
==== Front
J Mol Neurosci
J Mol Neurosci
Journal of Molecular Neuroscience
0895-8696
1559-1166
Springer US New York

39251453
2234
10.1007/s12031-024-02234-2
Research
Sex-Specific ADNP/NAP (Davunetide) Regulation of Cocaine-Induced Plasticity
Toren Yael 1
Ziv Yarden 12
Sragovich Shlomo 1
McKinney R. Anne 3
Barak Segev 2
Shazman Shula 4
Gozes Illana igozes@tauex.tau.ac.il

1
1 https://ror.org/04mhzgx49 grid.12136.37 0000 0004 1937 0546 The Elton Laboratory for Molecular Neuroendocrinology, Department of Human Molecular Genetics and Biochemistry, Faculty of Medicine, Sagol School of Neuroscience and Adams Super Center for Brain Studies, Tel Aviv University, Tel Aviv, 6997801 Israel
2 https://ror.org/04mhzgx49 grid.12136.37 0000 0004 1937 0546 School of Psychological Sciences, Sagol School of Neuroscience, Tel Aviv University, Tel Aviv, 6997801 Israel
3 https://ror.org/01pxwe438 grid.14709.3b 0000 0004 1936 8649 Department of Pharmacology and Therapeutics, McGill University, Montreal, Canada
4 https://ror.org/027z64205 grid.412512.1 0000 0004 0604 7424 Department of Mathematics and Computer Science, The Open University of Israel, Ra’anana, Israel
10 9 2024
10 9 2024
2024
74 3 7625 5 2024
29 5 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Cocaine use disorder (CUD) is a chronic neuropsychiatric disorder estimated to effect 1–3% of the population. Activity-dependent neuroprotective protein (ADNP) is essential for brain development and functioning, shown to be protective in fetal alcohol syndrome and to regulate alcohol consumption in adult mice. The goal of this study was to characterize the role of ADNP, and its active peptide NAP (NAPVSIPQ), which is also known as davunetide (investigational drug) in mediating cocaine-induced neuroadaptations. Real time PCR was used to test levels of Adnp and Adnp2 in the nucleus accumbens (NAc), ventral tegmental area (VTA), and dorsal hippocampus (DH) of cocaine-treated mice (15 mg/kg). Adnp heterozygous (Adnp +/−)and wild-type (Adnp +/−) mice were further tagged with excitatory neuronal membrane-expressing green fluorescent protein (GFP) that allowed for in vivo synaptic quantification. The mice were treated with cocaine (5 injections; 15 mg/kg once every other day) with or without NAP daily injections (0.4 µg/0.1 ml) and sacrificed following the last treatment. We analyzed hippocampal CA1 pyramidal cells from 3D confocal images using the Imaris x64.8.1.2 (Oxford Instruments) software to measure changes in dendritic spine density and morphology. In silico ADNP/NAP/cocaine structural modeling was performed as before. Cocaine decreased Adnp and Adnp2 expression 2 h after injection in the NAc and VTA of male mice, with mRNA levels returning to baseline levels after 24 h. Cocaine further reduced hippocampal spine density, particularly synaptically weaker immature thin and stubby spines, in male Adnp+/+) mice while increasing synaptically stronger mature (mushroom) spines in Adnp+/−) male mice and thin and stubby spines in females. Lastly, we showed that cocaine interacts with ADNP on a zinc finger domain identical to ketamine and adjacent to a NAP-zinc finger interaction site. Our results implicate ADNP in cocaine abuse, further placing the ADNP gene as a key regulator in neuropsychiatric disorders. Ketamine/cocaine and NAP treatment may be interchangeable to some degree, implicating an interaction with adjacent zinc finger motifs on ADNP and suggestive of a potential sex-dependent, non-addictive NAP treatment for CUD.

Keywords

Cocaine
Addiction
ADNP
NAP
Structural plasticity
Sex differences
Tel Aviv UniversityOpen access funding provided by Tel Aviv University.

issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Cocaine use disorder (CUD) is a chronic disorder characterized by compulsive drug-seeking and consumption, as well as symptoms of craving and withdrawal (Schwartz et al. 2022). Cocaine exposure can cause rapid and long-lasting changes in the central nervous system, disrupting learning and memory processes and promoting addictive behavior (Nestler 2001). These cocaine-induced neuroadaptations include changes in gene expression (Fernandez-Castillo et al. 2022), synaptic plasticity (Spronk et al. 2013), and structural remodeling at the level of the dendritic spine, the main site of excitatory synapses (Dos Santos et al. 2017; Dumitriu et al. 2012). For example, cocaine increases spine density in medium spiny neurons of the nucleus accumbens (NAc) (Robinson and Kolb 1999), and these changes can be rapid (Madangopal 2017), sub-regional, and sub-type specific (Dumitriu et al. 2012) and induced by even a single dose of cocaine (Shen et al. 2009).

From a neurochemical point of view, a 2019 study showed that microtubule (MT) end binding protein 3 (EB3), essential for dendritic spine formation, mediates structural and behavioral adaptation during withdrawal from cocaine self-administration (Calipari et al. 2019). The same study also suggested the involvement of the actin cytoskeletal system. A separate work by Damuka et al. demonstrated changes in MTs in vitro, in vivo, and ex vivo in a rodent model of CUD, further linking the cytoskeletal system with cocaine (Damuka et al. 2022).

In both human and animal models, there is evidence for biologically based sex differences underlying CUD (Fattore et al. 2020; Becker 2016). Using quantitative proteomics, a recent study found that cocaine induces non-overlapping protein expression patterns in male and females, with differences in drug-associated proteins GRM2, VPS51, SATT, VGLU3, IPO4, VAMP1, and CYFP2 (Lopez et al. 2021). A systematic review further puts the solute carrier family 6, neurotransmitter transporter, serotonin, member 4 (SLC6A4) as a major gene common to addiction, depression, and anxiety (Kaushik et al. 2023).

First discovered in Professor Illana Gozes laboratory, activity-dependent neuroprotective protein (ADNP) is an essential protein for brain development and cognitive functioning (Bassan et al. 1999; Zamostiano et al. 2001). ADNP is a leading autism spectrum disorder (ASD)-linked gene (Helsmoortel et al. 2014) and is further associated with Alzheimer’s disease (Gozes 2024), schizophrenia (Dresner et al. 2011), and stress response (Sragovich et al. 2019a, b) and is protective in fetal alcohol syndrome (Poggi et al. 2003; Pascual and Guerri 2007). Recently, we presented ADNP as an alcohol-responsive gene and negative regulator of alcohol consumption in adult female mice (Ziv et al. 2019), and the question arises whether ADNP is also involved in cocaine use disorder.

Significantly, ADNP regulates many cellular processes that could be relevant to CUD, including transcription, and autophagy (Sragovich et al. 2017). As part of the SWI/SNF chromatin remodeling complex, ADNP regulates transcription of over 400 genes (Mandel et al. 2008), including SLC6A4 (Amram et al. 2016), and P13-K/Akt, which activate several intracellular signaling pathways (Pascual and Guerri 2007; Hacohen-Kleiman et al. 2018; Karmon et al. 2022) involved in drug addiction (Cao et al. 2016). Its protective activity on nerve cells is largely mediated through its NAP motif (single amino acid code, NAPVSIPQ, also called CP201 or davunetide) interacting with MT end-binding proteins EB1 and EB3 (Oz et al. 2014).

In clinical studies, NAP, the ADNP active peptide fragment, has been shown to protect cognitive and functional activity in patients with mild cognitive impairment (Morimoto et al. 2013), as well as in schizophrenia patients (Vaisburd et al. 2015), in women suffering from progressive supranuclear palsy (PSP) (Gozes et al. 2023), and is currently under development for the treatment of ADNP syndrome (Gozes 2024). These data, along with favorable brain bioavailability and safety profile (Sragovich et al. 2019a, b; Gozes et al. 2005), position NAP as a promising drug candidate for neuropsychiatric disorders.

Notably, we (the Gozes laboratory) discovered extensive sex-dependent deficiencies in ADNP-mutated mice (Gozes 2017), coupled with sex-dependent effects on dendritic spines, axonal transport, and tubulin isotype expression (Amram et al. 2016; Hacohen-Kleiman et al. 2018; Karmon et al. 2022; Sragovich et al. 2019a, b; Vulih-Shultzman et al. 2007). These include the findings that hippocampal ADNP transcript are doubled in male vs. female Adnp+/− mice, with male Adnp+/− mice exhibiting greater impairments in object recognition and social memory (Malishkevich et al. 2015). Additionally, NAP treatment increased the expression of Nlgn2 and Nlgn3 (neuroligins) in the young Adnp+/− male mouse cortex, while it decreased these transcripts in the older Adnp+/− male with no effect in females, suggesting that ADNP/NAP are involved in sexually dichotomous brain plasticity (Hacohen-Kleiman et al. 2018). Importantly, we discovered significant increase in males (but not females) of the hippocampal Slc6a4 levels in the Adnp+/−, compared with Adnp+/+ mice. Treatment with the NAP EB1/EB3 active site SKIP reduced Slc6a4 expression levels in the hippocampus of the Adnp+/− mice to control levels, whereas the control peptide, D-SKIP, did not (Amram et al. 2016).

