
==== Front
J Diabetes Res
J Diabetes Res
JDR
Journal of Diabetes Research
2314-6745
2314-6753
Hindawi

10.1155/2021/7765623
Research Article
Combination of GLP-1 Receptor Activation and Glucagon Blockage Promotes Pancreatic β-Cell Regeneration In Situ in Type 1 Diabetic Mice
Gu Liangbiao
Wang Dandan
Cui Xiaona
Wei Tianjiao
Yang Kun
Yang Jin
https://orcid.org/0000-0002-8838-703X
Wei Rui weirui@bjmu.edu.cn

Hong Tianpei
Department of Endocrinology and Metabolism, Peking University Third Hospital, Beijing 100191, China
Academic Editor: Ruozhi Zhao

2021
25 11 2021
2021 77656236 8 2021
1 10 2021
23 10 2021
Copyright © 2021 Liangbiao Gu et al.
2021
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Pancreatic β-cell neogenesis in vivo holds great promise for cell replacement therapy in diabetic patients, and discovering the relevant clinical therapeutic strategies would push it forward to clinical application. Liraglutide, a widely used antidiabetic glucagon-like peptide-1 (GLP-1) analog, has displayed diverse β-cell-protective effects in type 2 diabetic animals. Glucagon receptor (GCGR) monoclonal antibody (mAb), a preclinical agent that blocks glucagon pathway, can promote the recovery of functional β-cell mass in type 1 diabetic mice. Here, we conducted a 4-week treatment of the two drugs alone or in combination in type 1 diabetic mice. Although liraglutide neither lowered the blood glucose level nor increased the plasma insulin level, the immunostaining showed that liraglutide expanded β-cell mass through self-replication, differentiation from precursor cells, and transdifferentiation from pancreatic α cells to β-cells. The pancreatic β-cell mass increased more significantly after GCGR mAb treatment, while the combination group did not further increase the pancreatic β-cell area. However, compared with the GCGR mAb group, the combined treatment reduced the plasma glucagon level and increased the proportion of β-cells/α-cells. Our study evaluated the effects of liraglutide, GCGR mAb monotherapy, and combined strategy in glucose control and islet β-cell regeneration and provided useful clues for the future clinical application in type 1 diabetes.

China Postdoctoral Science Foundation2019M660369 Natural Science Foundation of Beijing Municipality7192225 National Natural Science Foundation of China81970671 81770768 81830022
==== Body
pmc1. Introduction

Pancreatic β-cell dysfunction and cell mass loss are a pivotal pathogenesis in both type 1 diabetes (T1D) and type 2 diabetes (T2D) [1, 2]. Therefore, it is highly necessary to preserve β-cell function and expand β-cell mass for diabetes treatment. Glucagon-like peptide-1- (GLP-1-) based therapies, including GLP-1 receptor agonists and dipeptidyl peptidase-4 inhibitors, have several beneficial effects on pancreatic β-cells, including upregulating insulin gene transcription and biosynthesis, potentiating glucose-stimulated insulin secretion, and promoting β-cell regeneration by promoting β-cell proliferation, inhibiting β-cell apoptosis, and inducing stem cells to differentiate into β-cells [3, 4]. Recent researches have proven that GLP-1 overexpression or GLP-1 receptor agonists promoted β-cell regeneration via α- to β-cell transdifferentiation [5–7]. Although GLP-1-based therapy shows various beneficial effects in T2D animals and humans, these drugs cannot be used alone for T1D treatment [8]. Whether GLP-1-based therapy has similar effects on β-cell protection, especially for β-cell regeneration in T1D, needs to be determined, and which therapy should be combined with GLP-1 should be evaluated.

REMD2.59, a fully competitive antagonistic glucagon receptor (GCGR) monoclonal antibody (mAb), has a strong hypoglycemic effect in T1D and T2D rodents and nonhuman primates [9–11]. A randomized clinical trial showed that REMD477, another GCGR mAb that has an affinity for the GCGR equivalent to that of REMD2.59, improved glycemic control in patients with T1D without serious adverse effects [12]. Our previous findings suggested that treatment with the GCGR mAb increased the β-cell mass by promoting α- to β-cell conversion [13]. However, GCGR mAb substantially increased pancreatic α-cell mass and plasma glucagon levels. Notably, GLP-1 receptor agonists have the ability of inhibiting glucagon secretion. When combined with GCGR mAb, the GLP-1 receptor may avoid hyperglucagonemia.

