
==== Front
Bioinorg Chem Appl
Bioinorg Chem Appl
bca
Bioinorganic Chemistry and Applications
1565-3633
1687-479X
Hindawi

10.1155/2022/1401995
Research Article
Inhibition of Glycogen Synthase Kinase and the Neuroprotective Function of Conjugated ZnO-Osthol Nanoparticles in Alzheimer's Disease
https://orcid.org/0000-0001-5597-5882
Alharthi Nahed S. n.alharthi@psau.edu.sa
1
https://orcid.org/0000-0001-8047-8650
Aldakheel Fahad M. 2
https://orcid.org/0000-0001-7663-3443
Binshaya Abdulkarim S. 1
1Department of Medical Laboratory Sciences, College of Applied Medical Sciences, Prince Sattam Bin Abdulaziz University, Al-Kharj 11942, Saudi Arabia
2Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, King Saud University, Riyadh, Saudi Arabia
Academic Editor: R. Lakshmipathy

2022
21 9 2022
2022 14019957 7 2022
15 8 2022
27 8 2022
Copyright © 2022 Nahed S. Alharthi et al.
2022
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
A critical factor in the cause and progression of Alzheimer's disease (AD) is the growth of β-amyloid peptide (Aβ) in the brain. The mechanism of this effect is still unknown, although the effect of osthol on Aβ-induced inflammation is neuroprotective in AD and supplementation with zinc might prevent or delay the onset of dementia. In the current study, by inducing APP vector in human BE (2)-M17 cells, we established a cellular model of AD and investigated the protective effect of osthol (7-methoxy-8-3-methyl-2-butenyl-2H-1-benzopyran-2-one)-zinc oxide nanoparticles. The osthol-conjugated zinc oxide nanoparticles could significantly increase cell viability by inhibiting cell apoptosis. Osthol treatment has also prevented synaptic proteins such as postsynaptic density-95 (PSD-95), synaptophysin (SYP), and synapsin-1 from decreasing in APP-induced BE (2)-M17 cells. In addition, the expression of miR-132 was significantly upregulated by osthol by triggering the Wnt/β-catenin signaling pathway. We conclude from our observations that osthol is a potential drug for the treatment of a neurodegenerative disease, Alzheimer's. The key reason was that by upregulating miR-132, osthol could inhibit APP expression to prevent AD from occurring.

Prince Sattam Bin Abdulaziz University2020/03/17265
==== Body
pmc1. Introduction

The most neurodegenerative illness contributing to progressive cognitive impairment is Alzheimer's disease (AD), an age-related disorder. β-Amyloid plaques (Aβ), neurofibrillary tangles (NFTs), and neuronal brain damage are typical characteristics of AD neuropathology [1]. It is generally known that AD is associated with Aβ accumulation produced from amyloid pressure protein (APP) [2]. For plasticity and synaptic maturation, synaptophysin (SYP), synapsin, postsynaptic density-95 (PSD-95), and synaptic proteins play a critical role [3]. In rat hippocampal neurons, soluble Aβ therapy has been reported to significantly reduce the amount of these proteins (PSD-95, SYP, and synapsin-1) [4].

Osthol (OST, 7-methoxy-8-isopentenoxycoumarin, C15H16O3) (Figure 1) is a natural coumarin derived from Cnidium monnieri (L.) Cusson, recently used by several researchers, and has attracted a great range of attention due to its wide range of pharmacological attributes, such as anti-oxidative stress, anti-inflammatory, anti-tumor, and anti-apoptotic activities [5, 6]. ALCL3-induced Alzheimer's disease in mice has been prevented by Osthol which is regulated via PI3K/AKT signalling pathway and the PI3K/AKT signaling pathway [7, 8]. Initial studies of zinc supplementation in patients with AD who were ultimately not completed due to adverse events were initially performed by Constantinidis [9] and subsequently suggested by Burnet [10], who hypothesized that supplementation with zinc might prevent or delay the onset of dementia [11]. A number of human trials were carried out in subsequent years. Ziprimernc can be as a therapeutic agent to regulate the neurodegenerative and other CNS disorders via various fnctional pathways [9].

