
==== Front
Nat Cardiovasc Res
Nat Cardiovasc Res
Nature Cardiovascular Research
2731-0590
Nature Publishing Group UK London

39271818
538
10.1038/s44161-024-00538-5
Article
The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration
Goumenaki Pinelopi 123
http://orcid.org/0000-0002-5594-4549
Günther Stefan 234
Kikhi Khrievono 5
http://orcid.org/0000-0003-1495-9530
Looso Mario 236
Marín-Juez Rubén 78
http://orcid.org/0000-0002-0382-0026
Stainier Didier Y. R. didier.stainier@mpi-bn.mpg.de

123
1 https://ror.org/0165r2y73 grid.418032.c 0000 0004 0491 220X Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
2 https://ror.org/031t5w623 grid.452396.f 0000 0004 5937 5237 DZHK German Centre for Cardiovascular Research, Partner Site Rhine-Main, Bad Nauheim, Germany
3 https://ror.org/04ckbty56 grid.511808.5 Cardio-Pulmonary Institute (CPI), Bad Nauheim, Germany
4 https://ror.org/0165r2y73 grid.418032.c 0000 0004 0491 220X Bioinformatics and Deep Sequencing Platform, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
5 https://ror.org/0165r2y73 grid.418032.c 0000 0004 0491 220X Flow Cytometry Service Group, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
6 https://ror.org/0165r2y73 grid.418032.c 0000 0004 0491 220X Bioinformatics Core Unit (BCU), Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
7 grid.411418.9 0000 0001 2173 6322 Centre Hospitalier Universitaire Sainte-Justine Research Centre, Montreal, Quebec Canada
8 https://ror.org/0161xgx34 grid.14848.31 0000 0001 2104 2136 Department of Pathology and Cell Biology, University of Montreal, Montreal, Quebec Canada
13 9 2024
13 9 2024
2024
3 9 11581176
7 4 2024
6 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The innate immune response is triggered rapidly after injury and its spatiotemporal dynamics are critical for regeneration; however, many questions remain about its exact role. Here we show that MyD88, a key component of the innate immune response, controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. We find in cryoinjured myd88−/− ventricles a significant reduction in neutrophil and macrophage numbers and the expansion of a collagen-rich endocardial population. Further analyses reveal compromised PI3K/AKT pathway activation in the myd88−/− endocardium and increased myofibroblasts and scarring. Notably, endothelial-specific overexpression of myd88 reverses these neutrophil, fibrotic and scarring phenotypes. Mechanistically, we identify the endocardial-derived chemokine gene cxcl18b as a target of the MyD88 signaling pathway, and using loss-of-function and gain-of-function tools, we show that it controls neutrophil recruitment. Altogether, these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis during tissue regeneration.

Goumenaki et al. uncover that during zebrafish cardiac regeneration, MyD88 signaling promotes the inflammatory response to injury and attenuates the endocardial-mediated fibrotic response.

Subject terms

Innate immunity
Cardiac regeneration
Cardiovascular genetics
Transcriptomics
This research was supported by funds from the Max Planck Society as well as awards from the European Research Council (ERC) under the European Union’s research and innovation programs (AdG 694455-ZMOD and AdG 101021349-TAaGC) to D.Y.R.S.issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcMain

Myocardial infarction is the most common cause of cardiac injury in humans, often leading to an irreversible loss of heart muscle tissue1,2. Unlike the adult mammalian heart, the zebrafish heart can regenerate lost tissue upon different types of injuries, making it a powerful animal model to study heart regeneration3–6.

Immediately after cardiac injury, tissue damage triggers the activation of a sterile inflammatory response, with immune cells infiltrating the injured area, clearing dead cells and debris, modifying the extracellular matrix (ECM) and initiating signaling cascades7,8. As shown previously, this response is programmed to be resolved timely and is essential for triggering the regenerative response in both zebrafish9–11 and neonatal mice12. On the other hand, in the non-regenerative adult mammalian heart, inflammation persists longer and has been linked with tissue damage after myocardial infarction13,14. Thus, it is essential that the inflammatory response is tightly controlled to allow for successful regeneration14.

Cardiac inflammation after injury involves the release of damage-associated molecular pattern (DAMP) molecules from dying and stressed cells, which bind to Toll-like receptors (TLRs)15–17. Importantly, most TLRs, as well as interleukin-1 receptors (IL-1Rs), signal through the same adaptor molecule, myeloid differentiation factor 88 (MyD88)18,19. While the MyD88 signaling pathway is involved in the activation of the immune response, a comprehensive understanding of its role in cardiac repair and regeneration remains elusive, with studies reporting conflicting results14,20,21. As excessive and persistent inflammation has been linked with adverse regeneration outcomes, studies have often focused on blocking MyD88 or TLR function to restrict inflammation. Limiting inflammation in MyD88 or TLR loss-of-function (LOF) mouse models improved their regenerative potential22–24. Conversely, TLR4-MyD88 activation in mesenchymal stem cells conferred cardioprotective effects in cardiac ischemia–reperfusion injury models in mouse25, TLR4-MyD88 activation in cardiomyocytes (CMs) reduced their apoptosis in vitro26, and MyD88 cardioprotective effects were highlighted in a rat aortic banding model27. The critical role of MyD88 signaling in preserving cardiac function and limiting progression to heart failure was also shown in a dominant negative MyD88 transgenic mouse model28. Depletion of MyD88 in T cells results in increased inflammation and fibrosis after transverse aortic constriction in mouse29. While most of these studies were carried out in non-regenerative mammalian models, understanding the role of MyD88 in a regenerative system should provide insights into the pathogenesis of cardiovascular diseases and the development of new treatment approaches. In addition, the precise roles of the MyD88 signaling axis beyond cardiovascular inflammation and its contribution to other responses necessary for regeneration have so far been largely overlooked. Therefore, we directed our study toward unraveling the cell-specific functions of MyD88 signaling during cardiac regeneration in zebrafish.

In this study, we use newly generated genetic tools and transcriptomic profiling to investigate the role of MyD88 signaling during zebrafish cardiac regeneration at several stages and across different cell types; we find that MyD88 not only has a pivotal role in the immune response, but also a previously unidentified function in limiting endothelial-mediated fibrosis. Specifically, we show that in addition to its role in neutrophil and macrophage recruitment, MyD88 is important to limit a fibrotic response by regulating the transcriptome of endocardial and mesenchymal cells and by limiting myofibroblast numbers, fibrin levels and scar sizes. Furthermore, we identify a critical role for MyD88 signaling in regulating the phosphoinositide 3 kinase (PI3K)/AKT pathway in the injured endocardium. Notably, using an endothelial-specific mutant rescue strategy, we reveal the essential role of MyD88 in endothelial cells to promote neutrophil recruitment and limit the fibrotic response. Mechanistically, we identify the endocardial chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling pathway and showed that it controls neutrophil recruitment.

Results

Reduced inflammatory cell numbers in injured myd88−/− ventricles

Genes encoding MyD88 and MyD88 pathway-related signaling components are expressed in a wide range of tissues and cell populations even in the absence of tissue damage and infection15,30,31. To begin to understand how MyD88 signaling affects different cell populations during cardiac regeneration in zebrafish, we dissociated cryoinjured ventricles from myd88 LOF mutants (myd88−/−)32 and wild-type (WT) (myd88+/+) siblings, sorted live cells and performed single-cell RNA sequencing (scRNA-seq) analysis (Fig. 1a and Supplementary Fig. 1a). We focused our analysis at the early time point of 24 hours post cryoinjury (hpci), when myd88 expression peaks in the cryoinjured zebrafish heart (Supplementary Fig. 1b)10. In addition, as the receptors of the MyD88 signaling pathway can rapidly recognize cardiac tissue damage through binding their ligands, 24 hpci is a good time point because it is within the early acute inflammatory phase33. We performed quality control analysis, applied filtering cutoffs and obtained a dataset consisting of 11,735 cells (8,181 and 3,554 myd88+/+ and myd88−/− cells, respectively). To assess cell type diversity, we took into consideration known marker genes and identified five major cell cluster populations, including endocardial cells, coronary endothelial cells (cECs), myeloid cells, epicardial and epicardium-derived cells (EPDCs) and mesenchymal cells (Fig. 1b,c)34–36. We did not detect a CM population, presumably because their large size was incompatible with our sample preparation pipeline as reported previously36. As myeloid cells activate the MyD88 signaling pathway10,22,37,38, we decided to perform unbiased subclustering of the myeloid population to investigate their diversity (Fig. 1d). This analysis revealed five distinct myeloid clusters, of which four expressed macrophage marker genes (for example, mpeg1.1, c1qa) at higher levels and one expressed neutrophil marker genes (for example, mpx, lyz) at higher levels (Fig. 1d and Extended Data Fig. 1a,b). We identified additional genes highly expressed in this presumed neutrophil cluster and indeed observed their enrichment in neutrophils in published datasets (Extended Data Fig. 1c)34–36. Comparison of the myeloid populations between myd88+/+ and myd88−/− ventricles revealed pronounced differences, such as a strong reduction of the neutrophil and the marco macrophage clusters in myd88−/− ventricles (Fig. 1d). We also observed that the expression of inflammatory genes was increased in these two clusters, suggesting that they contain pro-inflammatory cells (Fig. 1e). myd88−/− ventricles also exhibited expansion of a macrophage subpopulation that is transcriptionally unique (enriched genes: gpx1a, mrc1b, timp4.2, lxn, lta4h, csf3r, cfh) and is not present in myd88+/+ ventricles (Extended Data Fig. 1d,e).Fig. 1 Reduced numbers of pro-inflammatory cells in cryoinjured myd88−/− ventricles.

a, Experimental plan for the scRNA-seq analysis performed in cryoinjured myd88+/+ and myd88−/− ventricles at 24 hpci. b, Uniform manifold approximation and projection (UMAP) representation of the scRNA-seq clustering results. c, Heatmap showing the expression levels of the gene markers for the different cell types. d, UMAP representation of the myeloid subclusters from the scRNA-seq analysis. Areas (i) and (ii) enclose myeloid populations reduced in myd88−/− ventricles. The pie charts show the proportions of different myeloid subclusters. e, Heatmap showing inflammatory gene (il1b, cxcl8a, ifngr1, timp2b, ptgs2a) expression levels in the myeloid subclusters. f, Representative images of GFP (neutrophils, white), with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured TgBAC(mpx:GFP); myd88+/+ and TgBAC(mpx:GFP); myd88−/− ventricles at 24 and 96 hpci. GFP; immunostaining for green fluorescent protein. g, mpx:GFP+ cell numbers in myd88+/+ and myd88−/− injured tissues and border zone areas (100 μm) at 24 and 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 9 myd88+/+ and n = 7 myd88−/− for 24 hpci; n = 7 myd88+/+ and n = 8 myd88−/− for 96 hpci. Statistical tests: Student’s t-test for 24 hpci and Mann–Whitney U-test for 96 hpci. h, Representative images of immunostaining for EGFP (macrophages, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured Tg(mpeg1:EGFP); myd88+/+ and Tg(mpeg1:EGFP); myd88−/− ventricles at 24 and 96 hpci. i, mpeg1:EGFP+ cell numbers in myd88+/+ and myd88−/− injured tissues and border zone areas (100 μm) at 24 and 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 4 myd88+/+ and n = 5 myd88−/− for 24 hpci; n = 5 myd88+/+ and n = 5 myd88−/− for 96 hpci. Statistical tests: Student’s t-test. The yellow dashed lines delineate the injured area; the yellow arrowheads point to mpx:GFP+ (f) and mpeg1:EGFP+ (h) cells. Scale bars, 100 μm.

Source data

Neutrophils are known pro-inflammatory mediators and immediate responders to tissue damage39–41. They can shape the regenerative outcome because they influence important regeneration events, including clearance of dead cells and debris from the injured area, macrophage polarization, effective revascularization, epicardial activation and myocardial regeneration42–47. The MyD88 signaling axis, once activated, facilitates neutrophil recruitment22,23,37,48. To further investigate the neutrophil phenotype observed in cryoinjured myd88−/− ventricles (Fig. 1d), we used the TgBAC(mpx:GFP) neutrophil reporter line to determine neutrophil numbers after injury. While at 6 hpci we did not observe obvious differences between myd88−/− and myd88+/+ sibling ventricles (Extended Data Fig. 1f,g), at 24 hpci neutrophil numbers were significantly reduced in myd88−/− ventricles and their numbers remained reduced at least until 96 hpci (Fig. 1f,g). We also counted the number of neutrophils at 6 days post sham (dps) surgery and 7 days post cryoinjury (dpci), but did not observe any significant differences at these time points (Extended Data Fig. 1f,g). Together these data indicate that neutrophil numbers were reduced at 24 and 96 hpci in myd88−/− ventricles.

As with neutrophils, the MyD88 signaling axis contributes to macrophage recruitment10,37,38,49. Thus, we used the Tg(mpeg1:EGFP) macrophage reporter line to determine whether macrophage numbers were also affected in cryoinjured myd88−/− ventricles. Both scRNA-seq analysis and immunostaining for mpeg1:EGFP+ cells revealed that total macrophage numbers were not affected in myd88−/− ventricles at 24 hpci (Fig. 1h,i and Extended Data Fig. 1h). While we did not observe a significant reduction in total macrophage numbers at 24 hpci, our transcriptomic data showed that some macrophage populations might be affected, with the marco macrophage population being severely reduced and the hp-1 macrophage population clearly increased in myd88−/− ventricles (Fig. 1d and Extended Data Fig. 1d,e). As the macrophage response initiates and develops later than the neutrophil response after injury, we set out to analyze cryoinjured ventricles at a later time point, when a macrophage phenotype might be more obvious. To this end, we selected 96 hpci, a time point when macrophage numbers increases significantly in WT zebrafish10,34,50,51, and indeed found a reduction in mpeg1:EGFP+ cells in myd88−/− ventricles compared with myd88+/+ siblings (Fig. 1h,i).

Taken together, these transcriptomic analyses and immunostaining data reveal that during zebrafish cardiac regeneration, MyD88 is important for neutrophil and macrophage recruitment and for enhancing the inflammatory state of immune cells.

MyD88 signaling attenuates fibrosis in injured ventricles

Besides analyzing myeloid cells, the most extensively studied activators of the MyD88 signaling pathway10,22,37,38, we wanted to determine which other cell types were important for MyD88 function during cardiac regeneration. As reported previously, endothelial cells express myd88 and components of the MyD88 signaling axis, such as the tlr genes52,53. To investigate the state and role of endocardial cells in the absence of MyD88 function during regeneration, we performed unbiased subclustering analysis of the endocardial population in our scRNA-seq dataset. This analysis revealed the presence of four distinct endocardial clusters, represented in different proportions in cryoinjured myd88−/− and myd88+/+ ventricles (Fig. 2a). Specifically, the most abundant endocardial cell cluster found in myd88+/+ ventricles (irx5a endocardial cells) was significantly reduced in myd88−/− ventricles. Interestingly, the most abundant endocardial cluster in myd88−/− ventricles displayed high expression levels of genes encoding collagens (col1a2, col1a1a, col5a1, col1a1b, col5a2a, col6a2, col6a1) and genes associated with fibrosis (postna, gstm.3, sparc, acta2)34,54. Hence, we annotated this cluster as ‘collagen-rich endocardial cells’ (Fig. 2a,b). Pseudotime trajectory analysis indicated that cells transition from the wound endocardial cluster serpine1 (ref. 55) to the other endocardial clusters (Extended Data Fig. 2a). To investigate the relationship between endocardial clusters, we also performed velocity analysis. The resulting data indicate that endocardial cells in myd88−/− ventricles tend to progress toward the collagen-rich endocardial state (Extended Data Fig. 2b). As shown previously in mouse56–58 and zebrafish35,59, the endocardium contributes to the activated fibroblast cell population and to α-smooth muscle actin (αSMA)+ myofibroblasts in injured hearts; thus, increased expression of collagen and fibrotic genes in the cryoinjured myd88−/− endocardium (Fig. 2a,b) could reflect an increase in these endocardium-derived cells. αSMA+ myofibroblasts are the key contributors to ECM fibrotic remodeling and scar formation in the injured heart56,58,60. Moreover, in the context of MyD88 signaling, MyD88 depletion in T cells results in increased cardiac fibroblast to myofibroblast transformation in vitro, as indicated by elevated αSMA and collagen type 1 expression in fibroblasts29. To investigate the role of MyD88 in myofibroblast differentiation during zebrafish cardiac regeneration, we immunostained for αSMA expression on sections of cryoinjured ventricles carrying the ET(krt4:EGFP) endocardial enhancer trap line (Fig. 2c). At 96 hpci, we found an increased abundance of αSMA+ cells in myd88−/− compared with myd88+/+ siblings (Fig. 2c,d), which remained elevated until 7 dpci (Extended Data Fig. 2c,d). To differentiate between αSMA+ cells of different origins, we quantified intraventricularly localized αSMA+ cells, presumably of endocardial and fibroblast origin, and excluded superficially localized αSMA+ cells, presumably of epicardial, fibroblast and perivascular origin35,61. In line with the fibrotic transcriptomic profile of the myd88−/− endocardium (Fig. 2a,b), at 96 hpci we found an increased number of intraventricular αSMA+ cells in myd88−/− zebrafish compared with myd88+/+ siblings (Fig. 2d). Superficially localized αSMA+ cells were also elevated in cryoinjured myd88−/− ventricles (Extended Data Fig. 2e), but not to the same extent as the intraventricularly localized αSMA+ cells. Altogether, these data indicate that MyD88 suppresses myofibroblast differentiation during zebrafish cardiac regeneration.Fig. 2 Fibrotic phenotype in cryoinjured myd88−/− ventricles.

a, UMAP representation of the endocardial subclusters from the scRNA-seq analysis. The pie charts show the proportions of different endocardial subclusters. b, Heatmap showing fibrotic gene (postna, col1a2, col1a1a, gstm.3, col5a1, sparc, col1a1b, col5a2a, col6a2, col6a1, acta2) expression levels in the endocardial subclusters. c, Representative images of immunostaining for EGFP (endocardial cells, magenta) and αSMA (myofibroblasts, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. d, Total number of αSMA+ cells and intraventricular αSMA+ cells in myd88+/+ and myd88−/− injured tissues at 96 hpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 13 myd88+/+ and n = 11 myd88−/−. Statistical tests: Student’s t-test. e, Representative images of AFOG staining on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 14 and 30 dpci. f, Pie charts showing the proportion of scar components (collagen, blue; fibrin, red; rest of cells and tissue, light brown) in myd88+/+ and myd88−/− scars; n = 6 myd88+/+ and n = 6 myd88−/− for both 14 and 30 dpci. g, Graph showing the percentage of the fibrin/scar area at 14 and 30 dpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 6 myd88+/+ and n = 6 myd88−/−. Statistical test: Student’s t-test. The yellow dashed lines delineate the injured area and the black dashed lines the scar area; the yellow arrowheads point to αSMA+ cells. Scale bars, 100 μm (c), 200 μm (e).

