
==== Front
Arch Virol
Arch Virol
Archives of Virology
0304-8608
1432-8798
Springer Vienna Vienna

39150476
6099
10.1007/s00705-024-06099-z
Brief Report
The first report of porcine parvovirus 8 (PPV8) on the American continent is associated with pigs in Colombia with porcine respiratory disease
Vargas-Bermudez Diana S.
http://orcid.org/0000-0001-7697-5101
Jaime Jairo jjaimec@unal.edu.co

https://ror.org/059yx9a68 grid.10689.36 0000 0004 9129 0751 Universidad Nacional de Colombia, Sede Bogotá, Facultad de Medicina Veterinaria y de Zootecnia, Centro de Investigación en Infectología e Inmunología Veterinaria (CI3V), Carrera 30 # 45-03, Bogotá, D.C Colombia
Communicated by Ana Cristina Bratanich

16 8 2024
16 8 2024
2024
169 9 1798 3 2024
13 6 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Seven novel porcine parvoviruses (PPV2 to PPV8) have been discovered in the last two decades. The last one reported was PPV8 in China in 2022, which was proposed to be a member of the genus Protoparvovirus. Here, we report the first detection of PPV8 outside China – in two provinces from Colombia. Six out of 146 (4.1%) pigs showing porcine respiratory disease (PRD) tested positive for PPV8. Sequencing and phylogenetic analysis of two Colombian PPV8 isolates (GenBank database accession numbers PP335559 and PP335560) showed them to be members of the genus Protoparvovirus. Furthermore, PPV8 was detected in coinfections with porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV), which are associated with PRD.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00705-024-06099-z.

Keywords

Porcine parvovirus 8 (PPV8)
Porcine parvoviruses (PPVs)
Novel porcine parvovirus (nPPVs)
Porcine respiratory disease (PRD)
Coinfections
National University of ColombiaOpen Access funding provided by Colombia Consortium

issue-copyright-statement© Springer-Verlag GmbH Austria, part of Springer Nature 2024
==== Body
pmcPorcine respiratory disease complex (PRDC) is a major cause of production losses in the global swine industry. This disease has a multifactorial origin and results from infection with different combinations of pathogens (including viruses, bacteria, and parasites), in addition to non-infectious factors such as environmental conditions, the age of the animal, population size, management strategies, and genetics [1]. The causative viral agents of PRDC include primary (putative) pathogens such as porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), swine influenza A virus (IAV), and Aujeszky’s disease virus (ADV). In addition, the involvement of other viruses, such as porcine orthopneumovirus (SOV), porcine parainfluenza virus 1 (PPIV1), porcine circovirus 3 and 4 (PCV3, PCV4), porcine respiratory coronavirus (PRCV), porcine cytomegalovirus (PCMV) [2], and some novel parvoviruses (nPPV), has been suggested [3].

Parvoviruses (PVs) are non-enveloped viruses with a linear ssDNA genome. They belong to the family Parvoviridae, which includes viruses that infect invertebrates and vertebrates [4, 5]. In recent years, due to advances in high-throughput sequencing techniques and metagenomic analysis, novel parvoviruses have been discovered in various animal species [5]. Eight porcine parvoviruses (PPVs), designated as PPV1 through PPV8, have been discovered in the swine population [6–11]. PPV1 has been reported since the 1960s and is considered the oldest of the PPVs. It is associated with porcine reproductive failure (PRF) and causes different clinical manifestations that are collectively named “SMEDI” (stillbirth, mummification, embryonic death, and infertility) [12]. Seven nPPVs, from PPV2 to PPV8, were discovered in the last decades, with some proposed to be associated with clinical syndromes [3]. PPV2 was first detected in 2001 [13] and is currently the nPPV most frequently found in pigs with PRDC, with a prevalence reaching 75% [14]. In addition to the above and due to its detection by in situ hybridization (ISH) in the lung tissue of pigs suffering from respiratory failure (unpublished data), it has been suggested as a potential pathogen of PRDC [15, 16]. PPV3 was first reported in 2010 in Hong Kong in samples collected in slaughterhouses [6] and was later found distributed on various continents [17–20]. Regarding its association with PRDC, PPV3 has been detected at high viral loads in the lungs of pigs with respiratory disease [21]. PPV4 was first reported in 2010 in lung samples of pigs in the USA [22] and has also been detected in lungs with edema [14]. PPV5 was initially reported in the USA in 2013 in pig lungs [23], but its possible association with PRDC has not been established. PPV6 was first reported in China in 2014 in cases of abortions and stillbirths in herds experiencing PRF, as well as in healthy herds [8]. PPV6 is also one of the nPPVs that is detected most frequently in the lungs of pigs with PRDC [24]. PPV7 was discovered in 2016 in the USA through metagenomic analysis of stool samples [10], and its possible association in pigs with PRDC is yet to be established. Finally, PPV8, the most recent nPPV, was reported for the first time in China in September 2022 [11]. It was identified via high-throughput sequencing (HTS) in pig lung samples collected in 2021 in Guangdong province. In the same study, PPV8 was detected in samples of various tissues stored between 1990 and 2021 and found together with PRRSV in lung tissue. Those investigators determined the nearly complete genome (NCG) sequence of one PPV8 isolate, and that sequence is currently still the only one available. The PPV8 NCG is 4,380 nucleotides (nt) in length and has two overlapping open reading frames (ORFs), encoding the proteins non-structural 1 (NS1) and viral protein 1 (VP1), respectively. Phylogenetic analysis revealed that PPV8 was segregated in a different clade from other members of the genus Protoparvovirus.