In this study, we investigated the possible effect of liraglutide, a commonly used GLP-1 receptor agonist, on β-cell regeneration in T1D mice, and evaluated the combined effect of liraglutide with GCGR mAb. Our study provides new clues for the clinical therapy to maintain glucose homeostasis and promote pancreatic β-cell neogenesis in T1D patients.

2. Materials and Methods

2.1. Animals and Intervention

All the animal experiments were conducted at Peking University Health Science Center (Beijing, China) and approved by the Institutional Animal Care and Use Committee. B6.Cg-Tg(Gcg-cre)1Herr/Mmnc (cre expression in pancreatic α-cell lineage) and B6.Rosa26-LSL-Cas9-tdTomato/J (when crossed to a cre recombinase-expressing strain, red fluorescence protein (RFP) expression is observed in the cre-expressing tissues) mice were crossed to generate pancreatic α-cell lineage-tracing mice, namely, glucagonCre-RFP mice. Eight-week-old male glucagonCre-RFP mice or C57BL/6J mice (Vital River Animal Center, Beijing, China) were injected intraperitoneally with streptozotocin (STZ, 150 mg/kg; Sigma-Aldrich, Saint Louis, MO) in citric acid buffer (0.1 mol/L, pH 4.2) to establish a T1D model. The diabetic condition was confirmed if fasting blood glucose was 11.1 mmol/L or the random blood glucose was 16.7 mmol/L at least twice. If the blood glucose level was higher than 33.3 mmol/L (the upper detection limit of the blood glucose meter), 33.3 mmol/L was recorded. The diabetic C57BL/6J animals were treated for four weeks by intraperitoneal administration of liraglutide (0.2 mg/kg, twice daily; Novo Nordish, Denmark), REMD2.59 (a human GCGR mAb, 5 mg/kg, once a week; REMD Biotherapeutics, Camarillo, CA, USA), a combination of two agents, or saline (as control). There were 6-8 mice in each group. The diabetic glucagonCre-RFP mice were treated for four weeks by intraperitoneal administration of liraglutide or saline. Mice were fasted 8 h for the measurement of fasting blood glucose by the glucose oxidase method. After the four-week treatment, the mice were sacrificed, and then, plasma and pancreas were collected. Specific ELISA kits were used for detecting insulin (Millipore, Saint Charles, MO, USA) and glucagon (R&D System, Minneapolis, MN, USA) according to the manufacturer's instructions.

2.2. Immunofluorescence Staining

Pancreases were fixed with 10% formalin at 4°C overnight and embedded in paraffin, and 5 μm thick sections were prepared. The sections were incubated with primary antibodies at 4°C overnight and secondary antibodies for 1 h at room temperature, followed by washing and staining with DAPI (1 μg/mL, Sigma-Aldrich). Images were captured under a confocal fluorescence microscope (Leica TCS SP8; Leica Microsystems Inc., Wetzlar, Germany) or an automatic digital slide scanner (Panoramic MIDI, 3D HISTECH, Budapest, Hungary). For cell quantification, 6 to 9 equally spaced sections (which covered the entire pancreas) per pancreas were imaged, and the total numbers of positive staining cells from 6 mice per group were counted by using ImageJ software.

The following antibodies and dilutions were used: rabbit antiglucagon (1 : 800, Cell Signaling Technology, Beverly, MA), mouse antiglucagon (1 : 400, Sigma-Aldrich), mouse anti-insulin (1 : 800, Sigma-Aldrich), guinea pig anti-insulin (1 : 200, Abcam), mouse antiproliferating cell nuclear antigen (PCNA; 1 : 400, Cell Signaling Technology), rabbit anticytokeratin 19 (CK19; 1 : 400, Abcam), rabbit polyclonal antipancreatic and duodenal homeobox 1 (Pdx1, 1 : 200, Abcam), rabbit monoclonal anti-NK6 homeobox 1 (Nkx6.1, 1 : 400 , Abcam), rabbit polyclonal antiproprotein convertase 1/3 (PC1/3, 1 : 400, Millipore), rabbit polyclonal anti-RFP (1 : 200; Abcam), Alexa Fluor 594-conjugated AffiniPure goat antimouse IgG (H+L) (1 : 800, Jackson ImmunoResearch Laboratories, West Grove, PA), Alexa Fluor 488 or 594-conjugated AffiniPure goat antirabbit IgG (H+L) (1 : 800, Jackson ImmunoResearch Laboratories), and Alexa Fluor 647-conjugated AffiniPure goat antiguinea pig IgG (H+L) (1 : 800, Jackson ImmunoResearch Laboratories).