Source data

Activation of MyD88 signaling in mesenchymal stem cells reportedly conferred cardioprotective effects via Stat3 in a mouse model of cardiac ischemia–reperfusion injury25. As myofibroblasts, a mesenchymal cell type, are affected in myd88−/− ventricles, we decided to take a closer look at the mesenchymal population in our scRNA-seq dataset. Unbiased subclustering analysis indicated the presence of three mesenchymal subclusters. Strikingly, strong differences between the myd88−/− and myd88+/+ samples resulted in one cluster (hapln1a mesenchymal cells) being of almost completely myd88−/− and another (cst14a.1 mesenchymal cells) being of almost completely myd88+/+ identity (Extended Data Fig. 2f). Specifically, the myd88−/− hapln1a mesenchymal cell cluster exhibited increased expression of endothelial-to-mesenchymal transition and fibrotic-related genes, such as sox9a and acta2 (Extended Data Fig. 2g,h)59.

As our data pointed to an endocardial-related fibrotic phenotype in cryoinjured myd88−/− ventricles, we next analyzed additional endocardial processes that could be affected in the absence of myd88 function. Endocardial hyperinvasion of the injured area has been linked with increased endothelial-to-mesenchymal transition and fibrotic remodeling59. However, we did not observe any obvious differences between myd88−/− and myd88+/+ siblings with respect to the krt4:EGFP+ and Cdh5+ endocardial cell area covering the injury at 96 hpci (Extended Data Fig. 3a,b) or 7 dpci (Extended Data Fig. 3c,d), respectively. Additionally, the Aldh1a2 activation pattern was similar in myd88−/− and myd88+/+ sibling ventricles at 96 hpci (Extended Data Fig. 3a)55, indicating that only endothelial-to-mesenchymal transition processes were affected in cryoinjured myd88−/− ventricles.

Blocking MyD88 signaling in uninjured murine hearts leads to increased fibrosis28. To investigate the regenerative potential and scar resolution abilities of cryoinjured myd88−/− ventricles, we performed acid fuchsin orange G (AFOG) staining. As reported previously, scar tissue in 14 dpci WT hearts consists of an extensive collagen network and a ring-like peripheral fibrin structure5,33,62. In contrast, the scar tissue in myd88−/− ventricles at 14 dpci displayed thicker fibrin-rich areas in comparison with their myd88+/+ siblings (Fig. 2e), and these increased fibrin levels persisted until at least until 30 dpci (Fig. 2e–g). However, the collagen proportions within the scars remained similar between myd88−/− and myd88+/+ siblings (Extended Data Fig. 4a). Additionally, at 30 dpci, there were more myd88−/− ventricles with bigger scar areas compared with their myd88+/+ siblings (Extended Data Fig. 4b). We also examined scars at 90 dpci to analyze fibrotic tissue persistence, but did not observe significant differences at this time point (Extended Data Fig. 4c,d).

In summary, the fibrotic-like transcriptomic profile (enrichment in collagen and fibrotic genes) observed in both endocardial and mesenchymal cells, along with the increased number of total and intraventricular αSMA+ cells, increased fibrin levels and larger scars in cryoinjured myd88−/− hearts, collectively indicate that MyD88 signaling has a role in limiting fibrosis during zebrafish cardiac regeneration.

Endocardial MyD88 signaling activates the PI3K/AKT pathway

To gain mechanistic insights into how MyD88 signaling regulates endocardial-specific processes during regeneration, we sorted endocardial cells from myd88−/− and myd88+/+ siblings using the ET(krt4:EGFP) line at 96 hpci and conducted bulk RNA-seq analysis (Fig. 3a and Supplementary Fig. 2). In line with the previously observed fibrotic phenotype (Fig. 2), gene set enrichment analysis (GSEA) revealed an increase in the regulation of the cellular response to transforming growth factor-β stimulus in the cryoinjured myd88−/− endocardium (Extended Data Fig. 5a). Additionally, GSEA (Extended Data Fig. 5a) and closer examination of the most differentially expressed genes (Fig. 3b) revealed that immune-associated processes, such as TLR, nucleotide-binding oligomerization domain (NOD)-like receptor, C-type lectin receptor and cytosolic DNA-sensing signaling pathways, as well as the mitogen-activated protein kinase (MAPK) signaling pathway, were impaired in the myd88−/− endocardium. As the MAPK signaling pathway has been linked with the activated endocardium in both the cardiac resection63,64 and cryoinjury51 models, we immunostained for phosphoERK (pERK), an indicator of activated MAPK signaling, in ET(krt4:EGFP) ventricles and verified its presence in the endocardium at 96 hpci. However, we did not observe statistically significant differences in the pERK+ cell area covering the injury between myd88−/− and myd88+/+ siblings (Extended Data Fig. 6a,b), indicating that defective MAPK signaling was not responsible for the endocardial phenotype observed in myd88−/− ventricles. This observation is in line with a previous study where lipopolysaccharide treated Myd88−/− mice displayed activation of the MAPK signaling pathway65.Fig. 3 The PI3K/AKT signaling pathway is suppressed in the myd88−/− endocardium.

a, Experimental plan for bulk RNA-seq analysis on sorted endocardial cells from ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. b, Heatmap showing differential expression of significantly (P < 0.05) downregulated genes in the myd88−/− endocardium at 96 hpci. c, Representative images of immunostaining for EGFP (endocardial cells, blue), Fli1 (endothelial cell nuclei, magenta) and pAkt (phosphoAkt, green) on sections of cryoinjured ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. d, krt4:EGFP+Fli1+pAkt+/krt4:EGFP+Fli1+ cell percentage in myd88+/+ and myd88−/− 50-μm-wide areas on the basal-most side of the injured tissue at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 8 myd88+/+ and n = 5 myd88−/−. Statistical test: Student’s t-test. e, Representative images of immunostaining for EGFP (endocardial cells, blue), Fli1 (endothelial cell nuclei, magenta) and PCNA (proliferation marker, green) on sections of cryoinjured ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. f, krt4:EGFP+Fli1+PCNA+/krt4:EGFP+Fli1+ cell percentage in myd88+/+ and myd88−/− 50-μm-wide areas on the basal-most side of the injured tissue at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 7 myd88+/+ and n = 5 myd88−/−. Statistical test: Student’s t-test. The yellow dashed lines delineate the injured area; the yellow arrowheads point to krt4:EGFP+Fli1+pAkt+ (c) and krt4:EGFP+Fli1+PCNA+ (e) cells; the red arrowheads (c) point to krt4:EGFP+Fli1+pAkt− cells. Scale bars, 100 μm.

Source data

GSEA and examination of the most differentially expressed genes (DEGs) (Fig. 3b, Supplementary Table 1 and Extended Data Fig. 5a,b) further indicated that activation of the PI3K/AKT pathway is impaired in the myd88−/− endocardium. Additionally, GSEA terms related to upstream (ErBB, IGF, VEGF, FGF and NGF pathways) and downstream components (mTOR pathway) of PI3K/AKT signaling were substantially downregulated in the cryoinjured myd88−/− endocardium (Extended Data Fig. 5a,b)64,66–69. Interestingly, MyD88 signaling can also regulate PI3K/AKT pathway activation28,70,71. Hence, we costained for phospho-Akt (pAkt), which indicates activation of PI3K/AKT signaling when present in the nucleus, together with the nuclear endothelial cell marker Fli1 in sections of ET(krt4:EGFP) ventricles and found a tendency for reduced activation of the PI3K/AKT pathway in myd88−/− endocardial cells at 96 hpci (Fig. 3c,d). Given that PI3K/AKT activation affects cell proliferation68,72, we then assessed endocardial proliferation at 96 hpci, when it reaches high levels in WT55,68. Notably, we found significantly reduced proliferation in myd88−/− endocardial cells at 96 hpci (Fig. 3e,f).

In summary, these findings underscore the critical role of MyD88 in regulating signaling cascades in the injured endocardium. Particularly, we identified impairments in the immune response, in the activation of the PI3K/AKT pathway and in endocardial cell proliferation in cryoinjured myd88−/− ventricles.

MyD88 signaling promotes revascularization and CM repopulation

Revascularization is one of the earliest processes observed in the injured area and it is vital for effective cardiac tissue regeneration73,74. Following cryoinjury of the zebrafish ventricle, cECs undergo proliferation and initiate the sprouting of new vessels, both superficially and intraventricularly. While intraventricular revascularization is orchestrated by endocardial vascular endothelial growth factor A signaling, superficial revascularization is partially regulated by Apelin signaling74. We found that both endocardial VEGF and Apelin signaling pathways were impaired in cryoinjured myd88−/− ventricles (Extended Data Fig. 5a). Additionally, neutrophils, which were significantly reduced in myd88−/− ventricles (Fig. 1d,f,g), express VEGF and promote revascularization42,44,46. Hence, we used the Tg(-0.8flt1:RFP) reporter line, which labels cECs and assessed their proliferation at 96 hpci, when cEC proliferation peaks in cryoinjured WT ventricles74. We found that cEC proliferation was significantly reduced at 96 hpci in myd88−/− hearts when compared with myd88+/+ siblings (Extended Data Fig. 7a,b). While cEC proliferation recovered by 7 dpci (Extended Data Fig. 7c,d), coronary vessel coverage in the injured area remained impaired at 7 dpci (Extended Data Fig. 7e,f) in myd88−/−. Together, these data reveal that revascularization of the injured area was affected in cryoinjured myd88−/− ventricles.

During cardiac regeneration in zebrafish, CMs undergo dedifferentiation and proliferation to repopulate the injured tissue75–77 and this process is heavily influenced by the microenvironment surrounding the CMs78. Given the altered inflammatory and fibrotic environment in cryoinjured myd88−/− ventricles, along with the impaired numbers and functions of various cell types that precede CM appearance in the injured area, we decided to assess CM behavior. We observed a significant reduction in CM proliferation in the injury border zone at 96 hpci and 7 dpci in myd88−/− cryoinjured ventricles (Fig. 4a–d). We also examined CM proliferation at 14 dpci and dedifferentiation at 96 hpci79 but did not find any significant differences (Extended Data Fig. 8a–d). Furthermore, we quantified CM protrusive activity toward the injury at 72 hpci and 7 dpci and found that while the number of protrusions was the same between myd88−/− and myd88+/+ siblings, CM protrusions were shorter in myd88−/− ventricles at 7 dpci (Fig. 4e–g). These results highlight the essential role of MyD88 in facilitating efficient CM proliferation and protrusion toward the injured tissue during cardiac regeneration.Fig. 4 Reduced CM proliferation and reduced length of CM protrusions toward the injured tissue in cryoinjured myd88−/− ventricles.

a,c, Representative images of immunostaining for MEF2 (CM nuclei, green) and PCNA (proliferation marker, magenta) on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 96 hpci (a) and 7 dpci (c). b,d, Quantification of proliferating CMs in border zone areas (100 μm) at 96 hpci (b) and 7 dpci (d). The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 4 myd88+/+ and n = 5 myd88−/− (b); n = 5 myd88+/+ and n = 6 myd88−/− (d). Statistical tests: Student’s t-test. e, Representative images of phalloidin staining for F-actin (white) on 50-μm-thick sections of cryoinjured myd88+/+ and myd88−/− ventricles at 72 hpci and 7 dpci. f, Quantification of the number of CM protrusions. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 6 myd88+/+ and n = 5 myd88−/− for 72 hpci; n = 7 myd88+/+ and n = 7 myd88−/− for 7 dpci. Statistical tests: Student’s t-test. g, Quantification of CM protrusion length. The dots in the graph represent individual CM protrusions; data are shown as the mean ± s.d.; n = 366 myd88+/+ and n = 274 myd88−/− for 72 hpci; n = 633 myd88+/+ and n = 459 myd88−/− for 7 dpci. Statistical tests: Mann–Whitney U-test. The yellow dashed lines delineate the injured area; the yellow arrowheads point to proliferating (a,c) and protruding (e) CMs. Scale bars, 100 μm.

Source data

Endothelial myd88 overexpression reverses myd88−/− phenotypes

To investigate whether the loss of MyD88 in endothelial cells was the contributing factor for the fibrotic phenotype observed in cryoinjured myd88−/− ventricles, we specifically overexpressed (OE) myd88 in endothelial cells. For this purpose, we generated a Tg(fli1a:myd88,EGFP) line that expresses myd88 and EGFP under the control of a bidirectional fli1a promoter. As expected, myd88 expression was increased in transgenic zebrafish when compared with non-transgenic sibling larvae and adult cryoinjured ventricles (Extended Data Fig. 9a), thereby validating the overexpression ability of the tool. In addition, the transgenic EGFP signal colocalized with the endocardial Aldh1a2 signal in cryoinjured ventricles, validating the endothelial-specific expression profile of the Tg(fli1a:myd88,EGFP) line (Extended Data Fig. 9b). We analyzed myd88−/− and myd88+/+ siblings carrying the overexpression transgene and found that the previously elevated αSMA+ cells (total and intraventricular) (Fig. 2c,d) not only reverted to control levels, but also significantly decreased in cryoinjured myd88−/− ventricles at 96 hpci (Fig. 5a,b). To assess whether endothelial-specific myd88 overexpression could improve the regeneration potential of cryoinjured myd88−/− ventricles, we analyzed scars at 30 dpci. Remarkably, Tg(fli1a:myd88,EGFP); myd88−/− and myd88+/+ sibling ventricles were indistinguishable in terms of fibrin abundance and scar area size (Fig. 5c–f). Altogether, these data further indicate that endothelial MyD88 function is critical to limit fibrosis in the regenerating zebrafish heart.Fig. 5 myd88 overexpression in endothelial cells rescues the fibrotic, scarring and neutrophil phenotypes in cryoinjured myd88−/− ventricles.

a, Representative images of immunostaining for EGFP (endothelial cells, magenta) and αSMA (myofibroblasts, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− ventricles at 96 hpci. b, Total number of αSMA+ cells and of intraventricular αSMA+ cells in Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− injured tissues at 96 hpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 6 Tg(fli1a:myd88,EGFP); myd88+/+ and n = 5 Tg(fli1a:myd88,EGFP); myd88−/−. Statistical tests: Student’s t-test. c, Representative images of AFOG staining on sections of cryoinjured Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− ventricles at 30 dpci. d, Pie charts showing the proportion of scar components (collagen, blue; fibrin, red; rest of cells and tissue, light brown) in Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− scars; n = 6 Tg(fli1a:myd88,EGFP); myd88+/+ and n = 6 Tg(fli1a:myd88,EGFP); myd88−/−. e, Graph showing the percentage of fibrin/scar area at 30 dpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 6 Tg(fli1a:myd88,EGFP); myd88+/+ and n = 6 Tg(fli1a:myd88,EGFP); myd88−/−. Statistical test: Mann–Whitney U-test. f, Graph showing the representation of groups (y axis) of different scar area sizes (different colors) at 30 dpci for cryoinjured Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− ventricles. g, Representative images of immunostaining for EGFP (endothelial cells, magenta) and Mpx (neutrophils, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− ventricles at 96 hpci. h, Mpx+ cell numbers in Tg(fli1a:myd88,EGFP); myd88+/+ and Tg(fli1a:myd88,EGFP); myd88−/− injured tissues and border zone areas (100 μm) at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 6 Tg(fli1a:myd88,EGFP); myd88+/+ and n = 6 Tg(fli1a:myd88,EGFP); myd88−/−. Statistical test: Student’s t-test. The yellow dashed lines delineate the injured area; the black dashed lines delineate the scar area; the yellow arrowheads point to αSMA+ (a) and Mpx+ (g) cells. Scale bars, 100 μm (a,g), 200 μm (c).

