
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

37505079
84710
10.7554/eLife.84710
version of record
Research Article
Cell Biology
Mitochondrial defects caused by PARL deficiency lead to arrested spermatogenesis and ferroptosis
Radaelli Enrico https://orcid.org/0000-0002-2885-0221
1
Assenmacher Charles-Antoine 1
Verrelle Jillian 1
Banerjee Esha 1
Manero Florence 2
Khiati Salim 3
Girona Anais 3
Lopez-Lluch Guillermo 45
Navas Placido 45
Spinazzi Marco https://orcid.org/0000-0003-0048-9558
marco.spinazzi@chu-angers.fr
36
1 https://ror.org/00b30xv10 Department of Pathobiology, Comparative Pathology Core, School of Veterinary Medicine, University of Pennsylvania Philadelphia United States
2 https://ror.org/04yrqp957 University of Angers Angers France
3 https://ror.org/04yrqp957 Unité Mixte de Recherche (UMR) MITOVASC, Centre National de la Recherche Scientifique (CNRS) 6015, Institut National de la Santé et de la Recherche Médicale (INSERM) U1083, University of Angers Angers France
4 https://ror.org/01v5e3436 Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide-Consejo Superior de Investigaciones Científicas-Junta de Andalucía Sevilla Spain
5 https://ror.org/00ca2c886 CIBERER, Instituto de Salud Carlos III Madrid Spain
6 https://ror.org/0250ngj72 Neuromuscular Reference Center, Department of Neurology, CHU Angers Angers France
Yan Wei Reviewing Editor https://ror.org/046rm7j60 University of California, Los Angeles United States

Yan Wei Senior Editor https://ror.org/046rm7j60 University of California, Los Angeles United States

28 7 2023
2023
12 e8471005 11 2022
23 7 2023
This manuscript was published as a preprint at .22 11 2022

© 2023, Radaelli et al
2023
Radaelli et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Impaired spermatogenesis and male infertility are common manifestations associated with mitochondrial diseases, yet the underlying mechanisms linking these conditions remain elusive. In this study, we demonstrate that mice deficient for the mitochondrial intra-membrane rhomboid protease PARL, a recently reported model of the mitochondrial encephalopathy Leigh syndrome, develop early testicular atrophy caused by a complete arrest of spermatogenesis during meiotic prophase I, followed by degeneration and death of arrested spermatocytes. This process is independent of neurodegeneration. Interestingly, genetic modifications of PINK1, PGAM5, and TTC19 – three major substrates of PARL with important roles in mitochondrial homeostasis – fail to reproduce or modify this severe phenotype, indicating that the spermatogenic arrest arises from distinct molecular pathways. We further observed severe abnormalities in mitochondrial ultrastructure in PARL-deficient spermatocytes, along with prominent electron transfer chain defects, disrupted coenzyme Q (CoQ) biosynthesis, and metabolic rewiring. These mitochondrial defects are associated with a germ cell-specific decrease in GPX4 expression leading arrested spermatocytes to ferroptosis – a regulated cell death modality characterized by uncontrolled lipid peroxidation. Our results suggest that mitochondrial defects induced by PARL depletion act as an initiating trigger for ferroptosis in primary spermatocytes through simultaneous effects on GPX4 and CoQ – two major inhibitors of ferroptosis. These findings shed new light on the potential role of ferroptosis in the pathogenesis of mitochondrial diseases and male infertility warranting further investigation.

eLife digest

Up to 9% of men are thought to experience infertility. These individuals may not produce enough healthy sperm cells. The root cause of infertility is often not discovered but, in some cases, it is associated with genetic defects in cell compartments known as mitochondria.

Mitochondria are responsible for converting energy from food into a form of chemical energy cells need to power vital processes. However, it remains unclear how defects in mitochondria contribute to male infertility.

Leigh syndrome is one of the most prevalent and severe diseases caused by genetic defects in mitochondria. The condition often develops in childhood and affects the nervous system, muscle and other organs, leading to many symptoms including muscle weakness and neurological regression. A previous study found that mutant mice that lack an enzyme, called PARL, display symptoms that are similar to those observed in humans with Leigh syndrome. PARL is found inside mitochondria where it cuts specific proteins to ensure they are working correctly in the cells.

Radaelli et al. used extensive microscopy and biochemical analyses to study the fertility of male mice lacking PARL. The experiments revealed that the males were infertile due to a failure to produce sperm: spermatocytes, which usually develop into sperm cells, where much more likely to die in mice without PARL (by a process known as ferroptosis).

Further experiments demonstrated that the mitochondria of the mutant mice had a shortage of two crucial molecules, a protein called GPX4 and a lipid called Coenzyme Q, which are required to prevent death by ferroptosis. It appears that this shortage was responsible for the demise of spermatocytes in the male mutant mice affected by infertility.

These findings reveal a new role for PARL in the body and provide evidence that mitochondrial defects in living mammals can trigger ferroptosis, thereby contributing to male infertility. In the future, this research may pave the way for new treatments for male infertility and other diseases associated with defects in mitochondria.

PARL
ferroptosis
GPX4
coenzyme Q
spermatogenesis
mitochondria
respiratory chain
mitochondrial structure
Leigh syndrome
Research organism

Mouse
http://dx.doi.org/10.13039/100006920 University of Pennsylvania URF Fall 19-0914 Radaelli Enrico http://dx.doi.org/10.13039/501100004923 Association Française Myopathies (AFM) Telethon 23019 Spinazzi Marco http://dx.doi.org/10.13039/100017006 Abramson Cancer Center P30CA016520 Radaelli Enrico The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementMitochondrial functional and structural defects caused by PARL deficiency lead to arrested spermatogenesis and germ cell ferroptosis.
==== Body
pmcIntroduction

Impaired spermatogenesis and consequent infertility are increasingly prevalent medical concerns affecting approximately 9% of the global male population (Boivin et al., 2009). The underlying mechanisms of these conditions appear to involve oxidative stress and mitochondrial dysfunction, but their specific contribution is poorly characterized (Aitken et al., 2022). Furthermore, male infertility has been identified as a significant manifestation of mitochondrial diseases (Martikainen et al., 2017). While the essential roles of mitochondria in reproductive biology, including spermatogenesis, are established, their precise mechanisms remain incompletely understood (Cannon et al., 2011; Rajender et al., 2010). Mitochondrial diseases encompass a range of inborn errors of metabolism caused by genetic defects in either mitochondrial or nuclear genome. The selective vulnerability of specific organs or tissues to these genetic defects remains an enigma and is likely influenced by cell-type-specific activation of poorly understood downstream molecular pathways acting independently of or in parallel with mitochondrial respiratory chain defects. Notably, energy insufficiency alone cannot fully explain the extremely heterogenous clinical manifestations observed (Dogan et al., 2014). Consequently, complex molecular responses to mitochondrial dysfunction are gaining recognition as crucial pathogenetic mechanisms (Suomalainen and Battersby, 2018; Khan et al., 2017; Forsström et al., 2019).

In our previous study, we described PARL-deficient mice as a novel model of mitochondrial encephalopathy resembling Leigh syndrome (Spinazzi et al., 2019), one of the most common and severe mitochondrial diseases. PARL, an evolutionary conserved protease belonging to the rhomboid family, is located in the inner mitochondrial membrane and has fundamental roles in cell homeostasis. PARL has been associated with various human disorders such as Parkinson’s disease, Leber hereditary optic neuropathy, and type 2 diabetes, albeit with some controversy (Shi et al., 2011; Hatunic et al., 2009; Istikharah et al., 2013; Spinazzi and De Strooper, 2016). Notably, PARL’s significant role in maintaining mitochondrial fitness has been established through critical studies that identified its substrates, such as PINK1 (Jin et al., 2010), a mitochondrial kinase implicated in Parkinson’s disease and mitophagy (Valente et al., 2004; Yan et al., 2020), PGAM5 (Sekine et al., 2012), a mitochondrial phosphatase implicated in Parkinsonism in mice (Lu et al., 2014), and TTC19 (Saita et al., 2017), a mitochondrial protein involved in maintaining complex III activity and associated with human Leigh syndrome (Bottani et al., 2017; Atwal, 2014).

In this study, we focus on impaired spermatogenesis as the earliest phenotype observed in PARL-deficient male mice, which occurs independently of neurodegeneration. We find that PARL deficiency leads to severe functional and structural abnormalities in germ cell mitochondria, resulting in a complete arrest of spermatogenesis and triggering ferroptosis specifically in spermatocytes. Our findings offer new insights into the role of mitochondrial dysfunction and ferroptosis in male infertility and pave the way for further investigations on this cell death mechanism in mitochondrial diseases.

Results

PARL deficiency results in arrested spermatogenesis and severe testis atrophy

PARL-deficient mice appear clinically normal until around 6 weeks of age, after which they develop a progressive necrotizing encephalomyelopathy resembling Leigh syndrome with death before the age of 8 weeks (Spinazzi et al., 2019). As previously described, these mice exhibit severe testis atrophy (Figure 1A; Spinazzi et al., 2019; Cipolat et al., 2006). We did not observe cryptorchidism. Upon closer examination, the testis weight of Parl-/- mice at 5 weeks of age, when they do not show clinical signs of neurological impairment, is found to be nearly half of that in matched WT littermates (Figure 1A). This difference cannot be explained by concurrent body weight reduction (Figure 1A). Microscopic analysis reveals that the seminiferous tubules from Parl-/- mice are smaller in diameter (Figure 1B; p=0.0002, Figure 1—figure supplement 1A) and contain approximately 40% fewer cells compared to WT littermates (p=0.0009, Figure 1—figure supplement 1B). Further investigation indicates that the seminiferous tubules in Parl-/- mice are populated by immature germ cells exhibiting degenerative changes and prominent intraluminal exfoliation, often in the form of multinucleated syncytia (Figure 1B). Immunohistochemistry reveals that PARL deficiency leads to a complete meiotic prophase I arrest as the seminiferous tubules are predominantly populated by SCP-1-positive spermatocytes (Figure 1B; Figure 1—figure supplement 1C; Yang and Wang, 2009; p=0.0001) while spermatids and spermatozoa are completely absent (Figure 1B; Köhler, 2007). The epididymal ducts of Parl-/- mice are also smaller in diameter and completely devoid of mature sperm (Figure 1B). Spermatogonia show a modest increase in number in Parl-/- seminiferous tubules compared to WT littermates (p=0.01; Figure 1—figure supplement 1D). Additionally, the analysis of γH2AX expression pattern in Parl-/- seminiferous tubules indicates specific meiotic prophase I arrest at the pachytene stage (Figure 1—figure supplement 1G). Supporting Sertoli cells appear to be slightly increased in number (p=0.0382; Figure 1—figure supplement 1E and F), and the distribution and morphology of Leydig cells appears normal.

Figure 1. Severe testis atrophy in Parl-/- mice is caused by arrested spermatogenesis.

(A) Reduced testicular size and weight in 5-week-old Parl-/- mice (n = 5) compared to WT littermates (n = 6; unpaired two-tailed t-test, p-value<0.0001). The reduction in testicular weight is not explained by body weight differences (p=0.0598). (B) Histological assessment of testes from 6-week-old Parl-/- and WT mice reveals reduced diameter of Parl-/- seminiferous tubules with impaired germ cell maturation and complete spermatogenesis arrest at the level of primary spermatocytes (testis HE stain, n = 10 for each genotype). Parl-/- seminiferous tubules also exhibit intraluminal exfoliation of degenerated spermatocytes often in the form of multinucleated syncytia (testis HE stain inset, arrowheads). The complete arrest of spermatogenesis leads to total absence of sperm in Parl-/- seminiferous tubules and epididymis compared to WT littermates (testis and epididymis HE stain, n = 10 for each genotype; asterisks indicate mature spermatozoa in the WT). Immunohistochemistry for synaptonemal complex protein 1, SCP-1, confirms complete spermatogenesis arrest at the level primary spermatocytes in Parl-/- testis (testis SCP-1, n = 10 for each genotype). The distribution of SCP-1 expression is confined to primary spermatocytes and is lost in postmeiotic germ cells as they undergo maturation in WT seminiferous tubules. Immunohistochemistry for allograft inflammatory protein 1, AIF-1, reveals the complete absence of spermatids in Parl-/- testis while WT seminiferous tubules are densely populated by AIF-1-positive spermatids at different levels of maturation (testis AIF-1, n = 10 for each genptype). 8-week-old mice with conditional Parl deletion driven by the Nes promoter in the nervous system and Leydig cells (Parl L/L::NesCre) display a normal testicular and epididymal histology as well as SCP-1 and AIF-1 immunohistochemistry comparable to WT mice (right column, n = 4). Scale bars, 200 µm.

Figure 1—figure supplement 1. Quantitative morphometry, cell composition, and meiotic stage evaluation in 5-week-old WT and Parl-/- seminiferous tubules.

(A) Tubule diameters (n = 3 mice for each genotype; 8–12 tubules considered per mouse; p=0.0002). (B) Number of total cells/tubule (n = 3 mice for each genotype; 8–12 tubules considered per mouse;. p=0.0009). (C) Ratio between SCP-1-positive spermatocytes/total tubular cells (n = 3 mice for each genotype; 8–12 tubules considered per mouse; p=0,0001). (D) Percentage of spermatogonia/tubule quantified using c-KIT immunohistochemistry (n = 3 mice for each genotype; 8–12 tubules considered per mouse; p=0.0103). (E) Percentage of Sertoli cells/total tubular cells (n = 3 mice for each genotype; 8–12 tubules considered per mouse;. p=0.0382). Sertoli cells were identified by means of WT1 immunohistochemistry. (F) Spermatocyte/ Sertoli cells ratio determined as in (C) and (E) (n = 3 for each genotype). p=0.0021. Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test. (G) Immunohistochemistry for γH2AX (n = 3 for each genotype) shows prominent accumulation of pachytene spermatocytes, characterized by the distinct XY body positivity (insets, arrowheads), in Parl-/- tubules. On the contrary, WT testis are populated by less γH2AX-positive spermatocytes with a prevalence of zygotene spermatocytes characterized by the dispersed nuclear immunoreactivity (insets, arrows). Scale bars, 50 µm.

Figure 1—figure supplement 2. Nestin expression in Leydig cells.

Immunohistochemistry for GFP identifies diffuse signal in the Leydig cell population (arrows) of reporter mice with transgenic GFP expression under the Nes promoter (n = 3). Scale bar, 50 µm. Expression of Nes is expected to result in Cre-mediated deletion of Parl in the conditional knockout model Parl L/L::NesCre.

To determine whether the observed testicular abnormalities are linked to neurodegeneration, mice with conditional deletion of Parl in the nervous system (Parl L/L::NesCre) were studied. Surprisingly, despite developing severe Leigh-like encephalopathy, these mice exhibit normal testicular size, histology, and sperm production comparable to WT littermates (Figure 1B), demonstrating that the testicular disorder is not a consequence of neurodegeneration. As previously reported (Anand-Ivell et al., 2017; Jiang et al., 2014; Davidoff et al., 2004), Nes is also expressed in Leydig cells (Figure 1—figure supplement 2). Although PARL deficiency in situ could not be formally verified in the absence of specific PARL antibodies suitable for immunohistochemistry, Cre recombinase activation under the Nes promoter is predicted to effectively delete Parl in these cells as in the nervous system. Moreover, extensive morphological observations detailed in the following paragraph indicate that Leydig cells are structurally unaffected in the germline Parl-/- testis (Figure 2—figure supplement 1B), suggesting that the spermatogenetic defect is not secondary to PARL deficiency in these cells.

Altogether, deficiency of PARL leads to a complete arrest of spermatogenesis at the level of primary spermatocytes, independent of the effects of PARL in the nervous system and in Leydig cells.

PARL deficiency results in mitochondrial ultrastructural abnormalities and progressive degeneration and death of arrested spermatocytes

To gain insight into the possible pathological effects of PARL deficiency on germ cells, we conducted a detailed morphological analysis using semithin sections and electron microscopy.

In unaffected WT animals, germ cells undergo a maturation process, with less differentiated forms (spermatogonia and spermatocytes) in the abluminal layers, more differentiated spermatids in the adluminal compartment, and mature spermatozoa in the lumen of the seminiferous tubules (Figure 2A). Conversely, Parl-/- mice exhibit severe vacuolar degeneration of arrested spermatocytes, leading to cell death, and this degeneration progressively worsens from the abluminal to the adluminal compartment (Figure 2A and B and Figure 2—figure supplement 1A). Analysis of spermatocyte ultrastructure showed a significant increase in the occurrence of degeneration/death in Parl-/- spermatocytes compared to WT (18.9% degenerated spermatocytes out of 201 analyzed in Parl-/- vs. 0% out of 79 WT spermatocytes analyzed; n = 3 for each genotype; p=0.0002 by two-sided Fisher’s exact test). Next, we assessed whether mitochondrial morphology was affected in PARL-deficient spermatocytes. Differentiation per se leads to important morphological adaptations of mitochondria that parallel increasing bioenergetic demands requiring a shift from more glycolytic to more oxidative metabolism (Varuzhanyan and Chan, 2020). To ensure accurate comparisons, we focused on primary spermatocytes showing fully assembled synaptonemal complexes, a characteristic feature during the zygotene and pachytene stages of meiotic prophase I (Figure 2C; Yang and Wang, 2009; Martins and Silva, 2001). Compared to the mitochondria of WT primary spermatocytes, which are typically small with dilated cristae and dense finely granular matrix, mitochondria of Parl-/- spermatocytes appear consistently swollen with few thin irregular cristae and loss of normal matrix density (Figure 2C). Quantitative analysis of the mitochondrial ultrastructure in primary spermatocytes showed a dramatic increase of degenerating mitochondria in Parl-/- compared to WT spermatocytes (92% of analyzed mitochondria in Parl-/- were abnormal vs. 1.9% in WT; n = 3 for each phenotype; p=0.0002 by two-sided Fisher’s exact test). Importantly, abnormal mitochondrial morphology was the earliest ultrastructural change detected in PARL-deficient spermatocytes localized in the abluminal compartment, while adluminal germ cells exhibited additional abnormalities affecting other cell compartments, including the endoplasmic reticulum, Golgi apparatus, and nuclear envelope. Chromatin clumping and nuclear fragmentation were also evident (Figure 2B and Figure 2—figure supplement 1A).