miRNAs, short noncoding gene expression RNA regulators, are expressed in the brain and participate in the regulation, function, and growth of neuronal plasticity. miRNA transcription dysfunction may contribute to neurodegenerative disease and neurodevelopmental disorders [12]. miR-132 leads to the dendritic development of newborn neurons in adult mouse hippocampus [13]. The signaling pathway of phosphoinositide 3-kinase (PI3K)/AKT appears to be important for AD because it promotes tau protein hyperphosphorylation [14]. The major roles in mediating neurogenesis are well known for glycogen synthase kinase-3β (GSK-3β), an important downstream target of the PI3K/AKT signaling pathway [15]. Accumulated evidence has shown that active GSK-3β can lead to aberrant tau phosphorylation in neurons and neurofibrillary tangle accumulation, ultimately impairing learning and memory [8, 16]. The signaling of Wnt/β-catenin is involved in neuron apoptosis, differentiation, and proliferation. In the cytoplasm, this interaction leads to the stabilization of β-catenin. AD pathogenesis is caused by GSK, referred to as glycogen synthase kinase, which is a negative Wnt signal transduction pathway controller [8]. Another study showed that high GSK-3β activity is due to Wnt/β-catenin activation, which can be decreased in patients with AD in the brain [17]. The dysregulation of the GSK-3β substrate and the level of β-catenin in AD is influenced by neuron death, growth, and differentiation [18]. Therefore, there was a need to understand the mechanism by which the signaling pathway of Wnt/β-catenin operates in AD. The effect of osthol on activation of Wnt/β-catenin signaling in APP-induced BE (2)-M17 cells was therefore investigated in the AD in vitro model.

In the current study, we investigated the neuroprotective role of conjugated zinc oxide-osthol nanoparticles in Alzheimer's disease model. We examined the effect of osthol by regulating miR-132 expression and also by controlling Wnt/β-catenin signaling pathway using the in vitro model of AD. Our study revealed that osthol exerted a protective effect by upregulating miR-132 expression in the in vitro AD model of APP-induced BE (2)-M17 cells by activating Wnt/β-catenin signaling.

2. Materials and Methods

2.1. Preparation and Characterization of Zinc Oxide Nanoparticles

Zinc oxide nanoparticles were prepared by laser ablation of metal pellets of zinc oxide (purity 99.99%) pressed as pellets with a diameter of 10 mm and a thickness of 2 mm. The laser (Nd:YAG) (neodymium-doped yttrium aluminium garnet) worked at 1 Hz repetition rate with no. 40 pulse, flounce (14.45 J/cm2) laser shots, and 1064 nm wavelength. The laser was centered on a cleaned 2 mm thick zinc oxide pellet sample by a 5 cm positive focal length lens, the spot diameter of the laser beam on the pellet was measured, and 2.3 mm was found. The pellets were immersed in 4 ml of deionized water, approximately 0.8 cm deep above the surface. The formation of colloidal nanoparticles with zinc oxide was verified by X-ray diffraction (XRD) and transmission electron microscopy (TEM) techniques.

2.2. Preparation of Drugs

OST (C15H16O3, 244.36 Da) such as Cnidium monnieri (L) Cusson has been extracted from plants [19]. To study, osthol was purchased with a purity of 99% from Abcam, Cambridge, MA, USA. Osthol's neuroprotective function was explored by treating it with BE (2)-M17 cells. In short, in 12.2 mg of osthol and 10 μl of dimethyl sulfoxide (DMSO) were dissolved, accompanied by dilution with 1 ml of DMEM to a 50 mM stock solution at 40°C [20]. BE (2)-M17 cells overexpressed with APP were treated with osthol at 50 μM concentration prepared in DMSO [7].

2.3. Preparation and Characterization of Conjugated Purified Osthol Zinc Oxide Nanoparticles by Pulse Technique

After preparing a thin film of each sample, the zinc oxide nanoparticles conjugated with purified osthol were prepared by the pulse method [21] which were then characterized by dropping 4 ml on a glass slide using a drop casting method and left to dry for 30 minutes at room temperature. The slides were then examined by UV-visible spectrophotometer and electron microscopy (transmission electron microscopy).