Source data

Endothelial cells activate immune-regulatory programs, secrete cytokines and chemokines, and facilitate early immune cell recruitment in response to cardiac injury14,52,55,80. They also express MyD88 and components of the MyD88 signaling axis, including TLRs52,53. To determine whether myd88 overexpression in endothelial cells could also restore the low neutrophil levels observed in cryoinjured myd88−/− ventricles (Fig. 1d,f,g), we quantified the number of Mpx+ cells and found that neutrophil levels were indeed restored at 96 hpci (Fig. 5g,h), indicating that MyD88 function in endothelial cells is sufficient to rescue the neutrophil phenotype. Overall, these endothelial-specific myd88 overexpression experiments support the model that endothelial-specific MyD88 activation promotes neutrophil recruitment in the cryoinjured heart.

MyD88-Cxcl18b signaling promotes neutrophil recruitment after cardiac injury

To gain a deeper understanding of the targets of the MyD88 signaling pathway during zebrafish cardiac regeneration, we conducted bulk RNA-seq analysis on myd88−/− and myd88+/+ untouched (UT) ventricles and injured tissues at 1 and 24 hpci (Fig. 6a). As anticipated, we observed decreased expression of several immune-related genes in cryoinjured myd88−/− tissues, including cxcl18b (Fig. 6b). Through cross-examination of our transcriptomic datasets with publicly available datasets, we found that cxcl18b was significantly upregulated (Padj < 0.05 and FDR > 1) at early time points after cardiac injury in WT zebrafish10,81,82. cxcl18b is also upregulated in zebrafish after infection and fin amputation, where it regulates neutrophil recruitment32,83–85. Importantly, a previous study reported that cxcl18b upregulation is downstream of MyD88 signaling in infection models32; however, the specific role of Cxcl18b during cardiac regeneration remains to be elucidated. Regarding its expression pattern, cxcl18b is expressed in caudal hematopoietic and endothelial cells in infected zebrafish larvae83 and in endocardial cells in regenerating zebrafish hearts34. We used a Tg(cxcl18b:EGFP) reporter line83 to look more closely at cxcl18b expression and observed clear EGFP expression in endocardial and epicardial cells at 24 hpci (Extended Data Fig. 10a).Fig. 6 cxcl18b is activated by MyD88 signaling and controls neutrophil recruitment.

a, Experimental plan for bulk RNA-seq analysis on myd88+/+ and myd88−/− UT ventricles and injured tissues at 1 and 24 hpci. b, Heatmap showing differential expression of downregulated immune-related genes in myd88−/− UT ventricles and injured tissues at 1 and 24 hpci. c, RT–qPCR analysis of cxcl18b mRNA levels in cryoinjured myd88+/+ and myd88−/− ventricles at 1 and 96 hpci. Data are shown as the mean ± s.d.; n = 7 myd88+/+ and n = 6 myd88−/− for 1 hpci; n = 4 myd88+/+ and n = 3 myd88−/− for 96 hpci. Statistical tests: Student’s t-test. Ct values are listed in Supplementary Table 3. d, Experimental plan for Cre mRNA-injected (cxcl18b overexpression (OE)) or uninjected (control) myd88+/− and Cre mRNA-injected (cxcl18b OE) or uninjected (control) myd88−/− Tg(hsp70l:LBL-cxcl18b-t2a-mCherry); TgBAC(mpx:GFP) siblings at 24 hpci. e, Representative images of immunostaining for GFP (neutrophils, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured myd88+/− control, myd88+/− cxcl18b OE, myd88−/− control and myd88−/− cxcl18b OE TgBAC(mpx:GFP) ventricles at 24 hpci. f, mpx:GFP+ cell numbers in injured tissues and border zone areas (100 μm) at 24 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 6 myd88+/− control, n = 5 myd88+/− cxcl18b OE, n = 6 myd88−/− control and n = 5 myd88−/− cxcl18b OE. Statistical tests: Student’s t-test. g, Representative images of immunostaining for Mpx (neutrophils, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured cxcl18b+/+ and cxcl18b−/− ventricles at 24 and 96 hpci. h, Mpx+ cell numbers in cxcl18b+/+ and cxcl18b−/− injured tissues and border zone areas (100 μm) at 24 and 96 hpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 7 cxcl18b+/+ and n = 7 cxcl18b−/− for 24 hpci; n = 5 cxcl18b+/+ and n = 4 cxcl18b−/− for 96 hpci. Statistical tests: Student’s t-test. The yellow dashed lines delineate the injured area; the yellow arrowheads point to mpx:GFP+ (e) and Mpx+ (g) cells. Scale bars, 100 μm.

Source data

We next investigated cxcl18b expression using real-time quantitative polymerase chain reaction (RT–qPCR) and observed clear downregulation in cryoinjured myd88−/− ventricles compared with myd88+/+ siblings (Fig. 6c). We then developed gain-of-function and LOF genetic tools to investigate Cxcl18b function during heart regeneration. As Cxcl18b is a chemokine that attracts neutrophils, we used the gain-of-function tool to determine whether cxcl18b overexpression could restore the low neutrophil levels observed in cryoinjured myd88−/− ventricles (Fig. 1d,f,g). For this purpose, we generated a Tg(hsp70l:LBL-cxcl18b-t2a-mCherry) line, which allows for conditional overexpression of cxcl18b under the control of the hsp70l promoter upon Cre-mediated recombination using the HOTcre system86. To achieve global cxcl18b overexpression, we injected transgenic embryos with Cre mRNA and performed heat shocks (Extended Data Fig. 10b). Successful overexpression of cxcl18b and mCherry was observed using RT–qPCR (Extended Data Fig. 10c). We raised Cre mRNA-injected (cxcl18b overexpression) myd88+/− and myd88−/− zebrafish and uninjected (control) myd88+/− and myd88−/− Tg(hsp70l:LBL-cxcl18b-t2a-mCherry); TgBAC(mpx:GFP) siblings to adulthood. We then performed heat shocks and cryoinjury and quantified the number of mpx:GFP+ cells at 24 hpci (Fig. 6d). Cre mRNA-mediated recombination was validated by the detection of the recombination marker, mCherry (Extended Data Fig. 10d). While the number of mpx:GFP+ cells was reduced in control cryoinjured myd88−/− ventricles, when we overexpressed cxcl18b, there was no significant difference in neutrophil numbers between myd88−/− and myd88+/− samples, indicating that cxcl18b overexpression is sufficient to at least partially rescue the low neutrophil numbers observed in cryoinjured myd88−/− ventricles (Fig. 6e,f).

To understand how loss of Cxcl18b might affect neutrophil recruitment during cardiac regeneration, we generated a cxcl18b mutant allele using the CRISPR–Cas9 technology. As many chemokines have high sequence homology and to avoid transcriptional adaptation events87,88, we specifically generated a full locus deletion allele (Extended Data Fig. 10e). To assess cxcl18b expression levels, we performed larval fin fold amputations, which trigger cxcl18b upregulation in WT cells84,85, and collected larvae 6 hours post amputation (hpa) for RT–qPCR analysis. As anticipated, cxcl18b full locus deletion mutants completely lacked cxcl18b expression (Extended Data Fig. 10f). To examine whether lack of Cxcl18b could affect neutrophil recruitment in cryoinjured ventricles, we quantified neutrophil abundance at 24 and 96 hpci. Notably, while the Mpx+ cell count was unaffected at 24 hpci, there was a significant difference between cxcl18b−/− and cxcl18b+/+ siblings at 96 hpci (Fig. 6g,h).

In summary, these findings together indicate that Cxcl18b is a chemokine whose expression is upregulated upon cardiac cryoinjury by MyD88 and is at least partly responsible for neutrophil recruitment to the injured area.

Discussion

After cardiac injury, the zebrafish heart mounts a robust innate immune response, which is crucial for the regeneration process9–11. The precise regulation of this early immune response is essential, underscoring the need for a detailed understanding of its regulators and underlying mechanisms14. Key activators of this response are the TLR and IL-1R signaling pathways, which signal predominantly through the adapter protein MyD88 (refs. 16–19). While previous studies mostly focused on immune cells to investigate MyD88 function, in this study we examined other cell types of the heart and identified an unexplored function for MyD88: not only does it regulate the inflammatory response, but it also limits the endocardial fibrotic response to injury. Specifically, we observed a significant reduction in pro-inflammatory neutrophil and macrophage populations in cryoinjured myd88−/− ventricles. More surprisingly, we also observed in myd88−/− ventricles (1) the expansion of a collagen-rich endocardial population, (2) compromised endocardial PI3K/AKT pathway activation, (3) an increased number of myofibroblasts and (4) increased fibrin levels, as well as bigger scars. Our data further revealed that lack of MyD88 signaling impairs CM behavior in the injured area. By endothelial cell-specific overexpression of myd88, we showed that it has an essential role in the endothelial response to injury by regulating neutrophil recruitment to the injury site as well as fibrosis. Mechanistically, we identified the chemokine gene cxcl18b as a target of the MyD88 signaling pathway that controls neutrophil recruitment (Fig. 7). Overall, these data highlight the beneficial role of MyD88 activation in the regenerative response to cardiac injury in zebrafish and provide insights on how pathways activated very quickly after injury can shape the regenerative outcome.Fig. 7 Proposed model for the role of MyD88 in fibrosis and neutrophil recruitment following cardiac cryoinjury in zebrafish.

a, TLRs (and IL-1Rs) recruit the adaptor molecule MyD88 upon ligand interaction. MyD88 in turn initiates signal transduction, which leads to the activation of several processes. In endocardial cells, PI3K/AKT pathway activation and fibrosis are controlled by the MyD88 signaling pathway. Neutrophil count is also partially affected by the levels of the endocardial chemokine Cxcl18b. Immune cells also activate a MyD88-mediated response leading to several processes, including the recruitment of more immune cells and the manifestation of an inflammatory response. b, In myd88−/− injured tissues, the MyD88 signaling pathway is not activated and thus, endocardial cells exhibit decreased activation of the PI3K/AKT pathway. myd88−/− injured tissues also exhibit decreased levels of the endocardial chemokine gene cxcl18b and an increase in features related to fibrosis. In addition, the neutrophil count appears significantly reduced. As the fibrotic and the immune responses are affected, other processes essential for successful regeneration are also impaired, including revascularization and CM proliferation.

Source data

While some studies suggested that MyD88 signaling promotes the regenerative process, others reported improved outcomes when MyD88 signaling was blocked14,20,21. Our data clearly show that MyD88 is a beneficial molecule for the regenerative process in zebrafish. The discrepancy with studies reporting detrimental effects of MyD88 signaling on regeneration mostly lies in the model used. Specifically, while inflammation is essential in the early stages of regeneration9–11, prolonged and excessive inflammation can lead to adverse outcomes14,20. In non-regenerative mouse models, inflammation tends to be uncontained; thus, limiting inflammation by blocking MyD88 signaling can enhance the regeneration potential22–24,89–91. Accordingly, blocking MyD88 function has been linked with protective effects in experimental settings (for example, endotoxin shock) after lipopolysaccharide administration23,92,93. Once again, these data reflect special cases where inflammation is uncontrolled and excessive.

In addition, following myd88 overexpression in endothelial cells, we successfully reversed the reduced neutrophil number and the enhanced fibrosis phenotypes observed in cryoinjured myd88−/− ventricles, indicating that MyD88 is required in endothelial cells for the regenerative response. However, myd88 overexpression in endothelial cells in cryoinjured myd88+/+ ventricles did not lead to an increase in neutrophil numbers (Figs. 1g and 5h) or an improvement in the fibrotic response (Figs. 2c–g and 5a–f), indicating that MyD88 signaling is optimally tuned in WT conditions. Studies reported that endothelial-specific MyD88-deficient mice exhibit features of decreased inflammation94, while stimulation of the MyD88 pathway in aortic endothelial cells in rabbits promoted inflammation95. In light of our data, it will be interesting to investigate in injured mammalian hearts which cells activate MyD88 signaling and the function of the MyD88 pathway in endocardial cells.

Myeloid cells serve as key activators of the MyD88 signaling pathway in response to injury or infection22,37–40. The myd88 LOF mutant used in this study has also been used in the context of larval zebrafish tail fin regeneration, where it was reported that MyD88 controls neutrophil and macrophage recruitment to the wound37. In line with these findings, we observed reduced neutrophil and macrophage numbers in cryoinjured myd88−/− ventricles. However, we do not anticipate major differences between myd88−/− and WT zebrafish in the absence of an insult (injury or infection) that could trigger MyD88 pathway activation. As shown previously, early leukocyte hematopoiesis, migration, basal motility and phagocytosis are not affected by MyD88 deficiency32,37. In addition, transcriptomic analysis from uninfected myd88−/− and WT embryos did not reveal any differences in immune-related genes other than myd88, which was explained by the lower stability of the mutant transcript32. In our study, we also did not observe any significant differences in neutrophil count between sham-injured myd88−/− and myd88+/+ ventricles (Extended Data Fig. 1f,g). Altogether, these data indicate that the observed phenotypes in cryoinjured myd88−/− ventricles are due to the mutant’s inability to activate the pathway in response to injury rather than to preexisting developmental defects.

We expanded our investigation beyond the conventional activators of the MyD88 signaling pathway, myeloid cells, to explore the impact of the loss of MyD88 function on other cell types. Our transcriptomic analysis pointed to endocardial cells, which in myd88−/− ventricles display a fibrotic phenotype. Bulk RNA-seq analysis of endocardial cells revealed impairment in the activation of the MAPK and PI3K/AKT pathways in the myd88−/− endocardium. We elected to focus on MyD88 function in the PI3K/AKT pathway because it was more strongly affected and has not been explored as extensively as the MAPK pathway in the endocardial response during cardiac regeneration in zebrafish51,63,64. For these and other studies, we then overexpressed myd88 in endothelial cells in cryoinjured myd88−/− ventricles, which led to the reversal of the reduced neutrophil count and the enhanced fibrosis. Taken together, these findings underscore the importance of the MyD88 signaling pathway in endocardial cells and thus support the hypothesis that at least some of the myd88−/− phenotypes after cardiac injury could originate mostly in the endocardium. Unlike most myeloid cells, which need to be recruited to the injured tissue, endocardial cells are inherently present and abundant in the heart36,96. Additionally, a previous study showed that MyD88 signaling in hematopoietic cells alone was not sufficient to trigger the inflammatory response in the injured mouse heart97. Specifically, myocardial infarction in Myd88−/− and WT mice reconstituted with WT bone marrow cells led to no differences in cytokine or chemokine levels97. Furthermore, endothelial cells activate immune-regulatory programs, secrete cytokines and chemokines, and initiate immune cell recruitment52,55,80. They express the tlr and myd88 genes52,53 and at least a subgroup of endothelial cells, vascular endothelial cells, rely exclusively on MyD88 for TLR activation98. Additionally, signaling cascades commonly activated by MyD88, such as nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and PI3K/AKT, get activated in endothelial cells69,99. These studies, together with our data, emphasize the pivotal role of early MyD88 signaling activation in endocardial cells and support the hypothesis that the fibrotic phenotype in cryoinjured myd88−/− ventricles initiates in the endocardium.

During cardiac development and regeneration, the endocardium has a crucial role in signaling to CMs55,100, while the ECM supports CM behavior101–103. Given the altered inflammatory and fibrotic environment observed in cryoinjured myd88−/− ventricles, along with the impaired endocardial response preceding CM appearance in the injured area, we investigated CM behavior. Our findings revealed decreased CM proliferation and reduced CM protrusion length in cryoinjured myd88−/− ventricles. We hypothesize that the myd88−/− CM environment is not sufficiently permissive for CM protrusions to extend as they do in myd88+/+ siblings. However, we cannot exclude the possibility that CMs also activate MyD88 signaling, as activity of NF-κB, a MyD88 target, has also been reported in CMs104. Unfortunately, our scRNA-seq analysis did not manage to capture a CM population; similar challenges with CM populations have been reported in other transcriptomic studies36,105. In addition, it is probable that epicardial cells also activate MyD88 signaling during cardiac regeneration in zebrafish. The number of superficially localized αSMA+ cells, presumably of epicardial, fibroblast and perivascular origin, was also elevated in cryoinjured myd88−/− ventricles (Extended Data Fig. 2e). To draw more definitive conclusions about the role of MyD88 in CMs, epicardial cells and other cardiac cell populations, additional cell type-specific studies will need to be performed.

Our data also reveal that the expression of Cxcl18b, a neutrophil chemoattractant produced in the endocardium, is induced after MyD88 activation. Notably, we observed that cxcl18b overexpression partially rescued the reduced neutrophil count in cryoinjured myd88−/− ventricles (Fig. 6e,f). Neutrophil recruitment via Cxcl18b was previously reported not to be dependent on the dosage of Cxcl18b because receptor saturation might occur or neutrophils might not be able to get stimulated further83. Our inability to fully rescue neutrophil numbers with cxcl18b overexpression might, at least in part, be due to these issues or the involvement of other chemoattractants. We also generated a cxcl18b full locus deletion allele and showed that homozygous mutants displayed significantly reduced neutrophil numbers at 96 hpci. As there was no clear difference in neutrophil count at 24 hpci between cryoinjured cxcl18b−/− and cxcl18b+/+ ventricles, we again speculate that Cxcl18b is one of several chemokines secreted after injury and required for neutrophil recruitment83, and that its absence alone is not sufficient to trigger a difference at early time points.

In summary, our findings highlight the crucial role of MyD88 signaling in cardiac regeneration. We propose that MyD88 regulates both the inflammatory and fibrotic responses and that its early activation in the endocardium is vital for successful regeneration. Additionally, we identified the chemokine Cxcl18b as a target of MyD88 signaling that contributes to neutrophil recruitment. Gaining a deeper understanding of the early innate immune mechanisms activated in the injured heart is of vital importance because they can influence subsequent processes and thereby impact the regenerative outcome. In addition, a comprehensive understanding of the MyD88 pathway’s contribution to the regenerative response will determine whether targeting a molecule of the innate immune system could be considered as a treatment target to limit pathogenesis in cardiovascular diseases.