Figure 2. Impaired spermatogenesis in Parl-/- testis is associated with early mitochondrial morphological abnormalities and progressive degeneration of arrested spermatocytes.

(A) Toluidine blue-stained semithin sections of testis from 5-week-old WT and Parl-/- mice. Seminiferous tubules from Parl-/- mice show extensive degenerative changes in arrested spermatocytes including tortuous membrane infoldings, cytoplasmic vacuolation (arrows), irregular chromatin clumping, nuclear fragmentation (arrowheads), and absence of mature germ cells such as adluminal spermatids and spermatozoa (n = 3 for each genotype). A WT seminiferous tubule with normal germ cell maturation is shown for comparison (left panel). Scale bars, 20 µm. (B) Electron microscopy examination shows multifocal cisternae distention, disruption of the endoplasmic reticulum and Golgi apparatus, and abundant accumulation of damaged membranous material and organelles (asterisks) in Parl-/- spermatocytes. The nuclear envelope is diffusely distended (arrowheads) outlining a convoluted fragmented nucleus (N) with dense irregular clumps of chromatin. A WT spermatocyte at the end of pachytene is shown for comparison (left panel). Scale bars, 1 µm. (C) Electron microscopy analysis shows that mitochondria in Parl-/- primary spermatocytes are swollen with few thin irregular cristae and loss of normal matrix density (right panel, arrowheads) compared to WT (left panel, arrowheads). The thin arrows indicate the intermitochondrial cement (nuage) typically associated with mitochondria in primary spermatocytes. The large arrows indicate fully assembled synaptonemal complexes, structures that are only detectable during the zygotene and pachytene stages of meiotic prophase I (n = 3 for each genotype). Scale bars, 0.5 µm.

Figure 2—figure supplement 1. Ultrastructural abnormalities of mitochondria and other cell compartments are restricted to arrested spermatocytes and absent in other testis cell types.

(A) Degenerating/dying spermatocytes from 5-week-old Parl-/- mice are mainly observed across the adluminal compartment of the seminiferous tubule (left panel, asterisks). At higher magnification (right panel), the cytoplasm of the degenerating spermatocyte shows multifocal cisternae distention and disruption of the endoplasmic reticulum with abundant accumulation of irregular coils of membranous material wrapped around damaged organelles including mitochondria (inset, arrowheads). Irregular nuclear infoldings and chromatin clumping are also evident (n = 3). Scale bars, 5 µm (left panel) and 1 µm (right panel). (B) Ultrastructural abnormalities in 5-week-old Parl-/- mice are not evident in spermatogonia, Leydig cells, and Sertoli cells. Spermatogonia (top panel) characterized by large round nuclei (N) and scant cytoplasm with scattered small oval mitochondria with lamellar cristae (arrowheads); scale bar, 0.5 µm. Leydig cells (middle panel) typically characterized by nuclei with a single prominent nucleolus (n), intercellular canaliculi with rudimentary microvillus processes (Can), large round to elongated mitochondria with dense tubular crista (arrowheads), and scattered cytoplasmic lipid droplets (asterisks); scale bar, 1 µm. Cytoplasmic projections of Sertoli cells (bottom panel) with typical round mitochondria characterized by few often dilated tubular cristae (arrowheads) (n = 3 for each genotype). Scale bar, 0.5 µm.

In contrast, other cell types within the seminiferous tubules and surrounding interstitium, such as spermatogonia, Leydig, and Sertoli cells, displayed normal ultrastructural features with preserved mitochondrial morphology (Figure 2—figure supplement 1B). Altogether, these data indicate the presence of early mitochondrial ultrastructural abnormalities culminating in extensive degeneration and death of arrested PARL-deficient spermatocytes, without morphological evidence of spermatogonia, Leydig cells, or Sertoli cells involvement.

Impaired spermatogenesis in PARL-deficient testis is not driven by misprocessing of PARL substrates PINK1, PGAM5, and TTC19

Next, we asked to what extent the severe spermatogenesis defect induced by PARL deficiency can be attributed to the misprocessing and altered maturation of PARL’s substrates. To answer this question, we first tested the testicular expression of established PARL substrates. Parl-/- testis mitochondria exhibit remarkable accumulation of uncleaved PINK1 and PGAM5, as well as almost total lack of the mature form of TTC19 (Figure 3A). These findings were consistent with previous observations in the brain (Spinazzi et al., 2019) and cultured cells (Saita et al., 2017). Since other PARL substrates, such as DIABLO, STARD7, and CLPB, displayed only subtle misprocessing or expression changes, possibly due to compensatory proteolytic cleavage by alternative proteases, we focused our investigation on PINK1, PGAM5, and TTC19. We aimed to determine whether the genetic modulation of these substrates could either modify or reproduce the testicular phenotype observed in Parl-/- mice. In particular, we assessed whether accumulation of uncleaved PINK1 and PGAM5, alone or in combination, or depletion of the cleaved form of PINK1, PGAM5, or TTC19 were the molecular mechanisms underlying the abnormalities documented in Parl-/- testis. PINK1 and PGAM5 are known to play essential roles in maintaining mitochondrial integrity and homeostasis and have been linked to both Parkinson’s disease and defects of spermatogenesis (Valente et al., 2004; Lu et al., 2014; Agarwal et al., 2020; Deng et al., 2008). Similarly, TTC19 is a mitochondrial protein crucial for the catalytic activity of complex III, and pathogenic variants of TTC19 are associated with mitochondrial diseases in humans, including Leigh syndrome (Atwal, 2014).

Figure 3. Mice with genetic manipulation of the PARL substrates PINK1, PGAM5, and TTC19 do not reproduce or modify Parl-/- testis phenotype.

(A) Immunoblots of testis mitochondria from 6-week-old WT and Parl−/− mice with antibodies for the established PARL substrates PINK1, PGAM5, TTC19, DIABLO, STARD7, and CLPB. Severe accumulation of unprocessed PINK1 and PGAM5, as well as severe decrease in the mature processed form of TTC19 are evident in Parl−/− testis. HSP60 is the loading control. (B) Histology of testes from 7-week-old mice of the indicated genotypes (HE stain, n = 3 for each genotype). Parl-/-/Pink1-/-, Parl-/-/Pgam5-/-, and Parl-/-/Pink1-/-/Pgam5-/- show complete lack of sperm production and no modification of the testicular phenotype compared to Parl-/- mice. Ttc19-/-, Pink1-/-, Pgam5-/-, and Pink1-/-/Pgam5-/- mice have no evident testis pathology and show normal sperm production (mature spermatozoa are indicated by asterisks), and are fertile. Scale bar, 145 µm.

Figure 3—source data 1. Original images for Figure 3A.

Figure 3—figure supplement 1. Similar to what has been described in Parl-/- mice, immunohistochemistry for AIF-1 confirms spermatogenesis arrest with complete absence of spermatids in Parl-/-/Pink1-/-, Parl-/-/Pgam5-/-, and Parl-/-/Pink1-/-/Pgam5-/- mice.

On the contrary, as observed in WT mice, normal seminiferous tubules in Pink1-/-, Pgam5-/-, Ttc19-/- and Pink1-/-/Pgam5-/- mice are populated by AIF-1-positive spermatids at different levels of maturation (n = 3 for each genotype).

To test this hypothesis, we analyzed testes from a series of genetically engineered mutant mouse lines, including single-gene knockouts such as Pink1-/-, Pgam5-/-, and Ttc19-/-, as well as multiple gene knockouts including both Parl and Pink1 (Parl-/-/Pink1-/-); Parl and Pgam5 (Parl-/-/Pgam5-/-); Pink1 and Pgam5 (Pink1-/-/Pgam5-/-); and Parl, Pink1, and Pgam5 combined (Parl-/-/Pink1-/-/Pgam5-/-). Remarkably, the severe testis phenotype resulting from PARL deficiency remained unaltered upon additional deletion of Pink1 or Pgam5 either individually or in combination (Figure 3B and Figure 3—figure supplement 1). In contrast, the single or combined knockouts of Pink1, Pgam5, and Ttc19 resulted in normal fertility and testis morphology, showing orderly and complete spermatogenesis (Figure 3B and Figure 3—figure supplement 1). In conclusion, these observations indicate that impaired spermatogenesis in PARL-deficient mice is not driven by altered proteolytic maturation of the substrates PINK1, PGAM5, and TTC19 despite their severely affected proteolytic processing, indicating that other pathogenetic mechanisms are responsible for the testis phenotype.

PARL-deficient testis mitochondria exhibit severe respiratory chain defects

Spermatogenesis involves crucial metabolic adaptations, with mitochondrial function playing a critical role throughout germ cell maturation (Varuzhanyan and Chan, 2020). Given the interconnection between mitochondrial morphology and function, we investigated the impact of the structural abnormalities identified in the mitochondria of Parl-/- spermatocytes by conducting a comprehensive functional analysis. Because of the previously reported role of PARL in mitochondrial biogenesis (Civitarese et al., 2010), we wondered whether mitochondrial mass is reduced in Parl-/- testis. Expression of the outer mitochondrial membrane protein TOMM20 and of the inner membrane ATP synthase beta subunit (ATPB) were similar between WT and Parl-/- testis, suggesting unaltered mitochondrial mass (Figure 4A, Figure 5B, and Figure 6B). Similarly, mitochondrial DNA abundance, often used as an indicator of mitochondrial mass, was not significantly different between the two groups (Figure 4B). Additionally, the expression of TFAM, a protein binding mitochondrial DNA in nucleoids (Ekstrand et al., 2004), did not show any significant difference between WT and Parl-/- SCP-1-positive spermatocytes (Figure 4—figure supplement 1). Next, we examined whether mitochondrial respiratory chain complexes were appropriately assembled in Parl-/- testis mitochondria. Blue native gel electrophoresis revealed severe assembly alterations in multiple respiratory chain complexes, including complex I, complex III, complex IV, and to a lesser extent complex V, as well as the supercomplex (Pérez-Pérez et al., 2016; Figure 4C). Since respiratory chain complexes’ supramolecular assembly is required for optimizing the efficiency of mitochondrial oxidative phosphorylation (OXPHOS), we then examined if PARL deficiency ultimately resulted in impaired mitochondrial respiration in testis mitochondria. To answer this question, we measured oxygen consumption by means of high-resolution respirometry in testis mitochondria supplied with substrates and specific inhibitors for complex I (CI), complex II (CII), and complex IV (CIV) as illustrated in Figure 4D. Basal mitochondrial respiration in presence of complex I substrates but no ADP (CI LEAK) was significantly increased in Parl-/- testis compared to WT, suggesting pathological short-circuit of protons across the inner mitochondrial membrane. Conversely, both phosphorylating respiration, whether driven by complex I only (CI OXPHOS) or by both complex I and II together (CI + II OXPHOS), and maximal uncoupled respiration, whether driven by complex II (CII ET) or by both complex I and II (CI + II ET) were severely diminished in Parl-/- testis mitochondria. Respiration driven by CIV was also decreased. These results localize the severe respiration defect at the level of electron transfer capacity (Figure 4E). However, the defects were not attributed to cytochrome c loss due to outer mitochondrial membrane permeabilization (Figure 4E; CIV+cytc graph). To gain cell-type insights into the observed electron transport defect, cytochrome c-oxidase activity staining was performed on frozen tissue sections. The enzyme function was significantly decreased in PARL-deficient seminiferous tubules but not in Leydig cells, highlighting the specific distribution of the defect (Figure 4F). The expression of the subunit 4 of cytochrome c-oxidase, COX4, was indeed severely decreased in Parl-/- SCP-1-positive spermatocytes, confirming the defect in this cell type (Figure 5A; p=0.0027). This defect was again unrelated to changes in mitochondrial mass since TOMM20 expression was unmodified by PARL deficiency in SCP-1 spermatocytes (Figure 5B). Interestingly,e dramatic overexpression of the glucose intracellular transporter GLUT1 was observed in Parl-/- spermatocytes suggesting increased glucose utilization as an adaptive response to disrupted OXPHOS (Figure 5C). In conclusion, PARL is crucial for maintaining the integrity of the mitochondrial electron transport chain. Its deficiency leads to severe respiratory chain defects and metabolic remodeling in arrested primary spermatocytes.

Figure 4. Severe mitochondrial electron transfer defects in Parl-/- testis mitochondria.

(A) Immunoblots of testis lysates from 5-week-old WT and Parl−/− mice with antibodies for PARL, ATPB, TOMM20, and ACTB (n = 3 for each genotype). ACTB is the loading control. (B) Quantification of mitochondrial DNA normalized to nuclear DNA in testis from 5-week-old WT and Parl-/- mice (n = 10 for each genotype). MtDNA was quantified by measuring the ratio (mtDNA/nDNA) between a target mitochondrial gene (Cox1) and a reference nuclear gene (B2m) using quantitative real-time PCR as detailed in the ‘Methods’ section. No significant difference is found between WT and Parl-/- testis (p=0.9146). (C) Blue native gel electrophoresis of testis mitochondria from 6-week-old WT and Parl-/- mice (n = 3 for each genotype). Mitochondrial complexes and supercomplex constituted by macromolecular assembly of complex I (CI), complex III (CIII) dimer, and complex IV (CIV) are visualized after staining with Instant Blue and marked by dotted lines. Assembly defects are evident for CI, CIII, CIV, and the supercomplex. (D) Representative trace illustrating the protocol for high-resolution respirometry in testis mitochondria. The blue trace indicates the O2 concentration (nmol/ml), and the red trace indicates its time derivative (pmol of O2 consumed/s*ml). Testis mitochondria (150 μg) were loaded in Miro6 buffer. Substrates are as follows: CI (PMG, pyruvate + malate + glutamate), CII (Succ, succinate), and CIV (ASC/TMPD, ascorbate + TMPD). The uncoupler is CCCP. The specific mitochondrial inhibitors are rotenone (ROT) for CI, antimycin a (Aa) for CIII, and cyanide (KCN) for CIV. Respiratory states are indicated between red dashed lines. CI LEAK, CI-driven leak respiration, in presence of CI substrates but no adenylates; CI OXPHOS, CI-driven phosphorylating respiration; CI+II OXPHOS, phosphorylating respiration driven by combined activation of CI and II; CI+II ET, electron transfer capacity driven by combined CI and II; CII ET, ET driven by CII; CIV, CIV-driven respiration; CIV+cytc: CIV-driven respiration after addition of exogenous cytochrome c to evaluate the integrity of the outer mitochondrial membranes; CIV BG: chemical background of CIV-driven respiration. H2O2 in the presence of catalase is used to reoxygenate the chamber. (E) Quantification of the respiratory states of testis mitochondria from 6-week-old WT and Parl-/- mice (n = 6 for each genotype) as from the protocol described in (D) and in the ‘Methods’ section. Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test: *p<0.05, **p<0.01,***p<0.001, and ****p<0.0001. (F) Cytochrome c oxidase histochemistry in frozen testis sections from 6-week-old WT and Parl-/- mice (n = 3 for each genotype).

Figure 4—source data 1. Original images for Figure 4A.

Figure 4—figure supplement 1. Unaltered TFAM expression in Parl-/- spermatocytes.

Normalized quantification of TFAM immunofluorescence in SCP1-positive primary spermatocytes does not reveal significant expression differences between 5-week-old WT and Parl-/- mice (n = 3 mice for each genotype, 500–1000 SCP-1-positive spermatocytes considered for each mouse; p=0.439). Scale bars, 100 µm. Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test.

Figure 5. Severe loss of COX4 associated with increased expression of glucose intracellular transporter in Parl-/- spermatocytes.

(A) Quantitative immunofluorescence shows decreased expression of COX4 in SCP-1-positive spermatocytes from 5-week-old Parl-/- mice compared to WT littermates (n = 3 for each genotype, 500–1000 SCP-1-positive spermatocytes for each mouse, two-sided Student’s t-test: p=0.0027). Scale bars, 100 µm. Bar graphs indicate average ± SD. (B) Normalized quantification of TOMM20 immunofluorescence in SCP-1-positive primary spermatocytes does not reveal significant differences in mitochondrial mass in the two different genotypes (n = 3 mice for each genotype, 500–1000 SCP-1-positive spermatocytes considered for each mouse; p=0.821). Scale bars, 100 µm. Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test. (C) GLUT1 immunohistochemistry of testis from 5-week-old mice shows prominent overexpression of GLUT1 in arrested Parl-/- spermatocytes, and low levels in WT (arrowheads) (n = 3 for each genotype). Scale bars, 50 µm.

Figure 6. Severe alteration in coenzyme Q (CoQ) biosynthesis and redox state in Parl-/- testis.