2.4. Cell Viability Test

The CCK-8 assay kit (MedChem Express, NJ, USA) was used to check cell viability, according to the manufacturer's instructions. With 10 μL of CCK-8 solution, 96-well plates (104–105 cells/well) that have 100 μL of supernatant were added. The entire system in which the reaction is carried out was incubated at 370°C for up to 48 hours. To measure the absorbance at 450 nm, a microplate reader (Bio-Rad, CA, USA) was used. This test was run in four sets of triplicates and each set was tested for viability at interval of 12 hours.

2.5. Flow Cytometry

In accordance with the annexin V-FITC/PI kit package protocol (BD Biosciences, CA, USA), flow cytometry was performed to test cell apoptosis in BE (2)-M17 and neuron cells. After washing twice with PBS for 10 minutes, the cells were suspended again with a 250 μL buffer binding solution. Subsequently, 20 μL FITC-conjugated annexin V and 15 μL propidium iodide were injected into the cells and set at 370°C for 30 minutes in the dark. 1.5 hours post staining, cells were run in flow cytometer to examine cells based on staining. Red propidium iodide (PI, red), which is shown on the y-axis, and annexin V-FITC (green), which is shown on the x-axis, were used to stain the cells. Using flow cytometry and Cell Search Pro software (BD Bioscience, CA, USA), both the early and late apoptotic cells were identified.

2.6. Cell Culture and Transfection

RT-PCR and western blot methods were used to determine the mRNA and protein expressions of APP to confirm whether the model of AD cells model was established successfully.

In a 6-well plate with a density of 3 × 105 cells/ml at 370°C for 15 min, BE (2)-M17 Neuroblastoma Cell Lines cells were cultured. For the culture of these cells (105/mL) in an atmosphere containing 95% air and 5% CO2 at a temperature of 370°C, 24-well plates coated with pol-L-lysine were used. The medium was exchanged with Dulbecco's Modified Eagle medium (DMEM) after 4–7 days with 1 to 2 mL of trypsin and 0.53 mM of EDTA solution. This culture medium was maintained at 370°C until BE (2)-M17 BE (2)-M17 cell purity increased to greater than 90%. BE (2)-M17 cells were used for one week of culture experiments.

The APP sequence (AuGCT DNA-SYN ATDBio Ltd., School of Chemistry, University of Southampton, UK) is replicated into an empty vector to generate APP expression at Notl and Xbal restriction sites 9I (Thermo Fisher Scientific, NJ, USA) [29]. The endotoxin-free Plasmid Mini kit (Meridian Life Science Inc., TN, USA) was used to isolate pLP1, pLP2, pLP/VSV-G, and newly produced APP plasmids from bacteria by modifying the concentration to approximately 1 μg/μL. To culture BE (2)-M17 cells, DMEM was used containing 1% P/S and 10% FBS. In DMEM, BE (2)-M17 cells with a confluence of about 90% were treated with control vector plasmid DNA, 15 μg APP, 2.5 μg pLP2, 3.5 μg pLP/VSV-G, and 6.5 μg pLP1 using Lipofectamine (Thermo Fisher Scientific, NJ, USA) in 10 mm dishes (24). This plasmid medium was replaced with a 10 mL fresh DMEM medium with 10% FBS after 12 hours. Using a 0.45 μm membrane after 24 hours, this culture medium was filtered again and held at a freezing temperature of around −800°C [26]. BE (2)-M17 BE (2)-M17 was transfected using APP-encoding lentiviral particles.

2.7. Reverse Transcription-PCR (RT-PCR)

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, NJ, USA) and cDNA was synthesized using a cDNA Synthesis Kit (Thermo Scientific, USA) from RevertAid First Strand. As an internal control, β-catenin was used. The APP and β-catenin gene primers are shown in Table 1. The DreamTaq Green PCR Master Mix (Roche, Grenzach-Wyhlen, Germany) was used to perform the PCR. The conditions for this are as follows: 900°C for 5 min, followed by 40 cycles of 600°C for 1 min, 550°C for 30 s, 720°C for 6 min, and 720°C for 5 min, respectively. In a 4% agarose gel stained with ethidium bromide, the RT-qPCR products were resolved. Using the Gel Image System (Tanon Science and Technology Co., Shanghai, China), quantitative analysis was carried out. For the estimation of RT-qPCR outcomes, the 2−−△△Ct approach was used.