Methods

Zebrafish husbandry and handling

Zebrafish larvae were raised under standard conditions. Adult fish were maintained in 3.5-l tanks at a stock density of ten fish per liter with the following parameters: water temperature, 27–27.5 °C; light–dark cycle, 14:10; pH, 7.0–7.5; conductivity, 750–800 µS cm−2. Zebrafish were fed 3–5 times a day, depending on age, with granular and live food (Artemia salina). Health monitoring was performed twice a year. All procedures performed on animals conformed to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes and were approved by the Animal Protection Committee (Tierschutzkommission) of the Regierungspräsidium Darmstadt (reference nos. B2/1218 and B2/1229).

Zebrafish lines

The following mutant and transgenic lines were used: myd88hu3568 (ref. 32), cxcl18bbns683 (this study), TgBAC(mpx:GFP)i114 (ref. 106), Tg(mpeg1:EGFP)gl22 (ref. 107), ET(krt4:EGFP)sqet33-1A ref. 108, abbreviated as ET(krt4:EGFP), Tg(-0.8flt1:RFP)hu5333 (ref. 109), Tg(fli1a:myd88,EGFP)bns703 (this study), Tg(cxcl18b:EGFP)ibl150 (ref. 83) and Tg(hsp70l:loxP-TagBFP-loxP-cxcl18b-t2a-mCherry)bns660 (this study), abbreviated as Tg(hsp70l:LBL-cxcl18b-t2a-mCherry).

Generation of zebrafish mutant and transgenic lines

Sequence analysis for the generation of new lines was performed using the ApE software (v.2.0.61). To generate the cxcl18bbns683 full locus deletion allele, the CRISPR–Cas9 technology was used, as described previously110–112. The single-guide RNAs (sgRNAs) GGAAAGTTACAAGGAAATGC and GGAAGTTTGGATGATTCTAA were designed with a CRISPR design tool (https://www.crisprscan.org/) targeting sequences upstream and downstream of the 5′ and 3′ untranslated regions, respectively. sgRNAs were transcribed using a MEGAshortscript T7 Kit (Thermo Fisher Scientific) and later purified with the RNA Clean & Concentrator Kit (Zymo Research). Then, 50 pg of each sgRNA were coinjected with 100 pg of cas9 mRNA into zebrafish one-cell-stage WT embryos. Injected embryos were raised to adulthood and later screened for founder identification. To detect the full locus deletion allele, we performed PCR using the forward 5′-GTACCCTGGTTAATGACTAATCCTAGTT-3′ and reverse 5′-AGCTGATCAGAACGCACAGTAACG-3′ primers, leading to a 310-bp product. To detect the WT allele, we performed PCR using the forward 5′- ATCCACAAAAACAGCAGGGC-3′ and reverse 5′- CATCTTCAGCGAGTCGGTGT-3′ primers, leading to a 739-bp product.

To generate the Tg(fli1a:myd88,EGFP)bns703 line, in which a bidirectional fli1a promoter drives the expression of both myd88 and EGFP, we modified the fli1a:mCherry,EGFP construct provided by C. Helker. The myd88 coding sequence was cloned and subsequently used to replace the mCherry coding sequence. Cloning was performed using the In-Fusion HD Cloning Kit (Takara Bio). Then, 10 pg of the final construct were coinjected with 25 pg of Tol2 mRNA into zebrafish one-cell-stage WT embryos. Injected embryos positive for EGFP were raised to adulthood and later screened for founder identification.

To generate the Tg(hsp70l:loxP-TagBFP-loxP-cxcl18b-t2a-mCherry)bns660 line, the hsp70l:loxP-TagBFP-loxP-il11ra-t2a-mCherry construct was modified59. The cxcl18b coding sequence was cloned and subsequently used to replace the il11ra coding sequence. Cloning was performed using the In-Fusion HD Cloning Kit. Then, 10 pg of the final construct were coinjected with 25 pg of Tol2 mRNA into zebrafish one-cell-stage WT embryos. Injected embryos were heat-shocked and embryos positive for TagBFP were raised to adulthood and later screened for founder identification. To induce recombination, 12.5 pg of Cre mRNA were injected into Tg(hsp70l:loxP-TagBFP-loxP-cxcl18b-t2a-mCherry) one-cell-stage embryos. Cre mRNA-injected embryos were heat-shocked and embryos positive for mCherry were raised to adulthood.

Cardiac cryoinjury and heat shock treatments

Cardiac cryoinjury was performed in adult zebrafish hearts as described previously3–5. Zebrafish were briefly anesthetized with tricaine and transferred on a wet sponge with their ventral side up. A small incision was made on the chest area exposing the heart. A cryoprobe precooled in liquid nitrogen was applied to the ventricular apex until thawing. Cryoinjured fish were transferred into fresh system water and left to recover. Heat shock treatments to induce the expression of the hsp70l-driven transgene Tg(hsp70l:loxP-TagBFP-loxP-cxcl18b-t2a-mCherry) were performed by incubating the adult fish or the embryos in preheated system or egg water (39 °C) for 1 h. Several heat shocks were performed as described in the corresponding experimental plans. It is important to note that heat shock alone, as a stress response, can promote an immune response, including the influx of inflammatory cells113,114, potentially explaining the discrepancy in neutrophil count in cryoinjured ventricles observed with (Fig. 6f) and without (Fig. 1g) heat shock treatments.

Histological analysis and imaging

For the histological analysis, zebrafish hearts were fixed in 4% paraformaldehyde for 1 h at room temperature and then preserved overnight in 30% (w/v) sucrose solution prepared in 1× PBS at 4 °C. Hearts samples were embedded in O.C.T. (Tissue-Tek) and stored at −80 °C until further use. Eight and 50-μm-thick cryosections were collected on SuperFrost Plus slides (Thermo Fisher Scientific) using the Leica CM1950 cryostat and stored at −20 °C.

For AFOG staining, slides were thawed for 15 min at room temperature, rinsed twice with 0.1% Triton X-100 in 1× PBS to remove O.C.T., incubated in Bouin’s solution for 2 h at 60 °C and then stained according to the manufacturer’s instructions (AFOG staining kit, BioGnost) and without hematoxylin solution59. Stained slides were imaged using a Nikon SMZ25 stereo microscope coupled with a Nikon Digital Sight DS-Ri1 camera.

For immunofluorescence staining, slides were thawed for 15 min at room temperature, rinsed twice with 0.1% Triton X-100 in 1× PBS to remove O.C.T. and permeabilized with 0.5% Triton X-100 in 1× PBS for 20 min (2 h for 50-μm-thick cryosections) at room temperature. Cryosections were then incubated in blocking buffer solution (1× PBS, 2% (v/v) goat serum, 0.2% Triton X-100 and 1% dimethyl sulfoxide) for 1 h at room temperature. Then, cryosections were incubated with primary antibodies in blocking buffer solution overnight at 4 °C, rinsed three times every 10 min with 0.1% Triton X-100 in 1× PBS and incubated with secondary antibodies in blocking buffer solution for 3 h at room temperature. Lastly, immunostained cryosections were rinsed three times every 10 min with 0.1% Triton X-100 in 1× PBS, incubated in DAPI (1:10,000 dilution, Sigma-Aldrich) for 5 min at room temperature and mounted with fluorescence mounting medium (cat. no. S3023, Agilent Dako) for imaging. MEF2, PCNA, pAkt and pERK immunostaining was performed as described previously73. MEF2 and pERK immunostaining was supplemented with an additional step after O.C.T. removal, which consisted of antigen retrieval in 10 mM sodium citrate buffer with 0.05% (v/v) Tween-20 (all from Sigma-Aldrich), pH 6.0, for 7 min at 95 °C.

Primary antibodies used were: anti-GFP at 1:500 dilution (chicken, cat. no. GFP-1010, Aves Labs); anti-αSMA at 1:200 dilution (rabbit, cat. no. GTX124505, GeneTex); anti-Fli1 (clone EPR4646) at 1:100 dilution (rabbit, cat. no. ab133485, Abcam); anti-pAkt (clone 6F5) at 1:200 dilution (mouse, cat. no. 05-1003, Sigma-Aldrich); anti-PCNA (clone PC10) at 1:200 dilution (mouse, cat. no. sc-56, Santa Cruz Biotechnology); anti-MEF2 at 1:100 dilution (rabbit, cat. no. DZ01398, Boster Bio); anti-Mpx at 1:200 dilution (rabbit, cat. no. GTX128379, GeneTex); anti-Aldh1a2 (clone G-2) at 1:100 dilution (mouse, cat. no. sc-393204, Santa Cruz Biotechnology); anti-Aldh1a2 at 1:200 dilution (rabbit, cat. no. GTX124302, GeneTex); anti-zf-Cdh5 at 1:100 dilution (rabbit, cat. no. AS-55715, AnaSpec); anti-pERK (clone D13.14.4E) at 1:100 dilution (rabbit, cat. no. 4370S, Cell Signaling Technology); anti-RFP at 1:200 dilution (rabbit, cat. no. 600-401-379, Rockland Immunochemicals); N2.261 at 1:20 dilution (mouse, developed by H. M. Blau and obtained from the Developmental Studies Hybridoma Bank); and anti-DsRed at 1:200 dilution (recognizing mCherry, Living Colors, rabbit, cat. no. 632496, Takara Bio). Secondary antibodies used (all at 1:500 dilution) were: anti-chicken IgG (H+L) Alexa Fluor 488 (goat, cat. no. A-11039, Invitrogen); anti-mouse IgG (H+L) Alexa Fluor 488 (goat, cat. no. A-11029, Invitrogen); anti-mouse IgG (H+L) Alexa Fluor 568 (goat, cat. no. A-11004, Invitrogen); and anti-rabbit IgG (H+L) Alexa Fluor 647 (goat, cat. no. A-21244, Invitrogen). Phalloidin-Alexa Fluor 568 (cat. no. A12380, Thermo Fisher Scientific) was used at a 1:200 dilution. Imaging was performed using a ZEISS LSM 800 Observer inverted confocal microscope, a ZEISS Cell Observer Spinning Disk inverted confocal microscope, a ZEISS Axioscan 7 microscope, a Nikon Ni-E Eclipse widefield microscope equipped with a SlideExpress 2 slideloader (Märzhäuser), a SOLA Light Engine (Lumencor) and a DS-Qi2 Mono Digital Microscope Camera (Nikon). For the ZEISS and Nikon microscopes, the ZEN Blue Edition and NIS-AR software v.5.3 were used, respectively. Wholemount ventricle imaging was performed using a Nikon SMZ25 microscope coupled with a Nikon Digital Sight DS-Ri1 camera and the NIS-Elements v.4.30 software.

Quantification and statistical analysis

Quantification was done in two or three non-consecutive sections per ventricle and with the ZEN Blue Edition software. Quantification of the mpx:GFP+, mpeg1:EGFP+ and Mpx+ cell numbers was performed in the injured tissue and in peripheral border zone areas (100 μm). The mpx:GFP+ cell number analysis for the myd88+/− control condition (Fig. 6e,f) was performed separately. Quantification of the total αSMA+ cell number was performed in the injured tissue, and of the intraventricular αSMA+ cell number was performed in the injured tissue excluding the superficial/peripheral αSMA+ cells (that is, quantification was based on cell localization and not on the presence of an additional cell marker). Quantification of intraventricularly localized αSMA+ cells did not include double-positive αSMA+ krt4:EGFP+ cells for the following reasons: (1) the endocardium has not fully extended into the injured tissue at 96 hpci (the time point of our analysis), as indicated by krt4:EGFP+ expression, and (2) even though αSMA+ cells can derive from the endocardium, it is not known how long they retain the expression of endocardial markers. The αSMA+ cell number analysis displayed in Fig. 2d is the result of two independent experiments, each of which contained samples of both genotypes from the same batch. For the endocardial pAkt activation and proliferation analysis, the percentage of pAkt+ and PCNA+ endocardial cells was calculated as a ratio of the total number of endocardial cells (krt4:EGFP+Fli1+) in a 50-μm wide area on the basal-most side of the injured tissue, as described previously55. For the krt4:EGFP+, Cdh5+ and pERK+ cell area analysis, the fluorescent area within the injured tissue was measured and then divided by the total injured tissue area. For the CM dedifferentiation and proliferation analysis, the percentage of N2.261+ and PCNA+ CMs was calculated as a ratio of the total number of CMs (MEF2+) in peripheral border zone areas (100 μm). CM protrusions and protrusion lengths were measured in two non-consecutive 50-μm-thick cryosections with the largest injured area from each heart. The start of the protrusions was defined as the injury border and the end of the protrusions as the point where the F-actin signal disappeared in the injured tissue, as described previously77. All protrusions measured were extending toward the injured tissue. For the cEC proliferation analysis, the percentage of PCNA+ cECs was calculated as a ratio of the total number of cECs (-0.8flt1:RFP+) in the injured tissue and in peripheral border zone areas (200 μm). For the coronary vessel coverage analysis, the percentage of the fluorescence intensity was calculated as a ratio of the background fluorescence in the injured tissue using ImageJ (v.1.53c) in wholemount images. For the scar area analyses, scar areas were selected based on the combined occurrence of collagen and fibrin within the ventricle. The average of the ratio of the 2–3 biggest scar areas to the total ventricular areas were calculated using ImageJ (v.1.53c). Percentages of scar areas (relative to ventricular areas) were then grouped based on their size. Fibrin and collagen measurements were performed as described previously62.

All statistical analyses were performed in GraphPad Prism (v.9). Distribution of data in each group was assessed using the Shapiro–Wilk normality test. Data that were normally distributed were further analyzed with a two-tailed Student’s t-test. Data that were not normally distributed were further analyzed with a two-tailed Mann–Whitney U-test. The significance level was set to 0.05 for all tests. The exact P values are indicated in the figures. The error bars in the figures represent the mean ± s.d.

Tissue dissociation and cell sorting

For the scRNA-seq experiment, cardiac cells were isolated from a pool of four myd88+/+ and four myd88−/− ventricles, and for the endocardial bulk RNA-seq experiment from a pool of four ET(krt4:EGFP); myd88+/+ and four ET(krt4:EGFP); myd88−/− ventricles for each sample. Cell isolation was performed according to the manufacturer’s instructions (Pierce Primary Cardiomyocyte Isolation Kit, cat. no. 88281, Thermo Fisher Scientific) and with the following modifications: incubation was performed at 30 °C for 20 min, followed by resuspension in 1× Hanks’ Balanced Salt Solution (cat. no. 14175053, Gibco) with 0.25% BSA. The cell suspension was passed through a round bottom polystyrene test tube fitted with a 35-µm nylon mesh filter cap (Falcon, cat. no. 352235, Corning). DAPI (cat. no. D954, Sigma-Aldrich) was added before sorting. For the scRNA-seq experiment, resuspended cells were sorted using a BD FACSAria III Cell Sorter (BD Biosciences) equipped with a 100-µm nozzle and at an instrument pressure setting of 20 psi. Dead cells were excluded using DAPI excited by a 30-mW 405-nm laser paired with a 450/50-nm band-pass filter. For the endocardial bulk RNA-seq experiment, resuspended cells were sorted using an Invitrogen Bigfoot Spectral Cell Sorter (Thermo Fisher Scientific) equipped with a 100-µm nozzle tip and at an instrument pressure setting of 20 psi. Dead cells were excluded using DAPI excited by a 100-mW 355-nm laser paired with 455/14-nm band-pass filter. EGFP fluorescence was measured with a 100-mW 488-nm excitation paired with a 530/30-nm band-pass filter. Sorted EGFP+ cells were resuspended in ice-cold QIAzol Lysis Reagent (QIAGEN), flash-frozen in liquid nitrogen and kept at −80 °C until RNA extraction. Cytometric data were recorded using the FACSDiva software v.8.0.1 (BD Biosciences) and the Sasquatch software v.1.19.2 (Thermo Fisher Scientific). The .fcs files were analyzed using FlowJo v.10.8.1 (BD Life Sciences).

scRNA-seq analysis

For the scRNA-seq experiment, cells were counted with a Moxi cell counter and diluted according to the manufacturer’s protocol to obtain 10,000 single-cell data points per sample. Each sample was run separately on a lane in a Chromium controller with the Chromium Next GEM Single Cell 3′ Reagent Kits v.3.1 (10x Genomics). scRNA-seq library preparation was done using a standard protocol. Sequencing was done on NextSeq 2000 system and raw reads were aligned against the zebrafish genome (DanRer11) and counted using STARsolo115 followed by secondary analysis in annotated data format. Preprocessed counts were further analyzed using Scanpy116. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore, we filtered 7,823 genes if they were detected in fewer than 30 cells (<0.01%). The raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance. We initially reduced the dimensionality of the dataset using principal component analysis, retaining 50 principal components. Final data visualization was done using the scVelo117,118 and CELLxGENE packages.