(A) Concentration (left) and CoQ red/ox ratio (right) of total CoQ (Q9 + Q10) measured by HPLC in the testes of 5-week-old WT and Parl-/- mice (n = 5 for each genotype). Total CoQ levels are severely decreased in Parl-/- testis compared to WT littermates (p=0.0001 calculated by two-sided Student’s t-test). Moreover, the redox status is altered with drastic elevation in the reduced/oxidized CoQ ratio (p<0,0001 calculated by two-sided Student’s t-test). (B) Immunoblot analysis of total testis lysates from 5-week-old WT and Parl-/- mice with antibodies for COQ4, TOMM20, and ACTB (n = 3 for each genotype). ACTB is the total lysate loading control. TOMM20 is the mitochondrial content control. Quantification of COQ4/TOMM20 confirms a significant decrease in Parl-/- testis compared to WT littermates (n = 3; p=0,0212 calculated by two-sided Student’s t-test.) but unchanged TOMM20/ACTB (n = 3; p=0,368 calculated by two-sided Student’s t-test), indicating that the observed decrease in COQ expression is not explained by decreased mitochondrial mass. Bar graphs indicate average ± SD. (C) Immunohistochemistry for COQ4 shows severely decreased levels of testicular COQ4 expression in 5-week-old Parl-/- mice compared to WT controls (n = 3 for each genotype). The deficit is particularly prominent in Parl-/- arrested spermatocytes, almost devoid of COQ4 expression, compared to the high constitutive levels of COQ4 expression in WT spermatocytes (inset, stage II tubule, arrowheads). Decreased COQ4 expression is also evident in Parl-/- Leydig cells compared to WT mice (insets, asterisk). In addition, COQ4-positive Sertoli cell projections observed in WT mice (inset, stage II tubule, arrows) are not evident in the seminiferous tubules of Parl-/- mice. Scale bar, 100 µm.

Figure 6—source data 1. Original images for Figure 6B.

Figure 6—figure supplement 1. Severe loss of COQ4 in Parl-/- spermatocytes.

Normalized quantification of COQ4 immunofluorescence in SCP1-positive primary spermatocytes shows significantly higher levels of expression in 5-week-old WT compared to Parl-/- mice (n = 3 mice for each genotype, 500–1000 SCP-1-positive spermatocytes considered for each mouse, p=0.0047). Scale bars, 100 µm. Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test.

PARL deficiency causes impaired testicular CoQ biogenesis and redox

CoQ is a lipid essential for cellular functions, serving both as an electron carrier in the mitochondrial respiratory chain and as a lipophilic antioxidant, preventing lipid peroxidation (Gueguen et al., 2021). In mammalian mitochondria, CoQ is involved in multiple converging pathways for its reduction, including complex I, complex II, dehydro-orotate dehydrogenase, sulfide-quinone oxidoreductase, and electron transfer dehydrogenase, while complex III is responsible for its oxidation. CoQ plays a critical role in promoting testicular functions including the maturation of male germ cells by safeguarding against oxidative damage (Lin et al., 2021; Mancini and Balercia, 2011).

In previous studies, we showed that brain mitochondria from PARL-deficient mice have decreased CoQ concentration linked to impaired expression of the ubiquinone biosynthesis protein COQ4 homolog, mitochondrial COQ4 (Spinazzi et al., 2019), a protein required for the biosynthesis of CoQ (Wang and Hekimi, 2019). Additionally, we observed an increase in the reduced-to-oxidized CoQ ratio (CoQ red/ox) in neurons due to TTC19 deficiency, leading to complex III dysfunction (Spinazzi et al., 2019). Similarly, we found significantly decreased CoQ levels in Parl-/- testis, accompanied by a dramatic increase in the CoQ red/ox (Figure 6A). This elevation in CoQ reduction can be attributed to impaired CoQH2 oxidation, resulting from compromised complex III activity caused by TTC19 depletion (Figure 3A) and complex III assembly defects (Figure 4C). Notably, we also noticed a substantial decrease in COQ4 levels in Parl-/- testis, as seen in the brain (Spinazzi et al., 2019). Western blotting (Figure 6B) and immunohistochemistry (Figure 6C) revealed a diffuse decrease in COQ4 expression in various cell types, including germ cells, Leydig cells, and Sertoli cells. The deficit was particularly pronounced in Parl-/- arrested spermatocytes, even those with no or minimal degenerative changes, suggesting that the CoQ biosynthesis defect occurred upstream of the degenerative process. Quantitative immunofluorescence of COQ4 expression confirms severe deficiency of this protein in Parl-/- SCP-1-positive spermatocytes compared to WT littermates (Figure 6—figure supplement 1). Collectively, our findings indicate that PARL plays a crucial role in maintaining CoQ biosynthesis and redox state.

PARL deficiency leads to ferroptosis in arrested spermatocytes

To understand the specific mechanism responsible for the severe germ cell degeneration and death observed in PARL-deficient mice, we first considered apoptosis due to the characteristic ultrastructural features observed in arrested spermatocytes (i.e., chromatin clumping and nuclear fragmentation) and previous links of PARL to antiapoptotic properties in vitro (Cipolat et al., 2006). However, levels of caspase-3 activation in the seminiferous tubules of Parl-/- mice were comparable to WT, suggesting that apoptosis was not significantly involved in this phenotype (Figure 7—figure supplement 1). Given the identification of decreased CoQ concentration and severe ultrastructural abnormalities involving mitochondria and other membranous cell compartments, we speculated about the possible role of ferroptosis. Ferroptosis is a programmed cell death modality characterized by lipid peroxidation of cell membranes (Stockwell et al., 2017; Santoro, 2020). Previous studies in cultured cells have shown the importance of CoQ producing mevalonate pathway (Shimada et al., 2016) and CoQ reducing pathways driven by FSP1 (Bersuker et al., 2019; Doll et al., 2019), DHODH (Mao et al., 2021), and GCH1 (Kraft et al., 2020) in ferroptosis. To test this hypothesis, we examined the expression of GPX4, a crucial antioxidant peroxidase that prevents ferroptosis by reducing phospholipid hydroperoxide in cell membranes using reduced glutathione as substrate (Chen et al., 2021; Seibt et al., 2019). Immunoblot analysis revealed a nearly complete absence of GPX4 expression in Parl-/- testis (Figure 7A). Immunohistochemistry and immunofluorescence provided cell-type-specific insights, showing a dramatic decrease in GPX4 expression in Parl-/- arrested spermatocytes (Figure 7C, top panels; Figure 8A, p=0.0013) but not in Leydig (Figure 7C, top panels, black arrowheads) or Sertoli cells (Figure 8—figure supplement 1; p=0.5313). The impact of PARL deficiency on GPX4 expression was not observed in other organs, indicating a specific effect on spermatocytes (Figure 7—figure supplement 2A). To rule out a possible effect of PARL proteolytic activity on GPX4 expression, we checked GPX4 expression in mouse embryonic fibroblasts with and without PARL expression, and knockouts rescued with proteolytically active or inactive PARL. The results do not show evidence of proteolytic misprocessing and do not indicate GPX4 as a direct substrate of PARL (Figure 7—figure supplement 2B). Further investigations demonstrated increased lipid peroxidation, as evidenced by significantly higher levels of 4-hydroxynonenal (HNE) adducts, the end-products of lipid peroxidation that defines ferroptosis, in Parl-/- testis (Figure 7B, middle panel), but not in brain (Figure 7—figure supplement 2C). The accumulation of HNE adducts was particularly prominent in adluminal and exfoliated spermatocytes during the late stages of degeneration (Figure 7C, middle panels). We confirmed these data by quantitative immunofluorescence showing a dramatic increase in HNE signal in SCP-1 positive Parl-/- spermatocytes (Figure 8B; p=0.0002), which is consistent with the specific loss of GPX4 expression in these cells.

Figure 7. Massive ferroptosis activation in Parl-/- arrested spermatocytes.

(A) Immunoblot of total testis lysates obtained from 5-week-old WT and Parl-/- mice using antibodies for GPX4, TOMM20, and ACTB (n = 3 for each genotype). ACTB is the loading control. GPX4 expression is barely detectable in Parl-/- testis. (B) Immunoblot analysis of total testis lysates from 7-week-old WT and Parl-/- mice using anti-HNE and anti-ACTB antibodies (n = 3 for each genotype). ACTB is the loading control. Quantification of the HNE/ACTB ratio is shown on the right as a graph indicating average ± SD (n = 3 for each genotype). The statistically significant HNE/ACTB ratio increase in Parl-/- mice has been calculated by two-sided Student’s t-test (p=0.0199). (C) Immunohistochemistry for GPX4, HNE, and TfR1 in testis from 6-week-old WT and Parl-/- mice (n = 3 for each genotype). GPX4 expression is barely detectable in Parl-/- arrested spermatocytes compared to WT littermates (inset, stage X tubule, white arrowheads), while it is unaffected in interstitial Leydig cells (black arrowheads) (top panels, scale bar, 100 um). HNE immunohistochemistry shows gradual intensification of lipid peroxidation during spermatocyte degeneration culminating in adluminal/exfoliated spermatocytes (inset, arrowheads) (middle panels; scale bar, 200 µm). Similarly, TfR1 expression is abnormally increased in degenerating Parl-/- spermatocytes (bottom panels; scale bars, 200 µm; inset, arrowheads).

Figure 7—source data 1. Original images for Figure 7A.

Figure 7—source data 2. Original images for Figure 7B.

Figure 7—figure supplement 1. Unremarkable levels of apoptosis activation in degenerated Parl-/- testis.

Cleaved-caspase-3 immunohistochemistry on testis from 5-week-old Parl-/- mice and WT littermates (n = 3 for each genotype). The maturation defect and degenerative changes of PARL-deficient seminiferous tubules are not associated with a significant increase of caspase-dependent apoptotic cell death as confirmed by sporadic cleaved caspase-3 expression with no substantial differences among the two genotypes (left panel). Arrowheads indicate occasional apoptotic cells in the seminiferous tubules. Scale bar, 50 µm. Quantification of caspase 3-positive cells/tubule, does not show significant differences between 5-week-old Parl-/- and WT mice (right panel; p=0,374). Between 13,000 and 16,000 cells were analyzed from each animal (n = 3 mice for each genotype). Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test.

Figure 7—figure supplement 2. Lack of effect of PARL proteolytic activity on GPX4 expression in vitro and testis-specific induction of ferroptosis in PARL-deficient mice.

(A) Mitochondria isolated from brain, liver, and testis of 6-week-old WT and Parl-/- mice (n = 3 for each genotype) were immunoblotted with antibodies for GPX4 and HSP60. HSP60 is the loading controls. GPX4 deficiency is evident in mitochondria isolated from Parl-/- testis, but not from other organs. (B) 20 µg of total protein from WT and Parl-/- mouse embryonic fibroblasts (MEFs) complemented or not with WT or catalytic inactive PARL S275A were separated by SDS PAGE and immunoblotted with GPX4 antibody. Citrate synthase (CS) is the loading control. (C) Brain and testis total lysates obtained from 6-week-old WT and Parl-/- mice (n = 3 for each genotype) were immunoblotted with antibodies for HNE and ACTB. ACTB is the loading control. In absence of PARL, lipid peroxidation is specifically increased in testis but not in the brain.

Figure 7—figure supplement 2—source data 1. Original images for Figure 7—figure supplement 2A.

Figure 7—figure supplement 2—source data 2. Original images for Figure 7—figure supplement 2B.

Figure 7—figure supplement 2—source data 3. Original images for Figure 7—figure supplement 2C.

Figure 7—figure supplement 3. Increased activation of p53 in PARL-deficient spermatocytes undergoing ferroptosis.

(A) Immunoblot analysis of testis total lysates from 7-week-old WT and Parl-/- mice (n = 3 for each genotype) with antibodies for p53 and ACTB. ACTB is the loading control. Parl-/- testes shows increased levels of p53 compared to WT littermates. (B) Immunohistochemical analysis confirms increased p53 expression in the seminiferous tubules of 7-week-old Parl-/- mice compared to WT controls (n = 3 for each genotype). Nuclear immunolabeling is mainly detectable in the adluminal and exfoliated multinucleated spermatocytes (inset) suggesting that p53 upregulation in Parl-/- testis takes place during the late stages of degeneration. No p53 expression is detectable via immunohistochemistry in WT littermates. Scale bars, 200 µm.

Figure 7—figure supplement 3—source data 1. Original images for Figure 7—figure supplement 3A.

Figure 8. Hallmarks of ferroptosis in Parl-/- primary spermatocytes.

(A) Quantitative immunofluorescence shows severely reduced GPX4 expression in SCP-1-positive primary spermatocytes from 5-week-old Parl-/- mice compared to WT littermates (n = 3 mice for each genotype, 500–1000 SCP-1-positive spermatocytes considered for each mouse, p=0.0013). (B) Quantitative immunofluorescence shows increased HNE accumulation in Parl-/- SCP-1-positive spermatocytes compared to WT littermates (n = 3 mice for each genotype, 500–1000 SCP-1-positive spermatocytes considered for each mouse, p=0.0002). Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test. Scale bars, 100 µm.

Figure 8—figure supplement 1. Unchanged GPX4 expression in Parl-/- Sertoli cells.

Quantitative immunofluorescence in WT and Parl-/- tubules shows very low expression of GPX4 in Vimentin-positive Sertoli cells of both genotypes. Normalized quantification of GPX4 immunofluorescence in Vimentin-positive Sertoli cells does not reveal significant expression differences between WT and Parl-/- 5-week-old mice (n = 3 mice for each genotype; 300–330 Vimentin-positive Sertoli cells considered for each mouse, p=0,5313). Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student’s t-test. Scale bars, 100 µm.

Figure 8—figure supplement 2. Increased transferrin receptor expression in Parl-/- spermatocytes undergoing ferroptosis.

Normalized quantification of TfR1 immunofluorescence in SCP1-positive spermatocytes shows significantly higher levels of expression in 5-week-old Parl-/- mice compared to WT littermates (n = 4 mice for each genotype, 500–100 SCP-1-positive spermatocytes considered for each mouse, p=0.0229). Bar graphs indicate average ± SD. Statistical significance calculated by two-sided Student t-test. Scale bars, 100 µm.

Additional established biomarkers of ferroptosis, including cellular tumor antigen p53, a master regulator of both canonical and non-canonical ferroptosis pathways (Jiang et al., 2015; Liu and Gu, 2022), and transferrin receptor protein 1 (TfR1), which promotes the cellular uptake of iron via receptor-mediated endocytosis (Feng et al., 2020), were also investigated. Excessive intracellular iron can contribute to ferroptosis by triggering lipid peroxidation through Fenton's reaction. In normal postpubertal mice, expression of p53 levels in testis is very low (Beumer et al., 1998) while TfR1 is very high in spermatogonia and gradually decreases during germ cell maturation (Leichtmann-Bardoogo et al., 2012; Gao et al., 2021; Figure 7C, bottom panel). In contrast, PARL-deficient testis showed prominent nuclear expression of p53 in adluminal degenerating spermatocytes (Figure 7—figure supplement 3), while TfR1 exhibited persistent overexpression in arrested spermatocytes (Figure 7C, bottom panel), suggesting abnormally high iron uptake. We confirmed these data by quantitative immunofluorescence showing increased TfR1 expression in Parl-/- SCP-1-positive spermatocytes compared to WT littermates (Figure 8—figure supplement 2; p=0.0229). These findings collectively indicate that ferroptosis is a cell-type-specific effect of PARL deficiency and the mechanism underlying the demise of Parl-/- arrested spermatocytes.

Discussion

This study sheds light on the critical role of PARL in spermatogenesis and germ cell survival by maintaining the mitochondrial respiratory chain, CoQ biogenesis, and regulating ferroptosis. The reported testicular phenotype represents the earliest manifestation of PARL deficiency. Interestingly, similar spermatogenic defects and neurodegeneration have been reported in Drosophila mutants lacking the mitochondrial rhomboid orthologue Rhomboid-7, suggesting that the physiological roles of the mitochondrial rhomboid in these tissues are conserved across different phyla in the animal kingdom (McQuibban et al., 2006; Spinazzi et al., 2019). Impaired spermatogenesis in the Parl-/- mouse is characterized by a complete maturation arrest before the completion of the first meiotic division, leading to the induction of ferroptosis in primary spermatocytes. This meiotic failure seems to be related to severe morphological abnormalities of mitochondria and respiratory chain defects. This finding reinforces the crucial role of mitochondrial fitness in supporting germ cell differentiation during spermatogenesis, as previously observed in other mouse models with mitochondrial impairment including defective mitochondrial DNA (Trifunovic et al., 2004; Nakada et al., 2006), adenylates transport (Brower et al., 2009), cardiolipin biosynthesis (Cadalbert et al., 2015), mitochondrial dynamics (Varuzhanyan et al., 2019; Varuzhanyan et al., 2021), and mitochondrial proteolysis (Gispert et al., 2013; Lu et al., 2008). In our model, respiratory chain defects involve the assembly and function of multiple complexes, as well as the biosynthesis of the electron carrier CoQ. These results corroborate earlier observations in Parl-/- brain (Spinazzi et al., 2019) and recently published studies confirming impaired CoQ biogenesis in PARL-/- cell culture models (Deshwal et al., 2023). Collectively, these data underscore a crucial but previously underestimated role of PARL in maintaining the respiratory chain, CoQ biosynthesis, and mitochondrial structure (Spinazzi et al., 2019).

The reason for the pronounced respiratory chain defects and mitochondrial abnormalities in spermatocytes compared to other cell types is not entirely clear. However, we speculate that these differences may arise from cell-type-specific metabolic requirements. Normal spermatogenesis requires a significant metabolic remodeling, with a shift from glycolysis to oxidative phosphorylation to support the energy demand for completing the first meiotic division (Wang et al., 2022). In the absence of PARL, primary spermatocytes seem unable to implement oxidative phosphorylation due to their defective respiratory chain, leading to meiotic arrest, despite compensating with increased intracellular glucose uptake . These findings suggest that this phenotype is mainly driven by a germ cell-autonomous defect. Further investigations using germ-cell-specific Parl conditional knockout mice may help elucidate the contribution of somatic cells to this phenotype.

PARL deficiency in spermatocytes leads to maturation arrest and progressive degeneration of germ cells, culminating in the activation of ferroptosis, a specific type of regulated necrosis (Seibt et al., 2019). While PARL’s essential role in cell survival has been established (Spinazzi and De Strooper, 2016), its relationship with apoptosis remains contradictory in cellular models (Saita et al., 2017; Cipolat et al., 2006). Recent findings indicate that PARL deficiency induces necrosis rather than apoptosis in the brain (Spinazzi et al., 2019). Although we cannot rule out the contribution of accidental necrosis, since no specific markers are actually available for this cell death modality, this study highlights the specific induction of ferroptosis as the primary mechanism leading to the demise of PARL-deficient spermatocytes.