In the present report, lung tissue samples that were collected during 2021–2022 from 76 swine herds located across Colombia´s five major swine-producing provinces – Antioquia, Atlántico, Valle de Cauca, Eje Cafetero, and Cundinamarca – were examined (Fig. 1). These samples were collected as part of a previous study aiming to determine the presence or absence of viruses implicated in PRDC, such as PCV2, PCV3, and PRRSV. Additionally, as a scientific interest, we routinely tested all samples received for some of the viruses that have been reported recently in the literature, including PPV8 and PCV4, which have never been reported in Colombia. As the original objective was the detection of viruses involved in PRD, samples were collected only from cases of pigs with respiratory clinical signs (dyspnea, tachypnea, and cyanosis). A total of 146 lung tissues were collected from nursery pigs (n = 122; aged 3 to 8 weeks) and grow-finisher pigs (n = 24; aged 8 to 23 weeks). Lung tissues were minced and diluted at 1:10 (weight/volume) in PBS (pH 7.4), homogenized, and centrifuged at 1,500 × g for 10 min. Total viral nucleic acids were extracted from 200 μL of the supernatant using a High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany), following the manufacturer’s instructions. All extracts were subsequently stored at -80°C until used for molecular analysis. The initial testing for PCV2, PCV3, and PRRSV was carried out via real-time PCR using TaqMan probes, employing specific primers and protocols that were reported previously [25]. Among these viruses, PRRSV was the most prevalent, detected in 65% (96/146) [95% CI; 57.2 − 72.7%] of the samples, followed by PCV2 in 63% (93/146) [95% CI; 53.0–70.8%] and PCV3 in 24% (36/146) [95% CI; 17–30.9%]. PPV8 was detected using conventional nested PCR (nPCR), employing specific primers as reported previously by Guo et al. [11]. The first amplification was performed using the primers PPV8-outF (5′-TGTTGGTTTGCACCTAGCG-3′) and PPV8-outR (5′-TGATGAGATGGTGGAACGC-3'). The second amplification was performed using the primers PPV8-inF (5′-TCCAAGTTGCCCTAGACAGC-3′) and PPV8-inR (5′- GCCTCGTACATGTGGACCTC-3′), producing a final product of 554 bp. Reactions were carried out in a total volume of 25 μL comprising 0.25 μL of Taq polymerase (5 U/μL) (Go Taq Flexi-Promega), 2.5 μL of 5x Taq buffer, 1 μL of each primer (20 μmol/μL), and 2 μL of extracted DNA. The thermal cycling conditions for each PCR included an initial denaturation step at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, and a final elongation step at 72°C for 10 min. The specificity of the assay was confirmed by testing DNA extracted from previous samples that were positive for other DNA viruses, including PCV2, PCV3, and PPV1 to PPV7. In this study, PPV8 was detected in 4.1% (6/146) [95% CI; 0.8– 7.3%] of the total lung samples tested (n = 146). At the herd level, the virus was detected in 3.1% (3/76) [95% CI; 0.4–8.2%] of the herds tested, and by age groups, it was detected in 3.3% (4/122) of nursery pigs and 8.3% (2/24) of grow-finisher pigs. By geographical regions, PPV8 was detected in two provinces (Cundinamarca and Eje Cafetero) out of the five surveyed. Comparing our study with the only other study in which PPV8 has been detected [11], we found a coincidence in the sample selection criteria since the pigs in both studies were sick with respiratory symptoms. Our sampling was larger (n = 146) versus (n = 55), and we covered the five provinces with the highest pork production in Colombia. In contrast, in the study from China, only one province (Guandong) was evaluated. Our study is the first to provide an approximation of the prevalence of PPV8 by tissue (lung) and groups evaluated (nursery and grow-finisher pigs) as well as by geographic distribution. In the study from China, PPV8 was detected in seven out of in 7/55 PRRSV-positive lungs, corresponding to a prevalence of 12.7%, which is higher than that found in Colombia (4.1%). An important aspect to discuss is the tropism of PPV8. Although these two studies reflect tropism for lung tissue, other studies [3, 16, 26] have shown that other nPPVs (PPV2 to PPV7) have been detected in different samples and tissues In the Chinese study [11], PPV8 was detected in 37 stored tissues collected between 1998 and 2021, with lung, kidney, spleen, liver, and lymph nodes testing positive. A major limitation of our study is that only lung tissues were tested. Therefore, it is still necessary to test for PPV8 in other organs and to determine whether it is associated with clinical manifestations. It is notable that all of the lung samples from the present study were negative for PCV4.

