
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0310138
PONE-D-24-00127
Research Article
Biology and Life Sciences
Anatomy
Musculoskeletal System
Muscles
Skeletal Muscles
Medicine and Health Sciences
Anatomy
Musculoskeletal System
Muscles
Skeletal Muscles
Medicine and Health Sciences
Public and Occupational Health
Physical Activity
Physical Fitness
Exercise
Medicine and Health Sciences
Sports and Exercise Medicine
Exercise
Biology and Life Sciences
Sports Science
Sports and Exercise Medicine
Exercise
Biology and Life Sciences
Physiology
Biological Locomotion
Swimming
Physical Sciences
Chemistry
Chemical Compounds
Organic Compounds
Carbohydrates
Monosaccharides
Glucose
Physical Sciences
Chemistry
Organic Chemistry
Organic Compounds
Carbohydrates
Monosaccharides
Glucose
Biology and Life Sciences
Biochemistry
Antioxidants
Biology and Life Sciences
Cell Biology
Oxidative Stress
Biology and Life Sciences
Biochemistry
Proteins
Muscle Proteins
Research and Analysis Methods
Chemical Synthesis
Biosynthetic Techniques
Protein Synthesis
Muscle Protein Synthesis
Biology and Life Sciences
Biochemistry
Proteins
Protein Synthesis
Muscle Protein Synthesis
Phycocyanin attenuates skeletal muscle damage and fatigue via modulation of Nrf2 and IRS-1/AKT/mTOR pathway in exercise-induced oxidative stress in rats
Phycocyanin protect against prolonged exercise
Puengpan Sayomphu Data curation Formal analysis Methodology Writing – original draft Writing – review & editing 1
Phetrungnapha Amnat Conceptualization Funding acquisition Resources Supervision 2
Sattayakawee Sarawut Conceptualization Funding acquisition Resources 3
https://orcid.org/0000-0002-5614-1908
Tunsophon Sakara Conceptualization Data curation Funding acquisition Methodology Supervision Writing – original draft Writing – review & editing 1 4 *
1 Department of Physiology, Faculty of Medical Science, Naresuan University, Phitsanulok, Thailand
2 Department of Biochemistry, Faculty of Medical Science, Naresuan University, Phitsanulok, Thailand
3 Thailand Science Research and Innovation (TSRI), Bangkok, Thailand
4 Center of Excellence for Innovation in Chemistry, Naresuan University, Phitsanulok, Thailand
Hitachi Keisuke Editor
Fujita Health University, JAPAN
Competing Interests: The authors have declared that no competing interests exist.

* E-mail: sakarat@nu.ac.th
10 9 2024
2024
19 9 e03101382 1 2024
24 8 2024
© 2024 Puengpan et al
2024
Puengpan et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Prolonged strenuous exercise induces oxidative stress, leading to oxidative damage, skeletal muscle fatigue, and reduced exercise performance. The body compensates for oxidative stress through antioxidant actions, while related enzymes alone may not overcome excessive oxidative stress during prolonged strenuous exercise. Phycocyanin is an important antioxidant supplement derived from blue-green algae, which may be helpful in this type of situation. This study determined the effects of phycocyanin on exercise performance from prolonged strenuous exercise. Forty Sprague Dawley male rats were divided into 5 groups (n = 8 /group); Control group (C), Exercise group (E), and Exercise with supplement groups receiving low dose (Phycocyanin = 100 mg/kg BW; ELP) and high dose (Phycocyanin = 200 mg/kg BW; EHP) or vitamin C (Vitamin C = 200 mg/kg BW; VC). Phycocyanin was found to decrease oxidative damage markers, muscle fatigue, and muscle atrophy through the activated AKT/mTOR pathway. This was also found to have greater increases in antioxidants via Nrf2 signaling and increases ATP synthesis, GLUT4 transporters, and insulin signaling due to increased IRS-1/AKT signaling. In conclusion, phycocyanin was found to reduce oxidative damage and muscle atrophy, including an increase in insulin signaling in skeletal muscles leading to increased exercise performance in rats.

http://dx.doi.org/10.13039/501100014729 Biodiversity-Based Economy Development Office 26/2561 Sattayakawee Sarawut http://dx.doi.org/10.13039/501100004704 National Research Council of Thailand 129/2563 https://orcid.org/0000-0002-5614-1908
Tunsophon Sakara Global and Frontier Research University Fund, Naresuan University R2567C003 https://orcid.org/0000-0002-5614-1908
Tunsophon Sakara A.P., and S.S.: Grant number 26/2561 from the Biodiversity-Based Economy Development Office (BEDO) https://www.bedo.or.th/ S.T., A.P. and S.S.: Grant number 129/2563 from the National Research Council of Thailand (NRCT) https://www.nrct.go.th/ S.T.: Grant number R2567C003, supported in part by Global and Frontier Research University Fund, Naresuan University, Thailand S.P.: Supported in part by the Center of Excellence for Innovation in Chemistry (PERCH-CIC), Ministry of Higher Education, Science, Research and Innovation, Thailand The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are within the manuscript and its Supporting Information files.
Data Availability

All relevant data are within the manuscript and its Supporting Information files.
==== Body
pmcIntroduction

Regular exercise has a positive effect on the body. Many health studies show that exercise improves the cardiovascular system, prevents type 2 diabetes, mitigates cancer, reduces the effects of aging, and counteracts more than 40 diseases [1, 2]. Despite exercise having a positive effect on the body, prolonged high-intensity, and strenuous exercise, can also have a negative effect. Several studies have focused on the fact that excessive exercise induces oxidative stress, which creates negative effects on the skeletal muscles after 45 ± 5 min of swimming exercise to exhaustion in guinea pigs, or acute forced swimming exercise for 20 min, which resulted in oxidative stress in the skeletal muscles, lungs, and other organs [3, 4]. Studies have also shown that reactive oxygen species (ROS) increase significantly with intense exercise, which causes oxidative damage to the body [5].

Prolonged high-intensity and strenuous exercise can induce muscle damage because the mechanical stress experienced during exercise produces a sustained increase in ROS that activates proinflammatory cytokines, causing inflammation in the skeletal muscles which then leads to further increased ROS [1, 2]. Exercise activates nuclear factor erythroid 2-related factor 2 (Nrf2) [3], a protein that regulates antioxidant genes (Superoxide dismutase 1 (SOD1), Glutathione peroxidase 1 (GPx1)), which helps to reduce ROS. However, in the case of prolonged vigorous exercise, the increased antioxidant activity could not overcome the dramatic increase in ROS that occurs in conjunction with the increased inflammation. This puts cells in a state of oxidative stress and leads to protein and DNA damage in skeletal muscles [2, 4]. Oxidative stress also causes abnormalities in skeletal muscle contraction in the myofilament segment, leading to decreased skeletal muscle contraction force and induced skeletal muscle atrophy. This process is mediated through the decreasing of the protein kinase B (AKT) signaling pathway which leads to increased protein degradation through the atrogin-related transcription factors-1 (Atrogin-1) and the muscle RING-finger protein 1 (MuRF-1) genes and inhibits skeletal muscle protein synthesis through the AKT/the mammalian target of rapamycin (mTOR) pathway, resulting in loss of muscle mass [5–7]. Muscle mass loss from prolonged high-intensity and strenuous exercise leads to increased muscle fatigue with a clear effect on reduced exercise performance [8].

In addition to these factors, other factors are affected by oxidative stress from prolonged high-intensity and strenuous exercise which also affects the skeletal muscles with exercise-related muscle injuries being common. In the normal state, the body can regenerate itself but in oxidative stress, ROS destroys tissues and causes mitochondria dysfunction, resulting in increased leakage of lactate dehydrogenase (LDH) and creatine kinase (CK). These destructive outcomes of ROS result in chronic muscle injury and diminish the body’s ability to regenerate itself, which is one factor that reduces exercise performance [9, 10]. Exercise stimulates glucose uptake to muscle cells and glycogen storage in skeletal muscles is important for energy expenditure of the muscle. Oxidative stress also causes decreased insulin sensitivity through the interruption of the insulin receptor substrate-1 (IRS-1)/AKT pathway leading to decreased glucose transporter type 4 (GLUT4) translocation causing decreased glucose uptake in skeletal muscle [11]. The oxidative stress from prolonged high-intensity and strenuous exercise may result in reduced glucose uptake to the skeletal muscles which results in a decrease in contractile capacity due to decreased ATP production and correspondingly decreased exercise performance [12].

Phycocyanin is a natural food with blue pigment protein in Cyanobacteria, Rhodophyceae, and Cryptophyceae. While being non-toxic to normal cells, it has the potential to treat oxidative stress, with antioxidant and anti-inflammatory effects [13, 14]. Dietary supplementation with Galdieria sulphuraria (Rhodophyta) has been reported to reduce exercise-induced oxidative stress and mitochondrial dysfunction. Supplementation with Galdieria sulphuraria, which contains the macronutrients glutathione and phycocyanin, helps protect tissue from oxidative damage caused by acute exercise [15, 16]. Gloiopeltis furcata (Rhodophyta) contains chlorophyll-a, phycoerythrin, phycocyanin, lutein, α-carotene, β-carotene as macronutrients, which have been reported to alleviate exercise fatigue, increase energy, and increase the efficiency of swimming exercise [16].

However, there has been little research on phycocyanin to prevent exercise-induced skeletal muscle damage. Therefore, the purpose of this research was to examine the effects of phycocyanin on antioxidant activity, anti-fatigue, muscle atrophy, and its underlying mechanisms on exercise performance.

Materials and methods

Materials and chemicals

Phycocyanin was purchased from Xi’an Day Natural Inc. (Xi’an, Shaanxi, China). Vitamin C (L-Ascorbic acid, 99%) was purchased from Thermo Scientific Chemicals (Waltham, MA, U.S.). The glucose, LDH, and CK assay kits were purchased from Sigma-Aldrich (St. Louis, MO, USA). The assay kits for insulin, interleukin-6 (IL-6), and tumor necrosis factor alpha (TNF-α) were from EMD Millipore (Burlington, MA, USA). The chemicals for oxidative status assays were pyrogallol, glutathione, and 2-thiobarbituric acid (TBA) (Sigma-Aldrich, MO, USA), hydrogen-peroxide (Merck, MA, USA), hydrochloric acid (HCl) (RCI Labscan Ltd., Bangkok, Thailand), and trichloroacetic acid (TCA) (AppliChem GmbH, Darmstadt, Germany). The chemicals used for real-time PCR were TRI-REAGENT (Molecular Research Centre, OH, USA), reverse transcribed (RT) master mix with gDNA remover, and THUNDERBIRD™ next SYBR qPCR mix (Toyobo, Osaka, Japan). The materials and chemicals used for the western blot were RIPA lysis buffer, protease phosphatase inhibitor cocktail (Sigma-Aldrich, MO, USA), and polyvinylidene fluoride (PVDF) membrane (Merck, MA, USA). The antibodies used for Western Blot analysis were Nrf2 (Affinity Biosciences, USA), IRS-1 (Elabscience Biotechnology Co., Ltd, TX, USA), AKT (Cell Signaling, MA, USA), Phospho-AKT at Ser473 (Cell Signaling, MA, USA) and β-actin (Elabscience, TX, USA).

Phycocyanin

The phycocyanin content was measured by the spectroscopic technique [17] as having a purity equal to 1.9 and 25% yield.