Ferroptosis represents a specific type of regulated cell death, characterized by uncontrolled iron-dependent lipid peroxidation of cell membranes (Chen et al., 2021). The presence of ferroptosis in PARL-deficient spermatocytes is evidenced by the dramatic accumulation of HNE, an electrophilic aldehyde generated by lipid peroxidation, and impaired expression of the ferroptosis suppressor GPX4. While ferroptosis has been documented in germ cells from Caenorhabditis elegans (Perez et al., 2020), it has not been extensively studied in mammalian spermatogenesis. In this context, our study provides evidence in vivo for the implication of ferroptosis during impaired spermatogenesis in a mammalian model. Ferroptosis can be experimentally induced in vitro by chemical or genetic inhibition of GPX4, or depletion of its substrate glutathione (Zheng and Conrad, 2020; Stockwell et al., 2017). Although much of what is known today about ferroptosis comes from in vitro experiments or studies in organisms with genetic inactivation of GPX4, its pathophysiological implication in diseases is rapidly emerging (Stockwell, 2022). GPX4 exists in three distinct isoforms originating from different transcription initiation sites: a full-length mitochondrial form, a shorter cytosolic form, and a nuclear isoform (Maiorino et al., 2003). GPX4 expression is highest in testis, where the mitochondrial isoform is mainly expressed (Godeas et al., 1997). Germline deletion of Gpx4 in mice results in embryonic lethality (Yant et al., 2003), while tissue-specific deletions lead to premature death (Seiler et al., 2008; Tan et al., 2021; Friedmann Angeli et al., 2014; Carlson et al., 2016; Wortmann et al., 2013). Notably, spermatocyte-specific Gpx4 deletion in mice causes severe testicular atrophy, reduced spermatogenesis, germ cell death, and infertility (Imai et al., 2009), highlighting its importance in male reproductive biology. Reduced GPX4 activity is also observed in the sperm of infertile patients, emphasizing its role in human spermatogenesis (Imai et al., 2001; Foresta et al., 2002; Hao et al., 2023).

In addition to GPX4, other defense mechanisms against ferroptosis have been described, including CoQ, which provides powerful protection from lipid peroxidation in cell membranes (Gueguen et al., 2021; Bersuker et al., 2019; Doll et al., 2019; Mao et al., 2021; Tan et al., 2021). Although the contribution of mitochondria to ferroptosis is still being debated (Zheng and Conrad, 2020), cumulating evidence indicates that mitochondria are implicated in this process (Gao et al., 2019). CoQ is in fact most abundant in mitochondria, where its biosynthesis takes place, and from which CoQ is then distributed to other cell membranes including the plasma membrane, Golgi apparatus, and endoplasmic reticulum (Gueguen et al., 2021; Stefely and Pagliarini, 2017). Moreover, in cancer cells treated with GPX4 inhibitors to induce ferroptosis, dihydroorotate dehydrogenase DHODH, a mitochondrial inner membrane enzyme involved in pyrimidine biosynthesis, inhibits ferroptosis by reducing CoQ (Mao et al., 2021), suggesting that mitochondrial CoQ reduction inhibits ferroptosis. Although the lack of GPX4 is per se sufficient to induce ferroptosis in Parl-/- spermatocytes, the process appears exacerbated by the concomitant CoQ deficiency. The functional interaction between PARL, GPX4, and CoQ in the determination of ferroptosis is consistent with a recent study, published during the revision of our manuscript, reporting increased susceptibility of PARL-/- cultured cells to ferroptosis induction by GPX4 inhibitors (Deshwal et al., 2023). The underlying mechanism involved defective CoQ biosynthesis and intracellular distribution outside mitochondria mediated by the PARL substrate STARD7 (Deshwal et al., 2023). Altogether, these converging results demonstrate the implication of PARL in the regulation of ferroptosis in specific conditions, both in vitro and in vivo. Interestingly, GPX4 is not a PARL substrate, hence the mechanism beyond GPX4 loss in this cell type remains currently unclear. One possibility is that GPX4 deficiency may result from protein degradation linked to chaperon-mediated autophagy, as reported in cells treated with the ferroptosis inducer erastin (Wu et al., 2019), but we cannot rule out a spermatocyte-specific effect on Gpx4 gene expression either. Interestingly, some interdependence between GPX4 and CoQ is suggested by overlapping inhibitory effects of the ferroptosis inducer FIN56 (Shimada et al., 2016) on both CoQ and GPX4 and by the influence of mevalonate pathway on the isopentenylation of selenocysteine-tRNA (Moosmann and Behl, 2004) needed for efficient GPX4 expression. Moreover, GPX4 deficit has been previously found in the brain of CoQ-deficient Coq9R239X mice (Luna-Sánchez et al., 2017), suggesting that GPX4 loss and ferroptosis may be an overlooked mechanism of CoQ deficiency deserving further investigations. The reason why only spermatocytes undergo ferroptosis in absence of PARL is likely related to the specific loss of GPX4 expression. The distinct vulnerability of spermatocytes might also be influenced by the high poly-unsaturated fatty acid content in these cells (Oresti et al., 2010). This peculiar feature could render spermatocytes exceptionally susceptible to lipid peroxidation in the context of the observed CoQ deficiency. This observation provides an important example of how specific phenotypes of mitochondrial diseases can be caused by unexpected cell-type-specific pathophysiological mechanisms downstream of mitochondrial dysfunction. Similar observations can provide some explanations for our very limited understanding of the tissue-specific clinical manifestations of mitochondrial diseases.

Knowledge of the physiological relevance of ferroptosis in mitochondrial diseases is limited. Compensatory activation of ferroptosis-inhibitory pathways has been recently reported in some conditions of mitochondrial deficiencies. In hearts from mice with different types of mitochondrial dysfunction, such as mitochondrial genome expression defects (Kühl et al., 2017) or cytochrome c oxidase deficiency (Ahola et al., 2022), GPX4 expression increases. Ahola and collaborators have elegantly shown that upregulation of GPX4, sustained by increased glutathione metabolism via the trans-sulphuration pathway and improved selenium incorporation in GPX4, provides a crucial homeostatic response to prevent ferroptosis in heart tissue of Cox10-/- mice (Ahola et al., 2022). Impairing GPX4 upregulation induced by OXPHOS deficiency through the inhibition of the integrated stress response, by knocking out either the mitochondrial protease OMA1 or its substrate DELE1, aggravates the cardiomyopathy of Cox10-/- mice by decreasing GPX4 to WT levels, thus inducing ferroptosis (Ahola et al., 2022). Moreover, direct ablation of GPX4 in cultured cells affected by defective OXPHOS induced by a variety of mitochondrial respiratory chain inhibitors is lethal (To et al., 2019). These data clearly demonstrate that prevention of ferroptosis by means of GPX4 upregulation is a required physiological mechanism to prevent cell death in conditions of defective OXPHOS. Our study provides in vivo evidence for this mechanism by showing the opposite situation: ferroptosis is spontaneously initiated in PARL-deficient spermatocytes unable to tune up ferroptosis inhibitory pathways in response to OXPHOS deficiency.

In conclusion, this work establishes PARL’s crucial role in spermatogenesis and prevention of germ cell ferroptosis by maintaining the integrity of mitochondrial structure, electron transport chain, CoQ biosynthesis, and GPX4 expression in spermatocytes (Figure 9). The discovery of ferroptosis as a consequence of primary mitochondrial defects advances our understanding of the pathophysiology of mitochondrial diseases and male infertility, offering potential targets for future therapeutic interventions.

Figure 9. Cartoon illustrating the identified mechanisms underlying the spermatogenesis defect of Parl-/- mice and the induction of spermatocyte ferroptosis.

Methods

Key resources table Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information	
Genetic reagent (Mus musculus)	B6.129P2(Cg)-Parltm1.1Bdes/Ieg	PMID:16839884	RRID:IMSR_EM:02075		
Genetic reagent (M. musculus)	B6.129P2-Parltm1Bdes/Ieg	PMID:16839884	RRID:IMSR_EM:02076		
Genetic reagent (M. musculus)	Tg(Nes-cre)1Kln; Parltm1Bdes/Parltm1Bdes	PMID:10471508	RRID:MGI:6280694		
Genetic reagent (M. musculus)	Parltm1.1Bdes/Parltm1.1Bdes;
Pgam5tm1d(EUCOMM)Wtsi/
Pgam5tm1d(EUCOMM)Wtsi	PMID:30578322	RRID:MGI:6280688		
Genetic reagent (M. musculus)	Parltm1.1Bdes/Parltm1.1Bdes; Pink1tm1.1Wrst/Pink1tm1.1Wrst	PMID:20049710	RRID:MGI:6280687		
Genetic reagent (M. musculus)	C57BL/6J-Ttc19em1Bds	PMID:30578322	RRID:MGI:6280684		
Cell line (M. musculus)	WT, Parl-/-, Parl-/-+ParlWT, Parl-/-+ParlS275A	PMID:30578322	RRID:MGI:2159769		
Antibody	Anti-SCP-1 (rabbit monoclonal)	Abcam	Cat#: ab175191	IHC 1:200, IF 1:500	
Antibody	Anti-AIF1 (rabbit polyclonal)	Wako	Cat#: 019-19741;
RRID:AB_839504	IHC 1:200	
Antibody	Anti-COQ4 (rabbit polyclonal)	ProteinTech	Cat#: 16654-1AP;
RRID:AB_2878296	IF 1:800, IHC 1:200, WB 1:1000	
Antibody	Anti-GPX4 (rabbit polyclonal)	Sigma	Cat#: HPA047224;
RRID:AB_2679990	IHC 1:100, IF 1:500	
Antibody	Anti-HNE (rabbit polyclonal)	Alpha Diagnostic International	Cat#: HNE11-S;
RRID:AB_2629282	IF 1:10,000, IHC 1:3000	
Antibody	Anti-TFR1 (rabbit monoclonal)	Abcam	Cat#: ab214039;
RRID:AB_2904534	IF 1:3000, IHC 1:1000	
Antibody	Anti-p53 (rabbit polyclonal)	Leica/Novocastra	Cat#: NCL-L-p53-CM5p;
RRID:AB_2895247	IHC 1:300	
Antibody	Anti-p53 (mouse monoclonal)	Cell Signaling Technology	(1C12) Mouse mAb #2524;
RRID:AB_331743	WB 1:1000	
Antibody	Anti-Wilm’s tumor 1 (rabbit monoclonal)	Abcam	Cat#: ab89901;
RRID:AB_2043201	IF 1:1500	
Antibody	Anti-cKit (rabbit polyclonal)	Agilent/DAKO	Cat#: A4502;
RRID:AB_2335702	IHC 1:50	
Antibody	Anti-γH2AX (rabbit monoclonal)	Cell Signaling Technology	Cat#: 2577;
RRID:AB_2118010	IHC 1:1000	
Antibody	Anti-COX4 (rabbit polyclonal)	ProteinTech	Cat#:11242–1-AP;
RRID:AB_2085278	IF1:3000	
Antibody	Anti-GLUT1 (rabbit monoclonal)	Cell Signaling Technology	Cat#:73015	IHC 1:600	
Antibody	Anti-TOMM20 (rabbit polyclonal)	ProteinTech	Cat#: 73015;
RRID:AB_2207530	IF 1:4000	
Antibody	Anti-TFAM (rabbit polyclonal)	Abcam	Cat#: ab307302	IF 1:3000	
Antibody	Anti-PARL (rabbit polyclonal)	PMID:16839884	Cat#: N/A	WB 1/1000	
Antibody	Anti-actin (mouse monoclonal)	Sigma	Cat#: A5441;
RRID:AB_476744	WB 1:200,000	
Antibody	Anti-HSP60 (mouse monoclonal)	BD Biosciences	Cat#: 611562;
RRID:AB_399008	WB 1:50,000	
Antibody	Anti-ATP5B (mouse monoclonal)	Abcam	Cat#: ab14730;
RRID:AB_301438	WB 1:50,000	
Antibody	Anti-TOMM20 (rabbit polyclonal)	Santa Cruz	Cat#: sc-11415;
RRID:AB_2207533	WB 1:5000	
Antibody	Anti-PINK1 (rabbit polyclonal)	Cayman	Cat#: 10006283;
RRID:AB_10098326	WB 1:500	
Antibody	Anti-PGAM5 (rabbit polyclonal)	Sigma	Cat#: HPA036979;
RRID:AB_10960559	WB 1:250	
Antibody	Anti-TTC19 (rabbit polyclonal)	Sigma	Cat#: HPA052380;
RRID:AB_2681806	WB 1:2000	
Antibody	Anti-CLPB (rabbit polyclonal)	ProteinTech	Cat#: 15743-1-AP;
RRID:AB_2847900	WB 1:1000	
Antibody	Anti-STARD7 (rabbit polyclonal)	ProteinTech	Cat#: 15689-1-AP;
RRID:AB_2197820	WB 1:2000	
Antibody	Anti-DIABLO (rabbit polyclonal)	Cell Signaling Technology	Cat#: 15108;
RRID:AB_2798711	WB 1:1000	
Antibody	Anti-GPX4 (mouse monoclonal)	R&D Systems	Cat#: MAB5457;
RRID:AB_2232542	WB 1:1000	
Antibody	Anti-GPX4 (mouse monoclonal)	Santa Cruz	Cat#: sc-166570;
RRID:AB_2112427	WB 1:1000	
Antibody	Anti-HNE (mouse monoclonal)	R&D Systems	Cat#: 198960;
RRID:AB_664165	WB 1:500	
Antibody	Anti-citrate synthase (mouse monoclonal)	Abcam	Cat#: ab96600;
RRID:AB_10678258	WB 1:1000	
Software, algorithm	GraphPad Prism software	GraphPad Prism
(https://graphpad.com)	RRID:SCR_015807		
Software	ImageJ software	ImageJ
(http://imagej.nih.gov/ij/)	RRID:SCR_003070		

Animals and husbandry

Mice with full knockout germline deletion of Parl (Parl-/-) (MGI:3693645), Pgam5 (Pgam5-/-) (MGI:5882561), Pink1 (Pink1-/-) (MGI:5436308), Ttc19 (Ttc19-/-) (MGI:6276545), and conditional Parl ablation under the Nestin promoter (Parl L/L::NesCre) (MGI:3526574, MGI:2176173) have been generated as previously described (Spinazzi et al., 2019; Cipolat et al., 2006). All mutant mouse lines were maintained on a C57BL/6J background. Mice were kept in a SPF facility and multiply housed in filter top polycarbonated cages enriched with wood‐wool and shavings as bedding. Standard rodent diet and acidified tap water were provided ad libitum. Animal rooms were maintained at 22°C ± 2°C with a 45 and 70% relative humidity range, 50 air changes per hour, and 12-hr light/dark cycles. Mice were included in a health-monitoring program developed in accordance with the guidelines of the Federation of European Laboratory Animal Science Associations (FELASA). All experiments were approved by the Ethical Committee on Animal Experimenting of the University of Leuven (IACUC protocol #072/2015) and the French Ministry (DUO-OGM 5769 3/2019).

Pathological and immunohistochemical examination

Testes harvested from postpubertal mutant mice and WT matched controls were immersion-fixed in 10% neutral buffered formalin for 24–48 hr at room temperature (RT). Samples were then routinely processed for paraffin embedding, sectioned at 5 µm, and stained with hematoxylin and eosin (HE) for histopathological assessment. For immunohistochemistry (IHC), 5-µm-thick paraffin sections were mounted on ProbeOn slides (Thermo Fisher Scientific #15-188-51). Chromogenic immunohistochemistry (IHC) and multiplex immunofluorescence (IF) were performed as described elsewhere (Tarrant et al., 2021) using a Leica BOND RXm automated platform combined with the Bond Polymer Refine Detection kit (Leica #DS9800) for IHC or the OPAL Automation Multiplex IHC Detection Kit (Akoya Biosciences NEL830001KT) implemented onto a Leica BOND Research Detection System (DS9455) for IF. Briefly, after dewaxing and rehydration, sections were pretreated with the epitope retrieval BOND ER2 high pH buffer (Leica #AR9640) for 20 min at 98°C. Endogenous peroxidase was inactivated with 3% H2O2 for 10 min at RT. Nonspecific tissue–antibody interactions were blocked by incubating the sections for 30 min at RT with Leica PowerVision IHC/ISH Super Blocking solution (PV6122) for IHC or with the Akoya Biosciences Opal Antibody Diluent/Block solution (ARD1001EA) for IF. The same blocking solution also served as diluent for the primary antibodies. Primary antibodies were incubated on the sections for 45 min at RT. A biotin-free polymeric detection system consisting of HRP conjugated anti-rabbit IgG was then applied for 25 min at RT. For IHC, immunoreactivity was then revealed with the diaminobenzidine (DAB) chromogen reaction. Tissue sections were finally counterstained in hematoxylin, dehydrated in an ethanol series, cleared in xylene, and permanently mounted with a resinous mounting medium (Thermo Scientific ClearVue coverslipper). For IF, the sections were finally incubated with the Akoya Biosciences TSA reagents Opal 520 (OP-1001), 570 (OP-1002), and 690 (OP-1003) (working concentration 1/150) for 10 min at RTs followed by Spectral DAPI nuclear counterstain (Akoya Biosciences FP1490) and mounting with Fluoromount-G (SouthernBiotech 100-01). Negative controls were obtained by replacement of the primary antibodies with irrelevant isotype-matched rabbit antibodies. HE and IHC-stained slides were evaluated by two board-certified veterinary pathologists (ER and CAA) with extensive expertise in mouse pathology. Staging of the seminiferous tubules was performed according to well-established morphological criteria (Ahmed and de Rooij, 2009; Meistrich and Hess, 2013). The Aperio Versa 200 instrument was used for image acquisition. Digital image analysis for cell count and morphometry of seminiferous tubules as well as for normalized quantification of marker expression within the SCP-1-positive spermatocyte population was performed using FIJI/ImageJ open-source software (Schroeder et al., 2021; Arena et al., 2017; Schindelin et al., 2012). Values for the normalized quantification correspond to the average positive area per spermatocyte and are expressed in um (Aitken et al., 2022).