Fig. 1 Map of Colombia highlighting the five provinces selected for this study, which have the highest level of pig production in the country. (A) Antioquia. (B) Atlántico. (C) Valle del Cauca. (D) Eje Cafetero. (E) Cundinamarca. The provinces (D and E) where PPV8 was detected are highlighted in black. The map was created using the National Department of Statistics of Colombia (DANE) database (https://geoportal.dane.gov.co/acerca-del-geoportal/acerca/#gsc.tab=0) (accessed on 02 May 2024) and adapted using QGIS software version 3.34.5, available online: https://qgis.org/es/site/ (accessed on 02 May 2024).

A sequencing strategy using partially overlapping primer pairs to determine the sequence of the coding region of the PPV8 genome. Primers were designed based on the PPV8 sequence from China (GenBank database accession number GDJM2021) using Primer 3 Input (v3.0.0; Institute for Biomedical Research, Boston, MA) [11]. A list of the primers used, some of which were described previously, and their target regions on the PPV8 genome is shown in Table 1. This resulted in a nearly complete genome sequence lacking the two inverted terminal repeats (ITRs). PCR reactions for sequencing PPV8 were carried out in a total volume of 25 μL containing 0.25 μL of AccuPrime Taq polymerase (5 U/μL) (Thermo Fisher), 2.5 μL of 1x AccuPrime PCR buffer, 1 μL of each primer (20 μmol/μL), and 2 μL of extracted DNA. PCR conditions comprised initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 68°C for 1 min. All reactions were performed in a C1000 Touch thermocycler (Bio-Rad, Foster City, California, USA). The PCR products were subsequently purified using a QIAquick PCR Purification Kit (QIAGEN) following the manufacturer’s instructions.

Table 1 Primers used in the present study for sequencing the PPV8 genome

Primer	Sequence (5´- 3´)	
PPV8-225F	GGATGTCTTGACTTACAGATGGC	
PPV8-1215R	TGAAATGGATGAAGGAGTCTGG	
PPV8-1190F	AGATCCAGACTCCTTCATCCA	
PPV8-2156R	TGTTTTCTTGCTGCAGCGTC	
PPV8-1944F	GGAGAGCCATGGACAACCAA	
PPV8-2952R	CATGCTGTCGCTGTCTAGGG	
PPV8-2924F*	TCCAAGTTGCCCTAGACAGC	
PPV8-3477R*	GCCTCGTACATGTGGACCTC	
PPV8-3475F	GGCGTTCCACCATCTCATCA	
PPV8-4338R	CCAAGACACCCAAGAGCGTT	
*Primers PPV8 2924F and PPV8 3477R were reported previously [11].