Taken together with ADNP promotion of sex-dependent neuronal morphogenesis/plasticity (Bennison et al. 2023), ADNP-mediated regulation of steroid biosynthesis genes (Grigg et al. 2020), sexually dichotomized (Malishkevich et al. 2015), estrous cycle (Furman et al. 2005), and gonadotropin-releasing hormone receptor (Gnrhr)-correlated ADNP expression (Kapitansky et al. 2020) all imply potential sex-dependent association of ADNP with cocaine addiction.

In 2001, the Gozes laboratory first described ADNP2, as a family member paralogue/homologue to ADNP (Zamostiano et al. 2001), further revealing ADNP2 protection against oxidative stress (Kushnir et al. 2008). ADNP/ADNP2 control of erythropoiesis (Dresner et al. 2012) and ADNP/ADNP2 coregulation (Giladi et al. 2007; Malishkevich et al. 2015) with dysregulation association with aging (Kapitansky and Gozes 2019), as well as brain disorders, such as schizophrenia (Dresner et al. 2011; Merenlender-Wagner et al. 2015) and Alzheimer’s disease (Malishkevich et al. 2016). Additionally, a de novo single nucleotide variation in ADNP2 has been associated with developmental abnormalities (Chung et al. 2015), and CpG hypermethylation of ADNP2 has been linked with post-traumatic stress disorder (PTSD) (Bainomugisa et al. 2021).

In this study, we tested whether cocaine exposure affects Adnp/Adnp2 expression in the mesolimbic system in wild-type mice. We next utilized the Adnp-deficient mouse model (Hacohen-Kleiman et al. 2018) to investigate the role of ADNP/NAP in cocaine-induced plasticity, namely, dendritic spine content and structure, in a sex dependent manner. We then demonstrated that cocaine (like ketamine; Ganaiem et al. 2023) and NAP show in silico affinity to adjacent ADNP Zn finger domains. Finally, we review possible mechanisms through which ADNP might mediate cocaine-response and conclude by discussing implications of the role of ADNP/NAP in cocaine addiction for future prevention and treatment.

Methods and Materials

Animals

All protocols conformed the guidelines of the Institutional Animal Care and Use Committee of Tel Aviv University and the Israeli Ministry of Health, as well as the guidelines of the NIH (animal welfare assurance number A5010-01). All efforts were made to minimize the number of animals used. All animals were housed in Tel-Aviv University Animal Facility (12-h light-dark cycle—lights on at 4 a.m., food, and water ad libitium). C57BL/6J mice (25–30 g) were housed 3–4/cage; Adnp+/+ and littermates, Adnp+/− mice (outbred with ICR strain for 30 generations in Tel-Aviv University Animal Facility; 25–30 g) (Sragovich et al. 2019a, b; Hacohen-Kleiman et al. 2018; Ziv et al. 2019) were individually housed. Bedding was standard sterilized dust-saw, and rodent chow used were Teklad Global 18% protein (Envigo, Israel).

Cocaine Administration by Intraperitoneal (IP) Injection

Three-month-old male and female mice of ICR background were bred with a second strain of C57BL mice which are transgenic for the GFP gene (Chang et al. 2014), resulting in Adnp+/+/+/−GFP black mice.

The mice first underwent 2 days of handling, followed by 3 days of habituation in which they were injected with saline. Following habituation, the mice were treated with either cocaine 15 mg/kg (10 ml/kg) or saline (10 ml/kg) and a secondary treatment included either 4 µg NAP (0.1 ml/per animal) or 0.1 ml saline for 5 days, every other day. This is consistent with an intermittent injection schedule which is known to produce sensitization, a process thought to underlie drug craving and relapse (Oliveira-Lima et al. 2017; Steketee 2005). This protocol is consistent with previously published work (Gaval-Cruz et al. 2012; Goltseker et al. 2017). All of the mice were sacrificed immediately after the fifth session, and their brains were processed for further analysis.

Tissue Collection

Brains were quickly removed from euthanized mice and placed on an ice-cold platform. Tissues from the nucleus accumbens (NAc), dorsal hippocampus (DH), and ventral tegmental area (VTA), brain regions having a major role in the mesolimbic system, which is strongly linked to reward and addiction, were carefully dissected from 1-mm slices using a brain matrix and immediately snap-frozen in liquid nitrogen and stored at − 80 °C until use. Further analysis included quantitative reverse transcription-real-time polymerase chain reaction (qRT-PCR), as previously described (Ziv et al. 2019) and illustrated below.

RNA Extraction from Mouse NAc, VTA, and DH Samples (Ziv et al. 2019)

Different brain areas were kept inside 1.5 ml RNAase free vials.  A 500 µl of TRIzol reagent were added to the samples along with mechanical crushing using a plastic pestle to breakdown the brain cells. A 100 µl of chloroform were added to separate the RNA from DNA and cell debris. The samples underwent centrifugation, and 150–200 µl of the top clear layer were taken from each vial. Each sample was mixed with 900 µl of ethanol 100% and 30 µl of sodium acetate and was incubated for 4 h in -20 °C. After 4 h, the samples underwent another centrifugation and were washed using 750 µl of ethanol 70%. Each sample was dried and re-suspended in 20 µl of ultra-pure water. A 280 µl of ultra-pure water were added to all samples, and the samples were mixed again with 900 µl of ethanol 100% and 30 µl of sodium acetate and were incubated in -20 °C overnight. The day after the above procedures, the samples were washed and dried again as described earlier (Krebs et al. 2009).

Real-time PCR (Ziv et al. 2019)

The expression levels of the Adnp, Adnp2, and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA species were analyzed by quantitative real time PCR.

Reverse transcription was performed, using the total RNA that was extracted from the mouse brain samples. The amplification was done by using SYBR Green PCR mix. The relative quantity of the specific mRNA expression was determined, using the ΔΔCt method, and the changes in expression were normalized to Gapdh.

The primers that were used for amplification are the following:

Adnp: F (ACGAAAAATCAGGACTATCGG)

R (GGACATTCCGGAAATGACTTT)

Adnp2: F (GGAAAGAAAGCGAGATACCG)

R (TCCTGGTCAGCCTCATCTTC)

Gapdh: F (CCAGAACATCATCCCTGC)

R (GGAAGGCCATGCCAGTGAGC)

Gapdh is a common reference gene for measuring mRNA expression (Dundas and Ling 2012), frequently used in cocaine studies (Fischer et al. 2022; Caffino et al. 2011; Fumagalli et al. 2006). As explained in previous work (Ziv et al. 2019), there is no reference gene appropriate for all experiments, and future studies can further explore this.

Dendritic Spine Quantification and Analysis

Three-month-old mice of ICR background were bred with a second strain of C57BL mice, which are transgenic for the GFP gene, to produce an Adnp+/–- mGFP mouse model (Chang et al. 2014; Paola et al. 2003). The breeding resulted in Adnp+/+/+/-GFP black mice. Mice were divided to groups according to sex, genotype, primary treatment (cocaine/vehicle), and secondary treatment (NAP/saline). Experiment duration was 9 days: On days 1, 3, 5, 7, and 9, the mice received cocaine (15 mg/kg, 10 ml/kg), or saline I.P. injection (10 ml/kg) and a second injection of either 4 µg NAP (0.1 ml/per animal) or 0.1 ml saline. On the days when the mice did not participate in a session, an injection of either 4 µg NAP (0.1 ml/per animal) or 0.1 ml saline was administered in the home cages. On day 9, mice were perfused, and brains were extracted (Hacohen-Kleiman et al. 2018). We analyzed CA1 pyramdial cells ~ 6–40 tertiary dendrites per animal from 3D confocal images, using the Imaris x64.8.1.2 (Oxford Instruments) software. Data were analyzed by normalizing the number of spines to dendrite length and group pooling of all animal results.