2.8. Western Blot

After 1 day of treatment, proteins were extracted from neurons with a ReadyPrep protein extraction kit (Bio-Rad Laboratories, Inc., CA, USA) as directed by the manufacturer. 60 μg of each protein was loaded on 15% SDS-PAGE and transferred (Thermo Fisher Science, NJ, USA) to polyvinylidene difluoride membranes. To block the membranes for 60 min in Tris-buffered saline solution and Tween 20 (Cell Signaling, CA, USA), a blocking buffer with 5% BSA was used. In the same blocking buffer at 40°C, membranes were then seeded overnight and diluted with separate primary antibodies. Incubation of these membranes with secondary antibodies was carried out for a further 60 minutes, and ECL detection reagent (Viagene, FL, USA) bands were observed. Primary antibodies used were as follows: mouse anti-Aβ 1–42 (NBP2-13075; 1 : 1000, Novus Biologicals, CO, USA), anti-GSK-3β (NBP1-47470; 1 : 1000, Novus Biologicals, CO, USA), p-GSK-3β(NB100-81946; 1 : 1000, Novus Biologicals, CO, USA), and anti-p-β-catenin (ab27798; 1 : 1000, Abcam, MA, USA). Goat Anti-Rabbit IgG H&L (HRP) (ab205718; 1 : 2000; Abcam, MA, USA) secondary antibodies were then incubated with these membranes (ab205718; 1 : 2000; Abcam, MA, USA).

2.9. Statistical Analysis

The data were provided as mean ± SD and assessed by SPSS 19.0 (IBM Inc., NY, USA). For these parameters, the student test (for two groups) and variance analysis (for multiple groups) were used to calculate the difference. By using GraphPad Prism 7.0 (Graphpad Software, CA, USA), statistical data were calculated. When the value of P < 0.05, differences were thought to be significant.

3. Results

3.1. Preparation and Characterization of Zinc Oxide Nanoparticles

Figure 2 displays the XRD spectrum of zinc oxide nanoparticles. For the dried film from the concentrated suspension on a glass slide, X-ray diffraction measurement was performed. Zinc oxide nanoparticles prepared by laser ablation in deionized water TEM image (Figure 2) showed that synthesized nanoparticles have spherical shapes and an average size of 35 nm.

3.2. Conjugation of Zinc Oxide-Osthol Nanoparticles

In order to produce nanoparticles by laser ablation, the extracted osthol was pulsed with zinc oxide pellet. Figure 3 shows the XRD study for thin film after osthol conjugation with zinc oxide nanoparticles. An increase in the grain size of the osthol extracted can be seen to be 65 nm. The increase in osthol grain size resulted from high osthol conjugation with nanoparticles of zinc oxide. The TEM method was used by pulse methods to visualize the shape and size of the conjugated osthol zinc oxide nanoparticles. Osthol-conjugated nanoparticles of zinc oxide were well distributed with buffer aggregation at 149 nm in size (Figure 3).

3.3. Cellular Model Construction of AD

In BE (2)-M17 cells, encoding lentiviral vector APP shows protein expressions of Aβ 1–42 in Figure 4 from western blot and RT-qPCR results; when compared to the control group containing the empty vector, protein expressions of Aβ 1–42 significantly increased in BE (2)-M17 cells overexpressed with APP after the 3rd day of post-transduction. The successful construction of the AD cellular model in which APP performs its role as a neurotoxic oligomer was suggested in these findings (Figure 4).