Immunoblot analysis

Total testis lysates were prepared by homogenization with a glass-to-glass potter homogenizer on ice in 20 mM HEPES, 100 NaCl, pH 7.4, supplemented with protease and phosphate inhibitors (ROCHE). The lysate was then transferred to a fresh tube, supplemented with Triton- X 1%, SDS 0.1%, and passed several times through a 26-gauge syringe. The samples were then centrifuged at 20,000 × g for 15 min at 4°C to remove insoluble material. Tissue extracts or enriched mitochondrial membranes were separated in reducing and denaturing conditions in NuPage gels (Invitrogen). Proteins were transferred to PVDF 0.45 µm membranes, blocked with milk 5% TRIS-buffered saline, Tween-20 0.1% (TTBS), and incubated with the indicated primary antibodies, washed in TTBS incubated for 1 hr at RT with horseradish peroxidase conjugated secondary antibodies in 5% milk-TTBS or Alexa Fluor conjugated secondary antibodies. Proteins were identified by chemiluminescence or by fluorescence according to the type of secondary antibody. A PARL carboxy-terminal antibody was generated in house as previously reported (Cipolat et al., 2006).

Subcellular fractionation methods

To prepare testis-enriched mitochondrial fractions for western blotting or blue native gel electrophoresis, freshly collected testis was homogenized with a motor-driven Teflon pestle set at 800 rpm in a glass potter containing ice-cold 20 mM HEPES, 225 mM sucrose, 75 mM mannitol, 1 mM EGTA pH 7.4, on ice. For mitochondrial respiration experiments, fresh testis was homogenized manually with a Teflon pestle in ice-cold 20 mM HEPES, 225 mM sucrose, 75 mM mannitol, 1 mM EGTA pH 7.4, on ice, then gently passed through a 22-gauge syringe. The homogenate was centrifuged at 700 × g for 10 min at 4°C to remove nuclei and unbroken debris. The supernatant (tissue homogenate) was then centrifuged at 10,000 × g for 10 min at 4°C to pellet mitochondrial enriched mitochondrial membranes. To prepare liver enriched mitochondrial fractions, freshly collected liver was thoroughly rinsed in homogenization buffer, then homogenized with a motor-driven Teflon pestle set at 800 rpm in a glass potter containing ice-cold 20 mM HEPES, 225 mM sucrose, 75 mM mannitol, 1 mM EGTA pH 7.4, on ice. The homogenate was centrifuged at 1000 × g for 10 min at 4°C to remove nuclei and unbroken debris. The supernatant (tissue homogenate) was then centrifuged at 6000 × g for 10 min at 4°C. Brain mitochondria were purified according to Sims’ method (Sims and Anderson, 2008).

Blue native gel electrophoresis

Blue native gel electrophoresis of digitonin-solubilized mitochondria was performed as described (Jha et al., 2016). Then, 100 µg isolated mitochondria were solubilized with 600 µg digitonin in Invitrogen Native Page sample buffer on ice for 20 min, then centrifuged at 20,000 × g for 20 min at 4°C. 0.75% Coomassie G-250 was added to supernatants, which were loaded on a 3–12% gradient Invitrogen Native Page gel according to the instructions. After electrophoresis, mitochondrial complexes and super complexes were visualized by protein staining with InstantBlue Coomassie Protein Stain (ISB1L) (Abcam ab119211).

High-resolution respirometry

Mitochondrial respiration in testis mitochondria respiration was measured in Miro6 Buffer (Fasching et al., 2016) (20 mM HEPES, 110 mM sucrose, 10 mM KH2PO4, 20 mM taurine, 60 mM lactobionic acid, 3 mM MgCl2, 0.5 EGTA, pH 7.1, 1 mg/ml fatty acid-free BSA, catalase 280 U/ml) at 37°C as previously described (Pesta and Gnaiger, 2012; Spinazzi et al., 2019). When needed H2O2 was added to reoxygenate the chambers by catalase mediated O2 generation. Then, 150 µg of mitochondrial-enriched membranes were loaded into the Oroboros 2K oxygraph. A typical experiment is illustrated in Figure 4D. Oxygen consumption rates were measured before and after addition of the following sequence of substrates and specific inhibitors: (1) 2.5 mM pyruvate, 10 mM glutamate, and 1 mM malate to measure complex I-driven leak respiration (CI leak); (2) 2.5 mM ADP to determine complex I-driven phosphorylating respiration (CI OXPHOS). (3) 5 mM succinate to determine the phosphorylating respiration driven by simultaneous activation of complex I and II (CI + II OXPHOS); (4) titrating concentrations of the mitochondrial uncoupler CCCP to reach the maximal uncoupled respiration (CI + II electron transfer capacity, ET); (5) 200 nM rotenone to fully inhibit complex I-driven respiration and measure complex II-driven uncoupled respiration (CII electron transfer capacity, CII ET); (6) 0.5 µM antimycin A to block mitochondrial respiration at the level of complex III. Residual oxygen consumption was always negligible. (7) 2 mM ascorbate, 0.5 mM TMPD to measure cytochrome c oxidase (CIV)-driven respiration; (8) 125 µg/ml cytochrome c to evaluate mitochondrial outer membrane integrity and (9) 500 µM potassium cyanide (KCN) to specifically block cytochrome c oxidase activity and measure residual background oxygen consumption caused by chemical reaction between ascorbate and TMPD. Cytochrome c oxidase-driven respiration was calculated as the cyanide-sensitive oxygen consumption.

CoQ analysis

CoQ content and the ratio of the reduced vs. oxidized forms were measured as previously described (Rodríguez-Aguilera et al., 2017).

mtDNA copy number quantification

For mtDNA quantification, total DNA was isolated from 20 to 30 mg of testis tissues by using a DNeasy Blood and tissues kit (QIAGEN). qPCRs were performed in triplicate in 96-well reaction plates (Applied Biosystems). Each reaction (final volume 10 µl) contained 25 ng DNA, 5 µl of Power SYBR-Green PCR Master Mix (Applied Biosystems), and 0.5 µM of each forward and reverse primer. COX1, mitochondrial encoded gene, was amplified and β2 microglobulin (β2 m), nuclear encoded gene, was used as a normalizing control. Fold changes in mtDNA amount were calculated with the ΔΔCt method. The employed primers sequences were Cox1-Mus-F: TTTTCAGGCTTCACCCTAGATGA, Cox1-Mus-R: CCTACGAATATGATGGCGAAGTG, B2m-Mus-F: ATGGGAAGCCGAACATACTG, B2M-Mus-R:CAGTCTCAGTGGGGGTGAAT.

Electron microscopy

Testes of the indicated genotype were collected and immediately fixed with 2.5% glutaraldehyde, 2% paraformaldehyde in 0.1 M cacodylate buffer pH 7.4. Tissue was stored overnight at 4°C in the fixative solution, washed in 0.1 M cacodylate buffer, and post-fixed for 2 hr at RT with 1% OsO4, 1.5% K4Fe(CN)6 in 0.1 M cacodylate buffer. Sections were rinsed, stained with 3% uranyl acetate for 1 hr at 4°C, and dehydrated in graded ethanol concentrations and propyleneoxide, followed by embedding in Epon Resin. Resin blocks were sectioned on a ultramicrotome. Post-staining was performed with 3% uranyl acetate followed by lead citrate staining. Semithin sections were collected on slides and stained with 1% Toluidine blue solution (Sigma-Aldrich). Ultrathin sections (60 nm) were mounted on copper grids and imaged using a JEOL transmission electron microscope.

Cultured cells

Immortalized mouse embryonic fibroblasts (MEFs) derived from WT and Parl-/- male mice were cultured in Dulbecco’s modified Eagle’s medium/F-12 (Gibco) containing 10% fetal bovine serum (Gibco). At 30–40% confluence, the MEFs were transduced using a replication-defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT) or catalytic inactive Parl S275A as previously described (Spinazzi et al., 2019). Cell lines stably expressing the desired proteins were selected based on their acquired resistance to 5 µg/ml puromycin. Cells were regularly tested to rule out Mycoplasma contamination.

Statistical analysis

Numerical data are expressed and illustrated in all graph bars as mean ± SD from biological replicates. No statistical tests were used to predetermine sample size. Replicates numbers were decided from experience of the techniques performed and practical considerations. Two-sided Student’s t-test was used to compare differences of all quantitative variables between two groups, and Fisher’s exact test was used for the analysis of contingency tables to compare the frequency distribution of ultrastructural abnormalities in two groups. Significance was calculated using GraphPad. Differences were considered statistically significant for p≤0.05. No data were excluded.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/100006920 University of Pennsylvania URF Fall 19-0914 to Enrico Radaelli.

http://dx.doi.org/10.13039/501100004923 Association Française Myopathies (AFM) Telethon 23019 to Marco Spinazzi.

http://dx.doi.org/10.13039/100017006 Abramson Cancer Center P30CA016520 to Enrico Radaelli.

Acknowledgements

This study was supported by the University of Pennsylvania URF research funding to ER (URF Fall 19-0914) and AFM-Telethon to MS (23019). MS is recipient of an INSERM translational research grant (CIHU INSERM). The authors affiliated with the Penn Vet Comparative Pathology Core are partially subsidized by the Abramson Cancer Center Support Grant (P30 CA016520); the Aperio Versa 200 scanner used for imaging was acquired through an NIH Shared Instrumentation Grant (S10 OD023465-01A1); the Leica BOND RXm instrument used for IHC was acquired through the Penn Vet IIZD Core pilot grant opportunity 2022. We are profoundly grateful to Prof. Bart De Strooper, KU Leuven, for his support and for the generous gift of all mouse strains used in this project. We thank Prof. Jeremy Wang, University of Pennsylvania, for his insightful comments as well as Dr. Cristina Ugalde, University Hospital of Madrid, for her feedback on blue-native electrophoresis results.

Additional information

Competing interests

Author contributions

Ethics

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file. Source data files have been included.

10.7554/eLife.84710.sa0
Editor's evaluation
Yan Wei Reviewing Editor https://ror.org/046rm7j60 University of California, Los Angeles United States

This manuscript reports an important finding that spermatogenic defects in Parl KO mice, a genetic model for Leigh syndrome, may result from mitochondrial defects leading to ferroptosis. The finding is of significance because male germ cell ferroptosis has not been well characterized before. The data as a whole strongly support ferroptosis as a mechanism for germ cell death in the Parl KO. However, potential non-ferroptosis and 'accidental' necrosis cannot be excluded, and the potential effects of quantitative immunofluorescent staining, instead of assays using purified spermatogenic cells, on the conclusion drawn should be considered.

10.7554/eLife.84710.sa1
Decision letter
Yan Wei Reviewing Editor https://ror.org/046rm7j60 University of California, Los Angeles United States

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Mitochondrial defects leading to arrested spermatogenesis and ferroptosis in a mouse model of Leigh Syndrome" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Ricardo Azziz as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Definitive evidence for germ cell ferroptosis.

2) Quantitative analyses using purified spermatogenic cells instead of total testes as the cellular compositions are different between KOs and controls.

Reviewer #1 (Recommendations for the authors):

1. In Figure 1A, it would be more useful to show testis/body weight ratio instead of the two metrics separately.

2. In Figure 1, SYCP-1 is used in the associated text but SCP-1 is used in the figure/legend; only one name should be used to avoid confusion.

3. Line 176 typo: "detail" -> "detailed".

4. Figure 2 – supplement 2 (activated caspase staining) is only referenced in association with Figure 6. It seems more appropriate to move this panel to the Figure 6 supplement.

5. For Figure 4B, the method for quantitating mtDNA is not specified in either the text or legend. It is provided in the methods (qPCR) but should also be specified in the main manuscript.

6. The various factors and pathways discussed tested throughout the study are complex. It would be helpful to have a cartoon or model figure outlining the proposed pathway and the differences between WT and Parl-/-.

7. Several details are missing in the figure legends; making the figures difficult to interpret:

a. In the legend to Figure 3A, the protein used as a loading control is not specified.

b. In Figure 4C, it is difficult to know which bands indicate assembly defects compared to normal complex assembly.

c. In Figure 4E, the abbreviation RCR is not explained in either the text or legend.

Reviewer #2 (Recommendations for the authors):

1. Ferroptosis is not reported in mammalian germ cells. However, the data presented here only indirectly support the possibility of germ cell ferroptosis in the mutants. The authors should clarify the definitions of ferroptosis in the field and demonstrate definitive evidence of germ-cell ferroptosis in mammals. P53 is not the only marker for ferroptosis. The HNE data is interesting but does not prove the main point.

2. Figure 2—figure supplement 2 shows "Absence of apoptosis in degenerated Parl-/- testis." However, apoptosis needs to be quantitatively evaluated in the mutants. Apoptosis is usually not so frequent in other mutants showing meiotic defects. Also, wild-type mice usually show a low rate of apoptosis. This data is not sufficient to demonstrate the "Absence of apoptosis."

3. The authors have done many analyses using the whole-testis (such as western or others; Figure 3A, 4A, 4B, 4C, 4D, 4E, 5B, 6A, 6B, 6 sup 1A-C, 6 sup 2A). However, the mutant testes were depleted with late germ cells, and the composition of germ cells was apparently different between the wild-type and mutant testes. The authors should confirm these results using analyses of juvenile testes (in which cellular composition is not changed yet) or isolated germ cells of specific stages from wild-type and mutant testes.

4. Results of fertility tests should be provided.

5. Figure 1—figure supplement 1: PARL deficiency should be confirmed in mutant Leydig cells. Otherwise, there is no evidence that PARL is depleted in the conditional mutants, as suggested.

6. Line 121-124: chromosome synapsis was not examined in the mutant. In this context, Line 242-244 explains the chromatin defects in the mutants, but there is no clear characterization.

7. Figure 2—figure supplement 2 should be described in the order of the explanation.

8. Line 155-158: The Pink1 single mutants should be characterized before examining the double mutants. In flies, PINK1 is required for spermatogenesis (Clark et al., Nature 2006: PMID 16672981). Thus, it is interesting if PINK1 is not required for spermatogenesis in mice. Results of fertility tests should be provided here as well.

9. Figure 4D is not possible to interpret. Please show the wild-type and mutant data separately and explain in a way general audiences can understand.

10. The Discussion section is disorganized and hard to read.

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for resubmitting your work entitled "Mitochondrial defects leading to arrested spermatogenesis and ferroptosis in the PARL deficient mouse model of Leigh Syndrome" for further consideration by eLife. Your revised article has been evaluated by Diane Harper (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

1) Add a paragraph summarizing the definitions of ferroptosis in mammals and explain how observation here fulfills these criteria.

2) The cellular compositions are different in KO vs control testes. Specifically, the mutant testes are enriched in spermatogonia, while the controls are enriched in spermatids. Therefore, purification of specific spermatogenic cell types followed by molecular assays is necessary.

Reviewer #2 (Recommendations for the authors):

The authors have addressed my primary concerns by providing quantitation of immunofluorescence microscopy and EM images, as well as additional controls and explanations. Functional infertility assessed by co-housing of mutant males with wild type females, which is an important addition to the report of azoospermia in describing an infertility phenotype, is now described at the beginning of the Results section. The paper makes a strong case for ferroptosis as a mechanism for germ cell death in Parl mutants and represents an advance in the fields of male fertility and mitochondrial function. There are two remaining points that I think should be acknowledged in the Discussion section:

1) I agree with reviewer 2 that analysis of stage-specific germ cells is important for the conclusions. In their rebuttal, the authors argue that deletion of Parl in all cells in the germline (whole body) knockout makes this concern irrelevant; this is not true because Parl is likely functioning differently across different germ cell types, making differing cell compositions a potential artifact in bulk assays. In addition, in a whole-body knockout there may be cell non-autonomous effects from testis somatic cells. The data from 4-week testes referred to in the rebuttal will not address the cell composition issue because by 4 weeks (28 days) there will be advanced round spermatids in control testes, meaning that cell compositions will differ between KO and control.

Taking all the data together, I think that the immunofluorescence data strongly supports a cell autonomous effect of Parl knockout in spermatocytes as the authors suggest. However, I think that they should acknowledge the possible issues related to mixed cell populations and somatic cell effects in the Discussion section.

2) Similarly, the data as a whole strongly supports ferroptosis as a mechanism for germ cell death in the Parl KO, but it is difficult to fully exclude non-ferroptotic 'accidental' necrosis. This should also be acknowledged in the Discussion section.

Reviewer #3 (Recommendations for the authors):

In this revision, I appreciate the authors' massive efforts to address my previous concerns, but I do not think my main concerns were not effectively addressed. The study provided several indirect evidence of germ cell ferroptosis, but I do not think the results firmly established the occurrence of germ cell ferroptosis. In general, perturbations in mitochondria dynamics could be expected to disrupt spermatogenesis. It would be necessary to clearly define germ-cell ferroptosis to explain the specific phenotype of the PARL mutants. Overall, I appreciate the potential impact; but I am not fully convinced by the main conclusion reported in this study yet.

1. The main issue is that the manuscript, including some of the revised parts, was not clearly written. I still do not understand many parts. Now, the abstract, results, and discussion are hard to read. The authors should clarify the contents and ask a professional editor to clarify the language. I am sorry that it took time to review the revised manuscript.