Statistical Analysis

Results are described as means ± standard error of the mean (SEM). Data generated from qRT-PCR experiments was analyzed by one-way ANOVA, with a group factor (2–24 h after cocaine injection). LSD post-hoc analysis followed significant effects. Gene expression levels were normalized to Gapdh expression, and each brain region was normalized to its own control. For the dendritic spine data, two-way ANOVA with Tukey’s post hoc was conducted to see effect of genotype x treatment on total spine density and subtypes (ANOVA; SPSS 14). To compare effects of treatment within the same genotype, one-way ANOVA with Tukey’s post hoc was performed. Additional analyses that compared only two groups, for example, male and female data for each group, were performed using unpaired Student’s t-test (SPSS 14). P values of < 0.05 were deemed statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001).

In silico modeling 

I-TASSER (https://zhanggroup.org/I-TASSER) was used for protein structure modelling, and HDOCK (http://hdock.phys.hust.edu.cn/) was used for in silico protein/protein docking of ADNP, cocaine (structure taken from pdb : 1I7Z), ketamine (as before (Ganaiem et al. 2023), and NAP. PatchFinderPlus (PFplus) (https://bindup.technion.ac.il/) (Shazman et al. 2007) was used for electrostatic calculations. PyMOL software was used to create figures.

Results

Cocaine Administration by Intraperitoneal (IP) Injection Causes an Apparent Short-Term Decrease in Adnp and Adnp2 mRNA Levels in Male Mice

We first tested how cocaine affects Adnp and Adnp2 expression in wild-type C57BL mice. Cocaine primarily targets the mesolimbic system; therefore, we focused on three mesolimbic brain regions: NAc, VTA, and DH. As shown in Fig. 1, in male mice, we saw a reduction of Adnp mRNA levels in the NAc (Fig. 1A) and of Adnp2 in the NAc and VTA (Fig. 1B) 2 h after the last cocaine injection, with a return to baseline after 24 h. In contrast, in female mice, we saw no change in Adnp expression in the NAc, VTA, or DH at either time point (Fig. 1C), but there was a significant increase of Adnp2 expression in the DH 24 h after cocaine treatment (Fig. 1D).

Fig. 1 Cocaine administration affects Adnp and Adnp2 relative expression following cocaine injections in males and female mice; 3-month-old male and female mice were administered with either 15 mg/kg of cocaine or saline (10 ml/kg)﻿ 3 times every other day. At the age of 4 months, the mice were given an additional injection and were sacrificed either 2 h after the injection or 24 h later. The brains were removed, and the NAc, VTA, and DH were recovered. Each brain region’s results are normalized to its own saline control. Adnp and Adnp2 expression was determined using real time PCR. Results are expressed as mean ± SEM and normalized to Gapdh #p < 0.1, *p < 0.05, **p < 0.01, ***p < 0.001. (n = 5–6/per group). A One-way ANOVA shows a trend of decrease in Adnp expression in the male NAc 2 h post-injection (F(2,15) = 6.897, p = 0.008) (LSD post hoc, p = 0.062) followed by an increase back to basal levels, 24 h later. No effects were found in the VTA or DH (*p > 0.05). B Adnp2 levels were significantly reduced in both male NAc and VTA, 2 h after the cocaine injection (NAc: F(2,15) = 4.120, p = 0.037, LSD post hoc, p = 0.013; VTA: F(2,13) = 7.681, p = 0.006, LSD post hoc, p = 0.002). No significant difference was detected in the DH (*p > 0.05). C In female mice, there was no change in Adnp expression in the tested regions (*p > 0.05), D but Adnp2 was increased in the DH 24 h after injection (F(2,15) = 4.646, p = 0.03, LSD post hoc, p = 0.046)

Cocaine and NAP Control Dendritic Spine Growth in a Spine- and Sex-Dependent Manner

Given that both cocaine (Calipari et al. 2019) and ADNP/NAP are known to regulate spine dynamics (Hacohen-Kleiman et al. 2018; Karmon et al. 2022), we then measured the effects of cocaine and cocaine/NAP on dendritic spines in Adnp-deficient (Adnp+/−) versus wild-type mice (Adnp+/+) (Fig. 2A). We found that in Adnp+/+ mice, both cocaine and cocaine/NAP treatment, reduced total spine density in males (Fig. 2B, ***p < 0.001), with no change in female mice (Fig. 2C, p = 0.9). The NAP direct effects were studied before and published, showing no treatment effect in females and a spine number reducing effect in males, coupled with significantly increased protective shaft synapse volumes (Hacohen-Kleiman et al. 2018).

Changes in spine morphology have been suggested to represent differences in their function (Yuste and Bonhoeffer 2001), with thin spines seen as transient/immature (“learning”) spines and mushroom spines considered stable/mature (“memory”) spines (Hering and Sheng 2001; Bourne and Harris 2007). For this reason, further measurements were made for dendritic spine subgroups classified on the basis of the following morphology types: stubby spines (< 0.5 µm in length, lacking a clear head), mushroom spines (mushroom-shaped head, approximately 1 µm in length), thin spines (with an elongated narrow neck with a distinctive head), and filopodia (McKinney 2010). Our results showed that cocaine selectively reduced stubby (Fig. 2D, **p < 0.01) and thin (***p < 0.001) spines in male mice, with cocaine/NAP treatment decreasing mushroom-type spines. In female Adnp+/+ mice, cocaine also reduced mushroom spines (Fig. 2E, ***p < 0.001) but increased stubby and thin spines (***p < 0.001), thereby keeping the total spine density stable.

Fig. 2 Sub-chronic cocaine and cocaine/NAP exposure decreases total hippocampal spine density in male Adnp+/+ mice, with no change in female mice. In both sexes, cocaine treatment is associated with morphological changes. Each of the experimental groups described below included 3–4 independent mice and the total number of dendritic spines counted per the entire experimental group is delineated below (analyzing ~ 6–40 tertiary dendrites/mouse). A  Representative image of GFP-labeled CA1 pyramidal neuron dendritic spines from Adnp+/+ male or female mice treated with control vehicle, cocaine, or cocaine + NAP. Scale bar = 3 μm. Average total spine density in Adnp+/+ mice (males,  Adnp+/+ n  = 75, Adnp+/+  cocaine n  = 66, Adnp+/+ NAP + cocaine n  = 69; females,  Adnp+/+ n  = 48, Adnp+/+  cocaine n  = 41, Adnp+/+  cocaine + NAP n  = 51). A two-way ANOVA with Tukey’s post hoc test was performed, followed by one-way ANOVA to determine treatment effects within Adnp+/- groups. Additional Student’s t test was performed to determine sex differences. Underlined numbers beneath the graphs represent the mean ± SEM. B  For male Adnp+/+ mice, there was a main effect of treatment on total spine density [F(3,271) = 16.051, ***p < 0.001], D  as well as on mushroom [F(3,271) = 4.470, **p < 0.005], stubby [F(3,271) = 10.482, ***p < 0.001], and thin [F(3,272) = 6.812, ***p < 0.001] subtypes. Tukey’s post-hoc revealed a significant effect on total spine density of cocaine (***p  < 0.001) and combined cocaine/NAP (**p < 0.001) treatment, as well as significant differences in stubby and thin subtype with cocaine (***p = 0.001) and cocaine/NAP (***p  < 0.001). C For female Adnp+/+ mice, there was no effect of treatment on total spine density. [F(3,185) = 0.1940, p  = 0.9]. E However, there was a significant effect of treatment on mushroom [F(3,184) = 73.913, p < 0.001], stubby [F(3,184) = 6.748, ***p < 0.001], and thin [F(3,183) = 14.569, ***p  < 0.001] spine subtypes

Cocaine Increases Dendritic Spine Density in Adnp-Deficient Mice

Adnp+/− mice have reduced dendritic spine density as compared to wild-type mice (Vulih-Shultzman et al. 2007), which is ameliorated by NAP treatment (see Hacohen-Kleiman et al. 2018 for full NAP results). Here, we found that (like NAP) cocaine treatment increases hippocampal spine density in male and female Adnp+/− mice (Fig. 3A, B, C). Interestingly, in male mice, there was an additive (synergistic) effect of cocaine and NAP, with combined treatment resulting in the greatest increase in spine density (***p < 0.001) and complete normalization.

Mushroom spines in particular are reduced with Adnp deficiency and increased by NAP treatment (Hacohen-Kleiman et al. 2018). Building on these data, we showed that cocaine similarly increases mushroom spines in male Adnp+/− mice (Fig. 3D, ***p < 0.001), with combined cocaine/NAP treatment showing the greatest increase (***p < 0.001). The opposite was true in female Adnp+/− mice, with cocaine decreasing mushroom spines (Fig. 3E, ***p < 0.001) and combined cocaine/NAP further reducing mushroom density but increasing stubby/thin spine subtypes (***p < 0.001). That cocaine/NAP initiate similar forms of structural remodeling (i.e., bias toward stable, mushroom spines in male mice, and toward immature thin/stubby spines in females) could reflect the induction of shared, sex-dependent signaling pathways.