Bidirectional Sanger sequencing was performed by a professional service (SSiGMol - Sequencing and Molecular Analysis Service, Institute of Genetics, National University of Colombia, Bogotá Campus). From the six PPV8-positive lung samples, sequences of two NCGs (4095 nt) were obtained and compared with those of PPV reference strains. Phylogenetic analysis was performed using our two PPV8 NCG sequences, the PPV8 sequence from China, and 39 PPV (PPV1 through PPV7) reference sequences obtained from the NCBI GenBank public database. These sequences were selected using nucleotide BLAST (Basic Local Alignment Search Tool), to include isolates from different continents. The sequences were aligned using MAFFT with default settings [27]. The two Colombian PPV8 NCG sequences (nt 243 to 4333), which included the VP and NS genes, have been deposited in the GenBank database under the accession numbers PP335559 and PP335560. The nt and aa sequence identity among two Colombian PPV8 sequences and the Chinese sequence (GenBank database accession number GDJM2021) ranged from 99.6–99.8%. The ORF1 region of the two Colombian sequences is 1,806 nt long and encodes an NS protein of 601 aa. The nt sequence identity of ORF1 ranged from 99.5–99.8%, and the aa sequence identity was 99.8%. The ORF2 of both Colombian sequences was 2,106 nt in length, encoding a 701-aa VP protein. The nt sequence identity among the ORF2 sequences ranged from 99.6–99.8%, and the aa sequence identity was 99.8%. Phylogenetic analysis was performed using MEGA 7.0 for Windows [12] by the maximum-likelihood (ML) method, with 1,000 ultrafast bootstrap replicates, and the Tamura 3 parameter model with gamma-distributed heterogeneity (T92 + G) nt substitution model was chosen as the best fit. The resulting tree (Fig. 2) revealed that the Colombian isolates (PPV8/Col/Cundinamarca3.19/2021 and PPV8/Col/E.cafetero4.1/2021) clustered together with the PPV8 isolate from China in an independent branch and were included in a clade with other members of the genus Protoparvovirus. The three PPV8 sequences shared the most sequence similarity with porcine bufavirus and were more distantly related to reference strains of PPV1. Based on its phylogenetic relationships, PPV8 is proposed to be a member of the genus Protoparvovirus, but its taxonomic position within the genus has yet to be defined.

Fig. 2 Maximum-likelihood phylogenetic tree of PPVs (PPV1 through PPV8) based on an alignment of complete genome nucleotide sequences. Sequences in black are from members of the genus Protoparvovirus, including three PPV8 sequences (highlighted in black), and ** indicates the positions of the two Colombian sequences from the present study

PPV8 was found to be present in both single infections and coinfections with other viruses. PPV8 mono-infection accounted for 16% (1/6) of the PPV8-positive lung samples. A dual infection with PRRSV and PPV8 was found in two of the six positive samples (33.3%), and a dual infection with PCV2 and PPV8 (16%) was found in one. A triple infection with PCV2, PRRSV, and PPV8 was detected in two samples (33%). In the study from China [11], PRRSV/PPV8 coinfections were also detected in lung samples, and classical swine fever virus (CSFV)/PPV8 coinfections were detected in tissues stored between 1998 and 2021. Our study is the first to identity coinfections between primary PRDC viruses (PRRSV and PCV2) and PPV8 in lung tissue, confirming earlier suggestions that nPPV coinfections occur frequently in different tissues and organs [3, 25].

The results of this study reveal that the two Colombian PPV8 isolates and the Chinese isolate belong to the same genus as PPV1 and form a separate subclade from other protoparvoviruses. The presence of PPV8 in pigs with respiratory signs, particularly in coinfection with other viruses (PRRSV and PCV2), suggests the possible participation of PPV8 in PRDC, but this still needs to be investigated experimentally. As with the other nPPVs, it needs to be clarified whether PPV8 is part of the normal porcine virome and whether it plays a role in disease when present in coinfection with other pathogens.

Electronic supplementary material

Below is the link to the electronic supplementary material

Supplementary Material 1

The authors would like to express their gratitude to all the veterinarians and technicians of Zoetis Colombia and the participating farms for their collaboration and logistical support for the development of this research.

Funding

This research was funded by the 2019–2021 Bicentennial Doctoral Excellence Scholarship Program, Ministry of Science and Technology of Colombia, with financing granted with resources from the Fondo de Ciencia, Tecnología e Innovación (FCTEI) del Sistema General de Regalías (SGR), Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Sede Bogotá (funding number Hermes 60845 − 2023), and through resources from the corresponding author.

