, membranes, and mastigonemes. J Cell Biol 54 , 507–539.4558009
Wloga DWebster DMRogowski KBré MHLevilliers NJerka-Dziadosz MJanke CDougan STGaertig J (2009). TTLL3 Is a tubulin glycine ligase that regulates the assembly of cilia. Dev Cell 16 , 867–876.19531357
Xia LHai BGao YBurnette DThazhath RDuan JBré MHLevilliers NGorovsky MAGaertig J (2000). Polyglycylation of tubulin is essential and affects cell motility and division in Tetrahymena thermophila. J Cell Biol 149 , 1097–1106.10831613