Animal model

The animal protocols were approved by the Institutional Animal Care Committee of Naresuan University, Phitsanulok, Thailand, Ethic number: NU-AE 630605. Male Sprague Dawley rats (4–6-week-old, weighing 160–220 g) were obtained from Nomura Siam International Co., Ltd., Bangkok, Thailand, and were brought to the Center for Animal Research at Naresuan University. The rats were divided into two groups: a non-exercise group (Control or C, n = 8) and 4 exercise groups. The rats in the exercise groups were trained for swimming for one week before the experiment began and were then further divided randomly into 4 groups as follows: E Group: exercise group with no special treatment (n = 8), ELP Group: exercise + a low dose of phycocyanin 100 mg/kg BW (n = 8), EHP Group: exercise + a high dose of phycocyanin 200 mg/kg BW (n = 8), and VC Group: the positive control exercise group (Vitamin C 200 mg/kg BW, n = 8).

Phycocyanin and vitamin C were dissolved in tap water to make 1 mL of supplement that was given to the rats in daily doses of either 100 mg or 200 mg/kg BW, fed to the various groups, ELP, EHP, and VC Groups, as indicated above. The C and E Groups were treated with the same daily volume of ordinary tap water. On the eighth week, the rats were intraperitoneal injected with thiopental sodium (50 mg/kg BW, i.p.) to anesthetize. Blood was collected from the heart, and the skeletal muscles were collected immediately for muscle tension determination and muscle glucose uptake. Blood and skeletal muscle samples were kept at -80°C until required for measurement of skeletal muscle injury and inflammation, oxidative and antioxidant status, gene and protein expressions. H&E staining was used to study the alteration of skeletal muscle the alteration of skeletal muscle structure.

Swimming training

The exercise groups (E, ELP, EHP, VC) swam in a pool (0.50 m x 0.50 m x 0.90 m) with 30 ± 5°C water for 5 days per week for 8 weeks. In week 1 the exercising rats spent 30 min swimming per day and in week 2, they spent 40 min swimming per day. The exercise period extended to 60 min of swimming per day in weeks 3–5, and in weeks 6–8, they spent 75 min per day swimming. The animals were released to swim freely without interference. After the time had passed, the rats were scrupulously dried and returned to the housing box [18–21]. This model is described as prolonged excessive exercise according to previous studies [21, 22].

Forced swim test (FST)

The forced swimming test (FST) for all animal groups was carried out with a weight weighing 3% of the body weight of each animal attached to the tail of the animal, which was swimming in a 45 cm x 45 cm x 45 cm pool with a height of 35 cm and a water temperature of 25°C. The animals were then timed for fatigue swimming above the water level and stopped when the animals were immobile, or the rat’s nose was underwater for 5 s [23, 24]. The swimming tests were conducted at weeks 0, 2, 4, 6, and 8.

Isolated muscle tension determination

To determine muscle contraction efficiency, the soleus muscle was used as described earlier [25, 26]. Briefly, the isolated soleus muscle (100–150 mg) was immersed in the Krebs- Ca2+ free (KCF) buffer aerates in 95% O2 and 5% CO2. The soleus muscle was then attached to the impulse transducer and electrically stimulated, and the stimulation frequency was increased. The values obtained from a computer connected to the power lab and calculated for which force tension using the following muscle force (N/cm2) = (force (g) x muscle length (cm) x 1.06) / (muscle weight (g) x 0.00981).

Skeletal muscle energy and insulin level

To determine muscle uptake of glucose, the quadriceps muscle was isolated (100–150 mg) and immersed in Krebs-Ringer bicarbonate (KRB) buffer [27]. The muscle samples were then incubated and aerated in 95% O2 and 5% CO2 at 37°C in a KRB solution containing glucose for 5 min, then incubated for 30 min at 37°C in an insulin (50 IU/mL) and non-insulin-containing water bath. The samples were then tested with a GO assay to determine the residual glucose concentration. Glucose was expressed as mmol/dL/g muscle.

A 150 mg of the quadriceps muscle was incubated at 70°C for 30 min in 30% KOH, added 95% EtOH for 20 min on ice, and then centrifuged at 18,000 rpm for 15 min. Remove the supernatant then add D.W., 5% phenol, and 95% sulfuric acid mix. Quantification of muscle glycogen was then tested with a GO assay to determine glycogen content expressed as mg/150 mg muscle.

The fasting serum glucose and insulin levels were determined for testing glucose uptake and insulin activity in skeletal muscle. The fasting serum glucose was determined from a GO assay expressed as mg/dL, and the fasting serum insulin was determined from an ELISA kit expressed as ng/ml. Insulin sensitivity was determined with the Quantitative Insulin Sensitivity Index (QUICKI), calculated as QUICKI = 1/[(Fasting insulin (μU/ml)) + (Fasting glucose (mg/dL)] [28].

Skeletal muscle damage and inflammation determination by ELISA

The levels of LDH, and CK are biomarkers of muscle injury. LDH and CK were determined following the manufacturer’s guidelines for using the LDH and CK commercial assay kits. The levels of LDH and CK are expressed as units/L in serum and units/mg protein in the quadriceps muscle.

The levels of inflammatory cytokines; IL-6 and TNF-α in the quadriceps muscle were determined following the manufacturer’s guidelines. IL-6 and TNF-α levels are expressed as pg/mg protein.

Oxidative stress determination

Antioxidant enzyme activity

Superoxide dismutase (SOD) activity was measured by inhibiting pyrogallol, which has autoxidation properties, and measured for kinetic assay every 30 s for 3 min at 420 nm by spectrophotometry. Catalase (CAT) activity was measured by a 30% change H2O2 to 2H2O + O2, kinetic assay every 30 s for 5 min at 240 nm by spectrophotometer. Glutathione peroxidase (GPx) activity was measured by the reduction of GSH which has an absorbance of 412 nm. SOD and CAT activities were expressed as U/mL in serum and U/mg protein in tissue, the GPx activity was expressed as mU/mL in serum and mU/mg protein in the quadriceps muscle.

Lipid peroxidation

Lipid peroxidation was measured by the 2-thiobarbituric substrate reacting with the amount of malondialdehyde (MDA) in serum and the quadriceps muscle. The mixtures of 0.37% TBA, 0.25M HCL, and 15% TCA were mixed in a 1:1:1 ratio, then incubated at 95°C for 15 min, then placed on ice for 1 min to stop the reaction. The OD was read at 535 nm.

Real-time PCR

TRI-REAGENT was used to extract RNA from the quadriceps muscle. The RNA concentration at the A260/A280 ratio was determined by NanoDrop One Spectrophotometers (Nanodrop Technologies), RT Master Mix with gDNA Remover was used to reverse transcribed RNA to cDNA at 1000 μg concentration according to the manufacturer’s protocol, THUNDERBIRD™ Next SYBR qPCR Mix was used for real-time PCR. The RT-PCR conditions were incubated at 95°C for 5 min and then 40 cycles at 94°C for 30 s, with an annealing temperature of primer for 30 s, and 72°C for 30 s.

The primer sequence and annealing temperature were as follows: SOD1 F: GCAGAAGGCAAGCGGTGAAC, R: TAGCAGGACAGCAGATGAGT, 58°C; GPx1 F: CTCTCCGCGGTGGCACAGT, R: CCACCACCGGGTCGGACATAC, 62°C; mTOR F: CAGGACGAGCGAGTGAT, R: CGAGTTGGTGGACAGAGG, 58°C; Atrogin-1 F: AGACCGGCTACTGTGGAAGAG, R: CCGTGCATGGATCAGTG, 60°C; MuRF-1 F: ACAACCTCTGCCGGAAGTGT, R: CCGCGGTTGGTCCAGTAG, 55°C; SLC2A4 F: GCTTCTGTTGCCCTTCTGTC, R: TGGACGCTCTCTTTCCAACT, 60°C; ATP5B F: GCACCGTCAGAACTATTGCT, R: GAATTCAGGAGCCTCAGCAT, 60°C; GAPDH F: TGCACCACCAACTGCTTA, R: GGATGCAGGGATGATGTTC, 60°C. The relative mRNA expression was calculated through the 2-ΔΔCt equation with GAPDH [29].

Western blot analysis

The extracted protein of the individual quadriceps muscle (n = 3) was mixed into a RIPA lysis buffer and protease phosphatase inhibitor cocktail which was then homogenized and centrifuged to collect the muscle protein supernatants, 80 μg of which was loaded in sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a PVDF membrane. The PVDF was blocked for nonspecific protein with 5% skimmed milk for 2 hr. to remove the skimmed milk. Primary antibodies of Nrf2, IRS-1, AKT, Phospho-AKT at Ser473, and β-actin were added to the PVDF which was then incubated at 4°C overnight. Secondary antibodies were added to the PVDF which was incubated for 2 hr. Subsequently, the proteins were detected by Amersham TM Image Quant 800 (Cytiva, MA, USA), and analyzed with Image Lab Software 6.0.1 (Bio-rad, USA).

Histological analysis of skeletal muscle

Quadriceps muscle tissues were embedded into a paraffin box using standard protocols. Then 5 μm cross-sections of the tissues were cut and stained with H&E staining. The cross-sectional area and diameter were visualized using a 20X power lens of a light microscope and calculated by ImageJ analysis software (US National Institutes of Health).

Statistical analysis

All data results were expressed as mean ± standard error of the mean (SEM). The statistical analysis was a One-Way Analysis of Variance (ANOVA) followed by Tukey’s multiple comparison test using GraphPad Prism 5 (GraphPad Software, Inc.). Statistical significance was considered at p < 0.05, p < 0.01 and p < 0.001.

Results

Muscle contraction and exercise endurance

In the FST test, which is a test of muscle endurance in exercise, it was observed that the swimming time began to extend in week 2 in the E, EHP, ELP, and VC groups which were able to swim for longer periods than the C group. The EHP group had a significant increase in swimming time from weeks 2–8, a time that was longer than achieved by the E group. In addition, the EHP, ELP, and VC showed less fatigue and demonstrated a significant difference in swimming time, which was also longer than the E group swimming time (Fig 1).

10.1371/journal.pone.0310138.g001 Fig 1 Forced swim test (FST).

Swimming duration change in comparison between the C group, E group, and supplement groups to examine muscular endurance in exercise. Histograms represent mean ± S.E.M. (n = 6–8). aap<0.01, aaap<0.001 versus C group; bbbp<0.001 versus E group; ccp<0.01, cccp<0.001 versus ELP group; dddp<0.001 versus EHP group.

In the muscle force tension test, the E and ELP groups’ muscle force tension significantly decreased than the C and VC groups, but non-significant changes were found in the EHP group on 10 Hz (Fig 2B). The muscle force tension in the ELP group decreased significantly more than the C and VC groups on 20 Hz and 30 Hz (Fig 2C and 2D). Therefore, it can be concluded that phycocyanin while exercising can help to increase exercise endurance but does not affect the force of muscle tension.

10.1371/journal.pone.0310138.g002 Fig 2 Muscle force tension.

Muscle force tension analysis at the specified frequency during electrical stimulation of 10 s duration, a 20 s rest period was used. Line graphs represent all frequency and muscle tension (Mean ± S.E.M.) (a). Histograms represent some frequencies; 10 Hz (b), 20 Hz (c), 30 Hz (c) (Mean ± S.E.M., n = 3–7). ap<0.05, aap<0.01 versus C group; bp<0.05 versus E group, ccp<0.01, cccp<0.001 versus ELP group.

Skeletal muscle injury and inflammation

Indicators of skeletal muscle injury were determined in both serum and skeletal muscle and showed increased LDH and CK levels in the E group more significantly than in the C EHP, ELP, and VC groups. In the same way, the biomarker of inflammation in skeletal muscle showed increased TNF-α and IL6 levels in the E group more significantly than in the C, EHP, ELP, and VC groups and the VC group showed an increased TNF-α levels more significantly than those experienced in the C group (Table 1).

10.1371/journal.pone.0310138.t001 Table 1 Parameters of body weight, muscle weight and biochemical markers for muscle injury and inflammation.

