
==== Front
Oxid Med Cell Longev
Oxid Med Cell Longev
OMCL
Oxidative Medicine and Cellular Longevity
1942-0900
1942-0994
Hindawi

10.1155/2022/4509019
Research Article
Overexpression of hsa_circ_0061817 Can Inhibit the Proliferation and Invasion of Lung Cancer Cells Based on Active Compounds
Ye Longping 1 2 3
Zhong Youqing 1
Hu Lihua 1
Huang Ya 1 3
Tang Xiang 1
Yu Shanjun 1
Huang Jianxin 1
Wang Ziyuan 1
https://orcid.org/0000-0003-4780-3831
Li Qi lqlq198210@sina.com
1 2 3
Zhou Xiangdong 1 2 3
1Department of Respiratory Medicine, The First Affiliated Hospital of Hainan Medical University, Haikou, Hainan 570102, China
2NHC Key Laboratory of Tropical Disease Control, Hainan Medical University, Haikou 571199, China
3Key Laboratory of Emergency and Trauma of Ministry of Education, Hainan Medical University, Haikou 571199, China
Academic Editor: Tarique Hussain

2022
16 9 2022
2022 450901912 7 2022
27 7 2022
2 8 2022
Copyright © 2022 Longping Ye et al.
2022
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Objective

This study was aimed at investigating the expression level of hsa_circ_0061817 in lung adenocarcinoma cells and its effect on cell proliferation and invasion and the possible mechanism of hsa_circ_0061817 in lung adenocarcinoma.

Methods

The overexpression plasmids of hsa_circ_0061817 (OE-hsacirc_0061817) were transfected into human lung A549 cells and mouse LLC-LUC cells, respectively. The cell viability was detected by CCK-8, and the cell proliferation was detected by cell clone formation assay and EdU assay. Transwell test was used to detect the ability of cell invasion, and apoptosis was detected by flow cytometry. WB was applied to determine the expression of apoptosis and epithelial mesenchymal transition- (EMT-) related proteins and also target proteins for observation the effect of OE-hsa_circ_0061817 on the growth of A549 cells in nude mice. Bioinformatics method was used to predict the binding microRNA (miRNA) of hsa_circ_0061817 and construct the regulatory network of competitive endogenous RNA (ceRNA) and functional analysis of miRNA target genes.

Results

Compared with PLO-ciR group, the cell viability, proliferation, and invasive ability of A549 and LLC-LUC were significantly reduced in OE-hsa_circ_00061817 group, while the apoptosis increased in OE-hsa_circ_00061817 group compared to PLO-ciR group. WB results showed that the expression of caspase 3, caspase 7, caspase 9, and E-cadherin increased significantly, while the expression levels of vimentin and N-cadherin decreased severely. Most importantly, OE-hsa_circ_00061817 inhibited the growth of A549 tumor-bearing nude mice. According to TargetScan and mirBase databases, hsa_circ_0061817 may competitively bind hsa_mir-181b-3p, hsa-mir-337-3p, hsa-mir-421, and hsa-mir-548d-3p. The results of functional enrichment showed that miRNA target genes were involved in many cancer-related biological processes, including negative regulation of apoptosis, gene expression, transcriptional imbalance in cancer, transforming growth factor-β, and P53 signal pathway.

Conclusions

Over expression of hsa_circ_0061817 inhibits the proliferation of lung adenocarcinoma A549 and LLC-LUC cells and may reduce the invasive ability of lung adenocarcinoma cells by weakening the process of EMT, which provides a new target for the prevention and treatment of lung adenocarcinoma.

Hainan Province Clinical Medical CenterHainan Medical UniversityHYYB2021A06 National Natural Science Foundation of China82160012 82011530049 81860001 Key R&D Project of Hainan ProvinceZDYF20223 Hainan Innovation Team Project820CXTD448
==== Body
pmc1. Introduction

Lung adenocarcinoma is one of the most common malignant tumors, and the mortality rate ranks first in all malignant tumors [1]. Among them, the incidence rate in East Asian countries is about half, and the mortality rate is higher than that in other countries [2, 3]. Most patients with lung adenocarcinoma are often in an advanced stage with distant metastasis and poor prognosis. The 5-year survival rate is only 20%~30% [4, 5]. If early lung adenocarcinoma can be found and treated in time, the 5-year survival rate can reach 90% [6]. The occurrence and development of lung adenocarcinoma are affected by many factors [7], but its exact etiological mechanism is still unclear, which greatly limits its further treatment.

Circular RNA (circRNA) is a kind of noncoding RNA molecule with 5′ and 3′ ends covalently bound to form a circular structure [8, 9]. It has the characteristics of abundant expression, stable structure, evolutionary conservation, and competitive endogenous and has become a research hotspot in the field of RNA [10, 11]. A large number of studies have found that lncRNA has the functions of regulating genes, interfering with transcription, regulating protein function, intranuclear transport, and so on [12]. Further studies have found that lncRNA is involved in the occurrence and progression of many diseases, especially in the process of tumorigenesis and evolution. It has the function of proto-cancer or tumor suppressor. lncRNAs are aberrantly expressed in many tumors by regulating gene expression [13]. Moreover, circRNAs play a variety of important roles in cell biology by binding with miRNAs and RNA binding proteins, or act as protein translation templates and immune regulators in cells [14, 15], thereby participating in the occurrence and development of human tumors. In addition, circRNA can be stably expressed in tissue, blood, urine, and saliva, which makes it a great potential to become a biomarker in the clinic [16]. circRNAs are thought to affect carcinogenesis through sponging miRNAs, binding with protein, influencing splicing events or transcription of genes, and even by translation into proteins or small peptides [17]. Abnormal expression patterns of circRNAs have been associated with pathogenesis of human cancers including lung cancer. Therefore, it is of great significance to find specific circRNAs related to lung adenocarcinoma and explore their mechanism in the occurrence and development of lung adenocarcinoma.