Bulk RNA-seq analysis

For bulk RNA-seq of endocardial cells (Fig. 3a), RNA was isolated from the fluorescence-activated cell-sorted endocardial cells using the miRNeasy Micro Kit (QIAGEN) combined with on-column DNase digestion (RNase-free DNase Set, QIAGEN) to avoid contamination by genomic DNA (gDNA). Subsequent RNA quality control analysis, complementary DNA (cDNA) preparation and sequencing were performed by Novogene. mRNA was purified from total RNA with poly-T oligo-attached magnetic beads, went through fragmentation and cDNA was synthesized. Trimmomatic119 was used to trim the reads. Reads longer than 15 nucleotides after trimming were kept and aligned to the Ensembl zebrafish genome v.danRer11 (Ensembl release 109) with STAR aligner (v.2.7.10a)115. Alignments were filtered with the Picard tool (v.3.0.0) to remove duplicates, multimapping, ribosomal or mitochondrial reads. Gene counts were generated using the featureCounts tool (v.2.0.4), taking all reads overlapping annotated exons into account and excluding those overlapping multiple genes120. Finally, the raw count matrix was normalized and contrasts were created and analyzed using DESeq2 (v.1.36.0)121. Genes were classified as significantly differentially expressed at an average count greater than five, multiple testing Padj < 0.05 and −0.585 < log2 fold change > 0.585. Heatmaps with DEGs were obtained using the WIlsON122. To perform GSEA, we used the Python package gseapy123. As gene sets, we used 162 custom Danio rerio mapped gene sets from reactome and 3,023 gene sets from Gene Ontology. Gene ranking was performed according to the DESeq-derived Padj multiplied by the direction (+ or −) of the log2 fold change. The GSEA analysis was run for gene sets with a min_size = 5, max_size = 1,000 and permutation_num = 1,000. From the resulting lists, representative sets were selected.

For bulk RNA-seq of untouched ventricles and injured tissues (Fig. 6a), RNA was isolated from three pooled ventricles or three pooled injured tissues per sample using the miRNeasy Micro Kit (QIAGEN) combined with on-column DNase digestion (RNase-free DNase Set, QIAGEN) to avoid contamination by gDNA. Two biological replicates were prepared for each condition. RNA and library preparation integrity were verified with LabChip Gx Touch 24 Analyzer (PerkinElmer). 400 ng of total RNA was used as input for the VAHTS Stranded mRNA-seq Library Preparation V6 according to the manufacturer’s protocol (Vazyme). Sequencing was performed on an NextSeq 500 instrument (Illumina) using v2 chemistry with 1 × 75-bp single end setup. Trimmomatic v.0.39 was used to trim reads after a quality drop below a mean of Q15 in a window of five nucleotides, keeping only filtered reads longer than 15 nucleotides119. Reads were aligned against the Ensembl zebrafish genome v.danRer11 (Ensembl release 99) with STAR v.2.7.3a115. Alignments were filtered with Picard v.2.21.7 to remove duplicates, multimapping, ribosomal or mitochondrial reads. Gene counts were established with featureCounts v.1.6.5 aggregating reads overlapping exons, excluding those overlapping multiple genes120. The raw count matrix was normalized with DESeq2 v.1.26.0 (ref. 121). Contrasts were created with DESeq2 based on the raw count matrix. Genes were classified as significantly differentially expressed at average count greater than five, multiple testing Padj < 0.05 and −0.585 < log2 fold change > 0.585. Heatmaps with DEGs were obtained using WIlsON122.

RT–qPCR

For RT–qPCR, RNA was extracted from three pooled cryoinjured tissues (1 hpci) and ventricles (96 hpci) (Fig. 6c) or from single larvae (Extended Data Fig. 9a and Extended Data Fig. 10c,f) or from single cryoinjured ventricles (96 hpci) (Extended Data Fig. 9a) per biological replicate using the TRIzol Reagent (Thermo Fisher Scientific) using the phenol–chloroform extraction protocol. Total RNA was purified with the RNA Clean & Concentrator Extraction Kit (Zymo Research) according to the manufacturer’s instructions. At least 250 ng of total RNA per sample was reverse-transcribed with the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. All reactions were performed with three technical replicates using the SYBR Green PCR Master Mix (Thermo Fisher Scientific) on the CFX Connect Real-Time System (CFX Manager 3.1, Bio-Rad Laboratories) and with the following program: preamplification at 95 °C for 7 min followed by 39 cycles of amplification at 95 °C for 5 s and 60 °C for 20 s, using a melting curve from 60 to 92 °C with an increment of 1.0 °C every 5 s. Gene mRNA levels were normalized against the rpl13a mRNA levels and fold changes were calculated using the 2−ΔΔCt method. The RT–qPCR primer sequences are listed in Supplementary Table 2. The average Ct values of the RT–qPCR are listed in Supplementary Table 3.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Supplementary Information Supplementary Figs. 1 and 2, Tables 1–3, Methods and References.

Reporting Summary

Source data

Source Data Statistical source data for Figs. 1–7 and Extended Data Figs. 1–10.

Extended data

Extended Data Fig. 1 Neutrophils and macrophages are affected in cryoinjured myd88−/− ventricles.

a, UMAP representation of the macrophage and neutrophil clusters from the scRNA-seq analysis. b, Violin plots showing expression of known macrophage and neutrophil gene markers. c, Violin plots showing expression of neutrophil-enriched gene markers in the macrophage and neutrophil clusters. Genes selected from published datasets34–36. d, UMAP representation of the myeloid subclusters from the scRNA-seq analysis. Area (iii) corresponds to a macrophage subcluster that is increased in cryoinjured myd88−/− ventricles. e, UMAP representation of this myd88−/− macrophage subcluster (blue) and the other macrophages (orange), and violin plots showing enriched genes in the myd88−/− macrophage subcluster (iii). f, Representative images of immunostaining for GFP (neutrophils, white) with DAPI (DNA marker, blue) counterstaining on sections of TgBAC(mpx:GFP); myd88+/+ and TgBAC(mpx:GFP); myd88−/− ventricles at 6 hps, 6 hpci and 7 dpci. g, mpx:GFP+ cell numbers in TgBAC(mpx:GFP); myd88+/+ and TgBAC(mpx:GFP); myd88−/− ventricles at 6 hps and injured tissues and border zone areas (100 μm) at 6, 24 and 96 hpci, as well as 7 dpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 4 myd88+/+, n = 5 myd88−/− for 6 hps, n = 5 myd88+/+, n = 5 myd88−/− for 6 hpci, n = 9 myd88+/+, n = 7 myd88−/− for 24 hpci, n = 7 myd88+/+, n = 8 myd88−/− for 96 hpci, and n = 3 myd88+/+, n = 4 myd88−/− for 7 dpci. Statistical tests: Student’s t-test for 6 hps, 6, 24 hpci and 7 dpci, and Mann-Whitney U-test for 96 hpci. h, The pie charts show the proportion of macrophages in the scRNA-seq dataset at 24 hpci. Yellow dashed lines delineate the injured area; yellow arrowheads point to mpx:GFP+ cells. Scale bars, 100 μm.

Source data

Extended Data Fig. 2 Fibrotic cell populations in cryoinjured myd88−/− ventricles.

a, Trajectory analysis revealing a potential transition from the serpine1 endocardial cluster to the collagen-rich, irx5a, and frzb endocardial clusters. b, Velocity analysis done by comparing pre-mRNA and mRNA levels to infer the relations between the cells in the endocardial clusters. c, Representative images of immunostaining for αSMA (myofibroblasts, white) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 7 dpci. d, Total αSMA+ cell numbers in myd88+/+ and myd88−/− injured tissues at 7 dpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 4 myd88+/+ and n = 5 myd88−/−. Statistical test: Student’s t-test. e, Superficially localized αSMA+ cell numbers in myd88+/+ and myd88−/− injured tissues at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 13 myd88+/+ and n = 11 myd88−/−. Statistical test: Mann-Whitney U-test. f, UMAP representation of the mesenchymal subclusters from the scRNA-seq analysis. g, UMAP representation of acta2 expression levels in the mesenchymal subclusters. h, Heatmap showing gene expression levels in the mesenchymal subclusters. Yellow dashed lines delineate the injured area; yellow arrowheads point to αSMA+ cells. Scale bars, 100 μm.

Source data

Extended Data Fig. 3 Endocardial area coverage is not affected in cryoinjured myd88−/− ventricles.

a, Representative images of immunostaining for EGFP (endocardial cells, green) and Aldh1a2 (endocardial and epicardial cell activation marker, magenta) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. b, Ratio of krt4:EGFP+ cell area within the injured tissue in cryoinjured myd88+/+ and myd88−/− ventricles at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 7 myd88+/+ and n = 6 myd88−/−. Statistical test: Student’s t-test. c, Representative images of immunostaining for Cdh5 (endothelial cell marker, white) on 50-μm-thick sections of cryoinjured myd88+/+ and myd88−/− ventricles at 7 dpci. d, Ratio of Cdh5+ cell area within the injured tissue in cryoinjured myd88+/+ and myd88−/− ventricles at 7 dpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 7 myd88+/+ and n = 4 myd88−/−. Statistical test: Mann-Whitney U-test. Yellow dashed lines delineate the injured area. Scale bars, 100 μm.

Source data

Extended Data Fig. 4 Bigger scars at 30 but not at 90 dpci in cryoinjured myd88−/− ventricles.

a, Graph showing the percentage of the collagen/scar area at 14 and 30 dpci. The dots in the graph represent individual ventricles, and data are shown as the mean ± s.d.; n = 6 myd88+/+ and n = 6 myd88−/−. Statistical tests: Student’s t-test. b, Graph showing representation of groups (y axis) of different scar area sizes (different colors) at 30 dpci in cryoinjured myd88+/+ and myd88−/− ventricles. c, Representative images of AFOG staining on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 90 dpci. d, Graph showing representation of groups (y axis) of different scar area sizes (different colors) at 90 dpci in cryoinjured myd88+/+ and myd88−/− ventricles. Black dashed lines delineate the scar area. Scale bars, 200 μm.

Source data

Extended Data Fig. 5 Enrichment analysis terms affected in the cryoinjured myd88−/− endocardium at 96 hpci.

a, Selected GSEA plots for GO and KEGG pathway terms from transcriptomic analysis in the cryoinjured myd88−/− versus myd88+/+ endocardium at 96 hpci. Plots with red and blue lines indicate processes enriched in myd88 (mutant; myd88−/−) and WT (myd88+/+), respectively. b, Plot showing Reactome pathway terms enriched in the cryoinjured myd88+/+ (WT) versus myd88−/− (myd88 mutant) endocardium at 96 hpci.

Source data

Extended Data Fig. 6 pERK+ area coverage is not significantly affected in cryoinjured myd88−/− ventricles.

a, Representative images of immunostaining for EGFP (endocardial cells, green) and pERK (activated MAPK signaling pathway, magenta) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured ET(krt4:EGFP); myd88+/+ and ET(krt4:EGFP); myd88−/− ventricles at 96 hpci. b, Ratio of pERK+ cell area within the injured tissue in cryoinjured myd88+/+ and myd88−/− ventricles at 96 hpci. The dots in the graph represent individual ventricles; data are shown as the mean ± s.d.; n = 7 myd88+/+ and n = 5 myd88−/−. Statistical test: Student’s t-test. Yellow dashed lines delineate the injured area. Scale bars, 100 μm.

Source data

Extended Data Fig. 7 Revascularization phenotype in cryoinjured myd88−/− ventricles.

a, c, Representative images of immunostaining for RFP (coronary endothelial cells, green) and PCNA (proliferation marker, magenta) with DAPI (DNA marker, blue) counterstaining on sections of cryoinjured Tg(-0.8flt1:RFP); myd88+/+ and Tg(-0.8flt1:RFP); myd88−/− ventricles at 96 hpci (a) and 7 dpci (c). b, d, Percentage of proliferating coronary endothelial cells in the injured tissues and border zone areas (200 μm) at 96 hpci (b) and 7 dpci (d). The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 7 myd88+/+, n = 6 myd88−/− at 96 hpci (b), and n = 4 myd88+/+, n = 5 myd88−/− at 7 dpci (d). Statistical tests: Student’s t-test. e, Wholemount images of cryoinjured Tg(-0.8flt1:RFP); myd88+/+ and Tg(-0.8flt1:RFP); myd88−/− ventricles at 7 dpci. f, Percentage of coronary vessel coverage in the injured tissues of cryoinjured Tg(-0.8flt1:RFP); myd88+/+ and Tg(-0.8flt1:RFP); myd88−/− ventricles at 7 dpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 4 myd88+/+ and n = 6 myd88−/−. Statistical test: Student’s t-test. Yellow dashed lines delineate the injured area; yellow arrowheads point to proliferating coronary endothelial cells. Scale bars, 100 μm (a,c), 200 μm (e).

Source data

Extended Data Fig. 8 CM dedifferentiation at 96 hpci and proliferation at 14 dpci are not significantly affected in cryoinjured myd88−/− ventricles.

a, Representative images of immunostaining for MEF2 (CM nuclei, green) and N2.261 (dedifferentiation marker, magenta) on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 96 hpci. b, Quantification of the number of dedifferentiating CMs in border zone areas (100 μm) at 96 hpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 5 myd88+/+ and n = 5 myd88−/−. Statistical test: Student’s t-test. c, Representative images of immunostaining for MEF2 (CM nuclei, green) and PCNA (proliferation marker, magenta) on sections of cryoinjured myd88+/+ and myd88−/− ventricles at 14 dpci. d, Quantification of proliferating CMs in border zone areas (100 μm) at 14 dpci. The dots in the graphs represent individual ventricles; data are shown as the mean ± s.d.; n = 5 myd88+/+ and n = 4 myd88−/−. Statistical test: Student’s t-test. Yellow dashed lines delineate the injured area; yellow arrowheads point to dedifferentiating (a) and proliferating (c) CMs. Scale bars, 100 μm.

Source data

Extended Data Fig. 9 Validation of the Tg(fli1a:myd88,EGFP) line.

a, RT-qPCR analysis of myd88 mRNA levels in transgenic (Tg(fli1a:myd88,EGFP)) and non-transgenic 24 hpf larvae and 96 hpci ventricles. Data are shown as the mean ± s.d.; n = 3 (no transgene) and n = 3 (Tg(fli1a:myd88,EGFP)) 24 hpf larvae and n = 6 (no transgene) and n = 6 (Tg(fli1a:myd88,EGFP)) 96 hpci ventricles. Statistical tests: Student’s t-test. Ct values listed in Supplementary Table 3. b, Representative images of immunostaining for EGFP (endothelial cells, green) and Aldh1a2 (endocardial and epicardial cell activation marker, magenta) with DAPI (DNA marker, blue) counterstaining on a section of a cryoinjured Tg(fli1a:myd88,EGFP); myd88+/+ ventricle at 96 hpci. Yellow dashed lines delineate the injured area. Scale bars, 100 μm.

Source data

Extended Data Fig. 10 Validation of cxcl18b tools.

a, Representative images of immunostaining for EGFP (cxcl18b expression, white) with DAPI (DNA marker, blue) counterstaining on a section of a cryoinjured Tg(cxcl18b:EGFP) ventricle at 24 hpci; n = 1. b, Experimental plan for Cre mRNA injected and uninjected (control) Tg(hsp70l:LBL-cxcl18b-t2a-mCherry) sibling larvae. c, RT-qPCR analysis of cxcl18b and mCherry mRNA levels in Cre mRNA-injected and uninjected (control) Tg(hsp70l:LBL-cxcl18b-t2a-mCherry) larvae. The dots in the graph represent individual larvae; data are shown as the mean ± s.d.; n = 4 (Control) and n = 4 (Cre mRNA injected). Statistical tests: Student’s t-test. Ct values listed in Supplementary Table 3. d, Representative images of immunostaining for mCherry (cxcl18b overexpressing cells, white) on sections of cryoinjured ventricles from uninjected (control) myd88+/−, Cre mRNA injected (cxcl18b OE) myd88+/−, uninjected (control) myd88−/− and Cre mRNA injected (cxcl18b OE) myd88−/− siblings at 24 hpci; all zebrafish carry the hsp70l:LBL-cxcl18b-t2a-mCherry transgene; n = 6 (myd88+/− control), n = 5 (myd88+/− cxcl18b OE), n = 6 (myd88−/− control), and n = 5 (myd88−/− cxcl18b OE). Experimental plan in Fig. 6d. e, Genomic sequence of the cxcl18bbns683 full locus deletion allele. f, Experimental plan and RT-qPCR analysis of cxcl18b mRNA levels in cxcl18b+/+ and cxcl18b−/− larvae 6 hours post fin fold amputation (hpa). The dots in the graph represent individual larvae; data are shown as the mean ± s.d.; n = 4 cxcl18b+/+ and n = 3 cxcl18b−/−. Statistical test: Student’s t-test. Ct values listed in Supplementary Table 3. Yellow dashed lines delineate the injured area. Scale bars, 100 μm.

Source data

Extended data

is available for this paper at 10.1038/s44161-024-00538-5.

Supplementary information

The online version contains supplementary material available at 10.1038/s44161-024-00538-5.

Acknowledgements

We thank D. Grabski, N. Fukuda, C. Kremser, C. Buettner, S. Howard and E. Atzaraki for essential technical support; R. Ramadass for help with microscopy; and S. Allanki, J. Cardeira-da-Silva, M. Balakrishnan, T.-L. Tseng, S. Gupta, P. Sagvekar and T. Molina-Villa for input during the development of this work and comments on the paper. We thank our animal house staff for excellent support. We also thank A. Meijer (Leiden University) for sharing the myd88hu3568 mutant and the Tg(cxcl18b:EGFP)ibl150 line. R.M.-J. is currently supported by the Canadian Institutes of Health Research (PJT-178037) and a FRQS Junior-1 award. This research was supported by funds from the Max Planck Society and awards from the European Research Council under the European Union’s research and innovation programs (AdG 694455-ZMOD and AdG 101021349-TAaGC) to D.Y.R.S.