Open Access funding provided by Colombia Consortium

Declarations

Ethical approval

The Ethics Committee of Animal Care and Experimentation of Facultad de Medicina Veterinaria y de Zootecnia of the Universidad Nacional de Colombia, Sede Bogotá, approved this study (approval number CB-FMVZ-UN-011–20). The pigs sampled in this study were cared for following The Guiding Principle for Animal Care applied by the Asociación Colombiana de Porcicultores-PorkColombia.

Conflict of interest

All authors declare no conflict of interest.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Ramos N Sibila M Neira V Editorial: Porcine respiratory disease complex: dynamics of polymicrobial infections, synergistic effects and management strategies Front Vet Sci 2023 10 1329073 10.3389/fvets.2023.1329073 38094500
Ramos N, Sibila M, Neira V (2023) Editorial: porcine respiratory disease complex: dynamics of polymicrobial infections, synergistic effects and management strategies. Front Vet Sci 10:1329073. 10.3389/fvets.2023.132907338094500 10.3389/fvets.2023.1329073
2. Saade G Deblanc C Bougon J Coinfections and their molecular consequences in the porcine respiratory tract Vet Res 2020 51 80 10.1186/s13567-020-00807-8 32546263
Saade G, Deblanc C, Bougon J et al (2020) Coinfections and their molecular consequences in the porcine respiratory tract. Vet Res 51:80. 10.1186/s13567-020-00807-832546263 10.1186/s13567-020-00807-8
3. Vargas-Bermudez DS, Mogollon JD, Franco-Rodriguez C, Jaime J (2023) The novel porcine parvoviruses: current state of knowledge and their possible implications in clinical syndromes in pigs. Viruses 15. 10.3390/v15122398
4. Pénzes JJ Söderlund-Venermo M Canuti M Reorganizing the family Parvoviridae: a revised taxonomy independent of the canonical approach based on host association Arch Virol 2020 165 2133 2146 10.1007/s00705-020-04632-4 32533329
Pénzes JJ, Söderlund-Venermo M, Canuti M et al (2020) Reorganizing the family Parvoviridae: a revised taxonomy independent of the canonical approach based on host association. Arch Virol 165:2133–2146. 10.1007/s00705-020-04632-432533329 10.1007/s00705-020-04632-4
5. Cotmore SF Agbandje-McKenna M Canuti M ICTV virus taxonomy profile: parvoviridae J Gen Virol 2019 100 367 368 10.1099/jgv.0.001212 30672729
Cotmore SF, Agbandje-McKenna M, Canuti M et al (2019) ICTV virus taxonomy profile: parvoviridae. J Gen Virol 100:367–368. 10.1099/jgv.0.00121230672729 10.1099/jgv.0.001212
6. Lau SKP Woo PCY Tse H Identification of novel porcine and bovine parvoviruses closely related to human parvovirus 4 J Gen Virol 2008 89 1840 1848 10.1099/vir.0.2008/000380-0 18632954
Lau SKP, Woo PCY, Tse H et al (2008) Identification of novel porcine and bovine parvoviruses closely related to human parvovirus 4. J Gen Virol 89:1840–1848. 10.1099/vir.0.2008/000380-018632954 10.1099/vir.0.2008/000380-0
7. Xiao C-T Giménez-Lirola LG Jiang Y-H Characterization of a novel porcine parvovirus tentatively designated PPV5 PLoS ONE 2013 8 e65312 10.1371/journal.pone.0065312 23762339
Xiao C-T, Giménez-Lirola LG, Jiang Y-H et al (2013) Characterization of a novel porcine parvovirus tentatively designated PPV5. PLoS ONE 8:e65312. 10.1371/journal.pone.006531223762339 10.1371/journal.pone.0065312
8. Ni J Qiao C Han X Identification and genomic characterization of a novel porcine parvovirus (PPV6) in China Virol J 2014 11 203 10.1186/s12985-014-0203-2 25442288
Ni J, Qiao C, Han X et al (2014) Identification and genomic characterization of a novel porcine parvovirus (PPV6) in China. Virol J 11:203. 10.1186/s12985-014-0203-225442288 10.1186/s12985-014-0203-2