3.4. Zinc Oxide-Osthol Enhances Cell Viability, Decreases Apoptosis, and Increases miRNA-132 Expression in BE (2)-M17 Cells Induced by APP

It can be seen from these findings that in APP-overexpressed BE (2)-M17 cells, cell viability has significantly decreased in CCk-8 analysis. However as opposed to the control group, treatment with zinc oxide-osthol significantly increased cell viability in APP-induced BE (2)-M17 cells. In a similar way, apoptosis was reduced when BE (2)-M17 cells were treated with ZnO-coated osthol which was able to recover the cell viability compared to control (Figure 5). The role of miR-132 in neuroprotection was investigated with RT-qPCR, and the effect of osthol on cells overexpressed with APP was confirmed. Compared with the control group, it can be shown that APP transduction inhibited miR-132 expression in BE (2)-M17 cells. On the other hand, miR-132 was upregulated in osthol-treated BE (2)-M17 cells as opposed to control cells having an empty vector (Figure 5).

3.5. Zinc Oxide-Osthol on Synapsin-1, PSD-95, and SYP Protein Expressions in the APP-Induced BE (2)-M17 Cells

The decrease in synapsin-1 attenuated and restored protein expression when treated with zinc oxide-osthol. Meanwhile, anti-miR-132 was used to lower the activity of miR-132. Anti-miR-132 significantly reduced synapsin-1 protein expressions, while zinc oxide-osthol treatment reversed the effect of the miR-132 inhibitor in BE (2)-M17 cells overexpressed with APP. In contrast to the control group, zinc oxide-osthol significantly increased the protein expressions of SYP and PSD-95 in APP-induced BE (2)-M17 cells (Figure 6).

3.6. Zinc Oxide-Osthol Inhibits APP-Induced Synaptoxicity by Controlling the Signaling Pathway of Wnt/β-Catenin Signaling Pathways in APP-Induced BE (2)-M17 Cells

Western blot analysis was used to measure the protein expressions of CDH13, GSK-3β, p-GSK-3β, and p-β-catenin. Zinc oxide-osthol treatment significantly decreased the expression of these factors in APP-induced cells as compared to the empty vector control group (Figure 7(a)). RT-qPCR was used to measure the CDH13, GSK-3β, p-GSK-3β, and p-β-catenin signaling pathways of miRNA-132 and APP miRNA-132 expressions in APP-induced BE (2)-M17 cells. It can be seen from the statistical graph that the relative expression of miRNA-132 has been substantially increased in the APP group of these factors (Figure 7(b)). These findings showed that zinc oxide-osthol could play a neuroprotective role in the APP-induced BE (2)-M17cells by upregulation of miR-132 [22, 23] and inhibition of CDH13, GSK-3β, p-GSK-3β, and p-β-catenin protein expressions.

4. Discussion

In elderly populations worldwide, AD is the most common neurodegenerative disease. Senile plaques (SPs) and neurofibrillary intracellular tangles (NFTs) are two pathological characteristics of AD [24]. Although Aβ plays a critical role in AD, as is known, growing evidence has shown that aberrant tau phosphorylation and oligomerization are likely to be crucial to the disease process [25]. Abnormal hyperphosphorylated tau protein is made up of NFTs. Tau protein hyperphosphorylation has occurred in some Ser or Thr in AD brains. Sites with phosphorylates include Ser202, Ser396, Ser404, Thr205, Thr181, and so on. Cytoskeletal destabilization, apoptotic cells, and eventually memory dysfunction can result from these hyperphosphorylated tau proteins [26]. Obviously, studying and designing drugs with an inhibitory effect on hyperphosphorylation of tau protein in neural cells subjected to Aβ is a significant activity.

Due to its diverse pharmaceutical functions, OST, an active monomer in Chinese medicinal plants, has received considerable attention [19]. OST act as anti-inflammatory agent [20], anti-apoptosis, and anti-oxidative stress [8] which might have promising therapeutic applications. Neuroprotective properties that make therapeutic applications promising [8]. AD is a complex disease predominantly caused by APP that causes Aβ-neurotoxicity; Aβ accumulation contributes to a decline in cognition in patients with AD [27]. BE (2)-M17 cells were therefore treated with the lentiviral vector APP in this study to investigate the effect of the zinc oxide-osthol in vitro model of AD. Our results indicated that cell viability decreased while the rate of cell apoptosis increased with APP overexpressed in BE (2)-M17 cells. On the other hand, Zinc oxide-osthol has substantially inhibited cell death as well as increase cell viability in BE(2)-M17-indu APP cells.