It has been reported that lncRNAs play an important role in regulating tumor progression and tumor biological behaviors such as gene expression, cell proliferation, cell differentiation, immune responses, and apoptosis, among which the most crucial process is the regulation of competing endogenous RNAs (ceRNAs) [18, 19]. The ceRNA hypothesis, first proposed by Salmena et al. in 2011, has gained a lot of attention in terms of tumorigenesis [20]. Basically, the hypothesis states that, in the ceRNA gene interaction network, which consists of lncRNAs, miRNAs, and mRNAs, lncRNAs can act as miRNA sponges and inhibit miRNA functions by sharing miRNA response elements (MRE), thereby indirectly regulating mRNA expression levels [21]. Hence, the idea that lncRNAs could serve as promising biomarkers for multiple diseases has gained increasing attention. Currently, the importance of the lncRNA-miRNA-mRNA-ceRNA regulatory network has been confirmed in various types of cancers [22–24]. However, only few studies on the roles of lncRNAs have been conducted in lung cancer. Moreover, lncRNA-related ceRNA network remains unelucidated in lung cancer.

The previous study of our research group found that hsa_circ_0061817 showed significantly low expression only in lung adenocarcinoma tissues, especially in early lung adenocarcinoma tissues, showing good lung adenocarcinoma tissue specificity. However, it is relatively lacking of relevant studies of hsa_circ_0061817 on regulating lung cancer cells. Therefore, this study was aimed at further exploring the important regulatory role of hsa_circ_0061817 on the proliferation and invasion of lung adenocarcinoma cells and its key molecular mechanism, in order to provide new ideas for the treatment of lung adenocarcinoma.

2. Materials and Methods

2.1. Materials

Human lung adenocarcinoma cell lines A549 and LLC-LUC were purchased from the Cell Bank of Shanghai Chinese Academy of Sciences. 6-week-old male BALB/c nude mice were purchased from Shanghai Slaker Experimental Animal Co., Ltd. with animal production license No. SCXK (Shanghai) 2017-0015 and raised in the animal center of Hainan Medical College, with animal use license No. 2022-0013 (Hainan Medical College). Fetal bovine serum (No. 42Q1782K), RPMI1640 medium (No. 31870082), and ham's F-12K medium (No. 21127022) were purchased from GIBCO company in the United States. CCK-8 Kit (No. C0037), Ripa lysate (No. P0013K), BCA protein concentration determination kit (No. P0012), Beyoclick™ EdU-555 cell proliferation detection kit (No. C0075S), ECL color development kit (No. P0018FS), and Annexin V/PI apoptosis detection kits (No. 4136994) were purchased from BD company in the United States. TRIzol reagent (No. 15596026) was purchased from Invitrogen company in the United States. PrimeScript™ RT master mix (No. RR036A) and SYBR® Premix EX Taq™ (No. RR820A) were purchased from Takara company in Japan. Caspase 3 (No. ab2302), caspase 7 (No. ab255818), caspase 9 (No. ab32539), E-cadherin (No. ab235682), vimentin (No. ab137321), N-cadherin (No. ab76011), and GAPDH (No. ab8245) were purchased from American Abcam company. Horseradish peroxidase-labeled donkey anti-rabbit IgG antibody (No. 1534671) was purchased from Life Technologies in the United States. Goat anti-mouse IgG antibody labeled with horseradish peroxidase (No. ab1501115) was purchased from Abcam company in the United States. hsa_circ_0067582 overexpression (OE-circ 0067582) plasmid and its negative control were purchased from Gemma gene (Shanghai Co., Ltd). Lipofectamine 2000 (No. 11668019) was purchased from Invitrogen company in the United States.

2.2. Cell Culture

Human lung adenocarcinoma cell lines A549 and LLC-LUC were treated with 10% fetal bovine serum and 1% double antibody (100 U/ml penicillin and 100 U/ml penicillin, respectively), F-12K medium, and RPMI1640 medium and cultured in 37°C and 5% CO2 cell incubator. The cells were subcultured when the degree of cell fusion reached 80%.

Real-time fluorescence quantitative PCR (qRT-PCR) was used to detect the expression level of hsa_circ_0061817 in A549 and LLC-LUC cells. GAPDH was used as internal reference for relative quantification. The total RNA of cells was extracted by TRIzol method, and the RNA concentration was detected by spectrophotometer when A260/A280 value was between 1.8 and 2.0. RNA reverse transcription was further performed. has_circ_0061817 reverse transcription was performed by PrimeScript™ RT master mix reverse transcription kit. SYBR® Premix Ex Taq™ kit was applied for qRT-PCR amplification with CFX96 real-time quantitative PCR instrument (Bio-Rad company in the United States), using 2–ΔΔCt. The relative expression of has_circ_0061817 was calculated by CT method. Three multiple wells were set for each sample, and the experiment was repeated three times. Primer sequence is as follows: hsa_circ_0061817 upstream primer: 5′ CACAGTGGCAAAAGAAACTTGGT 3′, downstream primer: 5′ TGT GGGGTCCAAGATATGGC 3′, and GAPDH upstream primer: 5′ ACCCAC TCCTCCCCTTTGAC 3′, downstream primer: 5′ TGTTGCTGTAGCCAAATTCGTT 3′.