Parameters	Groups	
C	E	ELP	EHP	VC	
Body weight (g)	575.70±17.17	543.80±13.18	520.00±7.87a	483.30±8.67aa	560.40±9.20d	
Quadriceps muscle weight (g)	4.00±0.11	4.17±0.13	3.77±0.13	3.28±0.32 a, bb	3.75±0.11	
Quadriceps muscle mass index (mg/g)	6.91±0.22	7.67±0.26	7.25±0.24	6.49±0.49	6.70±0.20	
Soleus muscle (g)	0.223±0.00	0.237±0.04	0.200±0.01	0.195±0.01	0.2043±0.01	
Soleus muscle mass index (mg/g)	0.375±0.01	0.428±0.08	0.436±0.04	0.418±0.02	0.399±0.02	
Muscle	
LDH (mU/mg protein)	761.80±169.70	1529.00±96.41aaa	789.80±80.11bbb	879.20±97.64bb	551.60±106.40bbb	
CK (U/mg protein)	13.50±1.28	26.74±1.78aaa	15.86±2.34bb	13.80±3.10bb	17.43±0.73b	
IL-6 (pg/mL/mg protein)	2024.00±1035.00	16230.00±3321.00aaa	6180.00±746.00bb	4666.00±2136.00bb	1587.00±518.00bb	
TNF-α (pg/mL/mg protein)	24.40±5.85	209.00±29.04aaa	33.87±12.65bbb	52.57±12.76bbb	104.90±26.26a, bb	
Serum	
LDH (mU/mL)	354.10±91.11	925.40±105.6aaa	277.40±61.51bbb	344.40±60.38bbb	418.80±17.95bbb	
CK (U/L)	81.61±9.62	164.30±17.43aaa	49.20±10.87bbb	38.16±9.34bbb	74.61±6.65bbb	
Data represents mean ± SEM (n = 5–8) and statistically determined by one-way ANOVA (Tukey’s).

ap<0.05

aap<0.01

aaap<0.001 versus C group

bp<0.05

bbp<0.01

bbbp<0.001 versus E group

dp<0.05 versus EHP group.

Skeletal muscle energy

In order to determine muscle energy expenditure, fasting glucose, and insulin were determined. The results showed decreased levels of both fasting serum glucose and fasting serum insulin in the EHP, ELP, and VC groups. This decrease was more significant than in the C and E groups (Fig 3A and 3B). These results show that insulin sensitivity increased in the ELP, EHP, and VC groups than in the C and E groups (Fig 3C) and the experimental results are consistent with the skeletal muscle glucose uptake test showing an increase in glucose uptake activity with insulin in the EHP, ELP, and VC groups. This increase was more significant than in the C and E groups (Fig 3D). Similarly, the glycogen content in the C and E groups decreased and the decrease was more significant than that experienced in the EHP, ELP, and VC groups (Fig 3E), while the glucose uptake activity without insulin was not significantly different in all groups (Fig 3D). In summary, EHP, ELP, and VC showed increased glucose uptake and glucose storage in the form of glycogen for reserve energy in skeletal muscle.

10.1371/journal.pone.0310138.g003 Fig 3 Muscle glucose uptake and glycogen content.

Fasting serum glucose levels (a), Fasting serum insulin levels (b), Insulin sensitivity (c), Glucose uptake without insulin and with insulin in skeletal muscle (d), Skeletal muscle glycogen content (e), change in comparison between C group, E group, and supplement groups to examine muscle glucose activity. Histograms represent mean ± S.E.M. (n = 6–8). ap<0.05, aap<0.01, aaap<0.001 versus C group; bp<0.05, bbp<0.01, bbbp<0.001 versus E group.

The experiment results showed that phycocyanin and vitamin C supplementation increased the uptake of glucose into the muscles, which modulate via the insulin signaling pathways. The predominant increased protein expressions of IRS-1 and pAKT/AKT were found in the ELP, EHP, and VC groups and considerably more than that found in the E group (Fig 4A and 4B). Moreover, the Solute Carrier Family 2 Member 4 (SLC2A4) gene showed the same effect in the E group, which showed a significant decrease than in the C, EHP, ELP, and VC groups (Fig 4C) meanwhile the mitochondrial ATP synthase F1 subunit beta (ATP5B) gene, which is regulated ATP synthesis, showed a greater decrease than in the other groups (Fig 4D). Therefore, it can be concluded that phycocyanin has the effect to increased insulin signaling pathway and ATP synthesis.

10.1371/journal.pone.0310138.g004 Fig 4 Protein and gene expression of muscle energy.

Western blot analysis of IRS-1 (a.) and pAKT/AKT (b.) in skeletal muscle. Real-Time PCR SLC2A4 gene (c.) and ATP5B gene in skeletal muscle (d.), change in comparison between the C group, E group and supplement groups to examine insulin signals and ATP synthesis. Histograms represent mean ± S.E.M. (n = 6–8). ap<0.05, aap<0.01, aaap<0.001 versus C group; bp<0.05, bbp<0.01, bbbp<0.001 versus E group.

Oxidative status and antioxidant activity

Oxidative status was measured by MDA as a biomarker of oxidative stress which increased significantly in the E group, and significantly more than the increase in the C EHP, ELP, and VC groups. Antioxidant activity tests in both serum and muscle showed the same effect. The EHP, ELP, and VC groups increased more significantly than the increase above the E and C groups (Table 2).

10.1371/journal.pone.0310138.t002 Table 2 The parameters of oxidative status and antioxidant enzymes in serum and muscle.

Parameters	Groups	
C	E	ELP	EHP	VC	
Muscle	
MDA (μM/mg protein)	0.22±0.04	0.67±0.07aaa	0.12±0.01bbb	0.12±0.04bbb	0.17±0.03bbb	
SOD (U/mg protein)	10.49±0.64	12.55±0.68	18.18±1.05aaa, bb	30.28±1.63aaa, bbb, ccc	27.29±0.96aaa, bbb, ccc	
CAT (U/mg protein)	1.03±0.08	1.49±0.19	3.22±0.28aaa, bbb	2.80±0.29aaa, bb	2.79±0.18aaa, bb	
GPx (mU/mg protein)	508.80±38.18	443.90±67.60	1378.00±199.10aa, bb	1170.00±239.90a, b	1478.00±136.80aa, bbb	
Serum	
MDA (μM)	1.49±0.19	4.22±0.78aa	1.15±0.30bb	1.07±0.240bbb	1.44±0.35bbb	
SOD (U/min)	124.10±11.22	115.90±7.77	189.30±8.89aaa, bbb	172.70±11.69a, bb	173.10±7.21a, bb	
CAT (U/min)	28.55±1.74	27.32±3.42	67.23±8.33a, b	64.09±10.93a, b	73.25±11.17aa, bb	
GPx (mU/mL)	1191.00±64.74	1292.00±102.10	2144.00±245.50aa, b	2093.00±150.50a	2529.00±105.60aaa, bb	
Data represents mean ± SEM (n = 6–8) and statistically determined by one-way ANOVA (Tukey’s)

ap<0.05

aap<0.01

aaap<0.001 versus C group

bp<0.05

bbp<0.01

bbbp<0.001 versus E group

cccp<0.001 versus ELP group.

The antioxidant activity was consistent with the expressions of Nrf2 by western blot analysis (Fig 5A), and expression of SOD1 and GPx1 genes tested by real-time PCR (Fig 5B and 5C), the EHP, ELP, and VC groups increased more significantly than the increase in the E and C groups. It is concluded that phycocyanin showed increased antioxidant activity and decreased oxidative stress.

10.1371/journal.pone.0310138.g005 Fig 5 Antioxidant protein and gene expressions.

Western blotting analysis of Nrf2 in skeletal muscle (a). Real-Time PCR SOD1 gene (b) and GPx1 gene in skeletal muscle (c), change in comparison between C group, E group, and supplement groups to examine antioxidant activity. Histograms represent mean ± S.E.M. (n = 6–8). aap<0.01, aaap<0.001 versus C group; bp<0.05, bbp<0.01, bbbp<0.001 versus E group.

Protein synthesis and protein degradation in skeletal muscle

A real-time PCR test showed that the expression of the mTOR gene in the E group decreased significantly more than was shown in the C, EHP, ELP, and VC groups (Fig 6A). It was also found that Atrogin-1 and MuRF-1 genes increased in the E group more significantly than the increase shown in the C, EHP, ELP, and VC groups (Fig 6B and 6C).

10.1371/journal.pone.0310138.g006 Fig 6 Gene expressions related to protein synthesis and degradation in muscle.

The relative expression of mTOR (a), Atrogin-1 (b), and MuRF-1 (c) are normalized to GAPDH. RT-PCR technique was used to examine gene expression related to protein synthesis and protein degradation in skeletal muscle. Histograms represent mean ± S.E.M. (n = 6–8). ap<0.05, aap<0.01, aaap<0.001 versus C group; bp<0.05, bbp<0.01, bbbp<0.001 versus E group.

Moreover, skeletal muscle histology from H&E staining in the E group showed a greater decrease in fiber cross-sectional area (CSA) and diameter than shown in all groups (Fig 7). This result can be concluded that phycocyanin showed the potential benefit of reducing muscle atrophy.

10.1371/journal.pone.0310138.g007 Fig 7 Histological change by Hematoxylin and eosin stain.

Representative images were taken at a 20x magnification (Scale bar = 100 μm) of cross sections (5 μm) with H&E staining (a), the bold arrow (➡) represents muscle fiber, the arrow (→) represents the nucleus, and the arrowhead (▲) represents perimysium, change in comparison between the C group, E group, and supplement groups to examine muscle fiber size (b), fiber diameter (c) and fiber number (d) in skeletal muscle. Histograms represent mean ± S.E.M. (n = 5). aaap<0.001 versus C group; bbbp<0.001 versus E group.

Discussion

Exercise is continuous movement or movement that directly affects the skeletal muscles. In high-intensity exercise, the higher energy demands require greater glucose absorbance from the bloodstream and the glycogen reserved in the skeletal muscles. This is essential to generate ATP in the mitochondria through the electron transport chain (ETC) process and also involves the release of ROS. High-intensity exercise that requires higher ATP leads to higher ROS which leads to oxidative stress. LDH and CK are cytoplasmic enzymes in skeletal and cardiac muscles. These enzymes are secreted through cell membranes that are damaged by lipid oxidation and, therefore commonly used as markers of tissue damage or injury [30, 31]. It has been reported that high-intensity exercise increased MDA levels in the specimen as a consequence of oxidative stress damage to the lipid bilayer of skeletal muscle cell membranes, resulting in the release of more CK and higher LDH levels. IL-6 and TNF-α are proinflammatory cytokines that are secreted when tissue infection, tissue injury, or oxidative stress occur, via nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling, which is a protein that regulates inflammation, immunity, and cell apoptosis in skeletal muscles. Strenuous exercise, high-intensity exercise, and resistance exercise release more IL-6 and TNF-α levels while high ROS was generated [32, 33]. Previous studies have shown that exercise-induced oxidative skeletal muscle damage can be treated with natural supplements. Spirulina supplementation for male rugby players during competitions over 7 weeks showed decreased levels of MDA which indicated a decrease in lipid peroxidation. Also, the decreased degree of CK and LDH indicated decreased muscle injury [34]. When rats were fed a diet that included Galdieria sulphuraria (Rhodophyta) for 10 days, then forced to swim for 6 hr. on the 10th day, and euthanized within 12 hr., they showed decreased oxidative damage in the liver, heart, and muscle [15]. Exercise to exhaustion, strenuous exercise, or chronic excessive exercise showed an increased secretion of IL-6 and TNF-α in serum [35, 36]. In our study, phycocyanin treatment reduced skeletal muscle injury and inflammation markers, demonstrating the ability of phycocyanin to repair skeletal muscle damage and inflammation which is in agreement with the prior research.