Previous studies have reported that osthol, by triggering β-catenin-BMP signaling, can promote bone formation and osteoblast differentiation [28]. Our findings showed that miRNA-377 and miRNA-107 overexpression could save Aβ 1-42-induced synapse loss by targeting the signaling pathway for GSK-3β, p-GSK-3β, and p-β-catenin [29]. In addition, zinc oxide-osthol plays a critical role in minimizing its downstream impact through miRNA-377 upregulation and downregulation of GSK-3β, p-GSK-iβ, and p-β-catenin signaling pathways in cells overexpressed with APP.

5. Conclusion

The osthol-conjugated zinc oxide nanoparticles could significantly increase cell viability by inhibiting cell apoptosis. Osthol treatment has also prevented synaptic proteins such as postsynaptic density-95 (PSD-95), synaptophysin (SYP), and synapsin-1 from decreasing in APP-induced BE (2)-M17 cells. In addition, the expression of miR-132 was significantly upregulated by osthol by triggering the Wnt/β-catenin signaling pathway. We conclude from our observations that osthol is a potential drug for the treatment of a neurodegenerative disease, Alzheimer's. The key reason was that by upregulating miR-132, osthol could inhibit APP expression to prevent AD from occurring.

Acknowledgments

This project was supported by the Deanship of Scientific Research at Prince Sattam Bin Abdulaziz University (PSAU), Alkharj, Saudi Arabia (research project no. 2020/03/17265).

Data Availability

The data used to support the findings of this study are included within the article.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

(d)

Figure 1 Chemical structure of osthol.

Figure 2 XRD spectrum of nanoparticles of zinc oxide on a glass slide and TEM image of NPs of zinc oxide formed by laser ablation in deionized water.

Figure 3 XRD patterns of conjugated osthol zinc oxide nanoparticles and TEM image of conjugated osthol zinc oxide NPs prepared by laser ablation in deionized water.

Figure 4 APP-expressing cells in culture media. Western blot analysis was used to measure Aβ expression in APP-induced BE (2)-M17 cells. Using RT-qPCR, expression levels of Aβ were measured.

Figure 5 Zinc oxide-osthol improves cell viability in BE (2)-M17 cells and decreases cell apoptosis. (a) CCK-8 has been used to determine the viability of cells, and using flow cytometry, the cell apoptosis rate in BE (2)-M17 cells was measured (P < 0.05). (b) To evaluate the mRNA expressions of miR-132, RT-qPCR was used (P < 0.055).

Figure 6 Effect of Osthol on various protein expression levels in BE(2)-M17 cells induced by APP. Using RT-qPCR to detect the expression and mRNA expressions of Synapsin-1, PSD-95 and SYP were calculated. P < 0.05.

Figure 7 Influence of osthol in APP-induced BE (2)-M17 cell activation of Wnt/β-catenin signaling pathways. (a) Using western blot analysis, protein expressions of CDH13, GSK-3β, P -GSK-3β, and P -β-catenin were assessed. To measure the mRNA expressions of the signaling pathways CDH13, GSK-3β, P -GSK-3β and P -β-catenin in APP-induced BE (2)-M17 cells, RT-qPCR was used (P < 0.05P).

Table 1 Details of primer used in this study.