2. Ferroptosis is not reported in mammalian germ cells. However, the revised manuscript only indirectly supports the possibility of germ-cell ferroptosis in the mutants. The authors did not address my previous concern: the authors should clarify the definitions of ferroptosis in the field and demonstrate definitive evidence of germ-cell ferroptosis in mammals. Again, P53 is not the only marker for ferroptosis. Please add a paragraph summarizing the definitions of ferroptosis in mammals and explain how observation here fulfills these criteria.

3. The mutant testes were depleted with late germ cells, and the composition of germ cells was apparently different between the wild-type and mutant testes. The issues are that the mutant testes are enriched with spermatogonia, and the controls are enriched with the late stages of spermatogenesis. I appreciate the authors have done many analyses using the whole testis in this revision. However, they did not address this main point. I understand it can be challenging to isolate germ cells of specific stages from wild-type and mutant testes. At least, the authors should confirm the main conclusions using analyses of juvenile testes (in which cellular composition is not changed yet). For example, at least the reduction of CoQ (Figure 5A) should be examined to solidify the main conclusion.

4. I suggested that "results of fertility tests should be provided."At least, please show how many mice were examined for what duration.

5. Figure 1—figure supplement 1: PARL deficiency should be confirmed in mutant Leydig cells. In this case, I understand that there is no PARL antibody to confirm. This caveat can be noted.

6. Figure 4D is still not possible to interpret. Please clearly explain what this means in detail. Also, I found a weird mark in the middle of the panel.

7. New Figure 6C: GPX4 expression appears to be reduced in various cells in Parl-/- testes, but I do not see any cell-type specific reduction in spermatocytes. Is GPX4 highly expressed in other stages in the mutants?

10.7554/eLife.84710.sa2
Author response
Essential revisions:

Reviewer #1 (Recommendations for the authors):

1. In Figure 1A, it would be more useful to show testis/body weight ratio instead of the two metrics separately.

We included as suggested the testis/body weight ratio but kept also the information about testis and weight separately to avoid loss of information (the ratio alone for instance could decrease if the KO body weight increased).

2. In Figure 1, SYCP-1 is used in the associated text but SCP-1 is used in the figure/legend; only one name should be used to avoid confusion.

We modify the text as suggested by the reviewer.

3. Line 176 typo: "detail" -> "detailed".

We modify the text as suggested by the reviewer.

4. Figure 2 – supplement 2 (activated caspase staining) is only referenced in association with Figure 6. It seems more appropriate to move this panel to the Figure 6 supplement.

We agree and moved this figure to Figure 6—figure supplement 1 as suggested by the reviewer.

5. For Figure 4B, the method for quantitating mtDNA is not specified in either the text or legend. It is provided in the methods (qPCR) but should also be specified in the main manuscript.

We modify the text as suggested by the reviewer adding this point in the legend. The method is detailed in the methods section.

6. The various factors and pathways discussed tested throughout the study are complex. It would be helpful to have a cartoon or model figure outlining the proposed pathway and the differences between WT and Parl-/-.

We agree with the reviewer. We added this cartoon in Figure 7 as suggested by the reviewer.

7. Several details are missing in the figure legends; making the figures difficult to interpret:

a. In the legend to Figure 3A, the protein used as a loading control is not specified.

We specified that HSP60 is the loading control.

b. In Figure 4C, it is difficult to know which bands indicate assembly defects compared to normal complex assembly.

We modify the figure to highlight the identification of the different complexes as suggested by the reviewer.

c. In Figure 4E, the abbreviation RCR is not explained in either the text or legend.

As suggested by the reviewer, we specify in the legend the abbreviation RCR being respiratory control ratio, which is a useful parameter to assess the efficiency of oxidative phosphorylation.

Reviewer #2 (Recommendations for the authors):

1. Ferroptosis is not reported in mammalian germ cells. However, the data presented here only indirectly support the possibility of germ cell ferroptosis in the mutants. The authors should clarify the definitions of ferroptosis in the field and demonstrate definitive evidence of germ-cell ferroptosis in mammals. P53 is not the only marker for ferroptosis. The HNE data is interesting but does not prove the main point.

GPX4 is the major suppressors of ferroptosis, and the ablation of this protein alone induces ferroptosis. The virtual absence of GPX4 expression specifically found in Parl-/- spermatocytes provides in our opinion robust evidence for ferroptosis in our model, since genetic or chemical inactivation of this enzyme alone is sufficient to induce ferroptosis in a variety of models. In addition, we discuss how Coenzyme Q, an established and independent suppressor of ferroptosis, is severely suppressed in Parl-/- cells providing further evidence for this process.

Moreover, we provided quantitative analysis of 3 additional established biomarkers of ferroptosis in Parl-/- spermatocytes, confirming highly significant pattern of expression consistent with ferroptosis: HNE (increase), Tfr1 (increase), p53 (increase). Altogether, we believe that our study provides definitive evidence of ferroptosis in spermatocytes. Finally, while this paper was under revision, an independent group led by Thomas Langer published a study on Nature Cell Biology finding increased susceptibility of ferroptosis of PARL-/- cells in culture treated with GPX4 inhibitors due to defective Coenzyme Q (Deshwal, S. et al. Nat Cell Biol 2023: doi:10.1038/s41556-022-01071-y). We believe that these works, one performed in vivo and the other in vitro, perfectly fit together strengthening both conclusions.

2. Figure 2—figure supplement 2 shows "Absence of apoptosis in degenerated Parl-/- testis." However, apoptosis needs to be quantitatively evaluated in the mutants. Apoptosis is usually not so frequent in other mutants showing meiotic defects. Also, wild-type mice usually show a low rate of apoptosis. This data is not sufficient to demonstrate the "Absence of apoptosis."

We provide now quantitative analysis of apoptosis in Figure 6—figure supplement 1. As suggested by the reviewer, few cells in both genotypes showed caspase 3 activation, so we corrected the sentence on “absence of apoptosis”, which is not accurate. We did not see a quantitative difference in the amount of caspase 3 + cells in the two genotypes. Most importantly, we did not see caspase 3 activation in the degenerating adluminal germ cells strongly indicating that apoptosis was not the main cell death mechanisms. Although we cannot rule out a very subtle participation of apoptosis in addition to ferroptosis in the reported phenotype, we believe we can safely conclude that apoptosis was not the main biological mechanism underlying the massive testis phenotype that we described.

3. The authors have done many analyses using the whole-testis (such as western or others; Figure 3A, 4A, 4B, 4C, 4D, 4E, 5B, 6A, 6B, 6 sup 1A-C, 6 sup 2A). However, the mutant testes were depleted with late germ cells, and the composition of germ cells was apparently different between the wild-type and mutant testes. The authors should confirm these results using analyses of juvenile testes (in which cellular composition is not changed yet) or isolated germ cells of specific stages from wild-type and mutant testes.

We agree with the reviewer that the cellular composition is different in KO vs WT and we added many morphometric and cell quantitative analysis in Figure 1—figure supplement 1 to better address this important point. Indeed, primary spermatocytes and to a lesser extent spermatogonia significantly accumulate in ParlKO vs WT due to the complete meiotic block, while there is a complete lack of post-meiotic spermatids. To address the reviewer concerns that changes in cellular composition might have affected our interpretation, we performed a series of cell-specific quantitative analysis in WT and mutant testes in order to eliminate any bias that may originate from differences in cell composition.

Figure 3A: since our study is on a germline KO for PARL, the effect of PARL deficiency on PARL substrates is the same in any cells, as previously reported in Spinazzi et al., 2019, so repeating the experiment on isolated germ cells would not provide any additional insight. Moreover, it is technically unfeasible to perform, being most of the PARL substrates undetectable by IHC due to absence of specific antibodies for this technique.

Figure 4A: as above, the mouse employed in the study is a germline KO for PARL, so PARL is absent in any cell, as previously described (Cipolat S et al. Cell. 2006), so repeating the experiment on isolated germ cells would not provide any useful insight. Moreover, there is no specific antibody currently available for PARL IHC.

Figure 4B: to address the question of whether mtDNA content may be different in WT vs Parl-/- spermatocytes, we performed quantitative immunofluorescences experiments with antibodies stained for TFAM, a protein associated with mitochondrial nucleoids commonly used as biomarker for mtDNA abundance, and SCP-1, a marker of primary spermatocytes. We did not observe significant difference of TFAM expression in SCP-1+ cells as shown in the new Figure 4—figure supplement 1. These data rule out the possibility of significant decrease of mtDNA in Parl-/- spermatocytes, that could explain the drastic mitochondrial respiratory chain defects that we describe.

Figure 4C: isolation of mitochondria, required for blue native gel electrophoresis requires a substantial amount of tissue/cells. This amount is impossible to reach after isolation of specific germ cells. We performed BNGE at an earlier stage (4 weeks), when the amount of tissue is sufficient for mitochondrial isolation, and the results are identical compared to those shown and Figure 4C. We can share this experiment if needed. Moreover, although it is not possible to precisely localize the severity of mitochondrial complex disassembly in different testis cells, we can safely affirm that the abnormalities shown in Figure 4C are definitely pathological since they do not respect the well characterized macromolecular organization of respiratory chain complexes and super complexes that is well known and conserved among different cell types even in different species.

Figure 4D: this graph, as explained in the text, is simply an illustrative example to describe to reader the protocol of high-resolution respirometry employed in the study.

Figure 4E: as for 4C, it is not realistic to perform mitochondrial isolation after germ cell isolation for the reasons above specified. Moreover, the procedure of germ cell isolation per se very likely would affect and compromise mitochondrial function and respiration. As explained in the text, to gain cell type-specific insights on mitochondrial function/electron transfer we performed hystoenzymatic assessment of cytochrome c oxydase (COX) activity, shown in Figure 4F. To further confirm our data we performed quantitative immunofluorescence analysis for COX4, a subunit of Complex IV of the respiratory chain, in SCP-1 positive primary spermatocytes, confirming a significant decrease in COX4 expression in primary spermatocytes of Parl-/- compared to WT. These results have been included in a new Figure 4—figure supplement 2.

Figure 5B: to address the reviewer concerns we performed quantitative immunofluorescence analysis for COQ4 in SCP-1 positive primary spermatocytes, confirming a significant decrease in COQ4 expression in primary spermatocytes of Parl-/- compared to WT. We added this new analysis in a new Figure 5—figure supplement 1.

Figure 6A: to address the reviewer concerns we performed quantitative immunofluorescence analysis for GPX4 in SCP-1 positive spermatocytes, confirming a dramatic decrease in GPX4 expression in primary spermatocytes of Parl-/- compared to WT (p=0.0013). We added this new analysis in a new Figure 6—figure supplement 2A. We also evaluated GPX4 expression in Sertoli cells with a similar approach and did not find significant differences (Figure 6—figure supplement 2A).

Figure 6B: to address the reviewer concerns we performed quantitative immunofluorescence analysis for HNE in SCP1 positive primary spermatocytes, confirming a dramatic increase in HNE expression in primary spermatocytes of Parl-/- compared to WT (p = 0.0002). We added this new analysis in Figure 6—figure supplement 5B.

Figure 6 sup1A, now Figure 6—figure supplement 3A: this experiment is not performed on whole-testis but on total mouse embryonic fibroblasts, as specified in the figure legend.

Figure 6 sup1B-C, now Figure 6—figure supplement 3B-C: 3B is not performed on whole-testis but on isolated mitochondria from different tissues (1B), and 3C on total brain tissue. These experiments show that the drastic effects on GPX4 and lipid peroxidation are not present in these tissues.

4. Results of fertility tests should be provided.

We specify in the text that the mice are totally infertile due to complete lack of sperm production.

5. Figure 1—figure supplement 1: PARL deficiency should be confirmed in mutant Leydig cells. Otherwise, there is no evidence that PARL is depleted in the conditional mutants, as suggested.

There is no currently available specific antibody for PARL immunohistochemistry, so it is not possible to directly quantify the effect of the Nestin-Cre deletion in Leydig cells at protein level. Nevertheless, the expression of Nestin in Leydig cells, that we and others before us verified, is expected to delete Parl by Cre recombinase, as in the nervous system. Moreover our extensive observations indicates that Leydig cells are structurally and functionally unaffected in the germline Parl-/- suggesting that Leydig cells are not major players of the drastic germ cell phenotype that we link to PARL deficiency.

6. Line 121-124: chromosome synapsis was not examined in the mutant. In this context, Line 242-244 explains the chromatin defects in the mutants, but there is no clear characterization.

We acknowledge lack of this evidence; however characterization of chromatin defects and chromosome synapsis is not the focus of the paper. We provided a more precise characterization of the meiotic arrest by γH2AX staining that we included in Figure 1—figure supplement 1.

7. Figure 2—figure supplement 2 should be described in the order of the explanation.

We thank the reviewer for pointing this out. We moved this figure to Figure 6—figure supplement 1 as suggested by the reviewer.

8. Line 155-158: The Pink1 single mutants should be characterized before examining the double mutants. In flies, PINK1 is required for spermatogenesis (Clark et al., Nature 2006: PMID 16672981). Thus, it is interesting if PINK1 is not required for spermatogenesis in mice. Results of fertility tests should be provided here as well.

We provided additional histological in data on single Pink1 and Pgam5 KO in Figure 3. Moreover, we performed a series of novel AIF1 staining confirming that Pink1-/- testis, as well as Pgam5/- have normal production of spermatids in sharp contrast with Parl-/- which show complete premeiotic maturation arrest. We included these data in Figure 3 – supplement 1. Moreover we specify that Pink1-/- mice are fertile as also indicated in the JAX website: https://www.jax.org/strain/017946; in fact Pink1-/- mice as well as Pgam5-/- and Ttc19-/- were also bred as homozygous mutant. Moreover, the phenotype of PINK1-/- flies is very different and much more severe than Pink1-/- mice which have barely any detectable phenotype and normal lifespan.

9. Figure 4D is not possible to interpret. Please show the wild-type and mutant data separately and explain in a way general audiences can understand.

This figure does not show WT and mutant data altogether so it cannot be split as suggested. It is an illustrative trace of one experiment to graphically illustrate to readers interested in bioenergetics how the high-resolution respirometry was performed, and to reassure of the validity of this delicate experiment. We try to improve this explanation in the text and legend.

10. The Discussion section is disorganized and hard to read.

We thank the reviewer for pointing this out. We substantially rewrote the discussion trying to organize it better and improve readability. To illustrate better the complex pathways that are involved we included a cartoon in Figure 7.

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

Reviewer #2 (Recommendations for the authors):

The authors have addressed my primary concerns by providing quantitation of immunofluorescence microscopy and EM images, as well as additional controls and explanations. Functional infertility assessed by co-housing of mutant males with wild type females, which is an important addition to the report of azoospermia in describing an infertility phenotype, is now described at the beginning of the Results section. The paper makes a strong case for ferroptosis as a mechanism for germ cell death in Parl mutants and represents an advance in the fields of male fertility and mitochondrial function. There are two remaining points that I think should be acknowledged in the Discussion section:

1) I agree with reviewer 2 that analysis of stage-specific germ cells is important for the conclusions. In their rebuttal, the authors argue that deletion of Parl in all cells in the germline (whole body) knockout makes this concern irrelevant; this is not true because Parl is likely functioning differently across different germ cell types, making differing cell compositions a potential artifact in bulk assays. In addition, in a whole-body knockout there may be cell non-autonomous effects from testis somatic cells. The data from 4-week testes referred to in the rebuttal will not address the cell composition issue because by 4 weeks (28 days) there will be advanced round spermatids in control testes, meaning that cell compositions will differ between KO and control.

Taking all the data together, I think that the immunofluorescence data strongly supports a cell autonomous effect of Parl knockout in spermatocytes as the authors suggest. However, I think that they should acknowledge the possible issues related to mixed cell populations and somatic cell effects in the Discussion section.

We added this caveat at the end of the first paragraph of the discussion.

2) Similarly, the data as a whole strongly supports ferroptosis as a mechanism for germ cell death in the Parl KO, but it is difficult to fully exclude non-ferroptotic 'accidental' necrosis. This should also be acknowledged in the Discussion section.

We added in the discussion that it is impossible to demonstrate the presence of accidental necrosis in vivo since no specific biomarker is currently available for accidental necrosis. However, whether accidental necrosis contributes in part to the cell death phenotype, this would not change the conclusions of the study.

Reviewer #3 (Recommendations for the authors):

In this revision, I appreciate the authors' massive efforts to address my previous concerns, but I do not think my main concerns were not effectively addressed. The study provided several indirect evidence of germ cell ferroptosis, but I do not think the results firmly established the occurrence of germ cell ferroptosis. In general, perturbations in mitochondria dynamics could be expected to disrupt spermatogenesis. It would be necessary to clearly define germ-cell ferroptosis to explain the specific phenotype of the PARL mutants. Overall, I appreciate the potential impact; but I am not fully convinced by the main conclusion reported in this study yet.

1. The main issue is that the manuscript, including some of the revised parts, was not clearly written. I still do not understand many parts. Now, the abstract, results, and discussion are hard to read. The authors should clarify the contents and ask a professional editor to clarify the language. I am sorry that it took time to review the revised manuscript.

We acknowledge that paper may be in some parts hard to read given complexity of the topic, and also the massive amount of data that have been added to address the reviewer’s concerns. We have again modified both abstract and discussion with the hope of improving the readability of the content. Upon request of the reviewer, we previously added a cartoon illustrating the key elements of the paper (Figure 7). At this stage, in absence of more precise indications, we cannot further address this point. If the paper is accepted, our English native speaker coauthors will work with the editorial office to perform a thorough style improvement and proofreading before publication.