2.3. Primary Islets and Islet Cell Line Experiments

Primary islets were isolated from C57BL/6J mice as previously reported [14, 15]. Briefly, the pancreas was perfused by collagenase V (Sigma-Aldrich), and individual islets were handpicked and cultured in the RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA), 2 mmol/L GlutMax, 1 mmol/L sodium pyruvate, and 1% penicillin-streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). Mouse pancreatic α-cell line αTC1 clone 7 (αTC1.9) cells (ATCC, USA) were cultured in Dulbecco's modified Eagle medium (5.5 mmol/L glucose; Invitrogen) supplemented with 10% fetal bovine serum, 15 mmol/L HEPES, 0.1 mmol/L nonessential amino acids, 0.02% bovine serum albumin, 2 mmol/L GlutMax, and 1% penicillin-streptomycin. Primary islets or αTC1.9 cells were treated with GCGR mAb (100 nmol/L) or IgG for 24 h, and RNA was collected for further analysis.

2.4. Quantitative RT-PCR

Total RNA was extracted with TRIzol reagent (Thermo Fisher Scientific) and reversely transcribed to cDNA using a RevertAid First Strand cDNA Synthesis kit (Fermentas, Vilnius, Lithuania). The quantitative RT-PCR was performed using iQ SYBR Green supermix (BioRad Laboratories, Hercules, CA, USA) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). All experiments were performed in triplicate. Relative quantification for gene expression was calculated using the 2−ΔΔCT method. The primers were synthesized by the Beijing AuGCT DNA-SYN Biotechnology Company (Beijing, China). The primer sequences were as follows: Glp-1r: forward: AGCACTGTCCGTCTTCATCA, reverse: AGAAGGCCAGCAGTGTGTAT; Gapdh: forward: TGCACCACCACCAACTGCTTAGC, reverse: GGCATGGACTGTGGTCATGAG.

2.5. Statistical Analysis

Data are expressed as the mean ± S.E.M. The difference between two groups was analyzed by ANOVA followed by the post hoc Tukey-Kramer test or Student's t-test (two-tailed) when appropriate. A p value < 0.05 was considered statistically significant. Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA).

3. Results

3.1. Liraglutide and GCGR mAb Treatments Improve Diabetic Phenotype in T1D Mice

Compared with the normal control group, the body weight of the T1D mice displayed a significant decrease while the blood glucose level showed obvious increment (Figures 1(a)–1(c)). Neither liraglutide nor GCGR mAb had any effects on the body weights (Figure 1(a)). Liraglutide alone did not decrease the random blood glucose (Figure 1(b)), while displaying a trend to lower fasting blood glucose (p = 0.17, Figure 1(c)). The GCGR mAb significantly reduced the random and fasting blood glucose levels (Figures 1(b) and 1(c)). However, the combination of GCGR mAb and liraglutide (mAb+Lira) did not decrease the blood glucose levels further compared to the GCGR mAb group (Figures 1(b) and 1(c)).

After STZ treatment, the plasma insulin level was significantly lower, and the plasma glucagon level was higher in the STZ group than in the control group. Liraglutide did not affect the insulin level or glucagon level (Figures 1(d) and 1(e)). The GCGR mAb treatment significantly upregulated the plasma insulin level and glucagon level when compared with vehicle treatment in T1D mice (Figures 1(d) and 1(e)). The mAb+Lira combination also significantly upregulated the plasma insulin level when compared with the STZ group, but did not show any difference when compared with mAb treatment alone (Figure 1(d)). Notably, although the glucagon level in the combination group was higher than that in the STZ group, it was significantly lower when compared with that in the GCGR mAb group (Figure 1(d)).