2.3. Cell Transfection

The full-length coding sequence of hsa_circ_0061817 was cloned into PLO-ciR vector, and the blank PLO-ciR vector was used as negative control. A549 and LLC-LUC cells were inoculated into 6-well plates (1 × 105/well), when the cell fusion degree reaches 60%; the serum-free medium containing OE-circ 0061817 plasmids and PLO-ciR vector was added to the 6-well plate according to the operation steps of the transfection reagent Lipofectamine 2000. After 48 h transfection, the cells were collected, and qRT-PCR was used to detect the overexpression efficiency of plasmid.

2.4. Cell Viability Was Detected by CCK-8 Method

A549 and LLC-LUC cells transfected with OE-circ 0067582 plasmid were treated with 5 × 103 pieces/well evenly spread in 96 well plates, cultured at 37°C and 5% CO2 for 24, 48, 72, and 96 hours, respectively, and then added to each well 10 ml mix of CCK-8 solution evenly. The culture plate was incubated in the incubator for 4 hours, and the absorbance value of each well at 450 nm was measured with an enzyme labeling instrument. Each group was set 6 multiple wells.

2.5. Clone Formation Experiment

After transfection, A549 and LLC-LUC cells (5 × 102 cells/well) were collected and inoculated into a 24 well plate and incubated in an incubator. The culture medium was changed every three days. After 14 days, the formation of cell clone was visible to the naked eye. The culture medium was sucked and discarded. PBS was used for washing three times and stained with 0.5% crystal violet for 15 min, then washed with pure sterilized water, and observed the number of cell clones.

2.6. EdU Assay Was Used to Detect Cell Proliferation

A549 and LLC-LUC cells inoculated into 24 well plates were transfected for 48 hours, fixed with 4% paraformaldehyde for 30 minutes, decolorized with 2 mg/ml glycine, and incubated in shaking table for 5 minutes; 5% TritonX-100 decolorizing shaker was incubated for 10 min; and the cells were stained with Apollo and DAPI according to the instructions of Beyoclick™ EdU-555 kit. After being sealed with antifluorescence quencher, the cells were photographed under fluorescence inverted microscope.

2.7. Transwell Assay Was Used to Detect Cell Invasion

A549 and LLC-LUC cells were transfected with OE-ciR 0061817 plasmids and blank PLO-ciR vectors, respectively. After being cultured in the cell incubator for 48 hours, the cells were collected after routine digestion with 25% trypsin. After PBS cleaning, they were resuspended with serum-free medium to make a single cell suspension. The cell concentration was adjusted to 1 × 105/ml. Then, 100 μl cells were inoculated into the Transwell chamber covered with matrix glue and hydrated with serum-free medium, and 600 μl conditioned medium containing 20% FBS was added to each well in the lower chamber. After incubation in 37°C and 5% CO2 cell incubator for 48 h, the plate was taken out, and the Transwell cells were washed with PBS once, fixed with 4% paraformaldehyde for 15 min, dyed with crystal violet for 10 min, and then washed with PBS twice. After wiping the cells on the surface above the basement membrane of the cell with cotton ball, the cells were observed and taken photos under the microscope to count the number of cells passing through the small hole.

2.8. Apoptosis Was Observed by Flow Cytometry

A549 and LLC-LUC cells transfected with OE-ciR-0061817 plasmids and blank PLO-ciR vectors were cultured for 24 hours. After digesting the cells with trypsin without EDTA, the medium was added to terminate the digestion, and the cells were collected. After being washed with PBS twice, the collected cells were adjusted to 1 × 109 cells/ml, and 100 μl cell suspension was added to each Falcon tube, and then, add 5 ml PI and 5 μl Annexin V-FITC, incubated in dark for 15 min, add binding buffer, and the apoptosis was detected by flow cytometry within 1 h.

2.9. The Expression of Apoptosis- and Epithelial Mesenchymal Transition-Related Proteins Were Detected by Western Blot

A549 and LLC-LUC cells were collected 48 hours after transfection. The total protein was extracted by Ripa lysate kit, and the cell protein concentration was measured by BCA protein quantitative kit. The same amount of protein of each sample was separated by 10% SDS-PAGE and transferred to PVDF membrane by constant current 350 mA wet method. The membranes were blocked with 5% skimmed milk for 2 h at room temperature. After TBST cleaning, the membranes were incubated, respectively, with the primary antibodies including caspase3 (1: 2000), caspase 7 (1 : 1000), caspase 9 (1 : 1000), E-cadherin (1 : 2000), vimentin (1 : 2000), N-cadherin (1 : 1000), and GAPDH (1 : 5000) at 4°C overnight. The membranes were washed with TBST buffer for 3 times, and each time was 5 min. Then, the secondary antibodies were added and incubated at room temperature for 2 h. The images were collected by chemiluminescence and gel imaging system, and the gray value of protein strip was analyzed by ImageJ software.