2. Ferroptosis is not reported in mammalian germ cells. However, the revised manuscript only indirectly supports the possibility of germ-cell ferroptosis in the mutants. The authors did not address my previous concern: the authors should clarify the definitions of ferroptosis in the field and demonstrate definitive evidence of germ-cell ferroptosis in mammals. Again, P53 is not the only marker for ferroptosis. Please add a paragraph summarizing the definitions of ferroptosis in mammals and explain how observation here fulfills these criteria.

In our previous revision we have already addressed this question and explained the definition of ferroptosis and how our observations fulfil these criteria. We highlighted further in this revised version that ferroptosis is a caspase independent type of regulated cell death defined by uncontrolled lipid peroxidation. This is demonstrated by a dramatic increase in 4-HNE signal in degenerating PARL-deficient spermatocytes. Moreover, PARL-deficient spermatocytes have a dramatic cell-specific expression defect of the major ferroptosis inhibitory enzyme GPX4. Genetic or chemical inactivation of this enzyme alone is sufficient to induce ferroptosis in a variety of models both in vitro and in vivo. Finally, we have shown that additional established biomarkers of ferroptosis such Tfr1 and p53 consistently increase in PARL-deficient degenerating spermatocytes, providing unambiguous evidence of ferroptosis in PARL-deficient spermatocytes.

3. The mutant testes were depleted with late germ cells, and the composition of germ cells was apparently different between the wild-type and mutant testes. The issues are that the mutant testes are enriched with spermatogonia, and the controls are enriched with the late stages of spermatogenesis. I appreciate the authors have done many analyses using the whole testis in this revision. However, they did not address this main point. I understand it can be challenging to isolate germ cells of specific stages from wild-type and mutant testes. At least, the authors should confirm the main conclusions using analyses of juvenile testes (in which cellular composition is not changed yet). For example, at least the reduction of CoQ (Figure 5A) should be examined to solidify the main conclusion.

We have already addressed the issue of the different cell type composition in WT and Parl-/- testis in the previous revision by repeating all experiments with quantitative immunofluorescence in specific germ cell populations (e.g. SCP-1-positive cells). This alternative approach to germ cell isolation has been deemed appropriate by the Editors to address the issue of different cellular composition between WT and PARL-deficient testis. Furthermore, this method allows us to visualize and quantify the expression of relevant markers within the intact and unperturbed tissue context avoiding the experimental biases associated with the artificial manipulations for isolating germ cells (PMID: 30149006). The quantitative immunofluorescence data have already been included in 7 supplementary figures added to the previous revised version of our manuscript. All these experiments have confirmed and strengthened our original conclusions. Therefore, we believe that purification of germ cells would not add any relevant scientific information. We also think that it would be ethically not acceptable violating the 3Rs rule of animal experimentation.

Repeating the analysis in juvenile testis in which cellular composition is not changed by PARL deficiency is not necessary in our opinion since we already addressed the question of cell type composition as explained above as well as in our previous submission. Moreover, based on preliminary data in our possession, the analysis of earlier time points would not be informative in that context since the cell composition is changed very early on, well before the presence of germ cell degeneration. Ongoing investigations on the early molecular mechanisms underlying the PARL-deficient phenotype will be part of an independent study which goes beyond the scope of this publication.

4. I suggested that "results of fertility tests should be provided."At least, please show how many mice were examined for what duration.

We have checked this more carefully and concluded that it is impossible to provide meaningful information on this point, since mice acquired full fertility after 6-8 weeks of life but Parl-/- mice develop neurological abnormalities by the age of 6 weeks and die by the age of 7 weeks. Therefore, although we know for sure that Parl-/- mice are not able to fecundate WT females, we cannot use this argument to. Therefore, we deleted this sentence from the manuscript. The same holds true for PARL double and triple KO (Parl-/-/Pink1-/-); Parl and Pgam5 (Parl-/-/Pgam5-/-); Pink1 and Pgam5 (Pink1-/-/Pgam5-/-); and Parl, Pink1, and Pgam5 combined (Parl-/-/Pink1-/-/Pgam5-/-). We modified Figure 3 accordingly.

Nevertheless, our data clearly show that Parl-/- mice are indisputably sterile due to total lack of sperm production caused by completely arrested spermatogenesis and consequent azoospermia. This has been clearly documented through our detailed histological analysis and AIF1 staining, as specified in the previous revision. In conclusion, we believe that fertility tests are superfluous since we have demonstrated that no spermatozoa are produced in any PARL deficient mouse line, which are therefore necessarily infertile.

5. Figure 1—figure supplement 1: PARL deficiency should be confirmed in mutant Leydig cells. In this case, I understand that there is no PARL antibody to confirm. This caveat can be noted.

We specified this caveat in the manuscript.

6. Figure 4D is still not possible to interpret. Please clearly explain what this means in detail.

We are confused by this repeated request, since a very detailed explanation has already been specified in the legend, in the text, and in the rebuttal letter of the previous submission. This figure is an illustrative trace, as provided by the Oroboros 2K high resolution respirometer, of a high resolution respirometry protocol that has been used in the study. The Oroboros 2K respirometer is currently the state-of-the-art instrument to perform the oxygen consumption analysis. This should be especially interesting for scientists interested in mitochondrial bioenergetics since we are not aware of previous studies/methods to perform high-resolution respirometry in testis mitochondria. We believe it is important to publish at least one illustrative trace of similar experiments in order to explain visually the experiment and build solid confidence in the results. We believe that a full course on high-resolution respirometry is out of scope in the paper. For further informations on high resolution respirometry it is possible to find extensive literature elsewhere (some examples: PMID: 18536644, PMID: 27008969, PMID: 32200800) and in the BIOBLAST website https://www.bioblast.at/index.php/MitoPedia:_SUIT

Also, I found a weird mark in the middle of the panel.

We erased the Oroboros 2k symbol that was automatically attached by the software DATLAB.

7. New Figure 6C: GPX4 expression appears to be reduced in various cells in Parl-/- testes, but I do not see any cell-type specific reduction in spermatocytes. Is GPX4 highly expressed in other stages in the mutants?

We are puzzled by this comment. As explained in the text, Fig6C and its insets show exactly the opposite: a clearly reduced expression of GPX4 expression in Parl-/- spermatocytes but normal expression in Leydig cells. To corroborate these finding, we added in the previous submission ad hoc experiments with quantitative immunofluorescence showing a dramatic reduction of GPX4 in SCP-1-positive spermatocytes but not in Sertoli cells.

No competing interests declared.

Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Formal analysis, Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation, Writing - review and editing.

Investigation, Writing - review and editing.

Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Mice were included in a health-monitoring program developed in accordance with guidelines of the Federation of European Laboratory Animal Science Associations (FELASA). All experiments were approved by the Ethical Committee on Animal Experimenting of the University of Leuven (IACUC protocol #072/2015) and by the French Ministry (DUO-OGM 5769 29/3/2019).
==== Refs
References