Excessive exercise or over-trained exercise was shown to be too high-intensity, or the recovery time allowed was too little, depending on the athlete’s physiology, type of exercise, and other factors. Excessive exercise has been shown to result in oxidative stress, muscle damage, reduced muscle glycogen reserves, and reduced ventilatory and cardiac efficiency [37]. In our study, the E group showed extreme increases in CK, LDH, IL-6, TNF- α, and MDA levels than the increases shown in the other groups. These parameters: CK, LDH, IL-6, TNF- α, and MDA levels, are indicators of muscle damage and oxidative stress caused by excessive exercise. Additionally, our swimming training protocol was similar to a previous report of the over-training study, which increased swimming time every week [20], and swimming time over 45 min/day [38] resulted in highly increased lipid peroxidation. The swimming exercise regimen in our study is therefore considered to be excessive exercise.

Exercise has been shown to increase insulin sensitivity, increase glucose uptake, and store glycogen for energy [39]. In contrast, strenuous exercise causes oxidative stress in skeletal muscles, leading to a disturbance in the insulin signaling pathway via decreased expression of IRS-1 protein, a key part of transmitted signals in IGF-1/PI3K/AKT pathways. It is responsible for the translocation of GLUT4 in skeletal muscle to uptake glucose from the blood circulatory system and enter muscle cells [40, 41]. In our current study, the IRS-1 expression of the protein was no different in the E and C groups, which is consistent with the previous research showing decreased or no difference in IRS-1 expression from the non-exercise [40, 42]. The ELP, EHP, and VC groups have been shown to increase IRS-1 expression greater than the E group. This is consistent with the reports that phycocyanin and vitamin C have the effect of increasing the Insulin-like growth factor 1 (IGF-1) [43, 44]. During exercise, glucose uptake in skeletal muscle is mediated by the activation of the IGF-1/IRS-1/AKT signaling pathway [45].

AKT is a key protein for major functions of glucose metabolism control, protein synthesis, and protein degradation in skeletal muscle. AKT phosphorylation via the IRS-1/PI3K signaling pathway leads to stimulating protein synthesis through the mTOR pathway, inhibiting protein degradation via the Forkhead Box O (FoxO) pathway, and translocation of GLUT4 in the skeletal muscles [46]. The previous study showed that excessive exercise-induced oxidative stress decreased phosphorylated AKT through decreased IRS-1 signaling [40, 41, 47], which is consistent with our study showed a decreased phosphorylated AKT expression in the E group compared with the other groups.

In addition, a previous study reported that the AKT activates GLUT4 translocation and increases GLUT4 synthesis by stimulating the expression of the SLC2A4 gene [48]. Our study showed a decreased SLC2A4 expression in the E group than other groups which is consistent with previous studies. However, phycocyanin and vitamin C showed an upregulated SLC2A4, resulting in increased glucose uptake and insulin sensitivity via the IRS-1/AKT pathway in skeletal muscle leading to increased glycogen content.

Exercise requires ATP for skeletal muscle contraction, using the glucose and glycogen in the skeletal muscles as a substrate. A previous study reported that excessive exercise causes mitochondrial dysfunction leading to decreased ATPase, ATP synthase, and ATP content due to ATP synthesis [49, 50]. Similarly, our study showed a decreased ATP5B which is responsible for ATP production in the E group than in the other groups, while phycocyanin and vitamin C supplements increase the synthesis of ATP.

Strenuous exercise has been shown to cause oxidative damage through the effects of progressively greater increases in ROS and decreased AKT activity, resulting in the activation of FoxO protein, an important regulator of Atrogin-1 and MuRF-1, which are genes related to increased protein degradation in skeletal muscle [51]. In addition, the 8 weeks of strenuous exercise reduced muscle protein synthesis, by inhibiting mTOR which is a gene associated with protein synthesis through the inhibition of AKT, a key protein that controls protein synthesis and degradation in muscle [52]. This leads to decreased protein synthesis in skeletal muscle and results in muscle atrophy [53]. Taken together from the above information, muscle atrophy coupled with high ATP expenditure, reduced glucose uptake, and decreased glycogen storage are the causes of muscle fatigue [54]. Our study shows that the EHP significantly decreased the quadriceps muscle weight and body weight compared to the C and E groups, while the EHP group was not significant in the quadriceps muscle mass index ratio compared to the other groups. The quadriceps muscle and body weight decrease in the EHP group may be due to another pathway on exercise combined with phycocyanin. Previous studies have shown that the effect of phycocyanin improves metabolism in diabetic rats [55] and decreases body weight in obese mice [56], and exercise increases metabolism, affecting decreased body weight and body composition [57]. This may be the reason for the decreased body weight and the quadriceps muscle weight in the EHP group. However, phycocyanin showed increased protein synthesis and decreased protein degradation, which has been shown to increase muscle fiber size and prevent muscle atrophy.

The muscle force tension relationship between ATP and Ca2+, in oxidative stress indicated that ROS inhibits ryanodine receptor type-1 (RyR1) channel function by interfering with the oxidative/nitrosative of the RyR1, which decreases Ca2+ release from the sarcoplasmic reticulum (SR). As well, oxidative stress-induced myofilament damage or dysfunction leads to decreased muscle tension [58]. Previous studies reported that excessive exercise in rats was used as the fatigue-stimulating technique to decrease muscle tension. However, the uptake of Ca2+ during excessive exercise showed that Ca2+ enabled increased muscle tension. This demonstrated that excessive exercise decreases muscle tension by interfering with Ca2+ release in skeletal muscles [59]. In our study, the E and ELP groups showed a greater decrease in muscle tension than shown in the C and VC groups at 10 Hz, while EHP showed a good tendency to increase the tension. We can therefore assume that the damage to skeletal muscle tissue resulting from excessive exercise may interfere with Ca2+ release in these groups. This assumption is supported by previous studies where excessive exercise was shown to interrupt Ca2+ release. However, the tension study with phycocyanin is inconclusive, and further studies may be needed to better understand its mechanism on muscle tension.

The forced swimming test is the animal model to assess the anti-fatigue properties of the compounds. An increased exercise endurance duration manifests anti-fatigue effects and is associated with changes in several biochemical marker levels [60]. In our current study, we found that phycocyanin extract significantly increased swimming duration in the forced swim test than was observed in the control and exercise groups. Administration of phytochemicals or natural compounds has been proven to increase swim duration in animal models [61, 62]. Previous research, together with the results from our study, show that phycocyanin supplementation promotes glucose uptake through the IRS-1/AKT signaling pathway as well as increases GLUT4 translocation leading to glycogen storage and ATP synthesis, inhibiting protein degradation and increasing protein synthesis in skeletal muscles, resulting in reduced muscle fatigue. From the results of our forced swimming tests, we can conclude that phycocyanin manifests anti-fatigue effects on skeletal muscles.

As mentioned above, exercise can increase the ROS in skeletal muscles, but this is countered by the body’s homeostasis through antioxidant enzymes and non-enzyme activity where ROS is converted to H2O, O2, and stable molecules. SOD, CAT, and GPx are antioxidant enzymes produced by the body. SOD catalyzes the superoxide anion (O2.-) to H2O2, whereas GPx and CAT catalyze H2O2 to H2O and O2. Regular low-intensity or moderate-intensity exercise in endurance and resistance training has been shown to increase antioxidant enzymes due to adaptation to decreased ROS from exercise [63, 64], whereas running for 30 min every day (non-recovery), by the rats, over 8 weeks showed decreased SOD and GPx but no change in CAT. This demonstrated that non-recovery exercise showed no change or decrease in the antioxidant enzyme activities [65]; a similar result to our study, where antioxidant enzyme activity in the E group was non-significantly different to the C group, but the ELP, EHP, and VC groups showed greater increases in antioxidant activities than in the C and E groups. Antioxidant enzymes are mostly modulated by Nrf2, thus increasing antioxidant enzymes in the ELP, EHP, and VC groups may mediate through the activation of Nrf2.

Nrf2 is a protein transcription factor of antioxidant genes (SOD1, SOD2, Catalase, GPx1) that are involved in the oxidative stress response which is activated by an increase in ROS. Exercise training has been shown to activate Nrf2 signaling which increases the antioxidant enzymes in skeletal muscle tissues in response to decreased ROS. There are conflicting reports regarding excessive exercise affecting a decrease or no change of Nrf2 in skeletal muscle, on account of deterioration, protein degradation, or damage in excessive exercise [66]. Acute exercise and endurance exercise showed an increase in Nrf2 [67], whereas exhaustive exercise showed no change in the expression of Nrf2 compared to the non-exercise group [68]. The previous study also showed that feeding with sulforaphane to the exhaustive exercise group exerts a greater increase in Nrf2 expression than the exhaustive exercise group [68]. A similar result was shown in our study, the Nrf2 expression in the E group was no different from that in the C group, while the increased Nrf2 expression was observed in the phycocyanin and vitamin C-treated groups. Specifically, exercise while being fed with phycocyanin, and vitamin C was shown to increase Nrf2 and antioxidant activities.

Vitamin C is a non-enzymatic antioxidant and functions as an electron donor to ROS. Vitamin C is currently commonly used as a supplement for athletes, which reduces exercise-induced oxidative stress for reduced fatigue, damage, and inflammation in skeletal muscle. Previous studies report that vitamin C supplementation works through the AKT/mTOR signaling pathways to reduce muscle atrophy [69], decrease inflammation and muscle pain, and oxidative stress induced by acute exercise [70]. Vitamin C increases glycogen content and glucose uptake activity in skeletal muscle through increased insulin signaling. Therefore, our study chose vitamin C as a positive control [71]. From the present study, phycocyanin treatment demonstrated equal benefits as vitamin C to reduce oxidative damage, activate antioxidant systems, improve muscle atrophy, and possess an anti-fatigue property. In addition, the human equivalence dose of phycocyanin 200 mg/kg BW in rats is equal to 1945.95 mg/60kg BW, or around 2 g/60kg BW in humans. The toxicity dose of phycocyanin in rats was reported to be greater than 3000 mg/kg BW [72], or around 29.19 g/60 kg BW in humans, so the dose in the present study is practically used and not toxic. As a result, phycocyanin has the potential to be used as an alternative supplement to reduce skeletal muscle damage in prolonged exercise.

Conclusions

We have shown that phycocyanin works to correct muscle fatigue and reduce muscle damage associated with high-intensity exercise by reducing inflammation and oxidative stress and enhancing the activity of antioxidant enzymes via the regulation of Nrf2, SOD1, and GPx. Phycocyanin also reduces protein degradation and increases protein synthesis via MuRF-1, and Atrogin-1, mTOR, leading to increased muscle mass. In addition, phycocyanin increases insulin sensitivity, muscle glucose uptake, and glycogen storage through the action of the IRS-1/AKT pathway. It also increases the synthesis of ATP in the mitochondria to serve as energy while being exercised. These findings provide new knowledge regarding the reduction of damage from high-intensity exercise and the possible mechanism is shown in Fig 8. However, its benefits for human applications should be investigated in future studies.

10.1371/journal.pone.0310138.g008 Fig 8 Effect of phycocyanin on swimming exercise-induced oxidative stress.

Phycocyanin decreases oxidative damage and reduces inflammation due to excessive exercise, also increases the Nrf2 pathway leading to an enhancement of the antioxidant system, which causes reduced muscle damage. Phycocyanin enhances muscle glucose uptake, insulin sensitivity, GLUT4 expression, and glycogen storage, and improves protein metabolism through the IRS-1/AKT/mTOR signaling pathway. These results show that phycocyanin reduces muscle atrophy and muscle fatigue leading to improved exercise performance.