Author contributions

P.G., R.M.-J. and D.Y.R.S. conceptualized the study. P.G., R.M.-J. and D.Y.R.S. devised the study methodology. P.G., S.G., K.K. and M.L. carried out the investigation. All authors carried out the formal analysis. P.G. wrote the original paper draft. All authors reviewed and edited the paper draft. R.M.-J. and D.Y.R.S. supervised the study. D.Y.R.S. administered the project and acquired the funding.

Peer review

Peer review information

Nature Cardiovascular Research thanks Herman Spaink, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Funding

Open access funding provided by Max Planck Society.

Data availability

The scRNA-seq, RNA-seq of endocardial cells and RNA-seq of untouched ventricles and injured tissues data reported in this study have been deposited in the Gene Expression Omnibus under accession nos. GSE262247, GSE262351 and GSE262169, respectively.

Competing interests

The authors declare no competing interests.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Braunwald E The war against heart failure: the Lancet lecture Lancet 2015 385 812 824 10.1016/S0140-6736(14)61889-4 25467564
Braunwald, E. The war against heart failure: the Lancet lecture. Lancet 385, 812–824 (2015).25467564 10.1016/S0140-6736(14)61889-4
2. Talman V Ruskoaho H Cardiac fibrosis in myocardial infarction—from repair and remodeling to regeneration Cell Tissue Res. 2016 365 563 581 10.1007/s00441-016-2431-9 27324127
Talman, V. & Ruskoaho, H. Cardiac fibrosis in myocardial infarction—from repair and remodeling to regeneration. Cell Tissue Res. 365, 563–581 (2016).27324127 10.1007/s00441-016-2431-9
3. González-Rosa JM Martín V Peralta M Torres M Mercader N Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish Development 2011 138 1663 1674 10.1242/dev.060897 21429987
González-Rosa, J. M., Martín, V., Peralta, M., Torres, M. & Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development 138, 1663–1674 (2011).21429987 10.1242/dev.060897
4. Schnabel K Wu C-C Kurth T Weidinger G Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation PLoS ONE 2011 6 e18503 10.1371/journal.pone.0018503 21533269
Schnabel, K., Wu, C.-C., Kurth, T. & Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS ONE 6, e18503 (2011).21533269 10.1371/journal.pone.0018503
5. Chablais F Veit J Rainer G Jaźwińska A The zebrafish heart regenerates after cryoinjury-induced myocardial infarction BMC Dev. Biol. 2011 11 21 10.1186/1471-213X-11-21 21473762
Chablais, F., Veit, J., Rainer, G. & Jaźwińska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Dev. Biol. 11, 21 (2011).21473762 10.1186/1471-213X-11-21
6. Wang J The regenerative capacity of zebrafish reverses cardiac failure caused by genetic cardiomyocyte depletion Development 2011 138 3421 3430 10.1242/dev.068601 21752928
Wang, J. et al. The regenerative capacity of zebrafish reverses cardiac failure caused by genetic cardiomyocyte depletion. Development 138, 3421–3430 (2011).21752928 10.1242/dev.068601
7. Frangogiannis NG The inflammatory response in myocardial injury, repair, and remodelling Nat. Rev. Cardiol. 2014 11 255 265 10.1038/nrcardio.2014.28 24663091
Frangogiannis, N. G. The inflammatory response in myocardial injury, repair, and remodelling. Nat. Rev. Cardiol. 11, 255–265 (2014).24663091 10.1038/nrcardio.2014.28
8. Anzai A Ko S Fukuda K Immune and inflammatory networks in myocardial infarction: current research and its potential implications for the clinic Int. J. Mol. Sci. 2022 23 5214 10.3390/ijms23095214 35563605
Anzai, A., Ko, S. & Fukuda, K. Immune and inflammatory networks in myocardial infarction: current research and its potential implications for the clinic. Int. J. Mol. Sci. 23, 5214 (2022).35563605 10.3390/ijms23095214
9. Huang W-C Treatment of glucocorticoids inhibited early immune responses and impaired cardiac repair in adult zebrafish PLoS ONE 2013 8 e66613 10.1371/journal.pone.0066613 23805247
Huang, W.-C. et al. Treatment of glucocorticoids inhibited early immune responses and impaired cardiac repair in adult zebrafish. PLoS ONE 8, e66613 (2013).23805247 10.1371/journal.pone.0066613
10. Lai S-L Reciprocal analyses in zebrafish and medaka reveal that harnessing the immune response promotes cardiac regeneration eLife 2017 6 e25605 10.7554/eLife.25605 28632131
Lai, S.-L. et al. Reciprocal analyses in zebrafish and medaka reveal that harnessing the immune response promotes cardiac regeneration. eLife 6, e25605 (2017).28632131 10.7554/eLife.25605
11. de Preux Charles A-S Bise T Baier F Marro J Jaźwińska A Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart Open Biol. 2016 6 160102 10.1098/rsob.160102 27440424
de Preux Charles, A.-S., Bise, T., Baier, F., Marro, J. & Jaźwińska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biol. 6, 160102 (2016).27440424 10.1098/rsob.160102
12. Han C Acute inflammation stimulates a regenerative response in the neonatal mouse heart Cell Res. 2015 25 1137 1151 10.1038/cr.2015.110 26358185
Han, C. et al. Acute inflammation stimulates a regenerative response in the neonatal mouse heart. Cell Res. 25, 1137–1151 (2015).26358185 10.1038/cr.2015.110
13. Farache Trajano L Smart N Immunomodulation for optimal cardiac regeneration: insights from comparative analyses npj Regen. Med. 2021 6 8 10.1038/s41536-021-00118-2 33589632
Farache Trajano, L. & Smart, N. Immunomodulation for optimal cardiac regeneration: insights from comparative analyses. npj Regen. Med. 6, 8 (2021).33589632 10.1038/s41536-021-00118-2
14. Lai S-L Marin-Juez R Stainier DYR Immune responses in cardiac repair and regeneration: a comparative point of view Cell. Mol. Life Sci. 2019 76 1365 1380 10.1007/s00018-018-2995-5 30578442
Lai, S.-L., Marin-Juez, R. & Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cell. Mol. Life Sci. 76, 1365–1380 (2019).30578442 10.1007/s00018-018-2995-5
15. Timmers L The innate immune response in reperfused myocardium Cardiovasc. Res. 2012 94 276 283 10.1093/cvr/cvs018 22266751
Timmers, L. et al. The innate immune response in reperfused myocardium. Cardiovasc. Res. 94, 276–283 (2012).22266751 10.1093/cvr/cvs018
16. Yang D Han Z Oppenheim JJ Alarmins and immunity Immunol. Rev. 2017 280 41 56 10.1111/imr.12577 29027222
Yang, D., Han, Z. & Oppenheim, J. J. Alarmins and immunity. Immunol. Rev. 280, 41–56 (2017).29027222 10.1111/imr.12577
17. Prabhu SD Frangogiannis NG The biological basis for cardiac repair after myocardial infarction: from inflammation to fibrosis Circ. Res. 2016 119 91 112 10.1161/CIRCRESAHA.116.303577 27340270
Prabhu, S. D. & Frangogiannis, N. G. The biological basis for cardiac repair after myocardial infarction: from inflammation to fibrosis. Circ. Res. 119, 91–112 (2016).27340270 10.1161/CIRCRESAHA.116.303577
18. Cohen P The TLR and IL-1 signalling network at a glance J. Cell Sci. 2014 127 2383 2390 24829146
Cohen, P. The TLR and IL-1 signalling network at a glance. J. Cell Sci. 127, 2383–2390 (2014).24829146
19. Muzio M Ni J Feng P Dixit VM IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling Science 1997 278 1612 1615 10.1126/science.278.5343.1612 9374458
Muzio, M., Ni, J., Feng, P. & Dixit, V. M. IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278, 1612–1615 (1997).9374458 10.1126/science.278.5343.1612
20. Bayer AL Alcaide P MyD88: at the heart of inflammatory signaling and cardiovascular disease J. Mol. Cell. Cardiol. 2021 161 75 85 10.1016/j.yjmcc.2021.08.001 34371036
Bayer, A. L. & Alcaide, P. MyD88: at the heart of inflammatory signaling and cardiovascular disease. J. Mol. Cell. Cardiol. 161, 75–85 (2021).34371036 10.1016/j.yjmcc.2021.08.001
21. Frangogiannis NG The immune system and cardiac repair Pharmacol. Res. 2008 58 88 111 10.1016/j.phrs.2008.06.007 18620057
Frangogiannis, N. G. The immune system and cardiac repair. Pharmacol. Res. 58, 88–111 (2008).18620057 10.1016/j.phrs.2008.06.007
22. Feng Y Innate immune adaptor MyD88 mediates neutrophil recruitment and myocardial injury after ischemia-reperfusion in mice Am. J. Physiol. Heart Circ. Physiol. 2008 295 H1311 H1318 10.1152/ajpheart.00119.2008 18660455
Feng, Y. et al. Innate immune adaptor MyD88 mediates neutrophil recruitment and myocardial injury after ischemia-reperfusion in mice. Am. J. Physiol. Heart Circ. Physiol. 295, H1311–H1318 (2008).18660455 10.1152/ajpheart.00119.2008
23. Singh MV MyD88 mediated inflammatory signaling leads to CaMKII oxidation, cardiac hypertrophy and death after myocardial infarction J. Mol. Cell. Cardiol. 2012 52 1135 1144 10.1016/j.yjmcc.2012.01.021 22326848
Singh, M. V. et al. MyD88 mediated inflammatory signaling leads to CaMKII oxidation, cardiac hypertrophy and death after myocardial infarction. J. Mol. Cell. Cardiol. 52, 1135–1144 (2012).22326848 10.1016/j.yjmcc.2012.01.021
24. Oyama J Reduced myocardial ischemia-reperfusion injury in Toll-like receptor 4-deficient mice Circulation 2004 109 784 789 10.1161/01.CIR.0000112575.66565.84 14970116
Oyama, J. et al. Reduced myocardial ischemia-reperfusion injury in Toll-like receptor 4-deficient mice. Circulation 109, 784–789 (2004).14970116 10.1161/01.CIR.0000112575.66565.84
25. Chu X Lipopolysaccharides improve mesenchymal stem cell-mediated cardioprotection by MyD88 and stat3 signaling in a mouse model of cardiac ischemia/reperfusion injury Stem Cells Dev. 2019 28 620 631 10.1089/scd.2018.0213 30808255
Chu, X. et al. Lipopolysaccharides improve mesenchymal stem cell-mediated cardioprotection by MyD88 and stat3 signaling in a mouse model of cardiac ischemia/reperfusion injury. Stem Cells Dev. 28, 620–631 (2019).30808255 10.1089/scd.2018.0213
26. Zhu X MyD88 and NOS2 are essential for Toll-like receptor 4-mediated survival effect in cardiomyocytes Am. J. Physiol. Heart Circ. Physiol. 2006 291 H1900 H1909 10.1152/ajpheart.00112.2006 16648192
Zhu, X. et al. MyD88 and NOS2 are essential for Toll-like receptor 4-mediated survival effect in cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol. 291, H1900–H1909 (2006).16648192 10.1152/ajpheart.00112.2006
27. Ha T Blockade of MyD88 attenuates cardiac hypertrophy and decreases cardiac myocyte apoptosis in pressure overload-induced cardiac hypertrophy in vivo Am. J. Physiol. Heart Circ. Physiol. 2006 290 H985 H994 10.1152/ajpheart.00720.2005 16199478
Ha, T. et al. Blockade of MyD88 attenuates cardiac hypertrophy and decreases cardiac myocyte apoptosis in pressure overload-induced cardiac hypertrophy in vivo. Am. J. Physiol. Heart Circ. Physiol. 290, H985–H994 (2006).16199478 10.1152/ajpheart.00720.2005
28. Chen WQ Overexpressing dominant negative MyD88 induces cardiac dysfunction in transgenic mice Chinese Sci. Bull. 2010 55 3569 3575 10.1007/s11434-010-4080-9
Chen, W. Q. et al. Overexpressing dominant negative MyD88 induces cardiac dysfunction in transgenic mice. Chinese Sci. Bull. 55, 3569–3575 (2010).10.1007/s11434-010-4080-9
29. Bayer AL T-cell MyD88 is a novel regulator of cardiac fibrosis through modulation of T-cell activation Circ. Res. 2023 133 412 429 10.1161/CIRCRESAHA.123.323030 37492941
Bayer, A. L. et al. T-cell MyD88 is a novel regulator of cardiac fibrosis through modulation of T-cell activation. Circ. Res. 133, 412–429 (2023).37492941 10.1161/CIRCRESAHA.123.323030
30. Hardiman G Genetic structure and chromosomal mapping of MyD88 Genomics 1997 45 332 339 10.1006/geno.1997.4940 9344657
Hardiman, G. et al. Genetic structure and chromosomal mapping of MyD88. Genomics 45, 332–339 (1997).9344657 10.1006/geno.1997.4940
31. Hall C Transgenic zebrafish reporter lines reveal conserved Toll-like receptor signaling potential in embryonic myeloid leukocytes and adult immune cell lineages J. Leukoc. Biol. 2009 85 751 765 10.1189/jlb.0708405 19218482
Hall, C. et al. Transgenic zebrafish reporter lines reveal conserved Toll-like receptor signaling potential in embryonic myeloid leukocytes and adult immune cell lineages. J. Leukoc. Biol. 85, 751–765 (2009).19218482 10.1189/jlb.0708405
32. van der Vaart M van Soest JJ Spaink HP Meijer AH Functional analysis of a zebrafish myd88 mutant identifies key transcriptional components of the innate immune system Dis. Model. Mech. 2013 6 841 854 23471913
van der Vaart, M., van Soest, J. J., Spaink, H. P. & Meijer, A. H. Functional analysis of a zebrafish myd88 mutant identifies key transcriptional components of the innate immune system. Dis. Model. Mech. 6, 841–854 (2013).23471913
33. Chablais F Jazwinska A The regenerative capacity of the zebrafish heart is dependent on TGFβ signaling Development 2012 139 1921 1930 10.1242/dev.078543 22513374
Chablais, F. & Jazwinska, A. The regenerative capacity of the zebrafish heart is dependent on TGFβ signaling. Development 139, 1921–1930 (2012).22513374 10.1242/dev.078543
34. Ma H Functional coordination of non-myocytes plays a key role in adult zebrafish heart regeneration EMBO Rep. 2021 22 e52901 10.15252/embr.202152901 34523214
Ma, H. et al. Functional coordination of non-myocytes plays a key role in adult zebrafish heart regeneration. EMBO Rep. 22, e52901 (2021).34523214 10.15252/embr.202152901
35. Hu B Origin and function of activated fibroblast states during zebrafish heart regeneration Nat. Genet. 2022 54 1227 1237 10.1038/s41588-022-01129-5 35864193
Hu, B. et al. Origin and function of activated fibroblast states during zebrafish heart regeneration. Nat. Genet. 54, 1227–1237 (2022).35864193 10.1038/s41588-022-01129-5
36. Rolland L The regenerative response of cardiac interstitial cells J. Mol. Cell. Biol. 2023 14 mjac059 10.1093/jmcb/mjac059 36271843
Rolland, L. et al. The regenerative response of cardiac interstitial cells. J. Mol. Cell. Biol. 14, mjac059 (2023).36271843 10.1093/jmcb/mjac059
37. Hu W A novel function of TLR2 and MyD88 in the regulation of leukocyte cell migration behavior during wounding in zebrafish larvae Front. Cell Dev. Biol. 2021 9 624571 10.3389/fcell.2021.624571 33659250
Hu, W. et al. A novel function of TLR2 and MyD88 in the regulation of leukocyte cell migration behavior during wounding in zebrafish larvae. Front. Cell Dev. Biol. 9, 624571 (2021).33659250 10.3389/fcell.2021.624571
38. Roh-Johnson M Macrophage-dependent cytoplasmic transfer during melanoma invasion in vivo Dev. Cell 2017 43 549 562 10.1016/j.devcel.2017.11.003 29207258
Roh-Johnson, M. et al. Macrophage-dependent cytoplasmic transfer during melanoma invasion in vivo. Dev. Cell 43, 549–562 (2017).29207258 10.1016/j.devcel.2017.11.003
39. Nathan C Neutrophils and immunity: challenges and opportunities Nat. Rev. Immunol. 2006 6 173 182 10.1038/nri1785 16498448
Nathan, C. Neutrophils and immunity: challenges and opportunities. Nat. Rev. Immunol. 6, 173–182 (2006).16498448 10.1038/nri1785
40. Li L Yan B Shi Y-Q Zhang W-Q Wen Z-L Live imaging reveals differing roles of macrophages and neutrophils during zebrafish tail fin regeneration J. Biol. Chem. 2012 287 25353 25360 10.1074/jbc.M112.349126 22573321
Li, L., Yan, B., Shi, Y.-Q., Zhang, W.-Q. & Wen, Z.-L. Live imaging reveals differing roles of macrophages and neutrophils during zebrafish tail fin regeneration. J. Biol. Chem. 287, 25353–25360 (2012).22573321 10.1074/jbc.M112.349126