3.2. Liraglutide and GCGR mAb Treatments Increase Pancreatic β-Cell Area of T1D Mice in Varying Degrees

Histological analysis of the pancreatic islets was carried out by using double-labeled immunofluorescence staining. STZ significantly decreased the entire islet area, with the level less than 1/3 of the normal control (Figures 2(a)–2(c), Table S1). STZ strikingly decreased β-cell area and increased α-cell mass compared with the normal control (Figures 2(d) and 2(e), Table S1). Liraglutide treatment did not change the total islet area and α-cell area, but liraglutide increased the β-cell area, thus having a tendency to increase the β/α-cell area proportion when compared with the STZ group (Figures 2(b)–2(f), Table S1). GCGR mAb treatment increased the total islet area, β-cell area, α-cell area, and β/α-cell area proportion when compared with the STZ group (Figures 2(c)–2(f), Table S1). Similarly, the mAb+Lira combination also greatly increased the total islet area and β-cell area when compared with the STZ group (Figures 2(c) and 2(d), Table S1), but showed no difference with the mAb group. The mAb+Lira combination increased the α-cell area when compared with the STZ group, while decreasing the α-cell area when compared with the mAb group (Figure 2(e), Table S1). Therefore, the mAb+Lira combination increased the β/α-cell area proportion significantly when compared with the STZ or mAb group (Figure 2(f), Table S1).

3.3. Liraglutide and GCGR mAb Treatments Promote β-Cell Self-Replication in T1D Mice

As shown above, both liraglutide and GCGR mAb increased the β-cell area. Subsequently, we tried to determine the source of the increased islet cells. We performed costaining of insulin and PCNA in pancreatic sections to detect β-cell proliferation. We found that the proportions of PCNA+insulin+ cells (the proliferating β-cells) were higher in the liraglutide group and the mAb+Lira group when compared to the STZ group, while the proportion in the GCGR mAb group did not show differences with that in other groups (Figures 3(a) and 3(d), Table S1).

3.4. Liraglutide Induces Duct-Derived β-Cell Neogenesis in T1D Mice

Neogenesis from precursor cells is an important approach for the recovery of β-cell mass. Pancreatic precursor cells were often located near or within the adult pancreatic ducts [16]. Our previous study has proved that GCGR mAb could induce pancreatic duct-derived α-cell neogenesis, rather than β-cell neogenesis, in T1D mice [13]. In this study, we costained insulin or glucagon with pancreatic duct marker CK19 to evaluate the cell neogenesis. Results showed that in the liraglutide group or mAb+Lira group, glucagon-positive cells or insulin-positive cells could appear adjacent to CK19+ cells, suggestive of duct-derived α-cell or β-cell neogenesis (Figures 3(b) and 3(c)). However, the glucagon or insulin-positive cells that were located in the duct were rare, so we did not perform quantification further.

3.5. Liraglutide and GCGR mAb Treatments Induce α- to β-Cell Transdifferentiation in T1D Mice

To evaluate α- to β-cell transdifferentiation, we performed glucagon and insulin double immunostaining. Compared with the STZ group, the proportion of glucagon+insulin+ cells were boosted by the liraglutide treatment (p = 0.031, Figures 4(a) and 4(c), Table S1). Next, we established pancreatic α-cell lineage-tracing (glucagonCre-RFP) mice. About 80% of glucagon-positive cells were RFP positive, suggestive of the high tracing efficiency, and there was almost no RFP+glucagon− cells in the nondiabetic tracing mice, suggestive of no leakage of tracing (Figure S1). Therefore, RFP could be a good tracing marker of α-cells. After liraglutide treatment, the proportion of RFP+insulin+ cells was significantly higher than that in the STZ group (p < 0.01, Figures 4(b) and 4(d)). Notably, we not only found glucagon+RFP+insulin+ cells but also found glucagon−RFP+insulin+ cells; the latter suggested that the transformed β-cells lost glucagon expression (Figure S2). All the above results confirmed that some newborn β-cells were derived from the transdifferentiation of pancreatic α-cells.

GCGR mAb could promote α- to β-cell transdifferentiation, as indicated by the increased proportion of glucagon+insulin+ cells (p < 0.01), which was consistent with our previous report [13]. Notably, the proportion of glucagon+insulin+ cells in the mAb+Lira combination group was even higher than that in the liraglutide group (p = 0.038, Figure 4(c)).