Fig. 3 Adnp+/− mice have decreased hippocampal spine density, ameliorated by both cocaine and NAP treatment. Notably, in male Adnp+/− mice, there is a synergistic effect of combined treatment, with cocaine/NAP resulting in the greatest increase. Each of the experimental groups described below included 4–5 independent mice, and the total number of dendritic spines counted per the entire experimental group is delineated below (analyzing ~ 6–40 tertiary dendrites/mouse). A Representative image of GFP-labeled CA1 pyramidal neuron dendritic spines from Adnp+/− male or female mice treated with control vehicle, cocaine or cocaine + NAP. Scale bar = 3 μm. Average total spine density in Adnp+/– males (Adnp+/– [n = 75, Adnp+/– cocaine n = 66, Adnp+/– NAP + cocaine n = 69) and females (Adnp+/+ n = 45, Adnp+/− n  = 23, Adnp+/− cocaine n = 50, Adnp+/− cocaine + NAP n  = 44). A two-way ANOVA with Tukey’s post hoc test was performed, followed by one-way ANOVA to determine treatment effects within Adnp+/− groups. Additional Student’s t test was performed to determine sex differences. Underlined numbers beneath graphs represent the mean ± SEM. B In male mice, for total spine density, main genotype [F(1,545) = 23.479, **p < 0.001] and interaction [F(3,545) = 6.388, ***p < 0.001] effects were found. C In female mice, for total spine density, main genotype [F(1,231) = 59.957, ***p < 0.001] and treatment [F(3,231) = 27.516, * **p <  0.001] effects were found. Tukey’s post hoc revealed significant differences between cocaine (***p < 0.001) versus vehicle-treated mice. D For male Adnp +/– mice, 1-way ANOVA revealed a main effect of treatment on mushroom [F(3,278) = 1.649, ***p < 0.001] and stubby [F(3,277) = 5.737, *** p = 0.001] spines. Tukey’s post hoc revealed significant differences in mushroom and stubby spines density between cocaine/NAP-treatment versus cocaine alone (mushroom ***p < 0.001, stubby p = 0.003) treatment alone. E For females, a main effect for treatment was seen for mushroom [F(3,184) = 77.173, ***p  < 0.001], stubby [F(3,184) = 52.076, ***p  < 0.001], and thin [F(3,184) = 1.258, ***p < 0.001] spines

Cocaine and NAP Show In Silico Affinity to Adjacent ADNP Zinc Finger Domains

Lastly, we used in silico modeling to explore possible cocaine/NAP interactions. Our most recent results (Ganaiem et al. 2023) partly explain the NAP effects on gene expression, showing NAP nuclear penetrance and a NAP direct interaction with an ADNP zinc finger domain (Ganaiem et al. 2023). Given the fact that cocaine may partly regulate ADNP expression (Fig. 1) and that ADNP auto-regulates its own synthesis (Mandel et al. 2007; Aboonq et al. 2012), we investigated in silico interactions of cocaine and ADNP. Our results identified cocaine proximity and presumptive interaction with a zinc finger. The identified zinc finger was localized on ADNP amino acids 489–510 (Fig. 4A, ADNP sequence, Fig. 4B an overall view of cocaine-ADNP interaction, Fig. 4C, zooming in on ADNP-cocaine interaction, ZnF denotes zinc finger).

Interestingly, this specific ZnF also interacts with ketamine (Ganaiem et al. 2023) (Fig. 4D), which in turn interacted also with the second EB1/EB3 interacting SIP motif (except for NAP), denoted SIP2 (yellow highlights) (see also Fig. 5). Figure 5 tested for NAP interactions in the presence of cocaine (and compared to ketamine) showing proximity amongst these different molecules on the ADNP surface, with NAP closest proximity to the adjacent ZnF, namely amino acids, 512–535 on ADNP.

Fig. 4 Cocaine interacts with ADNP on a zinc finger domain identical to ketamine. Experimental means are delineated in the methods section. A The ruler on top indicates the human ADNP linear amino acid sequence at the site of ketamine binding (red single letter amino acid code). The NAP motif (NAPVSIPQ, amino acids, 354–361, on ADNP) is indicated in blue (or cyan), including the EB1/EB3 binding SIP sequence. The second ADNP-SIP motif ADNP amino acids, 308–310 (SIP2), is also shown on the ruler in yellow. Zinc fingers (Znf) are shown in purple. B ADNP, surface view, and cocaine circled in green sticks are shown (HOX, pink, represents the ADNP homeobox domain) (Zamostiano et al. 2001; Ganaiem et al. 2023). C Represents an enlargement of (A) focusing on the Znf. D Zooming in on cocaine (circled in green) and ketamine (sticks) interactions with ADNP

Fig. 5 Cocaine interacts with ADNP on a zinc finger domain identical to ketamine and adjacent to a NAP-zinc finger interaction site. ADNP surface view enlarged with cocaine, ketamine, and NAP docking (details are delineated in the methods and in Fig. 4 legend)

Discussion

Here, we introduce ADNP and its active peptide fragment, NAP, as a novel regulator of cocaine-induced plasticity. Our finding that cocaine differentially changes Adnp/Adnp2 transcript levels in male vs. female mice adds to a growing literature describing sex differences in cocaine use (Becker 2016) and highlight genetic and synaptic changes underlying these differences.

Previously, we showed that Adnp and Adnp2 levels are increased in the dorsal hippocampus of male and female mice and in the NAc of females, following repeated alcohol injection (Ziv et al., 2019). In contrast, cocaine caused a short-term decrease in Adnp and Adnp2 mRNA levels in male, but not female mice. Taken together, current data support the role of ADNP in mediating substance abuse in a drug- and sex-dependent manner.

The fact that we found similar dendritic phenotypes after cocaine and NAP (Hacohen-Kleiman et al. 2018) suggests that both activate shared (sex-dependent) pathways to modulate spine growth (as evidenced by increased thin spines) and maturation (as evidenced by increased mushroom spines) in CA1 pyramidal cells in the hippocampus. Spine stabilization is dependent on the entry of MT-EB3 plus ends into dendritic spine heads, suggesting that cocaine/NAP may differentially effect MT dynamics in male versus female mice. This agrees with our results on robust sex differences in a novel Adnp genome-edited mouse model, carrying the most abundant ADNP heterozygous pathologic mutation (Karmon et al. 2022).

Given that ADNP/NAP and cocaine are known to interact with MT-EB proteins, it is possible that the cocaine-ADNP connection is mediated through the microtubular system. Cocaine primarily acts on monoamine transporters, raising synaptic dopamine (DA), norepinephrine, and serotonin levels by blocking neurotransmitter reuptake (Solinas et al 2019). Among its many downstream effects, cocaine-induced increases in DA lead to activation of Arc (activity-regulated cytoskeletal-associated protein) (Tan et al. 2000), as well as overexpression of dopamine transporter (DAT) and alpha synuclein (Mash et al. 2008). Overexpression of alpha synuclein is associated with impaired microtubule-dependent trafficking and assembly, as well as Tau phosphorylation and aggregation (Oikawa et al 2016). Cocaine has been shown to increase levels of phosphorylated Tau in both cocaine-treated rats (Liu et al. 2003) and in the post-mortem brains of young drug abusers (Ramage et al. 2005).

ADNP is protective against dopamine and 6-OHDA toxicity in vitro (Offen et al. 2000), and NAP has been shown to reduce Tau phosphorylation in vivo (Shiryaev et al. 2009). Moreover, in mice overexpressing alpha synuclein, NAP treatment improved behavioral deficits, recovered motor function, and decreased both alpha synuclein inclusions and Tau hyperphosphorylation (Fleming et al. 2011; Magen and Gozes 2013). A complementary mechanism may involve actin, with cocaine inactivating cofilin, a primary regulator of the neuronal actin cytoskeleton (Sequeira et al. 2023), and with ADNP including an actin binding site (Ivashko-Pachima et al. 2022). Additional shared cocaine-ADNP pathways may involve Wnt/beta-catenin signaling (Cuesta et al. 2017a, b; Sun et al. 2020), SIRT1 activation (Ferguson et al. 2015; Hadar et al. 2021), and autophagy (Guo et al. 2015; Amram et al. 2016).

A pattern for all drugs of abuse is that females begin to use drugs at lower doses than males, but their use escalates more rapidly, and it is more difficult for females to quit once addicted (Fattore et al. 2020). Women show an enhanced response to cocaine, and abstinent women report higher levels of craving when exposed to cocaine-related cues (Becker 2016; Robbins et al. 1999). From a neurobiological perspective, these differences are driven by both gonadal hormones and sex chromosome complement (Knouse and Briand 2021; Hu et al. 2004) (for a full review of sex differences in cocaine use disorder, see Becker 2016; Fattore et al. 2008; Harp, et al. 2020; Kokane and Perrotti 2020 Peart et al. 2022).