2.10. Xenograft Tumor Experiment

Six nude mice were randomly divided into OE-ciR 0061817 group and PLO-ciR group, with 3 mice in each group. A549 cells transfected with OE-ciR 0067582 plasmids and blank PLO-ciR vectors were prepared into single cell suspension with serum-free medium. The cells with the concentration of 1 × 106 (100 μl) were injected into the left axillary skin of nude mice. The general condition and tumor growth of nude mice were observed every day. The long diameter and short diameter of the tumor with Vernier caliper were measured every 5 days until 30 days. The relevant data was recorded, and the tumor growth curve was drawn. The tumor-bearing mice were sacrificed at the 30th day, and the subcutaneous tumors were separated, weighed, and taken photos.

2.11. Construction and Functional Enrichment Analysis of Competitive Endogenous RNA Network

The miRNAs that may interact with hsa_circ_0061817 were predicted by TargetScan (http://www.targetscan.org/vert72) and miRnada (http://www.microrna.org/). Construct miRnada miRNA relationship pair. TarBase (http://www.tarbase.com/) database was used to predict the downstream targets of miRNA and construct the regulatory relationship of miRNA-mRNA. Integrating the relationship between hsa_circ_0061817 miRNA and miRNA mRNA, the regulatory network of circRNA-miRNA-mRNA competitive endogenous RNA (ceRNA) was constructed by circBase (http://www.circbase.org/), and the regulatory network was visualized by Cytoscape software. Further, Diana miRpath software (http://SNF 515788. VM. Okeanos. Grnet. Gr/) was used to analyze the GO and KEGG signal pathways of miRNA target genes to explore the biological functions of target genes.

3. Results

3.1. The Effects of Overexpression of hsa_circ_0061817 on the Viability and Proliferation of A549 and LLC-LUC Cells

Compared with those in PLO-circ group, the expression levels of hsa_circ_0061817 in OE-ciR 0061817 group were significantly increased in A549 (17.28 ± 1.24 vs. 1.08 ± 0.24; t = 7.986, P = 0.003) and LLC-LUC cells (12.47 ± 1.15 vs. 1.04 ± 0.35; t = 5.581, P = 0.008). Compared with PLO-ciR group, the cell viability was significantly lower in the A549 cells in OE-ciR 0061817 group transfected with hsa_circ_0061817 plasmids for 48 hours (0.61 ± 0.13 vs. 0.86 ± 0.14; t = 3.765, P = 0.030) (Figure 1(a)). The cell viability of LLC-LUC cells decreased significantly at 72 h (0.82 ± 0.12 vs. 1.15 ± 0.18; t = 4.584, P = 0.010) and 96 h (1.16 ± 0.18 vs. 1.72 ± 0.25; t = 5.679, P = 0.005) (Figure 1(b)). The results of cell clone formation and EdU staining showed that compared with PLO-circ group, in OE-ciR 0061817 group, the number of clones formed by A549 cells (15.33 ± 2.51 vs. 37.66 ± 4.72; t = 6.709, P = 0.003) and LLC-LUC cells (22.41 ± 3.05 vs. 53.42 ± 6.50; t = 5.857, P = 0.003) decreased significantly (Figure 1(c)). The DNA replication activity of A549 (35.60 ± 3.49 vs. 60.00 ± 5.89; t = 4.528, P = 0.01) and LLC-LUC (28.48 ± 5.27 vs. 71.60 ± 7.54; t = 9.847, P = 0.001) decreased significantly (Figure 1(d)).

3.2. Effect of Overexpression of hsa_circ_0061817 on the Invasive Ability of A549 and LLC-LUC Cells

The results of Transwell experiment showed that compared with the PLO-ciR group, the number of A549 (72.67 ± 9.29 vs. 149.78 ± 16.26; t = 7.782, P = 0.002) and LLC-LUC cells (114.35 ± 14.64 vs. 184.65 ± 19.50; t = 6.342, P = 0.003) passing through the chamber decreased significantly in OE-ciR 0061817 group (Figure 2).

3.3. Effects of Overexpression of hsa_circ_0061817 on Apoptosis and Epithelial Mesenchymal Transition of A549 and LLC-LUC Cells

The results of flow cytometry showed that the percentage of apoptosis in the A549 (19.92 ± 1.13% ratio of OE-ciR 0061817 group compared with PLO-ciR group 7.82 ± 1.05%; t = 7.225, P < 0.001) and LLC-LUC (22.44 ± 1.18% ratio of OE-ciR 0061817 group compared with PLO-ciR group 5.67 ± 1.07%; t = 11.509, P = 0.0025) increased significantly in OE-ciR 0061817 group compared to PLO-ciR group (Figure 3). Western blot showed that compared with the PLO-ciR group, the protein expression level of caspase 3 of A549 and LLC-LUC cells in OE-ciR 0061817 group (3.83 ± 0.24 vs. 1.00 ± 0.09; t = 6.863, P = 0.002 and 4.68 ± 0.27 vs. 1.00 ± 0.09; t = 7.024, P = 0.001), caspase 7 (1.84 ± 0.22 vs. 1.00 ± 0.11; t = 3.295, P = 0.04 and 2.44 ± 0.12 vs. 1.00 ± 0.10; t = 6.008, P = 0.004), caspase 9 (1.40 ± 0.07 vs. 1.00 ± 0.06; t = 4.408, P = 0.012 and 1.46 ± 0.11 vs. 1.00 ± 0.09; t = 6.278, P = 0.004), E-cadherin (3.11 ± 0.20 vs. 1.00 ± 0.09; t = 12.453, P = 0.002 and 4.36 ± 0.22 vs. 1.00 ± 0.15; t = 10.867, P = 0.001), vimentin (0.28 ± 0.02 vs. 1.00 ± 0.09; t = 7.242, P = 0.002 and 0.38 ± 0.04 vs. 1.00 ± 0.10; t = 5.694, P = 0.004), and N-cadherin (0.23 ± 0.03 vs. 1.00 ± 0.08; t = 6.480, P = 0.003 and 0.33 ± 0.04 vs. 1.00 ± 0.10; t = 7.446, P = 0.001) decreased significantly (Figure 4).