9. Opriessnig T Xiao C-T Gerber PF Halbur PG Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease Vet Microbiol 2014 173 9 16 10.1016/j.vetmic.2014.06.024 25081955
Opriessnig T, Xiao C-T, Gerber PF, Halbur PG (2014) Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. Vet Microbiol 173:9–16. 10.1016/j.vetmic.2014.06.02425081955 10.1016/j.vetmic.2014.06.024
10. Palinski RM Mitra N Hause BM Discovery of a novel Parvovirinae virus, porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs Virus Genes 2016 52 564 567 10.1007/s11262-016-1322-1 26995221
Palinski RM, Mitra N, Hause BM (2016) Discovery of a novel Parvovirinae virus, porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs. Virus Genes 52:564–567. 10.1007/s11262-016-1322-126995221 10.1007/s11262-016-1322-1
11. Guo Y Yan G Chen S Identification and genomic characterization of a novel porcine parvovirus in China Front Vet Sci 2022 9 1009103 10.3389/fvets.2022.1009103 36204286
Guo Y, Yan G, Chen S et al (2022) Identification and genomic characterization of a novel porcine parvovirus in China. Front Vet Sci 9:1009103. 10.3389/fvets.2022.100910336204286 10.3389/fvets.2022.1009103
12. Streck AF Truyen U Porcine Parvovirus Curr Issues Mol Biol 2020 37 33 46 10.21775/cimb.037.033 31822635
Streck AF, Truyen U (2020) Porcine Parvovirus. Curr Issues Mol Biol 37:33–46. 10.21775/cimb.037.03331822635 10.21775/cimb.037.033
13. Hijikata M Abe K Win KM Identification of new parvovirus DNA sequence in swine sera from Myanmar Jpn J Infect Dis 2001 54 244 245 11862009
Hijikata M, Abe K, Win KM et al (2001) Identification of new parvovirus DNA sequence in swine sera from Myanmar. Jpn J Infect Dis 54:244–24511862009
14. Lagan Tregaskis P Staines A Gordon A Co-infection status of novel parvovirus’s (PPV2 to 4) with porcine circovirus 2 in porcine respiratory disease complex and porcine circovirus-associated disease from 1997 to 2012 Transbound Emerg Dis 2021 68 1979 1994 10.1111/tbed.13846 32969579
Lagan Tregaskis P, Staines A, Gordon A et al (2021) Co-infection status of novel parvovirus’s (PPV2 to 4) with porcine circovirus 2 in porcine respiratory disease complex and porcine circovirus-associated disease from 1997 to 2012. Transbound Emerg Dis 68:1979–1994. 10.1111/tbed.1384632969579 10.1111/tbed.13846
15. Novosel D Cadar D Tuboly T Investigating porcine parvoviruses genogroup 2 infection using in situ polymerase chain reaction BMC Vet Res 2018 14 163 10.1186/s12917-018-1487-z 29783968
Novosel D, Cadar D, Tuboly T et al (2018) Investigating porcine parvoviruses genogroup 2 infection using in situ polymerase chain reaction. BMC Vet Res 14:163. 10.1186/s12917-018-1487-z29783968 10.1186/s12917-018-1487-z
16. Nelsen A Lin C-M Hause BM Porcine parvovirus 2 is predominantly associated with macrophages in porcine respiratory disease complex Front Vet Sci 2021 8 726884 10.3389/fvets.2021.726884 34485445
Nelsen A, Lin C-M, Hause BM (2021) Porcine parvovirus 2 is predominantly associated with macrophages in porcine respiratory disease complex. Front Vet Sci 8:726884. 10.3389/fvets.2021.72688434485445 10.3389/fvets.2021.726884
17. Cadar D Cságola A Kiss T Tuboly T Capsid protein evolution and comparative phylogeny of novel porcine parvoviruses Mol Phylogenet Evol 2013 66 243 253 10.1016/j.ympev.2012.09.030 23044400
Cadar D, Cságola A, Kiss T, Tuboly T (2013) Capsid protein evolution and comparative phylogeny of novel porcine parvoviruses. Mol Phylogenet Evol 66:243–253. 10.1016/j.ympev.2012.09.03023044400 10.1016/j.ympev.2012.09.030
18. Adlhoch C Kaiser M Ellerbrok H Pauli G High prevalence of porcine Hokovirus in German wild boar populations Virol J 2010 7 171 10.1186/1743-422X-7-171 20653980