Supporting information

S1 Raw images Raw data images of the original western blot images on the PVDF membrane, staining with immobilon forte western HRP substrate detected by Amersham TM Image Quant 800.

(DOI: 10.5281/zenodo.12749098).

(PDF)

The author thanks Mr. Peter Barton and Mr. Kevin Mark Roebl from the International Relations and Language Development Division (DIALD) and Mr. Roy Morien of the Naresuan University Graduate School for their assistance in editing the English version of the manuscript. The author thanks Nalinnipa Wiengnak, a research assistant in the Department of Biochemistry, Faculty of Medical Science, Naresuan University for advice on the real-time PCR part, and Narongsak Pearyo from the Department of Physiology, Faculty of Medical Science, Naresuan University for advice and setting power lab machine.

10.1371/journal.pone.0310138.r001
Decision Letter 0
Hitachi Keisuke Academic Editor
© 2024 Keisuke Hitachi
2024
Keisuke Hitachi
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
19 Feb 2024

PONE-D-24-00127Phycocyanin attenuates skeletal muscle damage, atrophy, and fatigue via modulation of Nrf2, mTOR, MuRF-1, and Atrogin-1 in exercise-induced oxidative stress in ratsPLOS ONE

Dear Dr. Tunsophon,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Overall, the manuscript received positive reviews from two experts, who found it to be an interesting piece of research. However, several concerns were also raised that need to be addressed. The authors are requested to address these concerns point by point in their revised manuscript carefully. Please provide a detailed response to each comment, explaining how you have addressed the issue.

==============================

Please submit your revised manuscript by Apr 04 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Keisuke Hitachi

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. In the online submission form you indicate that your data is not available for proprietary reasons and have provided a contact point for accessing this data. Please note that your current contact point is a co-author on this manuscript. According to our Data Policy, the contact point must not be an author on the manuscript and must be an institutional contact, ideally not an individual. Please revise your data statement to a non-author institutional point of contact, such as a data access or ethics committee, and send this to us via return email. Please also include contact information for the third party organization, and please include the full citation of where the data can be found.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Study titled 'Phycocyanin attenuates skeletal muscle damage, atrophy, and fatigue via modulation of Nrf2, mTOR, MuRF-1, and Atrogin-1 in exercise-induced oxidative stress in rats.' It is indeed an interesting study. I have a few queries regarding the experiments and results.

1. "How was Vitamin C specifically chosen as the positive control? The rationale of choosing this. For the exercise group in the context of the experiment focusing on muscle glucose uptake and glycogen content? The authors conducted experiments on two muscle types - the abdominal muscle and the soleus muscle as can be seen in the materials and method. But used only soleus. As noted, 'To assess muscle glucose uptake, the abdominal muscle was isolated (100–150 mg) and immersed in Krebs-Ringer bicarbonate (KRB) buffer [26]. Kindly clarify the same.

2. In the endpoint please mention, which muscles have been collected.

3. Did the authors undertake an examination of fasting insulin levels in the animals as a means to evaluate insulin/glucose uptake? If so, it would be insightful to understand the baseline levels of both glucose and insulin.

4. In the analysis of NRf2 blots, an intriguing observation is the disparity between the representation in Vitamin C graphs and the actual expression in the same lane. To gain a comprehensive understanding, could the authors provide details on how many times the gel was run? Additionally, whether authors used soleus muscles were pooled or analyzed individually from each animal?

5. Given the nature of the soleus muscle as a slow-fiber muscle, it would be good if authors conduct fiber typing, preferably using techniques like COX/DSH staining or ATPase staining. This would enhance the robustness of the conclusion that phycocyanin contributes to an improvement in the observed conditions.

6. What could be the possible reasons for the increase in LDH during exercise? While there is no change in antioxidant parameters when comparing exercise and control conditions. How do the authors interpret this finding?

7. However, the tension study with phycocyanin is inconclusive, and further studies may be needed to better understand its mechanism on muscle tension. Could the author provide insights into the type of study that would be instrumental in proving the mechanism?

8. Additionally, in the table, the authors mentioned Quadriceps muscle weight (g) (MW), but all experiments utilized the soleus muscle, and the soleus muscle weight is provided. This inconsistency in muscle type raises questions about the accuracy of the reported data.

9. An intriguing observation is the maintenance of protein balance. Have the authors explored the pAKT/IGF signaling pathway or referred to any existing reports demonstrating that Phycocyanin activates the AKT/IGF signaling pathway?

10. Upon scrutiny, the histology picture presented in the panel raises concerns about the visibility of myofibers, particularly noting poor staining in panels ELP and EHP. Could the authors revise/clear on the methodology employed to calculate fiber numbers and provide a clear definition of fiber number? Furthermore, it would be valuable to include measurements of fiber diameter.

11. Regarding the statistical analysis description, there is an apparent complexity that may hinder comprehension. A thorough revision is recommended to ensure a clear and detailed explanation for better understanding.

Reviewer #2: Dear writers,

This report describes the effect of Phycocyanin against exercise-induced oxidative stress in a rat model. The results are interesting and this report seems suitable for publication in PLOS ONE. However, it should be noted that the final decision will be made by the editor. Additionally, there are some issues that need to be fixed before the article is published.

The following issues need to be reviewed.

1. Statistical analysis is not specified in the material- method section. Statistical explanations are briefly included only in the description of tables 1 and 2, however, it is not stated how the other data were evaluated statistically.

2. It was shown that both body weight and quadriceps muscle weight decreased significantly in the EHP group (table 1). This result is not discussed in the manuscript. Additionally, contradictory to these data, it was stated that phycocyanin increased protein synthesis and decreased protein degradation (lines 283, 284, 285).

3. There are abbreviation errors throughout the text. Abbreviations should be explained in full when first used in the text and then only abbreviations should be used.

4. References need to be reviewed. For example, in the 4th reference, the authors' titles are written. Volume and page numbers of some references are not written (e.g. 34, 35).

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment Submitted filename: comments PLOS.docx

10.1371/journal.pone.0310138.r002
Author response to Decision Letter 0
Submission Version1
17 Jul 2024

Reviewer #1: Study titled 'Phycocyanin attenuates skeletal muscle damage, atrophy, and fatigue via modulation of Nrf2, mTOR, MuRF-1, and Atrogin-1 in exercise-induced oxidative stress in rats.' It is indeed an interesting study. I have a few queries regarding the experiments and results.

Response:

We greatly appreciate the positive comment from the reviewer.

1. "How was Vitamin C specifically chosen as the positive control? The rationale of choosing this. For the exercise group in the context of the experiment focusing on muscle glucose uptake and glycogen content? The authors conducted experiments on two muscle types - the abdominal muscle and the soleus muscle as can be seen in the materials and method. But used only soleus. As noted, 'To assess muscle glucose uptake, the abdominal muscle was isolated (100–150 mg) and immersed in Krebs-Ringer bicarbonate (KRB) buffer [26]. Kindly clarify the same.

Response:

We are grateful that you find our research interesting. We chose vitamin C as the positive control since vitamin C or ascorbic acid is known to have high antioxidant activity, which protects the body from oxidative damage and helps strengthen the body's immunity [1]. Vitamin C is also used as a positive control in several studies related to exercise and oxidative stress [2,3] and is often used as a dietary supplement for athletes because of its strong antioxidant properties [4, 5]. Vitamin C reduces the oxidative stress effect on muscle fatigue, damage, and inflammation caused by exercise in skeletal muscles [4]. Previous studies have reported that vitamin C supplementation works effectively through the AKT/mTOR signaling pathway to reduce muscle atrophy [6], decreases muscle inflammation, muscle pain, and oxidative stress induced by acute exercise [7], and increases SR Ca2+ ATPase in the myocardium to improve myocardial contractility [8] and muscle tension [9], also increases glycogen content and glucose uptake activity in skeletal muscle through activated insulin signaling [10,11], which demonstrates a similar mechanism as phycocyanin.

For the concern regarding the muscle types, we apologize for unclear contents in the previous manuscript. We used two muscles, the soleus and quadriceps, both are muscle fiber type I [12,13]. Exercise clearly affects oxidative insulin-sensitive, glycolytic, and oxidative stress in the quadriceps muscle. Therefore, the quadriceps muscle is commonly used to test for muscle damage, glucose uptake, and insulin signaling [14,15]. The soleus muscle was used to determine the muscle force tension because of its small, and straight bundle shape. When electrically stimulated, clear changes can be seen according to the previous protocols [16-18]. We have added this information to the revised manuscript.

References

1. Ghalibaf MHE, Kianian F, Beigoli S, Behrouz S, Marefati N, Boskabady M, et al. The effects of vitamin C on respiratory, allergic and immunological diseases: an experimental and clinical-based review. Inflammopharmacology. 2023. doi:10.1007/s10787-023-01169-1

2. Close GL, Ashton T, Cable T, Doran D, Holloway C, McArdle F, et al. Ascorbic acid supplementation does not attenuate post-exercise muscle soreness following muscle-damaging exercise but may delay the recovery process. British Journal of Nutrition. 2006;95. doi:10.1079/bjn20061732

3. Yimcharoen M, Kittikunnathum S, Suknikorn C, Nak-On W, Yeethong P, Anthony TG, et al. Effects of ascorbic acid supplementation on oxidative stress markers in healthy women following a single bout of exercise. Journal of the International Society of Sports Nutrition. 2019;16. doi:10.1186/s12970-019-0269-8

4. Evans LW, Omaye ST. Use of saliva biomarkers to monitor efficacy of vitamin C in exercise-induced oxidative stress. Antioxidants. 2017. doi:10.3390/antiox6010005

5. Hemmatfar A, Piraki P, Sharif MAS, Behpour N. Evaluating the effect of Vitamin C on myocardial angiogenesis under oxidative stress induced by exhaustive exercise in rat. Pharmaceutical Sciences. 2018;24. doi:10.15171/PS.2018.40

6. Yang M, Teng S, Ma C, Yu Y, Wang P, Yi C. Ascorbic acid inhibits senescence in mesenchymal stem cells through ROS and AKT/mTOR signaling. Cytotechnology. 2018;70. doi:10.1007/s10616-018-0220-x

7. Righi NC, Schuch FB, De Nardi AT, Pippi CM, de Almeida Righi G, Puntel GO, et al. Effects of vitamin C on oxidative stress, inflammation, muscle soreness, and strength following acute exercise: meta-analyses of randomized clinical trials. European Journal of Nutrition. 2020. doi:10.1007/s00394-020-02215-2

8. Qin F, Yan C, Patel R, Liu W, Dong E. Vitamins C and E attenuate apoptosis, β-adrenergic receptor desensitization, and sarcoplasmic reticular Ca2+ ATPase downregulation after myocardial infarction. Free Radical Biology and Medicine. 2006;40. doi:10.1016/j.freeradbiomed.2006.01.019

9. Urso ML, Clarkson PM. Oxidative stress, exercise, and antioxidant supplementation. Toxicology. 2003. doi:10.1016/S0300-483X(03)00151-3

10. Bulduk E, Gönül B, Özer Ç. Effects of vitamin C on muscle glycogen and oxidative events in experimental diabetes. Molecular and Cellular Biochemistry. 2006;292. doi:10.1007/s11010-006-9226-3

11. Picklo MJ, Thyfault JP. Vitamin e and vitamin c do not reduce insulin sensitivity but inhibit mitochondrial protein expression in exercising obese rats. Applied Physiology, Nutrition and Metabolism. 2015;40. doi:10.1139/apnm-2014-0302

12. Kriketos AD, Pan DA, Sutton JR, Hoh JFY, Baur LA, Cooney GJ, et al. Relationships between muscle membrane lipids, fiber type, and enzyme activities in sedentary and exercised rats. American Journal of Physiology - Regulatory Integrative and Comparative Physiology. 1995;269. doi:10.1152/ajpregu.1995.269.5.r1154