3.4. Effect of Overexpression of hsa_circ_0061817 on the Growth of LLC-LUC Cells in Nude Mice

The results of subcutaneous tumorigenesis experiment in nude mice showed that the subcutaneous tumor volume of OE-ciR 0061817 group increased slowly from the 20th day compared with PLO-ciR group, and the difference was statistically significant (0.41 ± 0.12 cm3 vs. 0.64 ± 0.07 cm3; t = 7.682, P = 0.002) (Figure 5). On the 30th day, the subcutaneous tumor weight of mice in OE-circ 0067582 group was significantly lower than that in PLO-ciR group (0.48 ± 0.25 g vs. 1.36 ± 0.13 g; t = 3.526, P = 0.0125).

3.5. Construction of ceRNA Network and Functional Enrichment Analysis

Through the prediction of TargetScan and miRnada database, it was found that hsa_circ_0067582 can match has-mir-181b-3P, has-mir-337-3P, has-mir-421, and has-mir-548d-3P through seed sequence (Figure 6(a)). The downstream targets of the above miRNAs were obtained from the TarBase database, and the hsa_circ_0061817 miRNA mRNA network was constructed by Cytoscape software (Figure 6(b)). Venny2 1 software construction Wayne diagram results show that different miRNAs connect multiple common downstream targets (Figure 6(c)). The results of functional enrichment analysis showed that the predicted targets of miRNA were involved in a variety of biological functional processes, such as negative regulation of apoptosis, RNA binding, and gene expression (Figure 6(d)) and were associated with a variety of cancer-related pathways, such as proteoglycan, mRNA monitoring pathway, transcriptional imbalance in cancer, transforming growth factor-β (TGF-β), and P53 signaling pathway (Figure 6(e)).

4. Discussion

circRNA is a new type of noncoding RNA member composed of one or more spliced exons or introns, which has the characteristics of conservation, richness, and tissue specificity, so it may play a special molecular marker role in some diseases (such as tumors) [25]. circRNA can regulate gene expression by alternative splicing, regulating the expression of parental genes, and acting as a scaffold for protein complex assembly and RNA protein interaction and affect the occurrence and development of tumors [26, 27].

Previous studies have found that hsa_circ_0061817 is closely related to nonsmall lung adenocarcinoma and has the potential as a biomarker for the prevention and diagnosis of nonsmall lung adenocarcinoma [28, 29]. Li et al. showed that hsa_circ_0061817 partially inhibited NSCLC cell cancer partly by degrading IGF2BPs [30]. Our research showed that overexpression of hsa_circ_0061817 could inhibit the cell viability, proliferation, and invasion of A549 and LLC-LUC cells and promote the apoptosis of A549 and LLC-LUC cells. In addition, overexpression of hsa_circ_0061817 in A549 and LLC-LUC cells was accompanied by the increase of the expression levels of the apoptosis-related proteins like caspase 3, caspase 7, and caspase 9. Additionally, Kong et al. found that hsa through KEGG and GO analyses of mir path_circ_0061817 may be involved in galactose metabolism, intercellular junctions, N-glycoside synthesis, stem cell pluripotency, and TGF by binding with hsa-mir-148a-5p-β signal and other related signal pathways to regulate the development of lung adenocarcinoma [31]. Epithelial mesenchymal transition (EMT) is a phenomenon that epithelial cells transform into mesenchymal cells. It is not only involved in embryonic development and normal physiology but also involved in many pathological processes. EMT is also involved in the occurrence and development of tumors, especially in promoting tumor invasion and metastasis. Studies have shown that tumor cells enhance the ability of tumor cell migration and movement by means of EMT and promote tumor invasion and metastasis [32]. More and more studies have shown that EMT is an important link in tumor invasion and metastasis [33, 34] and promotes the invasion and migration ability of lung cells [35]. Its main characteristics are the increase of vimentin expression and the decrease of E-cadherin expression. The latest review by Patel et al. clarified that the identity and plasticity of cancer cells are required for transitional states such as epithelial mesenchymal transition (EMT) and mesenchymal epithelial transition (MET) in the occurrence, development, and metastasis of primary tumors. The functional roles of EMT, MET, and partial state (called PEMT) may vary depending on tumor type, spreading state, and degree of metastatic colonization [36]. Our study found that the overexpression of hsa_circ_0061817 significantly increased the expression level of E-cadherin in A549 and LLC-LUC cells and significantly decreased the expression level of vimentin and N-cadherin, suggesting that the overexpression of hsa_circ_0061817 may inhibit the invasion of A549 and LLC-LUC cells by inhibiting the process of EMT. At the same time, LLC-LUC cells overexpressing hsa_circ_0061817 slowed down the growth of subcutaneous transplanted tumors in nude mice. These results suggested that hsa_circ_0061817 may play an important role in the occurrence and development of lung adenocarcinoma, and hsa_circ_0061817 was expected to become a new therapeutic target for lung adenocarcinoma.