41. Ma Y Yabluchanskiy A Lindsey ML Neutrophil roles in left ventricular remodeling following myocardial infarction Fibrogenesis Tissue Repair 2013 6 11 10.1186/1755-1536-6-11 23731794
Ma, Y., Yabluchanskiy, A. & Lindsey, M. L. Neutrophil roles in left ventricular remodeling following myocardial infarction. Fibrogenesis Tissue Repair 6, 11 (2013).23731794 10.1186/1755-1536-6-11
42. Peterson EA Sun J Chen X Wang J Neutrophils facilitate the epicardial regenerative response after zebrafish heart injury Dev. Biol. 2024 508 93 106 10.1016/j.ydbio.2024.01.011 38286185
Peterson, E. A., Sun, J., Chen, X. & Wang, J. Neutrophils facilitate the epicardial regenerative response after zebrafish heart injury. Dev. Biol. 508, 93–106 (2024).38286185 10.1016/j.ydbio.2024.01.011
43. Horckmans M Neutrophils orchestrate post-myocardial infarction healing by polarizing macrophages towards a reparative phenotype Eur. Heart J. 2017 38 187 197 28158426
Horckmans, M. et al. Neutrophils orchestrate post-myocardial infarction healing by polarizing macrophages towards a reparative phenotype. Eur. Heart J. 38, 187–197 (2017).28158426
44. Taichman NS Young S Cruchley AT Taylor P Paleolog E Human neutrophils secrete vascular endothelial growth factor J. Leukoc. Biol. 1997 62 397 400 10.1002/jlb.62.3.397 9307080
Taichman, N. S., Young, S., Cruchley, A. T., Taylor, P. & Paleolog, E. Human neutrophils secrete vascular endothelial growth factor. J. Leukoc. Biol. 62, 397–400 (1997).9307080 10.1002/jlb.62.3.397
45. Ma Y Role of neutrophils in cardiac injury and repair following myocardial infarction Cells 2021 10 1676 10.3390/cells10071676 34359844
Ma, Y. Role of neutrophils in cardiac injury and repair following myocardial infarction. Cells 10, 1676 (2021).34359844 10.3390/cells10071676
46. Gong Y Koh D-R Neutrophils promote inflammatory angiogenesis via release of preformed VEGF in an in vivo corneal model Cell Tissue Res. 2010 339 437 448 10.1007/s00441-009-0908-5 20012648
Gong, Y. & Koh, D.-R. Neutrophils promote inflammatory angiogenesis via release of preformed VEGF in an in vivo corneal model. Cell Tissue Res. 339, 437–448 (2010).20012648 10.1007/s00441-009-0908-5
47. Xu S Prolonged neutrophil retention in the wound impairs zebrafish heart regeneration after cryoinjury Fish Shellfish Immunol. 2019 94 447 454 10.1016/j.fsi.2019.09.030 31526847
Xu, S. et al. Prolonged neutrophil retention in the wound impairs zebrafish heart regeneration after cryoinjury. Fish Shellfish Immunol. 94, 447–454 (2019).31526847 10.1016/j.fsi.2019.09.030
48. Castoldi A TLR2, TLR4 and the MYD88 signaling pathway are crucial for neutrophil migration in acute kidney injury induced by sepsis PLoS ONE 2012 7 e37584 10.1371/journal.pone.0037584 22655058
Castoldi, A. et al. TLR2, TLR4 and the MYD88 signaling pathway are crucial for neutrophil migration in acute kidney injury induced by sepsis. PLoS ONE 7, e37584 (2012).22655058 10.1371/journal.pone.0037584
49. Latty SL Activation of Toll-like receptors nucleates assembly of the MyDDosome signaling hub eLife 2018 7 e31377 10.7554/eLife.31377 29368691
Latty, S. L. et al. Activation of Toll-like receptors nucleates assembly of the MyDDosome signaling hub. eLife 7, e31377 (2018).29368691 10.7554/eLife.31377
50. Bevan L Specific macrophage populations promote both cardiac scar deposition and subsequent resolution in adult zebrafish Cardiovasc. Res. 2020 116 1357 1371 10.1093/cvr/cvz221 31566660
Bevan, L. et al. Specific macrophage populations promote both cardiac scar deposition and subsequent resolution in adult zebrafish. Cardiovasc. Res. 116, 1357–1371 (2020).31566660 10.1093/cvr/cvz221
51. Cardeira-da-Silva J Antigen presentation plays positive roles in the regenerative response to cardiac injury in zebrafish Nat. Commun. 2024 15 3637 10.1038/s41467-024-47430-1 38684665
Cardeira-da-Silva, J. et al. Antigen presentation plays positive roles in the regenerative response to cardiac injury in zebrafish. Nat. Commun. 15, 3637 (2024).38684665 10.1038/s41467-024-47430-1
52. Salvador B Modulation of endothelial function by Toll like receptors Pharmacol. Res. 2016 108 46 56 10.1016/j.phrs.2016.03.038 27073018
Salvador, B. et al. Modulation of endothelial function by Toll like receptors. Pharmacol. Res. 108, 46–56 (2016).27073018 10.1016/j.phrs.2016.03.038
53. Opitz B Eitel J Meixenberger K Suttorp N Role of Toll-like receptors, NOD-like receptors and RIG-I-like receptors in endothelial cells and systemic infections Thromb. Haemost. 2009 102 1103 1109 10.1160/TH09-05-0323 19967140
Opitz, B., Eitel, J., Meixenberger, K. & Suttorp, N. Role of Toll-like receptors, NOD-like receptors and RIG-I-like receptors in endothelial cells and systemic infections. Thromb. Haemost. 102, 1103–1109 (2009).19967140 10.1160/TH09-05-0323
54. Grivas D González-Rajal A de la Pompa JL Midkine-a regulates the formation of a fibrotic scar during zebrafish heart regeneration Front. Cell Dev. Biol. 2021 9 669439 10.3389/fcell.2021.669439 34026760
Grivas, D., González-Rajal, A. & de la Pompa, J. L. Midkine-a regulates the formation of a fibrotic scar during zebrafish heart regeneration. Front. Cell Dev. Biol. 9, 669439 (2021).34026760 10.3389/fcell.2021.669439
55. Münch J Grivas D González-Rajal A Torregrosa-Carrión R de la Pompa JL Notch signalling restricts inflammation and serpine1 expression in the dynamic endocardium of the regenerating zebrafish heart Development 2017 144 1425 1440 10.1242/dev.143362 28242613
Münch, J., Grivas, D., González-Rajal, A., Torregrosa-Carrión, R. & de la Pompa, J. L. Notch signalling restricts inflammation and serpine1 expression in the dynamic endocardium of the regenerating zebrafish heart. Development 144, 1425–1440 (2017).28242613 10.1242/dev.143362
56. Aisagbonhi O Experimental myocardial infarction triggers canonical Wnt signaling and endothelial-to-mesenchymal transition Dis. Model. Mech. 2011 4 469 483 10.1242/dmm.006510 21324930
Aisagbonhi, O. et al. Experimental myocardial infarction triggers canonical Wnt signaling and endothelial-to-mesenchymal transition. Dis. Model. Mech. 4, 469–483 (2011).21324930 10.1242/dmm.006510
57. Alonso-Herranz L Macrophages promote endothelial-to-mesenchymal transition via MT1-MMP/TGFβ1 after myocardial infarction eLife 2020 9 e57920 10.7554/eLife.57920 33063665
Alonso-Herranz, L. et al. Macrophages promote endothelial-to-mesenchymal transition via MT1-MMP/TGFβ1 after myocardial infarction. eLife 9, e57920 (2020).33063665 10.7554/eLife.57920
58. Davis J Molkentin JD Myofibroblasts: trust your heart and let fate decide J. Mol. Cell. Cardiol. 2014 70 9 18 10.1016/j.yjmcc.2013.10.019 24189039
Davis, J. & Molkentin, J. D. Myofibroblasts: trust your heart and let fate decide. J. Mol. Cell. Cardiol. 70, 9–18 (2014).24189039 10.1016/j.yjmcc.2013.10.019
59. Allanki S Interleukin-11 signaling promotes cellular reprogramming and limits fibrotic scarring during tissue regeneration Sci. Adv. 2021 7 eabg6497 10.1126/sciadv.abg6497 34516874
Allanki, S. et al. Interleukin-11 signaling promotes cellular reprogramming and limits fibrotic scarring during tissue regeneration. Sci. Adv. 7, eabg6497 (2021).34516874 10.1126/sciadv.abg6497
60. Fu X Specialized fibroblast differentiated states underlie scar formation in the infarcted mouse heart J. Clin. Invest. 2018 128 2127 2143 10.1172/JCI98215 29664017
Fu, X. et al. Specialized fibroblast differentiated states underlie scar formation in the infarcted mouse heart. J. Clin. Invest. 128, 2127–2143 (2018).29664017 10.1172/JCI98215
61. Crisan M Corselli M Chen WC Péault B Perivascular cells for regenerative medicine J. Cell. Mol. Med. 2012 16 2851 2860 10.1111/j.1582-4934.2012.01617.x 22882758
Crisan, M., Corselli, M., Chen, W. C. & Péault, B. Perivascular cells for regenerative medicine. J. Cell. Mol. Med. 16, 2851–2860 (2012).22882758 10.1111/j.1582-4934.2012.01617.x
62. Koth J Runx1 promotes scar deposition and inhibits myocardial proliferation and survival during zebrafish heart regeneration Development 2020 147 dev186569 10.1242/dev.186569 32341028
Koth, J. et al. Runx1 promotes scar deposition and inhibits myocardial proliferation and survival during zebrafish heart regeneration. Development 147, dev186569 (2020).32341028 10.1242/dev.186569
63. Liu P Zhong TP MAPK/ERK signalling is required for zebrafish cardiac regeneration Biotechnol. Lett. 2017 39 1069 1077 10.1007/s10529-017-2327-0 28353145
Liu, P. & Zhong, T. P. MAPK/ERK signalling is required for zebrafish cardiac regeneration. Biotechnol. Lett. 39, 1069–1077 (2017).28353145 10.1007/s10529-017-2327-0
64. Tahara N The FGF-AKT pathway is necessary for cardiomyocyte survival for heart regeneration in zebrafish Dev. Biol. 2021 472 30 37 10.1016/j.ydbio.2020.12.019 33444612
Tahara, N. et al. The FGF-AKT pathway is necessary for cardiomyocyte survival for heart regeneration in zebrafish. Dev. Biol. 472, 30–37 (2021).33444612 10.1016/j.ydbio.2020.12.019
65. Kawai T Adachi O Ogawa T Takeda K Akira S Unresponsiveness of MyD88-deficient mice to endotoxin Immunity 1999 11 115 122 10.1016/S1074-7613(00)80086-2 10435584
Kawai, T., Adachi, O., Ogawa, T., Takeda, K. & Akira, S. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11, 115–122 (1999).10435584 10.1016/S1074-7613(00)80086-2
66. Wen X Jiao L Tan H MAPK/ERK pathway as a central regulator in vertebrate organ regeneration Int. J. Mol. Sci. 2022 23 1464 10.3390/ijms23031464 35163418
Wen, X., Jiao, L. & Tan, H. MAPK/ERK pathway as a central regulator in vertebrate organ regeneration. Int. J. Mol. Sci. 23, 1464 (2022).35163418 10.3390/ijms23031464
67. Fukazawa R Neuregulin-1 protects ventricular myocytes from anthracycline-induced apoptosis via erbB4-dependent activation of PI3-kinase/Akt J. Mol. Cell. Cardiol. 2003 35 1473 1479 10.1016/j.yjmcc.2003.09.012 14654373
Fukazawa, R. et al. Neuregulin-1 protects ventricular myocytes from anthracycline-induced apoptosis via erbB4-dependent activation of PI3-kinase/Akt. J. Mol. Cell. Cardiol. 35, 1473–1479 (2003).14654373 10.1016/j.yjmcc.2003.09.012
68. Ghafouri-Fard S Interplay between PI3K/AKT pathway and heart disorders Mol. Biol. Rep. 2022 49 9767 9781 10.1007/s11033-022-07468-0 35499687
Ghafouri-Fard, S. et al. Interplay between PI3K/AKT pathway and heart disorders. Mol. Biol. Rep. 49, 9767–9781 (2022).35499687 10.1007/s11033-022-07468-0
69. Shiojima I Walsh K Role of Akt signaling in vascular homeostasis and angiogenesis Circ. Res. 2002 90 1243 1250 10.1161/01.RES.0000022200.71892.9F 12089061
Shiojima, I. & Walsh, K. Role of Akt signaling in vascular homeostasis and angiogenesis. Circ. Res. 90, 1243–1250 (2002).12089061 10.1161/01.RES.0000022200.71892.9F
70. Kwon OS MyD88 regulates physical inactivity-induced skeletal muscle inflammation, ceramide biosynthesis signaling, and glucose intolerance Am. J. Physiol. Endocrinol. Metab. 2015 309 E11 E21 10.1152/ajpendo.00124.2015 25968578
Kwon, O. S. et al. MyD88 regulates physical inactivity-induced skeletal muscle inflammation, ceramide biosynthesis signaling, and glucose intolerance. Am. J. Physiol. Endocrinol. Metab. 309, E11–E21 (2015).25968578 10.1152/ajpendo.00124.2015
71. Rhee SH Kim H Moyer MP Pothoulakis C Role of MyD88 in phosphatidylinositol 3-kinase activation by flagellin/Toll-like receptor 5 engagement in colonic epithelial cells J. Biol. Chem. 2006 281 18560 18568 10.1074/jbc.M513861200 16644730
Rhee, S. H., Kim, H., Moyer, M. P. & Pothoulakis, C. Role of MyD88 in phosphatidylinositol 3-kinase activation by flagellin/Toll-like receptor 5 engagement in colonic epithelial cells. J. Biol. Chem. 281, 18560–18568 (2006).16644730 10.1074/jbc.M513861200
72. He Y Targeting PI3K/Akt signal transduction for cancer therapy Signal Transduct. Target. Ther. 2021 6 425 10.1038/s41392-021-00828-5 34916492
He, Y. et al. Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct. Target. Ther. 6, 425 (2021).34916492 10.1038/s41392-021-00828-5
73. Marín-Juez R Fast revascularization of the injured area is essential to support zebrafish heart regeneration Proc. Natl Acad. Sci. USA 2016 113 11237 11242 10.1073/pnas.1605431113 27647901
Marín-Juez, R. et al. Fast revascularization of the injured area is essential to support zebrafish heart regeneration. Proc. Natl Acad. Sci. USA 113, 11237–11242 (2016).27647901 10.1073/pnas.1605431113
74. Marin-Juez R Coronary revascularization during heart regeneration is regulated by epicardial and endocardial cues and forms a scaffold for cardiomyocyte repopulation Dev. Cell 2019 51 503 515 10.1016/j.devcel.2019.10.019 31743664
Marin-Juez, R. et al. Coronary revascularization during heart regeneration is regulated by epicardial and endocardial cues and forms a scaffold for cardiomyocyte repopulation. Dev. Cell 51, 503–515 (2019).31743664 10.1016/j.devcel.2019.10.019
75. Kikuchi K Primary contribution to zebrafish heart regeneration by gata4+ cardiomyocytes Nature 2010 464 601 605 10.1038/nature08804 20336144
Kikuchi, K. et al. Primary contribution to zebrafish heart regeneration by gata4 + cardiomyocytes. Nature 464, 601–605 (2010).20336144 10.1038/nature08804
76. Jopling C Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation Nature 2010 464 606 609 10.1038/nature08899 20336145
Jopling, C. et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature 464, 606–609 (2010).20336145 10.1038/nature08899
77. Beisaw A AP-1 contributes to chromatin accessibility to promote sarcomere disassembly and cardiomyocyte protrusion during zebrafish heart regeneration Circ. Res. 2020 126 1760 1778 10.1161/CIRCRESAHA.119.316167 32312172
Beisaw, A. et al. AP-1 contributes to chromatin accessibility to promote sarcomere disassembly and cardiomyocyte protrusion during zebrafish heart regeneration. Circ. Res. 126, 1760–1778 (2020).32312172 10.1161/CIRCRESAHA.119.316167
78. Moretti L Stalfort J Barker TH Abebayehu D The interplay of fibroblasts, the extracellular matrix, and inflammation in scar formation J. Biol. Chem. 2022 298 101530 10.1016/j.jbc.2021.101530 34953859
Moretti, L., Stalfort, J., Barker, T. H. & Abebayehu, D. The interplay of fibroblasts, the extracellular matrix, and inflammation in scar formation. J. Biol. Chem. 298, 101530 (2022).34953859 10.1016/j.jbc.2021.101530
79. Sallin P de Preux Charles AS Duruz V Pfefferli C Jaźwińska A A dual epimorphic and compensatory mode of heart regeneration in zebrafish Dev. Biol. 2015 399 27 40 10.1016/j.ydbio.2014.12.002 25557620
Sallin, P., de Preux Charles, A. S., Duruz, V., Pfefferli, C. & Jaźwińska, A. A dual epimorphic and compensatory mode of heart regeneration in zebrafish. Dev. Biol. 399, 27–40 (2015).25557620 10.1016/j.ydbio.2014.12.002
80. Long H Endothelial cells adopt a pro-reparative immune responsive signature during cardiac injury Life Sci. Alliance 2023 7 e202201870 10.26508/lsa.202201870 38012001
Long, H. et al. Endothelial cells adopt a pro-reparative immune responsive signature during cardiac injury. Life Sci. Alliance 7, e202201870 (2023).38012001 10.26508/lsa.202201870
81. Bednarek D Telomerase is essential for zebrafish heart regeneration Cell Rep. 2015 12 1691 1703 10.1016/j.celrep.2015.07.064 26321646
Bednarek, D. et al. Telomerase is essential for zebrafish heart regeneration. Cell Rep. 12, 1691–1703 (2015).26321646 10.1016/j.celrep.2015.07.064