Agarwal A Panner Selvam MK Baskaran S 2020 Proteomic analyses of human sperm cells: understanding the role of proteins and molecular pathways affecting male reproductive health International Journal of Molecular Sciences 21 1621 10.3390/ijms21051621 32120839
Ahmed EA de Rooij DG 2009 Staging of mouse seminiferous tubule cross-sections Methods in Molecular Biology 558 263 277 10.1007/978-1-60761-103-5_16 19685330
Ahola S Rivera Mejías P Hermans S Chandragiri S Giavalisco P Nolte H Langer T 2022 OMA1-mediated integrated stress response protects against ferroptosis in mitochondrial cardiomyopathy Cell Metabolism 34 1875 1891 10.1016/j.cmet.2022.08.017 36113464
Aitken RJ Drevet JR Moazamian A Gharagozloo P 2022 Male infertility and oxidative stress: a focus on the underlying mechanisms Antioxidants 11 306 10.3390/antiox11020306 35204189
Anand-Ivell R Ye L Li X Li L Chen H 2017 Insights into the development of the adult leydig cell lineage from stem leydig cells Frontiers in Physiology 1 430 10.3389/fphys.2017.00430
Arena ET Rueden CT Hiner MC Wang S Yuan M Eliceiri KW 2017 Quantitating the cell: turning images into numbers with ImageJ Wiley Interdisciplinary Reviews. Developmental Biology 6 260 10.1002/wdev.260 27911038
Atwal PS 2014 Mutations in the Complex III Assembly Factor Tetratricopeptide 19 Gene TTC19 Are a Rare Cause of Leigh Syndrome JIMD Reports 14 43 45 10.1007/8904_2013_282 24368687
Bersuker K Hendricks JM Li Z Magtanong L Ford B Tang PH Roberts MA Tong B Maimone TJ Zoncu R Bassik MC Nomura DK Dixon SJ Olzmann JA 2019 The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis Nature 575 688 692 10.1038/s41586-019-1705-2 31634900
Beumer TL Roepers-Gajadien HL Gademan IS van Buul PP Gil-Gomez G Rutgers DH de Rooij DG 1998 The role of the tumor suppressor p53 in spermatogenesis Cell Death and Differentiation 5 669 677 10.1038/sj.cdd.4400396 10200522
Boivin J Bunting L Collins JA Nygren KG 2009 Reply: International estimates on infertility prevalence and treatment seeking: potential need and demand for medical care Human Reproduction 24 2380 2383 10.1093/humrep/dep218
Bottani E Cerutti R Harbour ME 2017 TTC19 Plays a Husbandry Role on UQCRFS1 Turnover in the Biogenesis of Mitochondrial Respiratory Complex III Molecular Cell 67 96 105 10.1016/j.molcel.2017.06.001 28673544
Brower JV Lim CH Jorgensen M Oh SP Terada N 2009 Adenine nucleotide translocase 4 deficiency leads to early meiotic arrest of murine male germ cells Reproduction 138 463 470 10.1530/REP-09-0201 19556438
Cadalbert LC Ghaffar FN Stevenson D Bryson S Vaz FM Gottlieb E Strathdee D 2015 Mouse tafazzin is required for male germ cell meiosis and spermatogenesis PLOS ONE 10 e0131066 10.1371/journal.pone.0131066 26114544
Cannon MV Takeda K Pinkert CA 2011 Mitochondrial biology in reproduction Reproductive Medicine and Biology 10 251 258 10.1007/s12522-011-0101-x 29662358
Carlson BA Tobe R Yefremova E Tsuji PA Hoffmann VJ Schweizer U Gladyshev VN Hatfield DL Conrad M 2016 Glutathione peroxidase 4 and vitamin E cooperatively prevent hepatocellular degeneration Redox Biology 9 22 31 10.1016/j.redox.2016.05.003 27262435
Chen X Comish PB Tang D Kang R 2021 Characteristics and biomarkers of ferroptosis Frontiers in Cell and Developmental Biology 9 637162 10.3389/fcell.2021.637162 33553189
Cipolat S Rudka T Hartmann D Costa V Serneels L Craessaerts K Metzger K Frezza C Annaert W D’Adamio L Derks C Dejaegere T Pellegrini L D’Hooge R Scorrano L De Strooper B 2006 Mitochondrial rhomboid PARL regulates cytochrome c release during apoptosis via OPA1-dependent cristae remodeling Cell 126 163 175 10.1016/j.cell.2006.06.021 16839884
Civitarese AE MacLean PS Carling S Kerr-Bayles L McMillan RP Pierce A Becker TC Moro C Finlayson J Lefort N Newgard CB Mandarino L Cefalu W Walder K Collier GR Hulver MW Smith SR Ravussin E 2010 Regulation of skeletal muscle oxidative capacity and insulin signaling by the mitochondrial rhomboid protease PARL Cell Metabolism 11 412 426 10.1016/j.cmet.2010.04.004 20444421
Davidoff MS Middendorff R Enikolopov G Riethmacher D Holstein AF Müller D 2004 Progenitor cells of the testosterone-producing Leydig cells revealed The Journal of Cell Biology 167 935 944 10.1083/jcb.200409107 15569711
Deng H Dodson MW Huang H Guo M 2008 The Parkinson’s disease genes pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila PNAS 105 14503 14508 10.1073/pnas.0803998105 18799731
Deshwal S Onishi M Tatsuta T Bartsch T Cors E Ried K Lemke K Nolte H Giavalisco P Langer T 2023 Mitochondria regulate intracellular coenzyme Q transport and ferroptotic resistance via STARD7 Nature Cell Biology 25 246 257 10.1038/s41556-022-01071-y 36658222
Dogan SA Pujol C Maiti P Kukat A Wang S Hermans S Senft K Wibom R Rugarli EI Trifunovic A 2014 Tissue-specific loss of DARS2 activates stress responses independently of respiratory chain deficiency in the heart Cell Metabolism 19 458 469 10.1016/j.cmet.2014.02.004 24606902
Doll S Freitas FP Shah R Aldrovandi M da Silva MC Ingold I Goya Grocin A Xavier da Silva TN Panzilius E Scheel CH Mourão A Buday K Sato M Wanninger J Vignane T Mohana V Rehberg M Flatley A Schepers A Kurz A White D Sauer M Sattler M Tate EW Schmitz W Schulze A O’Donnell V Proneth B Popowicz GM Pratt DA Angeli JPF Conrad M 2019 FSP1 is a glutathione-independent ferroptosis suppressor Nature 575 693 698 10.1038/s41586-019-1707-0 31634899
Ekstrand MI Falkenberg M Rantanen A Park CB Gaspari M Hultenby K Rustin P Gustafsson CM Larsson N-G 2004 Mitochondrial transcription factor A regulates mtDNA copy number in mammals Human Molecular Genetics 13 935 944 10.1093/hmg/ddh109 15016765
Fasching M Renner-sattler K Gnaiger E 2016 Mitochondrial Respiration Medium - MiR06 Mitochondrial Physiology Network 14 1 4
Feng H Schorpp K Jin J Yozwiak CE Hoffstrom BG Decker AM Rajbhandari P Stokes ME Bender HG Csuka JM Upadhyayula PS Canoll P Uchida K Soni RK Hadian K Stockwell BR 2020 Transferrin receptor is a specific ferroptosis marker Cell Reports 30 3411 3423 10.1016/j.celrep.2020.02.049 32160546
Foresta C Flohé L Garolla A Roveri A Ursini F Maiorino M 2002 Male fertility is linked to the selenoprotein phospholipid hydroperoxide glutathione peroxidase Biology of Reproduction 67 967 971 10.1095/biolreprod.102.003822 12193409
Forsström S Jackson CB Carroll CJ Kuronen M Pirinen E Pradhan S Marmyleva A Auranen M Kleine I-M Khan NA Roivainen A Marjamäki P Liljenbäck H Wang L Battersby BJ Richter U Velagapudi V Nikkanen J Euro L Suomalainen A 2019 Fibroblast Growth Factor 21 Drives Dynamics of Local and Systemic Stress Responses in Mitochondrial Myopathy with mtDNA Deletions Cell Metabolism 30 1040 1054 10.1016/j.cmet.2019.08.019 31523008
Friedmann Angeli JP Schneider M Proneth B Tyurina YY Tyurin VA Hammond VJ Herbach N Aichler M Walch A Eggenhofer E Basavarajappa D Rådmark O Kobayashi S Seibt T Beck H Neff F Esposito I Wanke R Förster H Yefremova O Heinrichmeyer M Bornkamm GW Geissler EK Thomas SB Stockwell BR O’Donnell VB Kagan VE Schick JA Conrad M 2014 Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice Nature Cell Biology 16 1180 1191 10.1038/ncb3064 25402683
Gao M Yi J Zhu J Minikes AM Monian P Thompson CB Jiang X 2019 Role of mitochondria in ferroptosis Molecular Cell 73 354 363 10.1016/j.molcel.2018.10.042 30581146
Gao T Lin M Wu Y Li K Liu C Zhou Q Shen C Zheng B Huang X 2021 Transferrin receptor (TFRC) is essential for meiotic progression during mouse spermatogenesis Zygote 29 169 175 10.1017/S0967199420000659 33323153
Gispert S Parganlija D Klinkenberg M Dröse S Wittig I Mittelbronn M Grzmil P Koob S Hamann A Walter M Büchel F Adler T Hrabé de Angelis M Busch DH Zell A Reichert AS Brandt U Osiewacz HD Jendrach M Auburger G 2013 Loss of mitochondrial peptidase Clpp leads to infertility, hearing loss plus growth retardation via accumulation of CLPX, mtDNA and inflammatory factors Human Molecular Genetics 22 4871 4887 10.1093/hmg/ddt338 23851121
Godeas C Tramer F Micali F Soranzo M Sandri G Panfili E 1997 Distribution and possible novel role of phospholipid hydroperoxide glutathione peroxidase in rat epididymal spermatozoa Biology of Reproduction 57 1502 1508 10.1095/biolreprod57.6.1502 9408261
Gueguen N Baris O Lenaers G Reynier P Spinazzi M 2021 Secondary coenzyme Q deficiency in neurological disorders Free Radical Biology & Medicine 165 203 218 10.1016/j.freeradbiomed.2021.01.017 33450382
Hao X Wang H Cui F Yang Z Ye L Huang R Meng J 2023 Reduction of SLC7A11 and GPX4 Contributing to Ferroptosis in Sperm from Asthenozoospermia Individuals Reproductive Sciences 30 247 257 10.1007/s43032-022-01004-y 35729458
Hatunic M Stapleton M Hand E DeLong C Crowley VEF Nolan JJ 2009 The Leu262Val polymorphism of presenilin associated rhomboid like protein (PARL) is associated with earlier onset of type 2 diabetes and increased urinary microalbumin creatinine ratio in an Irish case-control population Diabetes Research and Clinical Practice 83 316 319 10.1016/j.diabres.2008.12.004 19185381
Imai H Suzuki K Ishizaka K Ichinose S Oshima H Okayasu I Emoto K Umeda M Nakagawa Y 2001 Failure of the expression of phospholipid hydroperoxide glutathione peroxidase in the spermatozoa of human infertile males Biology of Reproduction 64 674 683 10.1095/biolreprod64.2.674 11159372
Imai H Hakkaku N Iwamoto R Suzuki J Suzuki T Tajima Y Konishi K Minami S Ichinose S Ishizaka K Shioda S Arata S Nishimura M Naito S Nakagawa Y 2009 Depletion of selenoprotein GPx4 in spermatocytes causes male infertility in mice The Journal of Biological Chemistry 284 32522 32532 10.1074/jbc.M109.016139 19783653
Istikharah R Tun AW Kaewsutthi S Aryal P Kunhapan B Katanyoo W Chuenkongkaew W Lertrit P 2013 Identification of the variants in PARL, the nuclear modifier gene, responsible for the expression of LHON patients in Thailand Experimental Eye Research 116 55 57 10.1016/j.exer.2013.08.007 23973714
Jha P Wang X Auwerx J 2016 Analysis of mitochondrial respiratory chain supercomplexes using blue native polyacrylamide gel electrophoresis (BN-PAGE) Current Protocols in Mouse Biology 6 1 14 10.1002/9780470942390.mo150182 26928661
Jiang MH Cai B Tuo Y Wang J Zang ZJ Tu X Gao Y Su Z Li W Li G Zhang M Jiao J Wan Z Deng C Lahn BT Xiang AP 2014 Characterization of Nestin-positive stem Leydig cells as a potential source for the treatment of testicular Leydig cell dysfunction Cell Research 24 1466 1485 10.1038/cr.2014.149 25418539
Jiang L Kon N Li T Wang S-J Su T Hibshoosh H Baer R Gu W 2015 Ferroptosis as a p53-mediated activity during tumour suppression Nature 520 57 62 10.1038/nature14344 25799988
Jin SM Lazarou M Wang C Kane LA Narendra DP Youle RJ 2010 Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL The Journal of Cell Biology 191 933 942 10.1083/jcb.201008084 21115803
Khan NA Nikkanen J Yatsuga S Jackson C Wang L Pradhan S Kivelä R Pessia A Velagapudi V Suomalainen A 2017 mTORC1 regulates mitochondrial integrated stress response and mitochondrial myopathy progression Cell Metabolism 26 419 428 10.1016/j.cmet.2017.07.007 28768179
Köhler C 2007 Allograft inflammatory factor-1/Ionized calcium-binding adapter molecule 1 is specifically expressed by most subpopulations of macrophages and spermatids in testis Cell and Tissue Research 330 291 302 10.1007/s00441-007-0474-7 17874251
Kraft VAN Bezjian CT Pfeiffer S Ringelstetter L Müller C Zandkarimi F Merl-Pham J Bao X Anastasov N Kössl J Brandner S Daniels JD Schmitt-Kopplin P Hauck SM Stockwell BR Hadian K Schick JA 2020 GTP Cyclohydrolase 1/Tetrahydrobiopterin Counteract Ferroptosis through Lipid Remodeling ACS Central Science 6 41 53 10.1021/acscentsci.9b01063 31989025
Kühl I Miranda M Atanassov I Kuznetsova I Hinze Y Mourier A Filipovska A Larsson NG 2017 Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals eLife 6 e30952 10.7554/eLife.30952 29132502
Leichtmann-Bardoogo Y Cohen LA Weiss A Marohn B Schubert S Meinhardt A Meyron-Holtz EG 2012 Compartmentalization and regulation of iron metabolism proteins protect male germ cells from iron overload American Journal of Physiology. Endocrinology and Metabolism 302 E1519 E1530 10.1152/ajpendo.00007.2012 22496346
Lin Y-S Liu C-Y Chen P-W Wang C-Y Chen H-C Tsao C-W 2021 Coenzyme Q10 amends testicular function and spermatogenesis in male mice exposed to cigarette smoke by modulating oxidative stress and inflammation American Journal of Translational Research 13 10142 10154 34650686
Liu Y Gu W 2022 p53 in ferroptosis regulation: the new weapon for the old guardian Cell Death & Differentiation 29 895 910 10.1038/s41418-022-00943-y 35087226
Lu B Poirier C Gaspar T Gratzke C Harrison W Busija D Matzuk MM Andersson K-E Overbeek PA Bishop CE 2008 A mutation in the inner mitochondrial membrane peptidase 2-like gene (Immp2l) affects mitochondrial function and impairs fertility in mice Biology of Reproduction 78 601 610 10.1095/biolreprod.107.065987 18094351
Lu W Karuppagounder SS Springer DA Allen MD Zheng L Chao B Zhang Y Dawson VL Dawson TM Lenardo M 2014 Genetic deficiency of the mitochondrial protein PGAM5 causes a Parkinson’s-like movement disorder Nature Communications 5 4930 10.1038/ncomms5930 25222142
Luna-Sánchez M Hidalgo-Gutiérrez A Hildebrandt TM Chaves-Serrano J Barriocanal-Casado E Santos-Fandila Á Romero M Sayed RK Duarte J Prokisch H Schuelke M Distelmaier F Escames G Acuña-Castroviejo D López LC 2017 CoQ deficiency causes disruption of mitochondrial sulfide oxidation, a new pathomechanism associated with this syndrome EMBO Molecular Medicine 9 78 95 10.15252/emmm.201606345 27856619
Maiorino M Scapin M Ursini F Biasolo M Bosello V Flohé L 2003 Distinct promoters determine alternative transcription of gpx-4 into phospholipid-hydroperoxide glutathione peroxidase variants The Journal of Biological Chemistry 278 34286 34290 10.1074/jbc.M305327200 12819198
Mancini A Balercia G 2011 Coenzyme Q(10) in male infertility: physiopathology and therapy BioFactors 37 374 380 10.1002/biof.164 21989906
Mao C Liu X Zhang Y Lei G Yan Y Lee H Koppula P Wu S Zhuang L Fang B Poyurovsky MV Olszewski K Gan B 2021 DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer Nature 593 586 590 10.1038/s41586-021-03539-7 33981038
Martikainen MH Grady JP Ng YS Alston CL Gorman GS Taylor RW McFarland R Turnbull DM 2017 Decreased male reproductive success in association with mitochondrial dysfunction European Journal of Human Genetics 25 1162 1164 10.1038/ejhg.2017.114 28812649
Martins MR Silva JR 2001 Ultrastructure of spermatogonia and primary spermatocytes of C57BL6J mice Anatomia, Histologia, Embryologia 30 129 132 11447934
McQuibban GA Lee JR Zheng L Juusola M Freeman M 2006 Normal mitochondrial dynamics requires rhomboid-7 and affects Drosophila lifespan and neuronal function Current Biology 16 982 989 10.1016/j.cub.2006.03.062 16713954
Meistrich ML Hess RA 2013 Assessment of spermatogenesis through staging of seminiferous tubules Methods Mol Biolactions 927 299 307 10.1007/978-1-62703-038-0
Moosmann B Behl CS 2004 Selenoproteins, cholesterol-lowering drugs, and the consequences: revisiting of the mevalonate pathway Trends in Cardiovascular Medicine 14 273 281 10.1016/j.tcm.2004.08.003 15542379
Nakada K Sato A Yoshida K Morita T Tanaka H Inoue S-I Yonekawa H Hayashi J-I 2006 Mitochondria-related male infertility PNAS 103 15148 15153 10.1073/pnas.0604641103 17005726
Oresti GM Reyes JG Luquez JM Osses N Furland NE Aveldaño MI 2010 Differentiation-related changes in lipid classes with long-chain and very long-chain polyenoic fatty acids in rat spermatogenic cells Journal of Lipid Research 51 2909 2921 10.1194/jlr.M006429 20610732
Perez MA Magtanong L Dixon SJ Watts JL 2020 Dietary Lipids Induce Ferroptosis in Caenorhabditis elegans and Human Cancer Cells Developmental Cell 54 447 454 10.1016/j.devcel.2020.06.019 32652074
Pérez-Pérez R Lobo-Jarne T Milenkovic D Mourier A Bratic A García-Bartolomé A Fernández-Vizarra E Cadenas S Delmiro A García-Consuegra I Arenas J Martín MA Larsson NG Ugalde C 2016 COX7A2L Is a Mitochondrial Complex III Binding Protein that Stabilizes the III2+IV Supercomplex without Affecting Respirasome Formation Cell Reports 16 2387 2398 10.1016/j.celrep.2016.07.081 27545886
Pesta D Gnaiger E 2012 High-resolution respirometry: OXPHOS protocols for human cells and permeabilized fibers from small biopsies of human muscle Methods in Molecular Biology 810 25 58 10.1007/978-1-61779-382-0_3 22057559
Rajender S Rahul P Mahdi AA 2010 Mitochondria, spermatogenesis and male infertility Mitochondrion 10 419 428 10.1016/j.mito.2010.05.015 20595008
Rodríguez-Aguilera J Cortés A Fernández-Ayala D Navas P 2017 Biochemical Assessment of Coenzyme Q10 Deficiency Journal of Clinical Medicine 6 27 10.3390/jcm6030027 28273876
Saita S Nolte H Fiedler KU Kashkar H Venne AS Zahedi RP Krüger M Langer T 2017 PARL mediates Smac proteolytic maturation in mitochondria to promote apoptosis Nature Cell Biology 19 318 328 10.1038/ncb3488 28288130
Santoro MM 2020 The Antioxidant Role of Non-mitochondrial CoQ10: Mystery Solved! Cell Metabolism 31 13 15 10.1016/j.cmet.2019.12.007 31951565
Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ Hartenstein V Eliceiri K Tomancak P Cardona A 2012 Fiji: an open-source platform for biological-image analysis Nature Methods 9 676 682 10.1038/nmeth.2019 22743772
Schroeder AB Dobson ETA Rueden CT Tomancak P Jug F Eliceiri KW 2021 The ImageJ ecosystem: Open-source software for image visualization, processing, and analysis Protein Science 30 234 249 10.1002/pro.3993 33166005
Seibt TM Proneth B Conrad M 2019 Role of GPX4 in ferroptosis and its pharmacological implication Free Radical Biology & Medicine 133 144 152 10.1016/j.freeradbiomed.2018.09.014 30219704
Seiler A Schneider M Förster H Roth S Wirth EK Culmsee C Plesnila N Kremmer E Rådmark O Wurst W Bornkamm GW Schweizer U Conrad M 2008 Glutathione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxygenase dependent- and AIF-mediated cell death Cell Metabolism 8 237 248 10.1016/j.cmet.2008.07.005 18762024
Sekine S Kanamaru Y Koike M Nishihara A Okada M Kinoshita H Kamiyama M Maruyama J Uchiyama Y Ishihara N Takeda K Ichijo H 2012 Rhomboid protease PARL mediates the mitochondrial membrane potential loss-induced cleavage of PGAM5 The Journal of Biological Chemistry 287 34635 34645 10.1074/jbc.M112.357509 22915595
Shi G Lee JR Grimes DA Racacho L Ye D Yang H Ross OA Farrer M McQuibban GA Bulman DE 2011 Functional alteration of PARL contributes to mitochondrial dysregulation in Parkinson’s disease Human Molecular Genetics 20 1966 1974 10.1093/hmg/ddr077 21355049
Shimada K Skouta R Kaplan A Yang WS Hayano M Dixon SJ Brown LM Valenzuela CA Wolpaw AJ Stockwell BR 2016 Global survey of cell death mechanisms reveals metabolic regulation of ferroptosis Nature Chemical Biology 12 497 503 10.1038/nchembio.2079 27159577
Sims NR Anderson MF 2008 Isolation of mitochondria from rat brain using Percoll density gradient centrifugation Nature Protocols 3 1228 1239 10.1038/nprot.2008.105 18600228
Spinazzi M De Strooper B 2016 PARL: The mitochondrial rhomboid protease Seminars in Cell & Developmental Biology 60 19 28 10.1016/j.semcdb.2016.07.034 27502471
Spinazzi M Radaelli E Horré K Arranz AM Gounko NV Agostinis P Maia TM Impens F Morais VA Lopez-Lluch G Serneels L Navas P De Strooper B 2019 PARL deficiency in mouse causes Complex III defects, coenzyme Q depletion, and Leigh-like syndrome PNAS 116 277 286 10.1073/pnas.1811938116 30578322
Stefely JA Pagliarini DJ 2017 Biochemistry of mitochondrial coenzyme q biosynthesis Trends in Biochemical Sciences 42 824 843 10.1016/j.tibs.2017.06.008 28927698
Stockwell BR Friedmann Angeli JP Bayir H Bush AI Conrad M Dixon SJ Fulda S Gascón S Hatzios SK Kagan VE Noel K Jiang X Linkermann A Murphy ME Overholtzer M Oyagi A Pagnussat GC Park J Ran Q Rosenfeld CS Salnikow K Tang D Torti FM Torti SV Toyokuni S Woerpel KA Zhang DD 2017 Ferroptosis: a regulated cell death nexus linking metabolism, redox biology, and disease Cell 171 273 285 10.1016/j.cell.2017.09.021 28985560
Stockwell BR 2022 Ferroptosis turns 10: emerging mechanisms, physiological functions, and therapeutic applications Cell 185 2401 2421 10.1016/j.cell.2022.06.003 35803244
Suomalainen A Battersby BJ 2018 Mitochondrial diseases: the contribution of organelle stress responses to pathology Nature Reviews. Molecular Cell Biology 19 77 92 10.1038/nrm.2017.66 28792006
Tan Q Fang Y Gu Q 2021 Mechanisms of modulation of ferroptosis and its role in central nervous system diseases Frontiers in Pharmacology 12 657033 10.3389/fphar.2021.657033 34149412
Tarrant JC Binder ZA Bugatti M Vermi W van den Oord J Ranieri B Assenmacher C-A Hoepp N O’Rourke DM Shan X Danet-Desnoyers G Radaelli E 2021 Pathology of macrophage activation syndrome in humanized NSGS mice Research in Veterinary Science 134 137 146 10.1016/j.rvsc.2020.12.003 33383491
To T-L Cuadros AM Shah H Hung WHW Li Y Kim SH Rubin DHF Boe RH Rath S Eaton JK Piccioni F Goodale A Kalani Z Doench JG Root DE Schreiber SL Vafai SB Mootha VK 2019 A compendium of genetic modifiers of mitochondrial dysfunction reveals intra-organelle buffering Cell 179 1222 1238 10.1016/j.cell.2019.10.032 31730859
Trifunovic A Wredenberg A Falkenberg M Spelbrink JN Rovio AT Bruder CE Bohlooly-Y M Gidlöf S Oldfors A Wibom R Törnell J Jacobs HT Larsson N-G 2004 Premature ageing in mice expressing defective mitochondrial DNA polymerase Nature 429 417 423 10.1038/nature02517 15164064
Valente EM Abou-Sleiman PM Caputo V Muqit MMK Harvey K Gispert S Ali Z Del Turco D Bentivoglio AR Healy DG Albanese A Nussbaum R González-Maldonado R Deller T Salvi S Cortelli P Gilks WP Latchman DS Harvey RJ Dallapiccola B Auburger G Wood NW 2004 Hereditary early-onset Parkinson’s disease caused by mutations in PINK1 Science 304 1158 1160 10.1126/science.1096284 15087508
Varuzhanyan G Rojansky R Sweredoski MJ Graham RLJ Hess S Ladinsky MS Chan DC 2019 Mitochondrial fusion is required for spermatogonial differentiation and meiosis eLife 8 e51601 10.7554/eLife.51601 31596236
Varuzhanyan G Chan DC 2020 Mitochondrial dynamics during spermatogenesis Journal of Cell Science 133 jcs235937 10.1242/jcs.235937 32675215
Varuzhanyan G Ladinsky MS Yamashita S-I Abe M Sakimura K Kanki T Chan DC 2021 Fis1 ablation in the male germline disrupts mitochondrial morphology and mitophagy, and arrests spermatid maturation Development 148 dev199686 10.1242/dev.199686 34355730
Wang Y Hekimi S 2019 The complexity of making ubiquinone Trends in Endocrinology and Metabolism 30 929 943 10.1016/j.tem.2019.08.009 31601461
Wang X Yin L Wen Y Yuan S 2022 Mitochondrial regulation during male germ cell development Cellular and Molecular Life Sciences 79 91 10.1007/s00018-022-04134-3 35072818
Wortmann M Schneider M Pircher J Hellfritsch J Aichler M Vegi N Kölle P Kuhlencordt P Walch A Pohl U Bornkamm GW Conrad M Beck H 2013 Combined deficiency in glutathione peroxidase 4 and vitamin E causes multiorgan thrombus formation and early death in mice Circulation Research 113 408 417 10.1161/CIRCRESAHA.113.279984 23770613
Wu Z Geng Y Lu X Shi Y Wu G Zhang M Shan B Pan H Yuan J 2019 Chaperone-mediated autophagy is involved in the execution of ferroptosis PNAS 116 2996 3005 10.1073/pnas.1819728116 30718432
Yan C Gong L Chen L Xu M Abou-Hamdan H Tang M Désaubry L Song Z 2020 PHB2 (prohibitin 2) promotes PINK1-PRKN/Parkin-dependent mitophagy by the PARL-PGAM5-PINK1 axis Autophagy 16 419 434 10.1080/15548627.2019.1628520 31177901
Yang F Wang PJ 2009 The mammalian synaptonemal complex: a scaffold and beyond Genome Dynamics 5 69 80 10.1159/000166620 18948708
Yant LJ Ran Q Rao L Van Remmen H Shibatani T Belter JG Motta L Richardson A Prolla TA 2003 The selenoprotein GPX4 is essential for mouse development and protects from radiation and oxidative damage insults Free Radical Biology & Medicine 34 496 502 10.1016/s0891-5849(02)01360-6 12566075
Zheng J Conrad M 2020 The metabolic underpinnings of ferroptosis Cell Metabolism 32 920 937 10.1016/j.cmet.2020.10.011 33217331