Studies have shown that circRNA can play an important role in the occurrence and development of tumors directly or indirectly [37]. In addition, ceRNA has greatly expanded the functional genetic information in the human genome and enriched the understanding of the potential mechanisms of tumorigenesis. According to the prediction of TargetScan and miRnada database, hsa_circ_0061817 may competitively bind multiple miRNAs, namely, has-mir-181b-3P, has-mir-337-3P, has-mir-421, and has-mir-548d-3p. It has been reported that has-mir-421 is closely related to lung adenocarcinoma. The results of Chen et al. [38] showed that the increased expression level of has-mir-421 in plasma can significantly distinguish normal people, especially in early lung adenocarcinoma. However, has-mir-181b-3P, has-mir-337-3P, and has-mir-548d-3P have not been reported in lung adenocarcinoma, which is worthy of further study on their interaction with hsa_circ_0061817. Through the functional enrichment analysis of miRNA target genes, it was found that the target genes were significantly enriched in negative regulation of apoptosis, RNA binding, gene expression, mRNA monitoring pathway, transcriptional imbalance in cancer and TGF-β, P53 signaling pathway, etc. Among them, most pathways have been supported to be closely related to the mechanism of tumorigenesis, such as TGF-β signal pathway mediates EMT of lung adenocarcinoma cells and promotes the migration and invasion of lung adenocarcinoma cells [39]. These results suggest that the ceRNA network mediated by hsa_circ_0061817 is involved in many biological processes of the occurrence and development of lung adenocarcinoma.

In conclusion, the results showed that overexpression of hsa_circ_0061817 could significantly inhibit the proliferation and invasion of A549 and LLC-LUC cells and promote apoptosis. This study further revealed the role of hsa_circ_0061817 in lung adenocarcinoma and its potential molecular mechanism in its occurrence and development and provided a new direction for exploring new targets for the prevention and treatment of lung adenocarcinoma.

Acknowledgments

This work was supported by the Hainan Innovation Team Project (820CXTD448), Key R&D Project of Hainan Province (ZDYF20223), National Natural Science Foundation of China (81860001, 82011530049, and 82160012), and Postgraduate Innovation and Scientific Research Project of Hainan Medical University (HYYB2021A06). This work was also the project supported by the Hainan Province Clinical Medical Center. We are also grateful to the contributors to the public databases used in this study.

Data Availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Authors' Contributions

All authors participated in the present study. Longping Ye, Youqing Zhong, and Lihua Hu contributed equally to this work. Conception and design were carried out by Longping Ye and Youqing Zhong, data collection by Lihua Hu, data analysis by Ya Huang, drafting the article or critical revision by Xiangdong Zhou and Qi Li, and study supervision by Qi Li. All authors have read and approved the final version submitted. Longping Ye, Youqing Zhong, and Lihua Hu are the co-first authors.

Figure 1 Effects of overexpression of hsa_circ_0061817 on the cell viability and proliferation of A549 and LLC-LUC cells. (a and b) CCK-8 assay: the effect of OE-circ 0061817 plasmids on the viability of A549 and LLC-LUC cells. (c) Cell cloning assay to examine the effect of OE-circ 0061817 plasmids on the proliferation of A549 and LLC-LUC cells. (d) EdU staining was performed to determine the DNA replication activity of the OE-circ 0061817 plasmid in A549 and LLC-LUC cells (×200).

Figure 2 The effect of OE-circ 0061817 plasmids on the invasion ability of A549 and LLC-LUC cells was evaluated by Transwell assay (0.1% crystal violet staining, ×200).

Figure 3 Effect of OE-circ 0061817 plasmids on A549 and LLC_LUC cells by flow cytometry.

Figure 4 Effect of OE-circ 0067582 on the expression levels of caspase 3, caspase 7, caspase 9, E-cadherin, vimentin, and N-cadherin in A549 and LLC-LUC cells by western blot.

Figure 5 Effect of OE-circ 0061817 plasmid on tumor growth in A549 tumor-bearing nude mice.