13. Larson L, Lioy J, Johnson J, Medler S. Transitional Hybrid Skeletal Muscle Fibers in Rat Soleus Development. Journal of Histochemistry and Cytochemistry. 2019;67. doi:10.1369/0022155419876421

14. Yaspelkis BB, Singh MK, Trevino B, Krisan AD, Collins DE. Resistance training increases glucose uptake and transport in rat skeletal muscle. Acta Physiol Scand. 2002;175. doi:10.1046/j.1365-201X.2002.00998.x

15. Ezaki O, Higuchi M, Nakatsuka H, Kawanaka K, Itakura H. Exercise training increases glucose transporter content in skeletal muscles more efficiently from aged obese rats than young lean rats. Diabetes. 1992;41. doi:10.2337/diab.41.8.920

16. Park KH, Brotto L, Lehoang O, Brotto M, Ma J, Zhao X. Ex Vivo assessment of contractility, fatigability and alternans in isolated skeletal muscles. Journal of Visualized Experiments. 2012. doi:10.3791/4198

17. Vedsted P, Larsen AH, Madsen K, Sjøgaard G. Muscle performance following fatigue induced by isotonic and quasi-isometric contractions of rat extensor digitorum longus and soleus muscles in vitro. Acta Physiol Scand. 2003;178. doi:10.1046/j.1365-201X.2003.01123.x

18. Gomes ARS, Coutinho EL, França CN, Polonio J, Salvini TF. Effect of one stretch a week applied to the immobilized soleus muscle on rat muscle fiber morphology. Brazilian Journal of Medical and Biological Research. 2004;37. doi:10.1590/S0100-879X2004001000005

2. In the endpoint please mention, which muscles have been collected.

Response:

We apologize for the missing information. We have added details for the collected skeletal muscles under the material and method section. In brief, we used the soleus muscle for tension experiment, while the quadriceps were used in the remaining experiments.

3. Did the authors undertake an examination of fasting insulin levels in the animals as a means to evaluate insulin/glucose uptake? If so, it would be insightful to understand the baseline levels of both glucose and insulin.

Response:

Thank you for your suggestion. Previous studies reported that excessive exercise-induced oxidative stress decreases insulin sensitivity and glucose uptake activity through decreased IRS-1 signaling [1,2], while nutrition supplementation in these conditions increases insulin sensitivity through increased IRS-1/PI3K/AKT signaling [3-5]. We therefore performed additional experiments to determine plasma insulin and glucose, and also the expression of the insulin receptor substrate-1 (IRS-1). Our study shows an increase in insulin sensitivity using QUICKI assessment [6] and increased glucose uptake activity through activation of the IRS-1 signaling pathway in excessive exercise combined with phycocyanin. These results helped us confirm insulin action in our study. We have added the new experiments and results in the revised MS.

References

1. Turgut M, Cinar V, Pala R, Tuzcu M, Orhan C, Telceken H, et al. Biotin and chromium histidinate improve glucose metabolism and proteins expression levels of IRS-1, PPAR-γ, and NF-ΚB in exercise-trained rats. Journal of the International Society of Sports Nutrition. 2018;15. doi:10.1186/s12970-018-0249-4

2. Chan SH, Kikkawa U, Matsuzaki H, Chen JH, Chang WC. Insulin receptor substrate-1 prevents autophagy-dependent cell death caused by oxidative stress in mouse NIH/3T3 cells. Journal of Biomedical Science. 2012;19. doi:10.1186/1423-0127-19-64

3. Wang H, Wang J, Zhu Y, Yan H, Lu Y. Effects of different intensity exercise on glucose metabolism and hepatic IRS/PI3K/AKT pathway in sd rats exposed with TCDD. International Journal of Environmental Research and Public Health. 2021;18. doi:10.3390/ijerph182413141

4. Kerksick CM, Wilborn CD, Roberts MD, Smith-Ryan A, Kleiner SM, Jäger R, et al. ISSN exercise & sports nutrition review update: Research & recommendations. Journal of the International Society of Sports Nutrition. 2018. doi:10.1186/s12970-018-0242-y

5. Turgut M, Cinar V, Pala R, Tuzcu M, Orhan C, Telceken H, et al. Biotin and chromium histidinate improve glucose metabolism and proteins expression levels of IRS-1, PPAR-γ, and NF-ΚB in exercise-trained rats. Journal of the International Society of Sports Nutrition. 2018;15. doi:10.1186/s12970-018-0249-4

6. Quon MJ. QUICKI Is a Useful and Accurate Index of Insulin Sensitivity. Journal of Clinical Endocrinology & Metabolism. 2002;87. doi:10.1210/jc.87.2.949

4. In the analysis of NRf2 blots, an intriguing observation is the disparity between the representation in Vitamin C graphs and the actual expression in the same lane. To gain a comprehensive understanding, could the authors provide details on how many times the gel was run? Additionally, whether authors used soleus muscles were pooled or analyzed individually from each animal?

Response:

Thank you for your comment. We have performed an additional Nrf2 western blotting and corrected the inconsistency between the NRf2 expression and histogram. By choosing the western blot image that represents the histogram as shown in Fig.5.

We have also added additional detail on the western blot as suggested. The quadriceps were used to determine the expression of proteins of interest. We used 3 individual muscle samples/groups.

5. Given the nature of the soleus muscle as a slow-fiber muscle, it would be good if authors conduct fiber typing, preferably using techniques like COX/DSH staining or ATPase staining. This would enhance the robustness of the conclusion that phycocyanin contributes to an improvement in the observed conditions.

Response:

We appreciate your comment. We decided to perform an additional experiment to determine whether phycocyanin has any effect on ATP or not. We used the real-time PCR technique to study the gene expression of ATP synthase (Mitochondrial ATP synthase F1 subunit beta (ATP5B)). Although, this is not to confirm the muscle type, but it can provide an insightful mechanism of the PC extraction on energy expenditure by muscle cells. A previous study reported that decreased ATPase, ATP synthase, and ATP content lead to decreased ATP synthesis in excessive exercise [1,2]. Our additional result showed that the ATP5B was activated which implies that phycocyanin can stimulate the ATP synthase. This is required for ATP production during exercise. The finding contributes to the beneficial effect of phycocyanin to improve the condition of exercise-induced oxidative stress.

References

1. Tarini VAF, Carnevali LC, Arida RM, Cunha CA, Alves ES, Seeleander MCL, et al. Effect of exhaustive ultra-endurance exercise in muscular Glycogen and both Alpha1 and Alpha2 AMPK protein expression in trained rats. Journal of Physiology and Biochemistry. 2013;69. doi:10.1007/s13105-012-0224-5

2. Schluter JM, Fitts RH. Shortening velocity and ATPase activity of rat skeletal muscle fibers: Effects of endurance exercise training. American Journal of Physiology-Cell Physiology. 1994;266. doi:10.1152/ajpcell.1994.266.6.c1699

6. What could be the possible reasons for the increase in LDH during exercise? While there is no change in antioxidant parameters when comparing exercise and control conditions. How do the authors interpret this finding?

Response:

Thank you for your question. Lactate dehydrogenase (LDH) is an enzyme that catalyzes the exchange between pyruvate and lactate in cells. The membrane lipid bilayer prevents LDH from leaking out to the extracellular compartment. However, exercise-induced oxidative stress results in membrane lipid peroxidation at the membrane lipid bilayer, leading to membrane dysfunction. Therefore, the leakage of LDH can be observed in the exercise group as shown in our study. LDH is a marker used to assess tissue damage or injury [1-3].

A previous study showed that decreased or no change in antioxidant activity due to excessive exercise-induced oxidative stress, while increased MDA was observed in excessive exercise than non-exercise [4]. These reports are similar to our study to show that antioxidants do not change in the exercise group, but an elevated lipid peroxidation was significantly determined when compared with the other groups (C, ELP, EHP, and VC groups). Therefore, increased lipid peroxidation in the excessive exercise results in an increased leaking of LDH due to lipid membrane dysfunction.

References

1. Olayeriju OS, Olaleye MT, Crown OO, Komolafe K, Boligon AA, Athayde ML, et al. Ethylacetate extract of red onion (Allium cepa L.) tunic affects hemodynamic parameters in rats. Food Science and Human Wellness. 2015;4. doi:10.1016/j.fshw.2015.07.002

2. Tie S, Zhang L, Li B, Xing S, Wang H, Chen Y, et al. Effect of dual targeting procyanidins nanoparticles on metabolomics of lipopolysaccharide-stimulated inflammatory macrophages. Food Science and Human Wellness. 2023;12. doi:10.1016/j.fshw.2023.03.045

3. Papadopoulos NM, Leon AS, Bloor CM. Effects of Exercise on Plasma and Tissue Levels of Lactate Dehydrogenase and Isoenzymes in Rats. Proceedings of the Society for Experimental Biology and Medicine. 1967;125. doi:10.3181/00379727-125-32260

4. Wang Y, Xiang Y, Wang R, Li X, Wang J, Yu S, et al. Sulforaphane enhances Nrf2-mediated antioxidant responses of skeletal muscle induced by exhaustive exercise in HIIT mice. Food Science and Human Wellness. 2022;11. doi:10.1016/j.fshw.2022.04.035

7. However, the tension study with phycocyanin is inconclusive, and further studies may be needed to better understand its mechanism on muscle tension. Could the author provide insights into the type of study that would be instrumental in proving the mechanism?

Response:

Thank you for your question. Since muscle contraction requires ATP and Ca2+ [1], if we could perform a future experiment, we would study the ryanodine receptor type 1 (RYR1). This is because RYR1 serves as the skeletal muscle calcium release channel [2]. If the expression of RYR1 increases, it indicates increased calcium release in the skeletal muscles. An optional experiment would be the study of the Ca2+ concentration. If Ca2+ is released in greater quantities, it leads to increased muscle contraction [3].

References

1. Adams RJ, Schwartz A. Comparative mechanisms for contraction of cardiac and skeletal muscle. Chest. 1980. doi:10.1378/chest.78.1.123

2. Lawal TA, Todd JJ, Meilleur KG. Ryanodine Receptor 1-Related Myopathies: Diagnostic and Therapeutic Approaches. Neurotherapeutics. 2018. doi:10.1007/s13311-018-00677-1

3. Martins AS, Shkryl VM, Nowycky MC, Shirokova N. Reactive oxygen species contribute to Ca2+ signals produced by osmotic stress in mouse skeletal muscle fibres. Journal of Physiology. 2008;586. doi:10.111

Attachment Submitted filename: Response to reviewer final.pdf

10.1371/journal.pone.0310138.r003
Decision Letter 1
Hitachi Keisuke Academic Editor
© 2024 Keisuke Hitachi
2024
Keisuke Hitachi
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
31 Jul 2024

PONE-D-24-00127R1Phycocyanin attenuates skeletal muscle damage and fatigue via modulation of Nrf2 and IRS-1/AKT/mTOR pathway in exercise-induced oxidative stress in ratsPLOS ONE

Dear Dr. Tunsophon,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Your manuscript was evaluated by the two original reviewers. Before formal acceptance, minor revisions are required according to the comments by Reviewer #1. 