3.6. The Regenerated β-Cells Own the Maturity Phenotype

To further investigate the identity of the neogenerated insulin-expressing cells above, thorough marker gene analyses were performed in all treated animals. Our data indicated that all insulin+ cells (including preexisting and neogenerated) uniformly expressed the bona fide β-cell labels, such as Pdx1, Nkx6.1, and PC1/3 (Figure 5). These analyses led us to conclude that the hyperplastic insulin-expressing cells observed after liraglutide or GCGR mAb treatment owned a β-like cell phenotype.

3.7. GCGR mAb Treatment Upregulates GLP-1 Receptor Expression

GLP-1 plays diversified effects mainly through the GLP-1 receptor [17]. To explore the potential mechanism of GCGR mAb synergistically promoting α- to β-cell conversion induced by liraglutide, we analyzed the levels of the GLP-1 receptor. In mouse primary islets and α-cell line αTC1.9, glucagon blockage by GCGR mAb upregulated the mRNA levels of the GLP-1 receptor (Figure 6).

4. Discussion

Our results demonstrated that the GLP-1 receptor agonist liraglutide increased pancreatic β-cell mass in T1D mice through self-replication, differentiation from precursor cells, and transdifferentiation of pancreatic α- to β-cells. Although combination of liraglutide and GCGR mAb did not demonstrate remarkable synergistic effects on the glucose level and β-cell area, the stimulating effects of GCGR mAb on the α-cell area and glucagon secretion were alleviated. Interestingly, transdifferentiation of pancreatic α- to β-cells was also boosted in the combination group. Increased GLP-1 receptor expression might be the possible reason of the synergetic effects of the two drugs. The combination strategy of the GLP-1 receptor activation with glucagon blockage may be beneficial in the T1D context, with good glucose control, β-cell regeneration, and not-very-high glucagon levels.

The current therapy for T1D is limited, and it is highly needed to evaluate the new nontraditional therapy for glucose control and maybe even for β-cell regeneration in T1D [18, 19]. GLP-1 receptor agonists have various beneficial effects on pancreatic β-cells, including promoting β-cell regeneration [20, 21]. However, most of the conclusions were obtained in T2D models. Our present study showed that a GLP-1 receptor agonist liraglutide increased pancreatic β-cell area in STZ-induced T1D mice. Moreover, we found that liraglutide not only promoted the proliferation of existing pancreatic β-cell and induced cells in the duct lining to transform into pancreatic islet cells, but also boosted α-cells to transdifferentiate into insulin-positive cells. In this way, we confirmed that all above sources participated in the liraglutide-induced β-cell renewal. However, liraglutide could not decrease blood glucose in T1D mice. The GLP-1-based therapy cannot be used alone for T1D treatment, and the combination with other drugs is needed.

Our previous study, together with others, has proven that GCGR blockage could decrease blood glucose and improve the phenotype of T1D mice. Strikingly, GCGR mAb increased the number of pancreatic β-cells and upregulated circulating insulin levels by inducing α- to β-cell transdifferentiation in T1D mice [13, 22]. However, GCGR mAb substantially increased pancreatic α-cell mass, which brings a safety concern on the α-cell tumor [23]. Notably, GLP-1 receptor agonists have the ability of inhibiting glucagon secretion and inducing α- to β-cell transdifferentiation. In this study, we tried to evaluate the synergistic effect of GCGR mAb and liraglutide in T1D mice. Although the combination did not show obvious advantages in decreasing blood glucose or increasing β-cell mass, the plasma glucagon level in the combination group decreased significantly and the α-cell area showed a downward trend, and notably, the α- to β-cell transdifferentiation was enhanced. Glucagon blockage by GCGR mAb could upregulate GLP-1 receptor expression, which might be the possible reason of the synergetic effects of GCGR mAb and liraglutide.