82. King BL RegenDbase: a comparative database of noncoding RNA regulation of tissue regeneration circuits across multiple taxa npj Regen. Med. 2018 3 10 10.1038/s41536-018-0049-0 29872545
King, B. L. et al. RegenDbase: a comparative database of noncoding RNA regulation of tissue regeneration circuits across multiple taxa. npj Regen. Med. 3, 10 (2018).29872545 10.1038/s41536-018-0049-0
83. Torraca V Otto NA Tavakoli-Tameh A Meijer AH The inflammatory chemokine Cxcl18b exerts neutrophil-specific chemotaxis via the promiscuous chemokine receptor Cxcr2 in zebrafish Dev. Comp. Immunol. 2017 67 57 65 10.1016/j.dci.2016.10.014 27815178
Torraca, V., Otto, N. A., Tavakoli-Tameh, A. & Meijer, A. H. The inflammatory chemokine Cxcl18b exerts neutrophil-specific chemotaxis via the promiscuous chemokine receptor Cxcr2 in zebrafish. Dev. Comp. Immunol. 67, 57–65 (2017).27815178 10.1016/j.dci.2016.10.014
84. Xie Y Glucocorticoids inhibit macrophage differentiation towards a pro-inflammatory phenotype upon wounding without affecting their migration Dis. Model. Mech. 2019 12 dmm037887 10.1242/dmm.037887 31072958
Xie, Y. et al. Glucocorticoids inhibit macrophage differentiation towards a pro-inflammatory phenotype upon wounding without affecting their migration. Dis. Model. Mech. 12, dmm037887 (2019).31072958 10.1242/dmm.037887
85. Chatzopoulou A Glucocorticoid-induced attenuation of the inflammatory response in zebrafish Endocrinology 2016 157 2772 2784 10.1210/en.2015-2050 27219276
Chatzopoulou, A. et al. Glucocorticoid-induced attenuation of the inflammatory response in zebrafish. Endocrinology 157, 2772–2784 (2016).27219276 10.1210/en.2015-2050
86. Hesselson D Anderson RM Beinat M Stainier DY Distinct populations of quiescent and proliferative pancreatic β-cells identified by HOTcre mediated labeling Proc. Natl Acad. Sci. USA 2009 106 14896 14901 10.1073/pnas.0906348106 19706417
Hesselson, D., Anderson, R. M., Beinat, M. & Stainier, D. Y. Distinct populations of quiescent and proliferative pancreatic β-cells identified by HOTcre mediated labeling. Proc. Natl Acad. Sci. USA 106, 14896–14901 (2009).19706417 10.1073/pnas.0906348106
87. Rossi A Genetic compensation induced by deleterious mutations but not gene knockdowns Nature 2015 524 230 233 10.1038/nature14580 26168398
Rossi, A. et al. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524, 230–233 (2015).26168398 10.1038/nature14580
88. El-Brolosy MA Genetic compensation triggered by mutant mRNA degradation Nature 2019 568 193 197 10.1038/s41586-019-1064-z 30944477
El-Brolosy, M. A. et al. Genetic compensation triggered by mutant mRNA degradation. Nature 568, 193–197 (2019).30944477 10.1038/s41586-019-1064-z
89. Arslan F Myocardial ischemia/reperfusion injury is mediated by leukocytic Toll-like receptor-2 and reduced by systemic administration of a novel anti-Toll-like receptor-2 antibody Circulation 2010 121 80 90 10.1161/CIRCULATIONAHA.109.880187 20026776
Arslan, F. et al. Myocardial ischemia/reperfusion injury is mediated by leukocytic Toll-like receptor-2 and reduced by systemic administration of a novel anti-Toll-like receptor-2 antibody. Circulation 121, 80–90 (2010).20026776 10.1161/CIRCULATIONAHA.109.880187
90. Timmers L Toll-like receptor 4 mediates maladaptive left ventricular remodeling and impairs cardiac function after myocardial infarction Circ. Res. 2008 102 257 264 10.1161/CIRCRESAHA.107.158220 18007026
Timmers, L. et al. Toll-like receptor 4 mediates maladaptive left ventricular remodeling and impairs cardiac function after myocardial infarction. Circ. Res. 102, 257–264 (2008).18007026 10.1161/CIRCRESAHA.107.158220
91. Luo W Blockage of MyD88 in cardiomyocytes alleviates cardiac inflammation and cardiomyopathy in experimental diabetic mice Biochem. Pharmacol. 2022 206 115292 10.1016/j.bcp.2022.115292 36241098
Luo, W. et al. Blockage of MyD88 in cardiomyocytes alleviates cardiac inflammation and cardiomyopathy in experimental diabetic mice. Biochem. Pharmacol. 206, 115292 (2022).36241098 10.1016/j.bcp.2022.115292
92. Hsu AY Development and characterization of an endotoxemia model in zebra fish Front. Immunol. 2018 9 607 10.3389/fimmu.2018.00607 29651289
Hsu, A. Y. et al. Development and characterization of an endotoxemia model in zebra fish. Front. Immunol. 9, 607 (2018).29651289 10.3389/fimmu.2018.00607
93. Feng Y Zou L Chen C Li D Chao W Role of cardiac- and myeloid-MyD88 signaling in endotoxin shock: a study with tissue-specific deletion models Anesthesiology 2014 121 1258 1269 10.1097/ALN.0000000000000398 25089642
Feng, Y., Zou, L., Chen, C., Li, D. & Chao, W. Role of cardiac- and myeloid-MyD88 signaling in endotoxin shock: a study with tissue-specific deletion models. Anesthesiology 121, 1258–1269 (2014).25089642 10.1097/ALN.0000000000000398
94. Yu M MyD88-dependent interplay between myeloid and endothelial cells in the initiation and progression of obesity-associated inflammatory diseases J. Exp. Med. 2014 211 887 907 10.1084/jem.20131314 24752299
Yu, M. et al. MyD88-dependent interplay between myeloid and endothelial cells in the initiation and progression of obesity-associated inflammatory diseases. J. Exp. Med. 211, 887–907 (2014).24752299 10.1084/jem.20131314
95. Liu S Blood flow patterns regulate PCSK9 secretion via MyD88-mediated pro-inflammatory cytokines Cardiovasc. Res. 2020 116 1721 1732 10.1093/cvr/cvz262 31593224
Liu, S. et al. Blood flow patterns regulate PCSK9 secretion via MyD88-mediated pro-inflammatory cytokines. Cardiovasc. Res. 116, 1721–1732 (2020).31593224 10.1093/cvr/cvz262
96. Patra C The zebrafish ventricle: a hub of cardiac endothelial cells for in vitro cell behavior studies Sci. Rep. 2017 7 2687 10.1038/s41598-017-02461-1 28578380
Patra, C. et al. The zebrafish ventricle: a hub of cardiac endothelial cells for in vitro cell behavior studies. Sci. Rep. 7, 2687 (2017).28578380 10.1038/s41598-017-02461-1
97. Feng Y Zou L Si R Nagasaka Y Chao W Bone marrow MyD88 signaling modulates neutrophil function and ischemic myocardial injury Am. J. Physiol. Cell Physiol. 2010 299 C760 C769 10.1152/ajpcell.00155.2010 20631245
Feng, Y., Zou, L., Si, R., Nagasaka, Y. & Chao, W. Bone marrow MyD88 signaling modulates neutrophil function and ischemic myocardial injury. Am. J. Physiol. Cell Physiol. 299, C760–C769 (2010).20631245 10.1152/ajpcell.00155.2010
98. Harari OA Alcaide P Ahl D Luscinskas FW Liao JK Absence of TRAM restricts Toll-like receptor 4 signaling in vascular endothelial cells to the MyD88 pathway Circ. Res. 2006 98 1134 1140 10.1161/01.RES.0000220105.85182.28 16574902
Harari, O. A., Alcaide, P., Ahl, D., Luscinskas, F. W. & Liao, J. K. Absence of TRAM restricts Toll-like receptor 4 signaling in vascular endothelial cells to the MyD88 pathway. Circ. Res. 98, 1134–1140 (2006).16574902 10.1161/01.RES.0000220105.85182.28
99. Wullaert A Bonnet MC Pasparakis M NF-κB in the regulation of epithelial homeostasis and inflammation Cell Res. 2011 21 146 158 10.1038/cr.2010.175 21151201
Wullaert, A., Bonnet, M. C. & Pasparakis, M. NF-κB in the regulation of epithelial homeostasis and inflammation. Cell Res. 21, 146–158 (2011).21151201 10.1038/cr.2010.175
100. Qu X Harmelink C Baldwin HS Endocardial-myocardial interactions during early cardiac differentiation and trabeculation Front. Cardiovasc. Med. 2022 9 857581 10.3389/fcvm.2022.857581 35600483
Qu, X., Harmelink, C. & Baldwin, H. S. Endocardial-myocardial interactions during early cardiac differentiation and trabeculation. Front. Cardiovasc. Med. 9, 857581 (2022).35600483 10.3389/fcvm.2022.857581
101. Wu CC Jeratsch S Graumann J Stainier DYR Modulation of mammalian cardiomyocyte cytokinesis by the extracellular matrix Circ. Res. 2020 127 896 907 10.1161/CIRCRESAHA.119.316303 32564729
Wu, C. C., Jeratsch, S., Graumann, J. & Stainier, D. Y. R. Modulation of mammalian cardiomyocyte cytokinesis by the extracellular matrix. Circ. Res. 127, 896–907 (2020).32564729 10.1161/CIRCRESAHA.119.316303
102. Bassat E The extracellular matrix protein agrin promotes heart regeneration in mice Nature 2017 547 179 184 10.1038/nature22978 28581497
Bassat, E. et al. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature 547, 179–184 (2017).28581497 10.1038/nature22978
103. Wang J Karra R Dickson AL Poss KD Fibronectin is deposited by injury-activated epicardial cells and is necessary for zebrafish heart regeneration Dev. Biol. 2013 382 427 435 10.1016/j.ydbio.2013.08.012 23988577
Wang, J., Karra, R., Dickson, A. L. & Poss, K. D. Fibronectin is deposited by injury-activated epicardial cells and is necessary for zebrafish heart regeneration. Dev. Biol. 382, 427–435 (2013).23988577 10.1016/j.ydbio.2013.08.012
104. Karra R Knecht AK Kikuchi K Poss KD Myocardial NF-κB activation is essential for zebrafish heart regeneration Proc. Natl Acad. Sci. USA 2015 112 13255 13260 10.1073/pnas.1511209112 26472034
Karra, R., Knecht, A. K., Kikuchi, K. & Poss, K. D. Myocardial NF-κB activation is essential for zebrafish heart regeneration. Proc. Natl Acad. Sci. USA 112, 13255–13260 (2015).26472034 10.1073/pnas.1511209112
105. Miranda AMA Single-cell transcriptomics for the assessment of cardiac disease Nat. Rev. Cardiol. 2023 20 289 308 10.1038/s41569-022-00805-7 36539452
Miranda, A. M. A. et al. Single-cell transcriptomics for the assessment of cardiac disease. Nat. Rev. Cardiol. 20, 289–308 (2023).36539452 10.1038/s41569-022-00805-7
106. Renshaw SA A transgenic zebrafish model of neutrophilic inflammation Blood 2006 108 3976 3978 10.1182/blood-2006-05-024075 16926288
Renshaw, S. A. et al. A transgenic zebrafish model of neutrophilic inflammation. Blood 108, 3976–3978 (2006).16926288 10.1182/blood-2006-05-024075
107. Ellett F Pase L Hayman JW Andrianopoulos A Lieschke GJ mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish Blood 2011 117 e49 e56 10.1182/blood-2010-10-314120 21084707
Ellett, F., Pase, L., Hayman, J. W., Andrianopoulos, A. & Lieschke, G. J. mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish. Blood 117, e49–e56 (2011).21084707 10.1182/blood-2010-10-314120
108. Poon K-L Liebling M Kondrychyn I Garcia-Lecea M Korzh V Zebrafish cardiac enhancer trap lines: new tools for in vivo studies of cardiovascular development and disease Dev. Dyn. 2010 239 914 926 10.1002/dvdy.22203 20063419
Poon, K.-L., Liebling, M., Kondrychyn, I., Garcia-Lecea, M. & Korzh, V. Zebrafish cardiac enhancer trap lines: new tools for in vivo studies of cardiovascular development and disease. Dev. Dyn. 239, 914–926 (2010).20063419 10.1002/dvdy.22203
109. Bussmann J Arteries provide essential guidance cues for lymphatic endothelial cells in the zebrafish trunk Development 2010 137 2653 2657 10.1242/dev.048207 20610484
Bussmann, J. et al. Arteries provide essential guidance cues for lymphatic endothelial cells in the zebrafish trunk. Development 137, 2653–2657 (2010).20610484 10.1242/dev.048207
110. Gagnon JA Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs PLoS ONE 2014 9 e98186 10.1371/journal.pone.0098186 24873830
Gagnon, J. A. et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE 9, e98186 (2014).24873830 10.1371/journal.pone.0098186
111. Varshney GK High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9 Genome Res. 2015 25 1030 1042 10.1101/gr.186379.114 26048245
Varshney, G. K. et al. High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res. 25, 1030–1042 (2015).26048245 10.1101/gr.186379.114
112. El-Sammak H A Vegfc-Emilin2a-Cxcl8a signaling axis required for zebrafish cardiac regeneration Circ. Res. 2022 130 1014 1029 10.1161/CIRCRESAHA.121.319929 35264012
El-Sammak, H. et al. A Vegfc-Emilin2a-Cxcl8a signaling axis required for zebrafish cardiac regeneration. Circ. Res. 130, 1014–1029 (2022).35264012 10.1161/CIRCRESAHA.121.319929
113. Lee CT Zhong L Mace TA Repasky EA Elevation in body temperature to fever range enhances and prolongs subsequent responsiveness of macrophages to endotoxin challenge PLoS ONE 2012 7 e30077 10.1371/journal.pone.0030077 22253887
Lee, C. T., Zhong, L., Mace, T. A. & Repasky, E. A. Elevation in body temperature to fever range enhances and prolongs subsequent responsiveness of macrophages to endotoxin challenge. PLoS ONE 7, e30077 (2012).22253887 10.1371/journal.pone.0030077
114. Lam P-Y Harvie EA Huttenlocher A Heat shock modulates neutrophil motility in zebrafish PLoS ONE 2013 8 e84436 10.1371/journal.pone.0084436 24367659
Lam, P.-Y., Harvie, E. A. & Huttenlocher, A. Heat shock modulates neutrophil motility in zebrafish. PLoS ONE 8, e84436 (2013).24367659 10.1371/journal.pone.0084436
115. Dobin A STAR: ultrafast universal RNA-seq aligner Bioinformatics 2013 29 15 21 10.1093/bioinformatics/bts635 23104886
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).23104886 10.1093/bioinformatics/bts635
116. Wolf FA Angerer P Theis FJ SCANPY: large-scale single-cell gene expression data analysis Genome Biol. 2018 19 15 10.1186/s13059-017-1382-0 29409532
Wolf, F. A., Angerer, P. & Theis, F. J. SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 19, 15 (2018).29409532 10.1186/s13059-017-1382-0
117. Bergen V Lange M Peidli S Wolf FA Theis FJ Generalizing RNA velocity to transient cell states through dynamical modeling Nat. Biotechnol. 2020 38 1408 1414 10.1038/s41587-020-0591-3 32747759
Bergen, V., Lange, M., Peidli, S., Wolf, F. A. & Theis, F. J. Generalizing RNA velocity to transient cell states through dynamical modeling. Nat. Biotechnol. 38, 1408–1414 (2020).32747759 10.1038/s41587-020-0591-3
118. La Manno G RNA velocity of single cells Nature 2018 560 494 498 10.1038/s41586-018-0414-6 30089906
La Manno, G. et al. RNA velocity of single cells. Nature 560, 494–498 (2018).30089906 10.1038/s41586-018-0414-6
119. Bolger AM Lohse M Usadel B Trimmomatic: a flexible trimmer for Illumina sequence data Bioinformatics 2014 30 2114 2120 10.1093/bioinformatics/btu170 24695404
Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).24695404 10.1093/bioinformatics/btu170
120. Liao Y Smyth GK Shi W featureCounts: an efficient general purpose program for assigning sequence reads to genomic features Bioinformatics 2014 30 923 930 10.1093/bioinformatics/btt656 24227677
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014).24227677 10.1093/bioinformatics/btt656
121. Love MI Huber W Anders S Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genome Biol. 2014 15 550 10.1186/s13059-014-0550-8 25516281
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).25516281 10.1186/s13059-014-0550-8
122. Schultheis H WIlsON: Web-based Interactive Omics VisualizatioN Bioinformatics 2019 35 1055 1057 10.1093/bioinformatics/bty711 30535135
Schultheis, H. et al. WIlsON: Web-based Interactive Omics VisualizatioN. Bioinformatics 35, 1055–1057 (2019).30535135 10.1093/bioinformatics/bty711
123. Fang Z Liu X Peltz G GSEApy: a comprehensive package for performing gene set enrichment analysis in Python Bioinformatics 2023 39 btac757 10.1093/bioinformatics/btac757 36426870
Fang, Z., Liu, X. & Peltz, G. GSEApy: a comprehensive package for performing gene set enrichment analysis in Python. Bioinformatics 39, btac757 (2023).36426870 10.1093/bioinformatics/btac757