The ovarian hormone estradiol (E2) is crucial in mediating behavioral and physiological responses to cocaine (Peart et al. 2022; Justice and Wit 2000), including sensitivity to the drug and symptoms of withdrawal/craving. Estradiol regulates structural plasticity through multiple pathways, including activation of metabotropic glutamate receptor type 5 (mGluR5), the extracellular signal-regulated kinase/mitogen activated protein kinase (ERK/MAPK) pathway, cyclic AMP response element binding protein (CREB), and activation of the mammalian target of rapamycin (mTOR) protein synthesis pathway (Lacy et al. 2016; Knouse and Briand 2021).

Significantly, ADNP is a vasoactive intestinal peptide (VIP)-responsive gene, and VIP is regulated by estrogen in the hypothalamus (Gozes et al. 1989; Gozes 2024). ADNP levels in hypothalamus and arcuate nucleus are mediated by the estrous cycle, with pro-estrous sections being the most ADNP-immunoreactive (Furman et al. 2005). As highlighted in depth earlier in this paper, ADNP is a sexually dimorphous gene. Our discovery that the ADNP gene mediates some effects of cocaine on spine morphology add to our understanding of structural mechanisms underlying sex differences in CUD. We suggest future studies using the Adnp+/− animal model to test the relationship between sex- cocaine use- structural plasticity.

Clinically, the ADNP-cocaine connection is especially relevant for individuals with deregulated ADNP, i.e., patients with autism spectrum disorder and patients with schizophrenia. Both populations may be at risk for substance abuse disorders (Ressel et al. 2020; Winklbaur et al. 2006) and present additional challenges in treatment (De Witte et al. 2014; Helverschou et al. 2019).

More broadly, individuals with pre-existing cognitive deficits and/or comorbid conditions affecting cognitive function are more vulnerable to drug-abuse (Majewska 1996; D’Souza 2019). Cocaine can worsen pre-existing and induce new cognitive impairments, both of which are correlated with decreased neurogenesis (D’Souza 2019). In addition, repetitive administration and high, short-term doses impair hippocampal neurogenesis (Yamaguchi et al. 2004; Sudai et al. 2011), though if taken acutely, cocaine can improve hippocampal function (Thompson et al. 2002) and prospective memory (Hutten et al. 2018). Conversely, promoting hippocampal neurogenesis in rats has been shown to reduce the rates of drug use and relapse (Noonan et al. 2010; Deschaux et al. 2014). These and related findings suggest that enhancing neurogenic activity and/or cognitive function could be one approach for treating CUD (Mash et al. 2008). For example, modafinil is a cognitive enhancer that has been tested as a treatment option (Anderson et al. 2009; Brandt et al. 2021; Buchholz and Saxon 2019; Sangroula et al. 2017).

Another drug that shows promise for substance use disorders, and CUD in particular, is ketamine (Gao et al. 2023). Ketamine modulates glutamatergic signaling through N-methyl-D-aspartate (NMDA) receptor antagonism and is used medically as an aesthetic. At low doses, it has been suggested as a therapeutic treatment for psychiatric conditions including depression (Jawad et al. 2023; Tsang et al. 2023), chronic pain (Riccardi et al. 2023), post-traumatic stress disorder (Asim et al. 2021), as well as autism spectrum disorder (Wink et al. 2014). Conversely, exposure to ketamine in early postnatal periods can lead to ASD symptoms in adult mice (Hadar et al. 2021) and used recreationally, ketamine has a high potential for addiction. Other ketamine limitations have been recently discussed (Ganaiem et al. 2023).

In this study, we show that cocaine binds to a Zn finger adjacent to the NAP binding site. Interestingly, this is the same site that ketamine binds to as well (Ganaiem et al. 2023). Our findings that cocaine and NAP have similar effects on synaptic plasticity, together with our in silico results highlighting the overlap of cocaine/ketamine NAP binding, indicate that NAP could be a safe (Hacohen-Kleiman et al. 2018) non-addictive alternative to investigate as a potential treatment for CUD, in a sex-dependent manner.

Lastly, addressing future studies, the autistic ADNP syndrome shows Alzheimer’s disease-like tauopathy (Grigg et al. 2020), which is protected against by NAP treatment (Karmon et al. 2022). Mechanistically, NAP binding to EB1/EB3 enhances Tau-MT interactions (Ivashko-Pachima et al. 2017, 2021) and protects against Tau hyperphosphorylation and Tau tangle-like depositions (Karmon et al. 2022). Conversely, cocaine was suggested to induce Tau hyperphosphorylation leading to tauopathy (Liu et al. 2003), paralleled by ADNP changes in the face of tauopathy (Schirer et al. 2014). Taken together, the findings imply compensation/replacement by NAP in CUD.

Conclusion

In conclusion, our findings suggest that ADNP is a potential novel biomarker and regulator of cocaine addiction, at the synaptic level. Future studies addressing the mechanisms downstream of ADNP will be beneficial to understanding the regulatory role of ADNP on cocaine-related behaviors and pathology. Measurements of ADNP levels, predictive of cognitive abilities (Malishkevich et al. 2016), coupled with NAP therapy in a dose- and sex-dependent manner may provide a potential treatment for CUD, especially when cognitive dysfunction is detected (Mahoney 2019).

Acknowledgements

The authors acknowledge PeiYou Wu assembling the picture panels of Figs 2A and 3A. This study was partially supported by grants and donations to research conducted at the laboratory of I.G. from Dr. Ronith and Dr. Armand Stemmer (French Friends of Tel Aviv University), Holly and Jonathan Strelzik (American Friends of Tel Aviv University), Anne and Alex Cohen (Canadian Friends of Tel Aviv University) and AMN Foundation. I.G. is Director of the Elton Laboratory for Molecular Neuroendocrinology and the former first incumbent of the Lily and Avraham Gildor Chair for the Investigation of Growth Factors. This work was carried out in partial fulfillment of the M.Sc. thesis degrees of Y.T. at the Sagol School of Neuroscience, and Y.Z. M.Sc. degree as well as S.S. Ph.D. degree at Miriam and Sheldon G. Adelson Graduate School, Faculty of Medical and Health Sciences, Tel Aviv University. I.G. is further supported by Marie Skłodowska-Curie TClock4AD grant aimed to discover pharmacological drugs that improve Alzheimer’s disease disrupted circadian rhythmicity: drug delivery, target validation & molecular mechanisms, and student training (double doctorate degrees). Project #: 101072895, from the EUROPEAN RESEARCH EXECUTIVE AGENCY (REA) REA, and by Exonavis Therapeutics Ltd. S.S. was supported by Eshkol fellowship, the Israel Ministry of Science and Technology and the Tel Aviv University GRTF and The Naomi Foundation, as well as The Eldee Foundation/ Bloomfield Family of Montreal awards for student exchange (Tel Aviv University/McGill University, I.G. and R.A.M. Directors). 

Author Contributions

Y.T., Y.Z., S.Sr., and S.Sh. performed the work. Y.Z. (Fig. 1), Y.Z. and S.S. (Figures 2 and 3), and S. Sh. (Figures 4 and 5) initiated the figures. R.A.M., S.B., and I.G. initiated the study, supervised the work, and contributed to the analysis and presentation of the data. I.G. orchestrated the collaborative work. Y.T. under I.G. supervised and wrote the paper. All authors read, edited, and approved the paper.

Funding

Open access funding provided by Tel Aviv University.

Data Availability

No datasets were generated or analyzed during the current study.

Declarations

Competing Interests

I.G., VP Drug Development, Exonavis Therapeutics Ltd. Sex-dependent use of davunetide is patent pending, and I.G. is listed as an inventor. I.G. also serves as Editor-in-Chief of Journal of Molecular Neuroscience.