However, there were some limitations in our research. First, the immunostaining of PCNA with insulin, CK19 with insulin, and glucagon with insulin only displayed the proliferating, neogenetic, and transdifferentiated insulin-positive cells at a time point (before sacrifice). Although the low proportion at a real-time state might not contribute to the increased beta cell mass, the increased beta cells could be much more during the whole treatment period. Because we did evaluate the neogenetic cell proportion during the whole treatment period, so we could not conclude which source contributed most to the regenerated beta cells. Second, precursor-specific lineage tracing mice were needed for verification of stem cell-derived β-cells. Third, we only found that the mRNA expression of the GLP-1 receptor was upregulated by GCGR mAb, and its effects on the combination and other underlying molecular mechanisms need to be further confirmed.

In summary, our present study evaluated the synergic effect of GLP-1 receptor activation and GCGR antagonism in T1D mice. Although we did not find better glucose control and β-cell regeneration, we discovered that combination of liraglutide with GCGR mAb could promote α- to β-cell transdifferentiation, thus attenuating the GCGR mAb-induced α-cell hyperplasia and hyperglucagonemia. Our research may provide useful clues for the clinical therapy in T1D.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (81830022, 81770768, 81970671), the Natural Science Foundation of Beijing (7192225), and the China Postdoctoral Science Foundation (2019M660369). We thank Hai Yan (REMD Biotherapeutics, Camarillo, CA, USA) for the kind gift of REMD2.59.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

None of the authors of this paper has any financial or personal relationships with other people or organizations that could influence (bias) the research results. No conflicts of interest exist for the authors of this study.

Authors' Contributions

L.G. and R.W. designed the research; L.G., T.W., and X.C. performed the research; J.Y., K.Y., and R.W. analyzed the data; L.G. and D.W. wrote the manuscript; and J.Y., R.W., and T.H. revised the paper.

Supplementary Materials

Supplementary Materials Figure S1: the efficiency of lineage-tracing. B6.Cg-Tg(Gcg-cre)1Herr/Mmnc and B6.Rosa26-LSL-Cas9-tdTomato/J mice were crossed to generate pancreatic α-cell lineage-tracing mice. Pancreas from eight-week-old mice was coimmunostained of glucagon and RFP. Figure S2: pancreatic histological analysis of α-to β-cell transdifferentiation in α-cell lineage-tracing T1D mice treated with liraglutide for four weeks. The arrowhead in the upper lane shows glucagon, RFP (the tracing marker of α-cells), and insulin colocalization. The arrowhead in the lower lane shows RFP and insulin colocalization with glucagon loss. Scale bar = 10 μm. Table S1: quantification of plasma hormone and immunostaining in the pancreas.

Figure 1 Body weight, blood glucose, plasma insulin, and glucagon levels in T1D and control mice treated with liraglutide, GCGR mAb, or both for four weeks. Eight-week-old male C57BL/6J mice were injected intraperitoneally with 150 mg/kg streptozotocin (STZ) to establish a T1D model. Diabetic mice were treated with liraglutide (Lira, 200 μg/kg), GCGR mAb (5 mg/kg), or liraglutide combined with GCGR mAb. The littermate C57BL/6J mice were used as normal control: (a) body weight; (b) random blood glucose; (c) fasting blood glucose; (d) plasma glucagon; (e) plasma insulin. Data are presented as the mean ± SEM (n = 6–8 mice per group). Statistical analysis was conducted by ANOVA. ∗p < 0.05 vs. control group; #p < 0.05 vs. STZ group; △p < 0.05 vs. GCGR mAb group.

Figure 2 Pancreatic histological analysis of pancreatic α-cell and β-cell mass in T1D and control mice treated with liraglutide, GCGR mAb, or both for four weeks. (a) Representative images of islets immunostained for glucagon and insulin. Scale bar = 50 μm. (b) Representative images of islets immunostained for DAPI, glucagon and insulin in panoramic view. Scale bar = 2000 μm. (c–f) Total islet area, α-cell area, β-cell area per pancreatic slice, and the ratio of β-cell area to α-cell area. n = 6 − 9 sections/mouse multiplied by 6 mice/group. Data are expressed as the mean ± SEM. Statistical analysis was conducted by ANOVA. ∗p < 0.05 vs. control group; #p < 0.05 vs. STZ group; △p < 0.05 vs. GCGR mAb group.