Figure 6 The competing endogenous RNA network mediated by has_circ_0061817 in lung adenocarcinoma and the functional enrichment map of target genes. (a) The TargetScan and miRnada databases predicted has_circ_0061817 interacting microRNAs; (b) Venn diagram of hsa-mir-181b-3P, hsa-mir-337-3P, hsa-mir-421, and hsa-mir-548d-3P target genes; (c) hsa_circ_0061817-miRNA-mRNA regulatory network, with red hexagons representing hsa_circ_0061817, green prisms representing miRNAs, blue rectangles representing miRNA target genes, and yellow rectangles representing miRNA coregulated target genes; (d) GO functional enrichment plots of target genes; (e) KEGG functional enrichment plots of target genes.
==== Refs
1 Li H. Han D. Zhang L. PD-1/L1 inhibitors may increase the risk of pericardial disease in non-small-cell lung cancer patients: a meta-analysis and systematic review Immunotherapy 2022 14 7 577 592 10.2217/imt-2021-0223 35373580
2 Heersche N. Veerman G. D. M. de With M. Clinical implications of germline variations for treatment outcome and drug resistance for small molecule kinase inhibitors in patients with non-small cell lung cancer Drug Resistance Updates 2022 62, article 100832 10.1016/j.drup.2022.100832
3 Göker E. Altwairgi A. Al-Omair A. Multi-disciplinary approach for the management of non-metastatic non-small cell lung cancer in the Middle East and Africa: expert panel recommendations Lung Cancer 2021 158 60 73 10.1016/j.lungcan.2021.05.025 34119934
4 Baumann Z. der Maur P. A. Bentires‐Alj M. Feed-forward loops between metastatic cancer cells and their microenvironment-the stage of escalation EMBO Molecular Medicine 2022 14 6, article e14283 10.15252/emmm.202114283
5 Liang J. Bi G. Shan G. Jin X. Bian Y. Wang Q. Tumor-associated regulatory T cells in non-small-cell lung cancer: current advances and future perspectives Journal of Immunology Research 2022 2022 8 4355386 10.1155/2022/4355386
6 Iwamoto N. Ichinose J. Hoshi R. Positive bag lavage cytology during thoracoscopic surgery for lung cancer is a significant predictor of locoregional recurrence General Thoracic and Cardiovascular Surgery 2022 70 4 366 371 10.1007/s11748-021-01745-8 34800224
7 Entezari M. Ghanbarirad M. Taheriazam A. Long non-coding RNAs and exosomal lncRNAs: potential functions in lung cancer progression, drug resistance and tumor microenvironment remodeling Biomedicine & Pharmacotherapy 2022 150, article 112963 10.1016/j.biopha.2022.112963
8 Zhang S. X. Hanineva A. Park K. S. Wang J. J. DeAngelis M. M. Farkas M. H. Emerging roles of circular RNAs in retinal diseases Neural Regeneration Research 2022 17 9 1875 1880 10.4103/1673-5374.335691 35142661
9 Sharma A. R. Banerjee S. Bhattacharya M. Saha A. Lee S. S. Chakraborty C. Recent progress of circular RNAs in different types of human cancer: technological landscape, clinical opportunities and challenges (review) International Journal of Oncology 2022 60 5 10.3892/ijo.2022.5346 35362541
10 Zheng Y. L. Guo J. B. Song G. The role of circular RNAs in neuropathic pain Neuroscience and Biobehavioral Reviews 2022 132 968 975 10.1016/j.neubiorev.2021.10.048 34740757
11 Chen C. Xia C. Tang H. Circular RNAs involve in immunity of digestive cancers from bench to bedside: a review Frontiers in Immunology 2022 13, article 833058 10.3389/fimmu.2022.833058 35464462
12 Xu Z. Peng B. Liang Q. Construction of a ferroptosis-related nine-lncRNA signature for predicting prognosis and immune response in hepatocellular carcinoma Frontiers in Immunology 2021 12, article 719175 10.3389/fimmu.2021.719175 34603293
13 Fok E. T. Davignon L. Fanucchi S. Mhlanga M. M. The lncRNA connection between cellular metabolism and epigenetics in trained immunity Frontiers in Immunology 2019 9 p. 3184 10.3389/fimmu.2018.03184 2-s2.0-85061613666 30761161
14 Beylerli O. Gareev I. Sufianov A. Ilyasova T. Zhang F. The role of microRNA in the pathogenesis of glial brain tumors Non-coding RNA Research 2022 7 2 71 76 10.1016/j.ncrna.2022.02.005 35330864
15 Bidula S. Analysis of putative G-quadruplex forming sequences in inflammatory mediators and their potential as targets for treating inflammatory disorders Cytokine 2021 142, article 155493 10.1016/j.cyto.2021.155493 33713881
16 Wei L. Yang Y. Wang W. Xu R. Circular RNAs in the pathogenesis of sepsis and their clinical implications: a narrative review Annals of the Academy of Medicine, Singapore 2022 51 4 221 227 10.47102/annals-acadmedsg.2021405 35506405
17 Ghafouri-Fard S. Dinger M. E. Maleki P. Taheri M. Hajiesmaeili M. Emerging role of circular RNAs in the pathobiology of lung cancer Biomedicine & Pharmacotherapy 2021 141, article 111805 10.1016/j.biopha.2021.111805 34120067
18 Wang F. Yuan J.-H. Wang S.-B. Oncofetal long noncoding RNA PVT1 promotes proliferation and stem cell-like property of hepatocellular carcinoma cells by stabilizing NOP2 Hepatology 2014 60 4 1278 1290 10.1002/hep.27239 2-s2.0-84927743632 25043274