Please submit your revised manuscript by Sep 14 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Keisuke Hitachi

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: To enhance the clarity and consistency of the manuscript, I recommend a few minor revisions. Firstly, consolidate the information regarding the company names of chemicals and kits used throughout the manuscript into a single section within the Materials and Methods, specifically where the phycocyanin materials are described. This will streamline the text and improve readability. Secondly, for the histological images, remove the freehand circles and only arrows are sufficient. Ensure each arrow is clearly labeled to indicate its significance, thus providing precise and comprehensible visual data. Lastly, correct the spelling error in the graph of Figure 2, specifically the term "muscle tension," and ensure that all syntactical elements are accurate. These adjustments will significantly enhance the overall quality and professionalism of the manuscript. Thank you to the authors for revising the manuscript as per the reviewer’s suggestions.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0310138.r004
Author response to Decision Letter 1
Submission Version2
22 Aug 2024

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

________________________________________

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: (No Response)

________________________________________

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: To enhance the clarity and consistency of the manuscript, I recommend a few minor revisions. Firstly, consolidate the information regarding the company names of chemicals and kits used throughout the manuscript into a single section within the Materials and Methods, specifically where the phycocyanin materials are described. This will streamline the text and improve readability. Secondly, for the histological images, remove the freehand circles and only arrows are sufficient. Ensure each arrow is clearly labeled to indicate its significance, thus providing precise and comprehensible visual data. Lastly, correct the spelling error in the graph of Figure 2, specifically the term "muscle tension," and ensure that all syntactical elements are accurate. These adjustments will significantly enhance the overall quality and professionalism of the manuscript. Thank you to the authors for revising the manuscript as per the reviewer’s suggestions.

Response: Thank you for your recommendation, we agree with the revision following your guidelines.

1. We consolidated the information on all chemicals and kits used in the Materials and Methods.

2. We removed freehand circles and stars in the histological images and showed only arrows. We have clarified the arrow in the figure legend. The bold arrow ( ) represents muscle fiber, the arrow (→) represents the nucleus, and the arrowhead (▲) represents the perimysium.

3. We corrected the spelling error in Figure 2 and checked for the typo throughout the main manuscripts.

Reviewer #2: (No Response)

________________________________________

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

10.1371/journal.pone.0310138.r005
Decision Letter 2
Hitachi Keisuke Academic Editor
© 2024 Keisuke Hitachi
2024
Keisuke Hitachi
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
26 Aug 2024

Phycocyanin attenuates skeletal muscle damage and fatigue via modulation of Nrf2 and IRS-1/AKT/mTOR pathway in exercise-induced oxidative stress in rats

PONE-D-24-00127R2

Dear Dr. Tunsophon,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Keisuke Hitachi

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

10.1371/journal.pone.0310138.r006
Acceptance letter
Hitachi Keisuke Academic Editor
© 2024 Keisuke Hitachi
2024
Keisuke Hitachi
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
30 Aug 2024

PONE-D-24-00127R2

PLOS ONE

Dear Dr. Tunsophon,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Keisuke Hitachi