Figure 3 Pancreatic histological analysis of cell proliferation and ductal cell transformation in T1D mice treated with liraglutide, GCGR mAb, or both for four weeks. (a) Representative images of coimmunostaining with insulin and PCNA (proliferating cell nuclear antigen). Scale bar = 50 μm. (b, c) Representative images of coimmunostaining CK19 (cytokeratin 19) with glucagon or insulin. Scale bar = 50 μm. (d) Quantification of the proliferating β-cells. n = 6 − 8 sections/mouse multiplied by 6 mice/group. Data are expressed as the mean ± SEM. Statistical analysis was conducted by ANOVA. #p < 0.05 vs. STZ group. Magnified views of box regions are shown in the upper-right panels.

Figure 4 Pancreatic histological analysis of α- to β-cell transdifferentiation in T1D mice treated with liraglutide, GCGR mAb, or both for four weeks. (a) Representative images of insulin and glucagon colocalization. Scale bar = 50 μm. (b) Representative images of insulin and tracing marker, red fluorescence protein (RFP), and colocalization in pancreatic α-cell tracing T1D mice. (c) Quantification of the glucagon+insulin+ cells. Scale bar = 50 μm. (d) Quantification of the RFP+insulin+ cells. Data are expressed as the mean ± SEM. n = 6 − 9 sections/mouse multiplied by 6 mice/group. Statistical analysis was conducted by ANOVA or Student's t-test when appropriate. #p < 0.05 vs. STZ group; §p < 0.05 vs. liraglutide group. Magnified views of box regions are shown in the upper-right panels.

Figure 5 Pancreatic histological analysis of β-cell phenotype in T1D mice treated with liraglutide, GCGR mAb, or both for four weeks. (a) Representative images of insulin and Pdx1 (pancreatic and duodenal homeobox 1) colocalization. (b) Representative images of insulin and Nkx6.1 (NK6 homeobox 1) colocalization. (c) Representative images of insulin and PC1/3 (proprotein convertase 1/3), colocalization. Scale bar = 50 μm.