miRNA Primer	Sequence	
GSK-3β	Forward	GAGCCACTGATTACACGTCCAG	
GSK-3β	Backward	CCAACTGATCCACACCACTGTC	
CDH13	Forward	AGGTAAGTGGCCTCCAGAAC	
CDH13	Backward	GCTTCAAACGAGGGTCTTCC	
SYP	Forward	TGTGGCTTGGAACATTTGGG	
SYP	Backward	CTGAAACCACCATGGAAGCC	
PSD-95	Forward	AGACTCGGTTCTGAGCTACG	
PSD-95	Backward	ATCTCATACTCCCGCTTGGG	
Synapsin-1	Forward	ATACAAGCTGTGGGTGGACA	
Synapsin-1	Backward	GACCACGAGCTCTACGATGA	
β-Catenin	Forward	TCCCACTAATGTCCAGCGTT	
β-Catenin	Backward	ATGGACCATAACTGCAGCCT	
β-Actin	Forward	CACTATCGGCAATGAGCGGTTCC	
β-Actin	Backward	CAGCACTGTGTTGGCATAGAGGTC
==== Refs
1 Lopez-Toledano M. A. Ali Faghihi M. Patel N. S. Wahlestedt C. Adult neurogenesis: a potential tool for early diagnosis in alzheimer’s disease? Journal of Alzheimer’s Disease 2010 20 2 395 408
2 Baranello R. Bharani L. Padmaraju V. Amyloid-beta protein clearance and degradation (ABCD) pathways and their role in alzheimer’s disease Current Alzheimer Research 2015 12 1 32 46 25523424
3 Bao Y. Meng X. Liu F. Protective effects of osthol against inflammation induced by lipopolysaccharide in BV2 cells Molecular medicine Reports 2018 17 3 4561 4566 29344655
4 Bloom G. S. Amyloid-β and tau: the trigger and bullet in alzheimer disease pathogenesis Journal of the American Medical Association Neurology 2014 71 4 505 508 10.1001/jamaneurol.2013.5847 2-s2.0-84899019792 24493463
5 Wang B. Zheng X. Liu J. Osthole inhibits pancreatic cancer progression by directly exerting negative effects on cancer cells and attenuating tumor-infiltrating M2 macrophages Journal of Pharmacological Sciences 2018 137 3 290 298 30098910
6 Okamoto T. Kawasaki T. Hino O. Osthole prevents anti-Fas antibody-induced hepatitis in mice by affecting the caspase-3-mediated apoptotic pathway Biochemical Pharmacology 2003 65 4 677 681 10.1016/s0006-2952 12566097
7 Shen L. X. Jin L. Q. Zhang D. S. Xue G. P. Effect of osthol on memory impairment of mice in AlCl3-induced acute senile model Acta Pharmaceutica Sinica 2002 37 3 178 180 12579756
8 Yao Y. Wang Y. Kong L. Chen Y. Yang J. Osthole decreases tau protein phosphorylation via PI3K/AKT/GSK-3β signaling pathway in alzheimer’s disease Life Sciences 2019 217 16 24 10.1016/j.lfs.2018.11.038 2-s2.0-85057553572 30471283
9 Adlard P. A. Bush A. I. Metals and alzheimer’s disease: how far have we come in the clinic? Journal of Alzheimer’s Disease 2018 62 3 1369 79 10.3233/jad-170662 2-s2.0-85044406622
10 Burnet F. A possible role of zinc in the pathology of dementia The Lancet 1981 317 8213 186 188
11 Nachdev C. K. Bonchev P. Kirov G. K. Kissiova K. Zinc deficiency and alzheimer’s disease: a new approach proceeding of the Psychiatry, A World Perspective 1990 New York Elsevier Science 496 504
12 Hu Y. K. Wang X. Li L. Du Y. H. Ye H. T. Li C. Y. MicroRNA-98 induces an alzheimer’s disease-like disturbance by targeting insulin-like growth factor 1 Neuroscience Bulletin 2013 29 6 745 51 10.1007/s12264-013-1348-5 2-s2.0-84890797680 23740209
13 Magill S. T. Cambronne X. A. Luikart B. W. MicroRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus Proceedings of the National Academy of Sciences 2010 107 47 20382 7 10.1073/pnas.1015691107 2-s2.0-78650560147
14 Matsuda S. Nakagawa Y. Tsuji A. Kitagishi Y. Nakanishi A. Murai T. Implications of PI3K/AKT/PTEN signaling on superoxide dismutases expression and in the pathogenesis of alzheimer’s disease Diseases 2018 6 2 p. 28 10.3390/diseases6020028