19 Su M. Xiao Y. Ma J. Long non-coding RNAs in esophageal cancer: molecular mechanisms, functions, and potential applications Journal of Hematology & Oncology 2018 11 1 p. 118 10.1186/s13045-018-0663-8 2-s2.0-85053512625 30223861
20 Salmena L. Poliseno L. Tay Y. Kats L. Pandolfi P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 2011 146 3 353 358 10.1016/j.cell.2011.07.014 2-s2.0-79961170994 21802130
21 Wang P. Zhi H. Zhang Y. miRSponge: a manually curated database for experimentally supported miRNA sponges and ceRNAs Database: The Journal of Biological Databases and Curation 2015 2015, article bav098 10.1093/database/bav098 2-s2.0-84943192833
22 Liu J. Li H. Zheng B. Sun L. Yuan Y. Xing C. Competitive endogenous RNA (ceRNA) regulation network of lncRNA-miRNA-mRNA in colorectal carcinogenesis Digestive Diseases and Sciences 2019 64 7 1868 1877 10.1007/s10620-019-05506-9 2-s2.0-85061184997 30734239
23 Chu A. Liu J. Yuan Y. Gong Y. Comprehensive Analysis of Aberrantly Expressed ceRNA network in gastric cancer with and without H.pylori infection Journal of Cancer 2019 10 4 853 863 10.7150/jca.27803 2-s2.0-85061584664 30854091
24 Bai Y. Long J. Liu Z. Comprehensive analysis of a ceRNA network reveals potential prognostic cytoplasmic lncRNAs involved in HCC progression Journal of Cellular Physiology 2019 234 10 18837 18848 10.1002/jcp.28522 2-s2.0-85063429563 30916406
25 Xue C. Li G. Zheng Q. The functional roles of the circRNA/Wnt axis in cancer Molecular Cancer 2022 21 1 p. 108 10.1186/s12943-022-01582-0 35513849
26 Choi S. S. Kim S. E. Oh S. Y. Ahn Y. H. Clinical implications of circulating circular RNAs in lung Cancer Biomedicines 2022 10 4 p. 871 10.3390/biomedicines10040871 35453621
27 Gao Y. Shang S. Guo S. Lnc2Cancer 3.0: an updated resource for experimentally supported lncRNA/circRNA cancer associations and web tools based on RNA-seq and scRNA-seq data Nucleic Acids Research 2021 49 D1 D1251 D1258 10.1093/nar/gkaa1006 33219685
28 Ge P. Zhang J. Zhou L. CircRNA expression profile and functional analysis in testicular tissue of patients with non-obstructive azoospermia Reproductive Biology and Endocrinology 2019 17 1 p. 100 10.1186/s12958-019-0541-4 31775841
29 Xie H. Yao J. Wang Y. Ni B. Exosome-transmitted circVMP1 facilitates the progression and cisplatin resistance of non-small cell lung cancer by targeting miR-524-5p-METTL3/SOX2 axis Drug Delivery 2022 29 1 1257 1271 10.1080/10717544.2022.2057617 35467477
30 Li B. Zhu L. Lu C. circNDUFB2 inhibits non-small cell lung cancer progression via destabilizing IGF2BPs and activating anti-tumor immunity Nature Communications 2021 12 1 p. 295 10.1038/s41467-020-20527-z 33436560
31 Kong M. Li H. Yuan W. Mao L. Chen J. The role of Circ_PRKCI/miR-24-3p in the metastasis of prostate cancer Journal of BUON 2021 26 3 949 955 34268958
32 Fu D. Senouthai S. Wang J. You Y. FKN facilitates HK-2 cell EMT and tubulointerstitial lesions via the Wnt/β-catenin pathway in a murine model of lupus nephritis Frontiers in Immunology 2019 10 p. 784 10.3389/fimmu.2019.00784 2-s2.0-85067068313 31134047
33 Liu X. Huang X. Ma J. 3’untranslated regions (3’UTR) of Gelsolin mRNA displays anticancer effects in non-small cell lung cancer (NSCLC) cells American Journal of Cancer Research 2021 11 8 3857 3876 34522454
34 Shao S. Piao L. Guo L. Tetraspanin 7 promotes osteosarcoma cell invasion and metastasis by inducing EMT and activating the FAK-Src-Ras-ERK1/2 signaling pathway Cancer Cell International 2022 22 1 p. 183 10.1186/s12935-022-02591-1 35524311
35 Hu Y. Bai J. Zhou D. The miR-4732-5p/XPR1 axis suppresses the invasion, metastasis, and epithelial-mesenchymal transition of lung adenocarcinomaviathe PI3K/Akt/GSK3β/Snail pathway Molecular Omics 2022 18 5 417 429 10.1039/D1MO00245G 35388387
36 Patel S. Alam A. Pant R. Chattopadhyay S. Wnt signaling and its significance within the tumor microenvironment: novel therapeutic insights Frontiers in Immunology 2019 10 p. 2872 10.3389/fimmu.2019.02872 31921137
37 Xu J. Sang N. Zhao J. He W. Zhang N. Li X. Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR-1301-3p/KIF23 axis Molecular Medicine Reports 2022 25 6 10.3892/mmr.2022.12718 35475447
38 Chen J. Xu L. Fang M. Xue Y. Cheng Y. Tang X. Hsa_circ_0060927 participates in the regulation of Caudatin on colorectal cancer malignant progression by sponging miR-421/miR-195-5p Journal of Clinical Laboratory Analysis 2022 36 5, article e24393 10.1002/jcla.24393 35373390
39 Han G. Wang Y. Liu T. Salvianolic acid B acts against non-small cell lung cancer A549 cells via inactivation of the MAPK and Smad2/3 signaling pathways Molecular Medicine Reports 2022 25 5 10.3892/mmr.2022.12700 35348194