Figure 6 GLP-1 receptor expression induced by GCGR mAb treatment. The primary islets (a) and α-cell line αTC1.9 cells (b) were treated with GCGR mAb or IgG (as control) for 24 h, and GLP-1 receptor mRNA levels were determined by real-time RT-PCR. Statistical analysis was conducted by Student's t-test. ∗p < 0.05 vs. control group.
==== Refs
1 Eizirik D. L. Pasquali L. Cnop M. Pancreatic β-cells in type 1 and type 2 diabetes mellitus: different pathways to failure Nature Reviews. Endocrinology 2020 16 7 349 362 10.1038/s41574-020-0355-7 32398822
2 Weir G. C. Gaglia J. Bonner-Weir S. Inadequate β-cell mass is essential for the pathogenesis of type 2 diabetes The Lancet Diabetes and Endocrinology 2020 8 3 249 256 10.1016/S2213-8587(20)30022-X 32006519
3 Müller T. D. Finan B. Bloom S. R. Glucagon-like peptide 1 (GLP-1) Molecular Metabolism 2019 30 72 130 10.1016/j.molmet.2019.09.010 2-s2.0-85073166351 31767182
4 Wei R. Hong T. P. Glucagon-like peptide-1 promotes α-to-β cell transdifferentiation: how far is it from clinical application? Diabetes & Metabolism 2019 45 6 601 602 10.1016/j.diabet.2019.01.003 30660762
5 Lee Y. S. Lee C. Choung J. S. Jung H. S. Jun H. S. Glucagon-like peptide 1 increases β-cell regeneration by promoting α- to β-cell transdifferentiation Diabetes 2018 67 12 2601 2614 10.2337/db18-0155 2-s2.0-85056803173 30257975
6 Zhang Z. Hu Y. Xu N. A new way for beta cell neogenesis: transdifferentiation from alpha cells induced by glucagon-like peptide 1 Journal Diabetes Research 2019 2019, article 2583047 11 10.1155/2019/25830474 31001561
7 Sarnobat D. Moffett C. R. Tanday N. Antidiabetic drug therapy alleviates type 1 diabetes in mice by promoting pancreatic α-cell transdifferentiation Biochemical Pharmacology 2020 182, article 114216 10.1016/j.bcp.2020.114216 32926875
8 Goyal I. Sattar A. Johnson M. Dandona P. Adjunct therapies in treatment of type 1 diabetes Journal of Diabetes 2020 12 10 742 753 10.1111/1753-0407.13078 32567125
9 Wang M. Y. Yan H. Shi Z. Glucagon receptor antibody completely suppresses type 1 diabetes phenotype without insulin by disrupting a novel diabetogenic pathway Proceedings of the National Academy of Sciences of the United States of America 2015 112 8 2503 2508 10.1073/pnas.1424934112 2-s2.0-84923686666 25675519
10 Okamoto H. Kim J. Aglione J. Glucagon receptor blockade with a human antibody normalizes blood glucose in diabetic mice and monkeys Endocrinology 2015 156 8 2781 2794 10.1210/en.2015-1011 2-s2.0-84938704754 26020795
11 Yan H. Gu W. Yang J. Fully human monoclonal antibodies antagonizing the glucagon receptor improve glucose homeostasis in mice and monkeys The Journal of Pharmacology and Experimental Therapeutics 2009 329 1 102 111 10.1124/jpet.108.147009 2-s2.0-63849296798 19129372
12 Pettus J. Reeds D. Cavaiola T. S. Effect of a glucagon receptor antibody (REMD-477) in type 1 diabetes: a randomized controlled trial Diabetes, Obesity & Metabolism 2018 20 5 1302 1305 10.1111/dom.13202 2-s2.0-85045318550 29283470
13 Wei R. Gu L. Yang J. Antagonistic glucagon receptor antibody promotes α-cell proliferation and increases β-cell mass in diabetic mice iScience 2019 16 326 339 10.1016/j.isci.2019.05.030 2-s2.0-85067183101 31203188
14 Wei R. Cui X. Feng J. Dapagliflozin promotes beta cell regeneration by inducing pancreatic endocrine cell phenotype conversion in type 2 diabetic mice Metabolism 2020 111, article 154324 10.1016/j.metabol.2020.154324 32712220
15 Wang L. Liu Y. Yang J. GLP-1 analog liraglutide enhances proinsulin processing in pancreatic β-cells via a PKA-dependent pathway Endocrinology 2014 155 10 3817 3828 10.1210/en.2014-1218 2-s2.0-84907191530 25051441
16 al-Hasani K. Pfeifer A. Courtney M. Adult duct-lining cells can reprogram into β-like cells able to counter repeated cycles of toxin-induced diabetes Developmental Cell 2013 26 1 86 100 10.1016/j.devcel.2013.05.018 2-s2.0-84880506680 23810513
17 Drucker D. J. Mechanisms of action and therapeutic application of glucagon-like peptide-1 Cell Metabolism 2018 27 4 740 756 10.1016/j.cmet.2018.03.001 2-s2.0-85044154182 29617641
18 Accili D. Whither type 1 diabetes? The New England Journal of Medicine 2020 383 21 2078 2079 10.1056/NEJMe2030472 33207099
19 Zhou Q. Melton D. A. Pancreas regeneration Nature 2018 557 7705 351 358 10.1038/s41586-018-0088-0 2-s2.0-85047184448 29769672
20 Tudurí E. López M. Diéguez C. Nadal A. Nogueiras R. Glucagon-like peptide 1 analogs and their effects on pancreatic islets Trends in Endocrinology and Metabolism: TEM 2016 27 5 304 318 10.1016/j.tem.2016.03.004 2-s2.0-84962730836 27062006
21 Cryer P. E. M. Minireview: glucagon in the pathogenesis of hypoglycemia and hyperglycemia in diabetes Endocrinology 2012 153 3 1039 1048 10.1210/en.2011-1499 2-s2.0-84857401843 22166985
22 Wang M. Y. Dean E. D. Quittner-Strom E. Glucagon blockade restores functional β-cell mass in type 1 diabetic mice and enhances function of human islets Proceedings of the National Academy of Sciences of the United States of America 2021 118 9, article e2022142118 10.1073/pnas.2022142118 33619103
23 Dean E. D. Li M. Prasad N. Interrupted glucagon signaling reveals hepatic α cell axis and role for L-glutamine in α cell proliferation Cell Metabolism 2017 25 6 1362 1373.e5 10.1016/j.cmet.2017.05.011 2-s2.0-85020233245 28591638