15 Li X. T. Liang Z. Wang T. T. Brain-derived neurotrophic factor promotes growth of neurons and neural stem cells possibly by triggering the phosphoinositide 3-kinase/AKT/glycogen synthase kinase-3β/β-catenin pathway CNS & Neurological Disorders-Drug Targets 2017 16 7 828 36 10.2174/1871527316666170518170422 2-s2.0-85032492144 28524001
16 Avila J. Wandosell F. Hernández F. Role of glycogen synthase kinase-3 in alzheimer’s disease pathogenesis and glycogen synthase kinase-3 inhibitors Expert Review of Neurotherapeutics 2010 10 5 703 10 10.1586/ern.10.40 2-s2.0-77951875902 20420491
17 Sun C. Gui Y. Hu R. Preparation and pharmacokinetics evaluation of solid self-microemulsifying drug delivery system (S-SMEDDS) of osthole AAPS PharmSciTech 2018 19 5 2301 2310 10.1208/s12249-018-1067-3 2-s2.0-85047667265 29845504
18 Wang Y. Veremeyko T. Wong A. H. K. Downregulation of miR-132/212 impairs S-nitrosylation balance and induces tau phosphorylation in alzheimer’s disease Neurobiology of Aging 2017 51 156 166 28089352
19 Yan Y. Kong L. Xia Y. Osthole promotes endogenous neural stem cell proliferation and improved neurological function through notch signaling pathway in mice acute mechanical brain injury Brain, Behavior, and Immunity 2018 67 118 129 28823624
20 Zhao D. Wang Q. Zhao Y. The naturally derived small compound Osthole inhibits osteoclastogenesis to prevent ovariectomy-induced bone loss in mice Menopause 2018 25 12 1459 69 10.1097/gme.0000000000001150 2-s2.0-85057563644 29944638
21 Ogawa H. Sasai N. Kamisako T. Baba K. Effects of osthol on blood pressure and lipid metabolism in stroke-prone spontaneously hypertensive rats Journal of Ethnopharmacology 2007 112 1 26 31 10.1016/j.jep.2007.01.028 2-s2.0-34247889815 17324541
22 Li S. Yan Y. Jiao Y. Neuroprotective effect of osthole on neuron synapses in an alzheimer’s disease cell model via upregulation of MicroRNA-9 Journal of Molecular Neuroscience 2016 60 1 71 81 10.1007/s12031-016-0793-9 2-s2.0-84978027789 27394443
23 Li S. H. Gao P. Wang L. T. Osthole stimulated neural stem cells differentiation into neurons in an alzheimer’s disease cell model via upregulation of MicroRNA-9 and rescued the functional impairment of hippocampal neurons in APP/PS1 transgenic mice Rontiers in Neuroscience 2017 11 p. 340 10.3389/fnins.2017.00340 2-s2.0-85020724487
24 Rudrabhatla P. Jaffe H. Pant H. C. Direct evidence of phosphorylated neuronal intermediate filament proteins in neurofibrillary tangles (NFTs): phosphoproteomics of alzheimer’s NFTs Federation of American Societies for Experimental Biology journal 2011 25 11 3896 905 10.1096/fj.11-181297 2-s2.0-80355148480 21828286
25 Mielke M. M. Haughey N. J. Bandaru V. V. R. Cerebrospinal fluid sphingolipids, β-amyloid, and tau in adults at risk for alzheimer’s disease Neurobiology of Aging 2014 35 11 2486 2494 24952994
26 LaFerla M. Oddo S. Alzheimer’s disease: aβ, tau and synaptic dysfunction Trends in Molecular Medicine 2005 11 4 170 6 15823755
27 Lovejoy D. B. Guillemin G. J. The potential for transition metal-mediated neurodegeneration in amyotrophic lateral sclerosis Frontiers in Aging Neuroscience 2014 6 p. 173 10.3389/fnagi.2014.00173 2-s2.0-84904697602
28 Popugaeva E. Pchitskaya E. Bezprozvanny I. Dysregulation of neuronal calcium homeostasis in alzheimer’s disease–a therapeutic opportunity Biochemical and Biophysical Research Communications 2017 483 4 998 1004 27641664
29 Jiao Y. Kong L. Yao Y. Osthole decreases beta amyloid levels through up-regulation of miR-107 in alzheimer’s disease Neuropharmacology 2016 108 332 44 27143098