Adlhoch C, Kaiser M, Ellerbrok H, Pauli G (2010) High prevalence of porcine Hokovirus in German wild boar populations. Virol J 7:171. 10.1186/1743-422X-7-17120653980 10.1186/1743-422X-7-171
19. Cságola A Lőrincz M Cadar D Detection, prevalence and analysis of emerging porcine parvovirus infections Arch Virol 2012 157 1003 1010 10.1007/s00705-012-1257-3 22383055
Cságola A, Lőrincz M, Cadar D et al (2012) Detection, prevalence and analysis of emerging porcine parvovirus infections. Arch Virol 157:1003–1010. 10.1007/s00705-012-1257-322383055 10.1007/s00705-012-1257-3
20. Cui J Biernacka K Fan J Circulation of Porcine Parvovirus Types 1 through 6 in Serum Samples Obtained from Six Commercial Polish Pig Farms Transbound Emerg Dis 2017 64 1945 1952 10.1111/tbed.12593 27882679
Cui J, Biernacka K, Fan J et al (2017) Circulation of porcine Parvovirus Types 1 through 6 in serum samples obtained from six commercial Polish pig farms. Transbound Emerg Dis 64:1945–1952. 10.1111/tbed.1259327882679 10.1111/tbed.12593
21. Xiao C-T Giménez-Lirola LG Halbur PG Opriessnig T Increasing porcine PARV4 prevalence with pig age in the U.S. pig population Vet Microbiol 2012 160 290 296 10.1016/j.vetmic.2012.05.038 22728123
Xiao C-T, Giménez-Lirola LG, Halbur PG, Opriessnig T (2012) Increasing porcine PARV4 prevalence with pig age in the U.S. pig population. Vet Microbiol 160:290–296. 10.1016/j.vetmic.2012.05.03822728123 10.1016/j.vetmic.2012.05.038
22. Cheung AK Wu G Wang D Identification and molecular cloning of a novel porcine parvovirus Arch Virol 2010 155 801 806 10.1007/s00705-010-0646-8 20339886
Cheung AK, Wu G, Wang D et al (2010) Identification and molecular cloning of a novel porcine parvovirus. Arch Virol 155:801–806. 10.1007/s00705-010-0646-820339886 10.1007/s00705-010-0646-8
23. Xiao C-T, Halbur PG, Opriessnig T (2013) Complete genome sequence of a novel porcine parvovirus (PPV) provisionally designated PPV5. 10.1128/genomeA.00021-12. Genome Announc 1:
24. Qin S Ruan W Yue H Viral communities associated with porcine respiratory disease complex in intensive commercial farms in Sichuan province, China Sci Rep 2018 8 13341 10.1038/s41598-018-31554-8 30190594
Qin S, Ruan W, Yue H et al (2018) Viral communities associated with porcine respiratory disease complex in intensive commercial farms in Sichuan province, China. Sci Rep 8:13341. 10.1038/s41598-018-31554-830190594 10.1038/s41598-018-31554-8
25. Vargas-Bermudez DS Diaz A Polo G Infection and Coinfection of Porcine-Selected Viruses (PPV1 to PPV8, PCV2 to PCV4, and PRRSV) in Gilts and Their Associations with Reproductive Performance Veterinary Sci 2024 11 185 10.3390/vetsci11050185
Vargas-Bermudez DS, Diaz A, Polo G et al (2024) Infection and coinfection of porcine-selected viruses (PPV1 to PPV8, PCV2 to PCV4, and PRRSV) in gilts and their associations with reproductive performance. Veterinary Sci 11:185. 10.3390/vetsci1105018510.3390/vetsci11050185
26. Kim S-C Kim J-H Kim J-Y Prevalence of porcine parvovirus 1 through 7 (PPV1-PPV7) and co-factor association with PCV2 and PRRSV in Korea BMC Vet Res 2022 18 133 10.1186/s12917-022-03236-1 35395853
Kim S-C, Kim J-H, Kim J-Y et al (2022) Prevalence of porcine parvovirus 1 through 7 (PPV1-PPV7) and co-factor association with PCV2 and PRRSV in Korea. BMC Vet Res 18:133. 10.1186/s12917-022-03236-135395853 10.1186/s12917-022-03236-1
27. Katoh K Rozewicki J Yamada KD MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization Brief Bioinf 2019 20 bbx108 10.1093/bib/bbx108
Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinf 20:bbx108. 10.1093/bib/bbx10810.1093/bib/bbx108