In memory of the late Professor Richard Wurtman

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

Aboonq MS Vasiliou SA Haddley K Quinn JP Bubb VJ Activity-dependent neuroprotective protein modulates its own gene expression J Mol Neurosci 2012 46 1 33 39 10.1007/s12031-011-9562-y 21647709
Aboonq MS, Vasiliou SA, Haddley K, Quinn JP, Bubb VJ (2012) Activity-dependent neuroprotective protein modulates its own gene expression. J Mol Neurosci 46(1):33–39. 10.1007/s12031-011-9562-y21647709 10.1007/s12031-011-9562-y
Amram N Hacohen-Kleiman G Sragovich S Malishkevich A Katz J Touloumi O Lagoudaki R Grigoriadis NC Giladi E Yeheskel A Pasmanik-Chor M Jouroukhin Y Gozes I Sexual divergence in microtubule function: the novel intranasal microtubule targeting SKIP normalizes axonal transport and enhances memory Mol Psychiatry 2016 21 10 1467 1476 10.1038/mp.2015.208 26782054
Amram N, Hacohen-Kleiman G, Sragovich S, Malishkevich A, Katz J, Touloumi O, Lagoudaki R, Grigoriadis NC, Giladi E, Yeheskel A, Pasmanik-Chor M, Jouroukhin Y, Gozes I (2016) Sexual divergence in microtubule function: the novel intranasal microtubule targeting SKIP normalizes axonal transport and enhances memory. Mol Psychiatry 21(10):1467–1476. 10.1038/mp.2015.20826782054 10.1038/mp.2015.208
Anderson AL Reid MS Li SH Holmes T Shemanski L Slee A Smith EV Kahn R Chiang N Vocci F Ciraulo D Dackis C Roache JD Salloum IM Somoza E Urschel HC 3rd Elkashef AM Modafinil for the treatment of cocaine dependence Drug Alcohol Depend 2009 104 1-2 133 139 10.1016/j.drugalcdep.2009.04.015 19560290
Anderson AL, Reid MS, Li SH, Holmes T, Shemanski L, Slee A, Smith EV, Kahn R, Chiang N, Vocci F, Ciraulo D, Dackis C, Roache JD, Salloum IM, Somoza E, Urschel HC 3rd, Elkashef AM (2009) Modafinil for the treatment of cocaine dependence. Drug Alcohol Depend 104(1-2):133–139. 10.1016/j.drugalcdep.2009.04.01519560290 10.1016/j.drugalcdep.2009.04.015
Asim M Wang B Hao B Wang X Ketamine for post-traumatic stress disorders and it's possible therapeutic mechanism Neurochem Int 2021 146 105044 10.1016/j.neuint.2021.105044 33862176
Asim M, Wang B, Hao B, Wang X (2021) Ketamine for post-traumatic stress disorders and it's possible therapeutic mechanism. Neurochem Int 146:105044. 10.1016/j.neuint.2021.10504433862176 10.1016/j.neuint.2021.105044
Bainomugisa CK Sutherland HG Parker R McRae AF Haupt LM Griffiths LR Heath A Nelson EC Wright MJ Hickie IB Martin NG Nyholt DR Mehta D Using monozygotic twins to dissect common genes in posttraumatic stress disorder and migraine Front Neurosci 2021 15 678350 10.3389/fnins.2021.678350 34239411
Bainomugisa CK, Sutherland HG, Parker R, McRae AF, Haupt LM, Griffiths LR, Heath A, Nelson EC, Wright MJ, Hickie IB, Martin NG, Nyholt DR, Mehta D (2021) Using monozygotic twins to dissect common genes in posttraumatic stress disorder and migraine. Front Neurosci 15:678350. 10.3389/fnins.2021.67835034239411 10.3389/fnins.2021.678350
Bassan M Zamostiano R Davidson A Pinhasov A Giladi E Perl O Bassan H Blat C Gibney G Glazner G Brenneman DE Gozes I Complete sequence of a novel protein containing a femtomolar-activity-dependent neuroprotective peptide J Neurochem 1999 72 3 1283 1293 10.1046/j.1471-4159.1999.0721283.x 10037502
Bassan M, Zamostiano R, Davidson A, Pinhasov A, Giladi E, Perl O, Bassan H, Blat C, Gibney G, Glazner G, Brenneman DE, Gozes I (1999) Complete sequence of a novel protein containing a femtomolar-activity-dependent neuroprotective peptide. J Neurochem 72(3):1283–1293. 10.1046/j.1471-4159.1999.0721283.x10037502 10.1046/j.1471-4159.1999.0721283.x
Becker JB Sex differences in addiction Dialogues Clin Neurosci 2016 18 4 395 402 10.31887/DCNS.2016.18.4/jbecker 28179811
Becker JB (2016) Sex differences in addiction. Dialogues Clin Neurosci 18(4):395–402. 10.31887/DCNS.2016.18.4/jbecker28179811 10.31887/DCNS.2016.18.4/jbecker
Bennison SA Blazejewski SM Liu X Hacohen-Kleiman G Sragovich S Zoidou S Touloumi O Grigoriadis N Gozes I Toyo-Oka K The cytoplasmic localization of ADNP through 14-3-3 promotes sex-dependent neuronal morphogenesis, cortical connectivity, and calcium signaling Mol Psychiatry 2023 28 5 1946 1959 10.1038/s41380-022-01939-3 36631597
Bennison SA, Blazejewski SM, Liu X, Hacohen-Kleiman G, Sragovich S, Zoidou S, Touloumi O, Grigoriadis N, Gozes I, Toyo-Oka K (2023) The cytoplasmic localization of ADNP through 14-3-3 promotes sex-dependent neuronal morphogenesis, cortical connectivity, and calcium signaling. Mol Psychiatry 28(5):1946–1959. 10.1038/s41380-022-01939-336631597 10.1038/s41380-022-01939-3
Bourne J Harris KM Do thin spines learn to be mushroom spines that remember? Curr Opin Neurobiol 2007 17 3 381 386 10.1016/j.conb.2007.04.009 17498943
Bourne J, Harris KM (2007) Do thin spines learn to be mushroom spines that remember? Curr Opin Neurobiol 17(3):381–386. 10.1016/j.conb.2007.04.00917498943 10.1016/j.conb.2007.04.009
Brandt L Chao T Comer SD Levin FR Pharmacotherapeutic strategies for treating cocaine use disorder-what do we have to offer? Addiction 2021 116 4 694 710 10.1111/add.15242 32888245
Brandt L, Chao T, Comer SD, Levin FR (2021) Pharmacotherapeutic strategies for treating cocaine use disorder-what do we have to offer? Addiction 116(4):694–710. 10.1111/add.1524232888245 10.1111/add.15242
Buchholz J Saxon AJ Medications to treat cocaine use disorders: current options Curr Opin Psychiatry 2019 32 4 275 281 10.1097/YCO.0000000000000518 31008728
Buchholz J, Saxon AJ (2019) Medications to treat cocaine use disorders: current options. Curr Opin Psychiatry 32(4):275–281. 10.1097/YCO.000000000000051831008728 10.1097/YCO.0000000000000518
Caffino L Racagni G Fumagalli F Stress and cocaine interact to modulate Arc/Arg3.1 expression in rat brain Psychopharmacology (Berl) 2011 218 1 241 248 10.1007/s00213-011-2331-3 21590283
Caffino L, Racagni G, Fumagalli F (2011) Stress and cocaine interact to modulate Arc/Arg3.1 expression in rat brain. Psychopharmacology (Berl) 218(1):241–248. 10.1007/s00213-011-2331-321590283 10.1007/s00213-011-2331-3
Calipari ES Godino A Salery M Damez-Werno DM Cahill ME Werner CT Gancarz AM Peck EG Jlayer Z Rabkin J Landry JA Smith ACW Defilippi P Kenny PJ Hurd YL Neve RL Dietz DM Nestler EJ Synaptic microtubule-associated protein EB3 and SRC phosphorylation mediate structural and behavioral adaptations during withdrawal from cocaine self-administration J Neurosci 2019 39 29 5634 5646 10.1523/JNEUROSCI.0024-19.2019 31092585
Calipari ES, Godino A, Salery M, Damez-Werno DM, Cahill ME, Werner CT, Gancarz AM, Peck EG, Jlayer Z, Rabkin J, Landry JA, Smith ACW, Defilippi P, Kenny PJ, Hurd YL, Neve RL, Dietz DM, Nestler EJ (2019) Synaptic microtubule-associated protein EB3 and SRC phosphorylation mediate structural and behavioral adaptations during withdrawal from cocaine self-administration. J Neurosci 39(29):5634–5646. 10.1523/JNEUROSCI.0024-19.201931092585 10.1523/JNEUROSCI.0024-19.2019
Cao L Walker MP Vaidya NK Fu M Kumar S Kumar A Cocaine-mediated autophagy in astrocytes involves sigma 1 receptor, PI3K, mTOR, Atg5/7, BECLIN-1 and induces type II programed cell death Mol Neurobiol 2016 53 7 4417 4430 10.1007/s12035-015-9377-x 26243186