Academic Editor

PLOS ONE
==== Refs
References

1 Clarkson PM , Nosaka K , Braun B . Muscle function after exercise-induced muscle damage and rapid adaptation. Medicine & Science in Sports & Exercise. 1992;24 : 512–520. 1569847
2 Davies KJ . Oxidative stress: the paradox of aerobic life. Biochemical Society Symposia. 1995;61 : 1–31. doi: 10.1042/bss0610001 8660387
3 Chen J , Zhang Z , Cai L . Diabetic cardiomyopathy and its prevention by nrf2: current status. Diabetes & Metabolism Journal. 2014;38 : 337–345. doi: 10.4093/dmj.2014.38.5.337 25349820
4 S A B , Waldman HS , Krings BM , Lamberth J , Smith JW , McAllister MJ . Effect of Curcumin Supplementation on Exercise-Induced Oxidative Stress, Inflammation, Muscle Damage, and Muscle Soreness. Journal of Dietary Supplements. 2020;17 : 401–414. doi: 10.1080/19390211.2019.1604604 31025894
5 Peake JM , Neubauer O , Della Gatta PA , Nosaka K . Muscle damage and inflammation during recovery from exercise. Journal of Applied Physiology (1985). 2017;122 : 559–570. doi: 10.1152/japplphysiol.00971.2016 28035017
6 Powers SK , Jackson MJ . Exercise-induced oxidative stress: cellular mechanisms and impact on muscle force production. Physiological Reviews. 2008;88 : 1243–1276. doi: 10.1152/physrev.00031.2007 18923182
7 Beyfuss K , Hood DA . A systematic review of p53 regulation of oxidative stress in skeletal muscle. Redox Report. 2018. doi: 10.1080/13510002.2017.1416773 29298131
8 Cesare MM , Felice F , Santini V , Di Stefano R . Antioxidants in Sport Sarcopenia. Nutrients. 2020;12 . doi: 10.3390/nu12092869 32961753
9 Rauf A , Khalil AA , Awadallah S , Khan SA , Abu-Izneid T , Kamran M , et al . Reactive oxygen species in biological systems: Pathways, associated diseases, and potential inhibitors—A review. Food Science and Nutrition. 2024. doi: 10.1002/fsn3.3784 38370049
10 Thirupathi A , Pinho RA , Chang YZ . Physical exercise: An inducer of positive oxidative stress in skeletal muscle aging. Life Sciences. 2020;252 : 117630. doi: 10.1016/j.lfs.2020.117630 32294473
11 Ding X , Jian T , Wu Y , Zuo Y , Li J , Lv H , et al . Ellagic acid ameliorates oxidative stress and insulin resistance in high glucose-treated HepG2 cells via miR-223/keap1-Nrf2 pathway. Biomedicine and Pharmacotherapy. 2019;110 . doi: 10.1016/j.biopha.2018.11.018 30466006
12 Lian D , Chen MM , Wu H , Deng S , Hu X . The Role of Oxidative Stress in Skeletal Muscle Myogenesis and Muscle Disease. Antioxidants (Basel). 2022;11 . doi: 10.3390/antiox11040755 35453440
13 Guo W , Zeng M , Zhu S , Li S , Qian Y , Wu H . Phycocyanin ameliorates mouse colitis via phycocyanobilin-dependent antioxidant and anti-inflammatory protection of the intestinal epithelial barrier. Food and Function. 2022;13 : 3294–3307. doi: 10.1039/d1fo02970c 35244658
14 Costa M , Costa-Rodrigues J , Fernandes MH , Barros P , Vasconcelos V , Martins R . Marine cyanobacteria compounds with anticancer properties: a review on the implication of apoptosis. Marine Drugs. 2012;10 : 2181–2207. doi: 10.3390/md10102181 23170077
15 Carfagna S , Napolitano G , Barone D , Pinto G , Pollio A , Venditti P . Dietary supplementation with the microalga Galdieria sulphuraria (Rhodophyta) reduces prolonged exercise-induced oxidative stress in rat tissues. Oxidative Medicine and Cellular Longevity. 2015;2015 : 732090. doi: 10.1155/2015/732090 25874021
16 Sutikno LA , Lee GH , Harwanto D , Choi JS , Hong YK . The ethanol extract from the rhodophyta Gloiopeltis furcata and its active ingredient docosahexaenoic acid improve exercise performance in mice. Journal of Food Biochemistry. 2019;43 : e12980. doi: 10.1111/jfbc.12980 31489659
17 Bennett A , Bogobad L . Complementary chromatic adaptation in a filamentous blue-green alga. Journal of Cell Biology. 1973;58 . doi: 10.1083/jcb.58.2.419 4199659
18 Lima FD , Stamm DN , Della-Pace ID , Dobrachinski F , de Carvalho NR , Royes LFF , et al . Swimming Training Induces Liver Mitochondrial Adaptations to Oxidative Stress in Rats Submitted to Repeated Exhaustive Swimming Bouts. PLoS One. 2013;8 . doi: 10.1371/journal.pone.0055668 23405192
19 Kwon DK , Hwang KH , Kim YK , Lee KH , Song YJ . Effects of swimming exercise and soybean supplementation on the immune functions of rats fed a high-fat diet. Clinical and Experimental Pharmacology and Physiology. 2008;35 . doi: 10.1111/j.1440-1681.2007.04847.x 18177482
20 Ogonovszky H , Berkes I , Kumagai S , Kaneko T , Tahara S , Goto S , et al . The effects of moderate-, strenuous- and over-training on oxidative stress markers, DNA repair, and memory, in rat brain. Neurochemistry International. 2005;46 . doi: 10.1016/j.neuint.2005.02.009 15863241
21 Li Q , Tuo X , Li B , Deng Z , Qiu Y , Xie H . Semaglutide attenuates excessive exercise-induced myocardial injury through inhibiting oxidative stress and inflammation in rats. Life Sciences. 2020;250 . doi: 10.1016/j.lfs.2020.117531 32151691
22 Aydin C , Ince E , Koparan S , Cangul IT , Naziroglu M , Ak F . Protective effects of long term dietary restriction on swimming exercise-induced oxidative stress in the liver, heart and kidney of rat. Cell Biochemistry and Function. 2007;25 . doi: 10.1002/cbf.1279 16143963
23 Duan FF , Guo Y , Li JW , Yuan K . Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways. Oxidative Medicine and Cellular Longevity. 2017;2017 . doi: 10.1155/2017/3159358 28588747
24 Lamou B , Taiwe GS , Hamadou A , Abene , Houlray J , Atour MM , et al . Antioxidant and antifatigue properties of the aqueous extract of moringa oleifera in rats subjected to forced swimming endurance test. Oxidative Medicine and Cellular Longevity. 2016;2016 . doi: 10.1155/2016/3517824 26904162
25 Park KH , Brotto L , Lehoang O , Brotto M , Ma J , Zhao X . Ex Vivo assessment of contractility, fatigability and alternans in isolated skeletal muscles. Journal of Visualized Experiments. 2012. doi: 10.3791/4198 23149471
26 Capogrosso RF , Mantuano P , Cozzoli A , Sanarica F , Massari AM , Conte E , et al . Contractile efficiency of dystrophic mdx mouse muscle: In vivo and ex vivo assessment of adaptation to exercise of functional end points. Journal of Applied Physiology. 2017;122 . doi: 10.1152/japplphysiol.00776.2015 28057817
27 Doan H Van, Riyajan S, Iyara R, Chudapongse N. Antidiabetic activity, glucose uptake stimulation and α-glucosidase inhibitory effect of Chrysophyllum cainito L. stem bark extract. BMC complementary and alternative medicine. 2018;18. doi:10.1186/s12906-018-2328-0
28 Bordenave S , Brandou F , Manetta J , Fedou C , Mercier J , Brun JF . Effects of acute exercise on insulin sensitivity, glucose effectiveness and disposition index in type 2 diabetic patients. Diabetes & metabolism. 2008;34 . doi: 10.1016/j.diabet.2007.12.008 18448376
29 Jiang Q , Chen L , Wang R , Chen Y , Deng S , Shen G , et al . Hypoglycemic mechanism of Tegillarca granosa polysaccharides on type 2 diabetic mice by altering gut microbiota and regulating the PI3K-akt signaling pathways. Food Science and Human Wellness. 2024;13 . doi: 10.26599/FSHW.2022.9250072
30 Olayeriju OS , Olaleye MT , Crown OO , Komolafe K , Boligon AA , Athayde ML , et al . Ethylacetate extract of red onion (Allium cepa L.) tunic affects hemodynamic parameters in rats. Food Science and Human Wellness. 2015;4 . doi: 10.1016/j.fshw.2015.07.002
31 Tie S , Zhang L , Li B , Xing S , Wang H , Chen Y , et al . Effect of dual targeting procyanidins nanoparticles on metabolomics of lipopolysaccharide-stimulated inflammatory macrophages. Food Science and Human Wellness. 2023;12 . doi: 10.1016/j.fshw.2023.03.045
32 Vella L , Caldow MK , Larsen AE , Tassoni D , Gatta PAD , Gran P , et al . Resistance exercise increases NF-κB activity in human skeletal muscle. American journal of physiology. Regulatory, integrative and comparative physiology. 2012;302 . doi: 10.1152/ajpregu.00336.2011 22189669
33 Gallego-Selles A , Galvan-Alvarez V , Martinez-Canton M , Garcia-Gonzalez E , Morales-Alamo D , Santana A , et al . Fast regulation of the NF-κB signalling pathway in human skeletal muscle revealed by high-intensity exercise and ischaemia at exhaustion: Role of oxygenation and metabolite accumulation. Redox Biology. 2022;55 . doi: 10.1016/j.redox.2022.102398 35841628
34 Chaouachi M , Gautier S , Carnot Y , Guillemot P , Pincemail J , Moison Y , et al . Spirulina supplementation prevents exercise-induced lipid peroxidation, inflammation and skeletal muscle damage in elite rugby players. Journal of Human Nutrition and Dietetics. 2022;35 . doi: 10.1111/jhn.13014 35394687
35 Pedersen BK . Special feature for the Olympics: effects of exercise on the immune system: exercise and cytokines. Immunology and cell biology. 2000;78 . doi: 10.1111/j.1440-1711.2000.t01-11-.x 11050536
36 da Rocha AL , Pinto AP , Kohama EB , Pauli JR , de Moura LP , Cintra DE , et al . The proinflammatory effects of chronic excessive exercise. Cytokine. 2019. doi: 10.1016/j.cyto.2019.02.016 30884427
37 Fry RW , Morton AR , Keast D . Overtraining in Athletes: An Update. Sports Medicine. 1991. doi: 10.2165/00007256-199112010-00004 1925188
38 Lee SP , Mar GY , Ng LT . Effects of tocotrienol-rich fraction on exercise endurance capacity and oxidative stress in forced swimming rats. European journal of applied physiology. 2009;107 . doi: 10.1007/s00421-009-1159-6 19705143
39 Richter EA , Garetto LP , Goodman MN , Ruderman NB . Muscle glucose metabolism following exercise in the rat. Increased sensitivity to insulin. Journal of Clinical Investigation. 1982;69 . doi: 10.1172/JCI110517 6804492
40 Glynn EL , Lujan HL , Kramer VJ , Drummond MJ , DiCarlo SE , Rasmussen BB . A chronic increase in physical activity inhibits fed state mTOR/S6K1 signaling and reduces IRS-1 serine phosphorylation in rat skeletal muscle. Applied Physiology, Nutrition and Metabolism. 2008;33 . doi: 10.1139/H07-149 18347658
41 Aoi W , Naito Y , Tokuda H , Tanimura Y , Oya-Ito T , Yoshikawa T . Exercise-induced muscle damage impairs insulin signaling pathway associated with IRS-1 oxidative modification. Physiological Research. 2012;61 . doi: 10.33549/physiolres.932239 22188104
42 Archuleta TL , Lemieux AM , Saengsirisuwan V , Teachey MK , Lindborg KA , Kim JS , et al . Oxidant stress-induced loss of IRS-1 and IRS-2 proteins in rat skeletal muscle: Role of p38 MAPK. Free Radical Biology and Medicine. 2009;47 . doi: 10.1016/j.freeradbiomed.2009.08.014 19703555
43 Agrawal M , Perumal Y , Bansal S , Arora S , Chopra K . Phycocyanin alleviates ICV-STZ induced cognitive and molecular deficits via PI3-Kinase dependent pathway. Food and Chemical Toxicology. 2020;145 . doi: 10.1016/j.fct.2020.111684 32805344
44 Peterkofsky B , Gosiewska A , Kipp DE , Shah V , Wilson S . Circulating insulin-like growth factor binding proteins (IGFBPs) 1 and 2 induced in vitamin c-deficient or fasted Guinea pigs inhibit IGF-I action in cultured cells. Growth Factors. 1994;10 . doi: 10.3109/08977199409010989 7528515
45 Bailes J , Soloviev M . Insulin-like growth factor-1 (IGF-1) and its monitoring in medical diagnostic and in sports. Biomolecules. 2021. doi: 10.3390/biom11020217 33557137
46 Nitulescu GM , Van De Venter M , Nitulescu G , Ungurianu A , Juzenas P , Peng Q , et al . The Akt pathway in oncology therapy and beyond (Review). International Journal of Oncology. 2018. doi: 10.3892/ijo.2018.4597 30334567
47 Luo L , Lu AM , Wang Y , Hong A , Chen Y , Hu J , et al . Chronic resistance training activates autophagy and reduces apoptosis of muscle cells by modulating IGF-1 and its receptors, Akt/mTOR and Akt/FOXO3a signaling in aged rats. Experimental Gerontology. 2013;48 . doi: 10.1016/j.exger.2013.02.009 23419688
48 Esteves JV , Enguita FJ , Machado UF . MicroRNAs-Mediated Regulation of Skeletal Muscle GLUT4 Expression and Translocation in Insulin Resistance. Journal of Diabetes Research. 2017. doi: 10.1155/2017/7267910 28428964
49 Schluter JM , Fitts RH . Shortening velocity and ATPase activity of rat skeletal muscle fibers: Effects of endurance exercise training. American Journal of Physiology-Cell Physiology. 1994;266 . doi: 10.1152/ajpcell.1994.266.6.C1699 8023900
50 Tarini VAF , Carnevali LC , Arida RM , Cunha CA , Alves ES , Seeleander MCL , et al . Effect of exhaustive ultra-endurance exercise in muscular Glycogen and both Alpha1 and Alpha2 AMPK protein expression in trained rats. Journal of Physiology and Biochemistry. 2013;69 . doi: 10.1007/s13105-012-0224-5 23184732
51 Yin L , Li N , Jia W , Wang N , Liang M , Yang X , et al . Skeletal muscle atrophy: From mechanisms to treatments. Pharmacological Research. 2021;172 : 105807. doi: 10.1016/j.phrs.2021.105807 34389456
52 Chen CC , Jeon SM , Bhaskar PT , Nogueira V , Sundararajan D , Tonic I , et al . FoxOs Inhibit mTORC1 and Activate Akt by Inducing the Expression of Sestrin3 and Rictor. Developmental Cell. 2010;18 . doi: 10.1016/j.devcel.2010.03.008 20412774
53 Zhang G , Lu BF , Wang E , Wang W , Li Z , Jiao L , et al . Panax ginseng improves physical recovery and energy utilization on chronic fatigue in rats through the PI3K/AKT/mTOR signalling pathway. Pharmaceutical Biology. 2023;61 . doi: 10.1080/13880209.2023.2169719 36695132
54 Sartori R , Romanello V , Sandri M . Mechanisms of muscle atrophy and hypertrophy: implications in health and disease. Nature Communications. 2021. doi: 10.1038/s41467-020-20123-1 33436614
55 Husain A , Alouffi S , Khanam A , Akasha R , Farooqui A , Ahmad S . Therapeutic Efficacy of Natural Product ‘C-Phycocyanin’ in Alleviating Streptozotocin-Induced Diabetes via the Inhibition of Glycation Reaction in Rats. International Journal of Molecular Sciences. 2022;23 . doi: 10.3390/ijms232214235 36430714
56 Silva-Neto AF , Fratelli C , Pucci VG , Boldarine VT , Ferreira YAM , Telles MM , et al . C-phycocyanin extracted from Spirulina using a green solvent approach presents an anti-obesity characteristic in mice fed a hyperlipidic diet. Journal of Functional Foods. 2023;108 . doi: 10.1016/j.jff.2023.105747
57 Caton SJ , Bielohuby M , Bai Y , Spangler LJ , Burget L , Pfluger P , et al . Low-carbohydrate high-fat diets in combination with daily exercise in rats: Effects on body weight regulation, body composition and exercise capacity. Physiology & Behavior. 2012;106 . doi: 10.1016/j.physbeh.2012.02.003 22342194
58 Martins AS , Shkryl VM , Nowycky MC , Shirokova N . Reactive oxygen species contribute to Ca2+ signals produced by osmotic stress in mouse skeletal muscle fibres. Journal of Physiology. 2008;586 . doi: 10.1113/jphysiol.2007.146571 17974587
59 Mikkelsen UR , Fredsted A , Gissel H , Clausen T . Excitation-induced Ca2+ influx and muscle damage in the rat: Loss of membrane integrity and impaired force recovery. Journal of Physiology. 2004;559 . doi: 10.1113/jphysiol.2004.067199 15218060
60 Chen YJ , Baskaran R , Shibu MA , Lin WT . Anti-Fatigue and Exercise Performance Improvement Effect of Glossogyne tenuifolia Extract in Mice. Nutrients. 2022;14 . doi: 10.3390/nu14051011 35267986
61 Hsu YJ , Huang WC , Chiu CC , Liu YL , Chiu WC , Chiu CH , et al . Capsaicin Supplementation Reduces Physical Fatigue and Improves Exercise Performance in Mice. Nutrients. 2016;8 . doi: 10.3390/nu8100648 27775591
62 Huang WC , Chiu WC , Chuang HL , Tang DW , Lee ZM , Wei L , et al . Effect of curcumin supplementation on physiological fatigue and physical performance in mice. Nutrients. 2015;7 : 905–921. doi: 10.3390/nu7020905 25647661
63 Pingitore A , Lima GPP , Mastorci F , Quinones A , Iervasi G , Vassalle C . Exercise and oxidative stress: Potential effects of antioxidant dietary strategies in sports. Nutrition. 2015. doi: 10.1016/j.nut.2015.02.005 26059364
64 Powers SK , Goldstein E , Schrager M , Ji LL . Exercise Training and Skeletal Muscle Antioxidant Enzymes: An Update. Antioxidants. 2023. doi: 10.3390/antiox12010039 36670901
65 Abd Hamid NA , Hasrul MA , Ruzanna RJ , Ibrahim IA , Baruah PS , Mazlan M , et al . Effect of vitamin e (Tri E®) on antioxidant enzymes and DNA damage in rats following eight weeks exercise. Nutrition Journal. 2011;10 . doi: 10.1186/1475-2891-10-37 21513540
66 Kitaoka Y. The role of nrf2 in skeletal muscle on exercise capacity. Antioxidants. 2021;10 . doi: 10.3390/antiox10111712 34829582
67 Pala R , Orhan C , Tuzcu M , Sahin N , Ali S , Cinar V , et al . Coenzyme Q10 supplementation modulates NFκB and Nrf2 pathways in exercise training. Journal of Sports Science and Medicine. 2016;15 .
68 Wang Y , Xiang Y , Wang R , Li X , Wang J , Yu S , et al . Sulforaphane enhances Nrf2-mediated antioxidant responses of skeletal muscle induced by exhaustive exercise in HIIT mice. Food Science and Human Wellness. 2022;11 . doi: 10.1016/j.fshw.2022.04.035
69 Yang M , Teng S , Ma C , Yu Y , Wang P , Yi C . Ascorbic acid inhibits senescence in mesenchymal stem cells through ROS and AKT/mTOR signaling. Cytotechnology. 2018;70 . doi: 10.1007/s10616-018-0220-x 29777434
70 Righi NC , Schuch FB , De Nardi AT , Pippi CM , de Almeida Righi G , Puntel GO , et al . Effects of vitamin C on oxidative stress, inflammation, muscle soreness, and strength following acute exercise: meta-analyses of randomized clinical trials. European Journal of Nutrition. 2020. doi: 10.1007/s00394-020-02215-2 32162041
71 Bulduk E , Gonul B , Ozer C . Effects of vitamin C on muscle glycogen and oxidative events in experimental diabetes. Molecular and Cellular Biochemistry. 2006;292 . doi: 10.1007/s11010-006-9226-3 16758299
72 Romay C , Ledon N , González R . Further studies on anti-inflammatory activity of phycocyanin in some animal models of inflammation. Inflammation Research. 1998;47 . doi: 10.1007/s000110050338 9754867