Cao L, Walker MP, Vaidya NK, Fu M, Kumar S, Kumar A (2016) Cocaine-mediated autophagy in astrocytes involves sigma 1 receptor, PI3K, mTOR, Atg5/7, BECLIN-1 and induces type II programed cell death. Mol Neurobiol 53(7):4417–4430. 10.1007/s12035-015-9377-x26243186 10.1007/s12035-015-9377-x
Chang PK Prenosil GA Verbich D Gill R McKinney RA Prolonged ampakine exposure prunes dendritic spines and increases presynaptic release probability for enhanced long-term potentiation in the hippocampus Eur J Neurosci 2014 40 5 2766 2776 10.1111/ejn.12638 24925283
Chang PK, Prenosil GA, Verbich D, Gill R, McKinney RA (2014) Prolonged ampakine exposure prunes dendritic spines and increases presynaptic release probability for enhanced long-term potentiation in the hippocampus. Eur J Neurosci 40(5):2766–2776. 10.1111/ejn.1263824925283 10.1111/ejn.12638
Chung JH Cai J Suskin BG Zhang Z Coleman K Morrow BE Whole-genome sequencing and integrative genomic analysis approach on two 22q11.2 Deletion syndrome family trios for genotype to phenotype correlations Hum Mutat 2015 36 8 797 807 10.1002/humu.22814 25981510
Chung JH, Cai J, Suskin BG, Zhang Z, Coleman K, Morrow BE (2015) Whole-genome sequencing and integrative genomic analysis approach on two 22q11.2 Deletion syndrome family trios for genotype to phenotype correlations. Hum Mutat 36(8):797–807. 10.1002/humu.2281425981510 10.1002/humu.22814
Cuesta S Batuecas J Severin MJ Funes A Rosso SB Pacchioni AM Role of Wnt/betacatenin pathway in the nucleus accumbens in long-term cocaine-induced neuroplasticity: a possible novel target for addiction treatment J Neurochem 2017 140 1 114 125 10.1111/jnc.13863 27718509
Cuesta S, Batuecas J, Severin MJ, Funes A, Rosso SB, Pacchioni AM (2017a) Role of Wnt/betacatenin pathway in the nucleus accumbens in long-term cocaine-induced neuroplasticity: a possible novel target for addiction treatment. J Neurochem 140(1):114–125. 10.1111/jnc.1386327718509 10.1111/jnc.13863
Cuesta S Severin MJ Batuecas J Rosso SB Pacchioni AM Wnt/beta-catenin pathway in the prefrontal cortex is required for cocaine-induced neuroadaptations Addict Biol 2017 22 4 933 945 10.1111/adb.12377 26910786
Cuesta S, Severin MJ, Batuecas J, Rosso SB, Pacchioni AM (2017b) Wnt/beta-catenin pathway in the prefrontal cortex is required for cocaine-induced neuroadaptations. Addict Biol 22(4):933–945. 10.1111/adb.1237726910786 10.1111/adb.12377
D'Souza MS Brain and cognition for addiction medicine: from prevention to recovery neural substrates for treatment of psychostimulant-induced cognitive deficits Front Psychiatry 2019 10 509 10.3389/fpsyt.2019.00509 31396113
D'Souza MS (2019) Brain and cognition for addiction medicine: from prevention to recovery neural substrates for treatment of psychostimulant-induced cognitive deficits. Front Psychiatry 10:509. 10.3389/fpsyt.2019.0050931396113 10.3389/fpsyt.2019.00509
Damuka N Martin TJ Bansode AH Krizan I Martin CW Miller M Whitlow CT Nader MA Solingapuram Sai KK Initial evaluations of the microtubule-based pet radiotracer, [(11)C]MPC-6827 in a rodent model of cocaine abuse Front Med (Lausanne) 2022 9 817274 10.3389/fmed.2022.817274 35295607
Damuka N, Martin TJ, Bansode AH, Krizan I, Martin CW, Miller M, Whitlow CT, Nader MA, Solingapuram Sai KK (2022) Initial evaluations of the microtubule-based pet radiotracer, [(11)C]MPC-6827 in a rodent model of cocaine abuse. Front Med (Lausanne) 9:817274. 10.3389/fmed.2022.81727435295607 10.3389/fmed.2022.817274
De Paola V Arber S Caroni P AMPA receptors regulate dynamic equilibrium of presynaptic terminals in mature hippocampal networks Nat Neurosci 2003 6 5 491 500 10.1038/nn1046 12692557
De Paola V, Arber S, Caroni P (2003) AMPA receptors regulate dynamic equilibrium of presynaptic terminals in mature hippocampal networks. Nat Neurosci 6(5):491–500. 10.1038/nn104612692557 10.1038/nn1046
De Witte NA Crunelle CL Sabbe B Moggi F Dom G Treatment for outpatients with comorbid schizophrenia and substance use disorders: a review Eur Addict Res 2014 20 3 105 114 10.1159/000355267 24192558
De Witte NA, Crunelle CL, Sabbe B, Moggi F, Dom G (2014) Treatment for outpatients with comorbid schizophrenia and substance use disorders: a review. Eur Addict Res 20(3):105–114. 10.1159/00035526724192558 10.1159/000355267
Deschaux O Vendruscolo LF Schlosburg JE Diaz-Aguilar L Yuan CJ Sobieraj JC George O Koob GF Mandyam CD Hippocampal neurogenesis protects against cocaine-primed relapse Addict Biol 2014 19 4 562 574 10.1111/adb.12019 23278919
Deschaux O, Vendruscolo LF, Schlosburg JE, Diaz-Aguilar L, Yuan CJ, Sobieraj JC, George O, Koob GF, Mandyam CD (2014) Hippocampal neurogenesis protects against cocaine-primed relapse. Addict Biol 19(4):562–574. 10.1111/adb.1201923278919 10.1111/adb.12019
Dos Santos M Salery M Forget B Garcia Perez MA Betuing S Boudier T Vanhoutte P Caboche J Heck N Rapid synaptogenesis in the nucleus accumbens is induced by a single cocaine administration and stabilized by mitogen-activated protein kinase interacting kinase-1 activity Biol Psychiatry 2017 82 11 806 818 10.1016/j.biopsych.2017.03.014 28545678
Dos Santos M, Salery M, Forget B, Garcia Perez MA, Betuing S, Boudier T, Vanhoutte P, Caboche J, Heck N (2017) Rapid synaptogenesis in the nucleus accumbens is induced by a single cocaine administration and stabilized by mitogen-activated protein kinase interacting kinase-1 activity. Biol Psychiatry 82(11):806–818. 10.1016/j.biopsych.2017.03.01428545678 10.1016/j.biopsych.2017.03.014
Dresner E Agam G Gozes I Activity-dependent neuroprotective protein (ADNP) expression level is correlated with the expression of the sister protein ADNP2: deregulation in schizophrenia Eur Neuropsychopharmacol 2011 21 5 355 361 10.1016/j.euroneuro.2010.06.004 20598862
Dresner E, Agam G, Gozes I (2011) Activity-dependent neuroprotective protein (ADNP) expression level is correlated with the expression of the sister protein ADNP2: deregulation in schizophrenia. Eur Neuropsychopharmacol 21(5):355–361. 10.1016/j.euroneuro.2010.06.00420598862 10.1016/j.euroneuro.2010.06.004
Dresner E Malishkevich A Arviv C Leibman Barak S Alon S Ofir R Gothilf Y Gozes I Novel evolutionary-conserved role for the activity-dependent neuroprotective protein (ADNP) family that is important for erythropoiesis J Biol Chem 2012 287 48 40173 40185 10.1074/jbc.M112.387027 23071114
Dresner E, Malishkevich A, Arviv C, Leibman Barak S, Alon S, Ofir R, Gothilf Y, Gozes I (2012) Novel evolutionary-conserved role for the activity-dependent neuroprotective protein (ADNP) family that is important for erythropoiesis. J Biol Chem 287(48):40173–40185. 10.1074/jbc.M112.38702723071114 10.1074/jbc.M112.387027
Dumitriu D Laplant Q Grossman YS Dias C Janssen WG Russo SJ Morrison JH Nestler EJ Subregional, dendritic compartment, and spine subtype specificity in cocaine regulation of dendritic spines in the nucleus accumbens J Neurosci 2012 32 20 6957 6966 10.1523/JNEUROSCI.5718-11.2012 22593064
Dumitriu D, Laplant Q, Grossman YS, Dias C, Janssen WG, Russo SJ, Morrison JH, Nestler EJ (2012) Subregional, dendritic compartment, and spine subtype specificity in cocaine regulation of dendritic spines in the nucleus accumbens. J Neurosci 32(20):6957–6966. 10.1523/JNEUROSCI.5718-11.201222593064 10.1523/JNEUROSCI.5718-11.2012
Dundas J Ling M Reference genes for measuring mRNA expression Theory Biosci 2012 131 4 215 223 10.1007/s12064-012-0152-5 22588998
Dundas J, Ling M (2012) Reference genes for measuring mRNA expression. Theory Biosci 131(4):215–223. 10.1007/s12064-012-0152-522588998 10.1007/s12064-012-0152-5
Fattore L Altea S Fratta W Sex differences in drug addiction: a review of animal and human studies Womens Health (Lond) 2008 4 51 65 10.2217/17455057.4.1.51 19072451
Fattore L, Altea S, Fratta W (2008) Sex differences in drug addiction: a review of animal and human studies. Womens Health (Lond) 4:51–65. 10.2217/17455057.4.1.5119072451 10.2217/17455057.4.1.51
Fattore L, Marti M, Mostallino R, Castelli MP (2020) Sex and gender differences in the effects of novel psychoactive substances. Brain Sci 10(9). 10.3390/brainsci10090606
Ferguson D Shao N Heller E Feng J Neve R Kim HD Call T Magazu S Shen L Nestler EJ SIRT1-FOXO3a regulate cocaine actions in the nucleus accumbens J Neurosci 2015 35 7 3100 3111 10.1523/JNEUROSCI.4012-14.2015 25698746
Ferguson D, Shao N, Heller E, Feng J, Neve R, Kim HD, Call T, Magazu S, Shen L, Nestler EJ (2015) SIRT1-FOXO3a regulate cocaine actions in the nucleus accumbens. J Neurosci 35(7):3100–3111. 10.1523/JNEUROSCI.4012-14.201525698746 10.1523/JNEUROSCI.4012-14.2015
Fernandez-Castillo N Cabana-Dominguez J Corominas R Cormand B Molecular genetics of cocaine use disorders in humans Mol Psychiatry 2022 27 1 624 639 10.1038/s41380-021-01256-1 34453125
Fernandez-Castillo N, Cabana-Dominguez J, Corominas R, Cormand B (2022) Molecular genetics of cocaine use disorders in humans. Mol Psychiatry 27(1):624–639. 10.1038/s41380-021-01256-134453125 10.1038/s41380-021-01256-1
Fischer DK Krick KS Han C Woolf MT Heller EA Cocaine regulation of Nr4a1 chromatin bivalency and mRNA in male and female mice Sci Rep 2022 12 1 15735 10.1038/s41598-022-19908-9 36130958
Fischer DK, Krick KS, Han C, Woolf MT, Heller EA (2022) Cocaine regulation of Nr4a1 chromatin bivalency and mRNA in male and female mice. Sci Rep 12(1):15735. 10.1038/s41598-022-19908-936130958 10.1038/s41598-022-19908-9
Fleming SM Mulligan CK Richter F Mortazavi F Lemesre V Frias C Zhu C Stewart A Gozes I Morimoto B Chesselet MF A pilot trial of the microtubule-interacting peptide (NAP) in mice overexpressing alpha-synuclein shows improvement in motor function and reduction of alpha-synuclein inclusions Mol Cell Neurosci 2011 46 3 597 606 10.1016/j.mcn.2010.12.011 21193046
Fleming SM, Mulligan CK, Richter F, Mortazavi F, Lemesre V, Frias C, Zhu C, Stewart A, Gozes I, Morimoto B, Chesselet MF (2011) A pilot trial of the microtubule-interacting peptide (NAP) in mice overexpressing alpha-synuclein shows improvement in motor function and reduction of alpha-synuclein inclusions. Mol Cell Neurosci 46(3):597–606. 10.1016/j.mcn.2010.12.01121193046 10.1016/j.mcn.2010.12.011
Fumagalli F Bedogni F Frasca A Di Pasquale L Racagni G Riva MA Corticostriatal upregulation of activity-regulated cytoskeletal-associated protein expression after repeated exposure to cocaine Mol Pharmacol 2006 70 5 1726 1734 10.1124/mol.106.026302 16908598
Fumagalli F, Bedogni F, Frasca A, Di Pasquale L, Racagni G, Riva MA (2006) Corticostriatal upregulation of activity-regulated cytoskeletal-associated protein expression after repeated exposure to cocaine. Mol Pharmacol 70(5):1726–1734. 10.1124/mol.106.02630216908598 10.1124/mol.106.026302
Furman S Hill JM Vulih I Zaltzman R Hauser JM Brenneman DE Gozes I Sexual dimorphism of activity-dependent neuroprotective protein in the mouse arcuate nucleus Neurosci Lett 2005 373 1 73 78 10.1016/j.neulet.2004.09.077 15555780
Furman S, Hill JM, Vulih I, Zaltzman R, Hauser JM, Brenneman DE, Gozes I (2005) Sexual dimorphism of activity-dependent neuroprotective protein in the mouse arcuate nucleus. Neurosci Lett 373(1):73–78. 10.1016/j.neulet.2004.09.07715555780 10.1016/j.neulet.2004.09.077
Ganaiem M, Gildor ND, Shazman S, Karmon G, Ivashko-Pachima Y, Gozes I (2023) NAP (Davunetide): The neuroprotective ADNP drug candidate penetrates cell nuclei explaining pleiotropic mechanisms. Cells 12(18). 10.3390/cells12182251
Gao Z Winhusen TJ Gorenflo M Ghitza UE Davis PB Kaelber DC Xu R Repurposing ketamine to treat cocaine use disorder: integration of artificial intelligence-based prediction, expert evaluation, clinical corroboration and mechanism of action analyses Addiction 2023 118 7 1307 1319 10.1111/add.16168 36792381
Gao Z, Winhusen TJ, Gorenflo M, Ghitza UE, Davis PB, Kaelber DC, Xu R (2023) Repurposing ketamine to treat cocaine use disorder: integration of artificial intelligence-based prediction, expert evaluation, clinical corroboration and mechanism of action analyses. Addiction 118(7):1307–1319. 10.1111/add.1616836792381 10.1111/add.16168
Gaval-Cruz M Liles LC Iuvone PM Weinshenker D Chronic inhibition of dopamine betahydroxylase facilitates behavioral responses to cocaine in mice PLoS One 2012 7 11 e50583 10.1371/journal.pone.0050583 23209785
Gaval-Cruz M, Liles LC, Iuvone PM, Weinshenker D (2012) Chronic inhibition of dopamine betahydroxylase facilitates behavioral responses to cocaine in mice. PLoS One 7(11):e50583. 10.1371/journal.pone.005058323209785 10.1371/journal.pone.0050583
Giladi E Hill JM Dresner E Stack CM Gozes I Vasoactive intestinal peptide (VIP) regulates activity-dependent neuroprotective protein (ADNP) expression in vivo J Mol Neurosci 2007 33 3 278 283 10.1007/s12031-007-9003-0 17952637
Giladi E, Hill JM, Dresner E, Stack CM, Gozes I (2007) Vasoactive intestinal peptide (VIP) regulates activity-dependent neuroprotective protein (ADNP) expression in vivo. J Mol Neurosci 33(3):278–283. 10.1007/s12031-007-9003-017952637 10.1007/s12031-007-9003-0
Goltseker K Bolotin L Barak S Counterconditioning during reconsolidation prevents relapse of cocaine memories Neuropsychopharmacology 2017 42 3 716 726 10.1038/npp.2016.140 27468918
Goltseker K, Bolotin L, Barak S (2017) Counterconditioning during reconsolidation prevents relapse of cocaine memories. Neuropsychopharmacology 42(3):716–726. 10.1038/npp.2016.14027468918 10.1038/npp.2016.140
Gozes I Sexual divergence in activity-dependent neuroprotective protein impacting autism, schizophrenia, and Alzheimer's disease J Neurosci Res 2017 95 1-2 652 660 10.1002/jnr.23808 27870441
Gozes I (2017) Sexual divergence in activity-dependent neuroprotective protein impacting autism, schizophrenia, and Alzheimer's disease. J Neurosci Res 95(1-2):652–660. 10.1002/jnr.2380827870441 10.1002/jnr.23808
Gozes I Tau, ADNP, and sex Cytoskeleton (Hoboken) 2024 81 1 16 23 10.1002/cm.21776 37572043
Gozes I (2024) Tau, ADNP, and sex. Cytoskeleton (Hoboken) 81(1):16–23. 10.1002/cm.2177637572043 10.1002/cm.21776
Gozes I Morimoto BH Tiong J Fox A Sutherland K Dangoor D Holser-Cochav M Vered K Newton P Aisen PS Matsuoka Y van Dyck CH Thal L NAP: research and development of a peptide derived from activity-dependent neuroprotective protein (ADNP) CNS Drug Rev 2005 11 4 353 368 10.1111/j.1527-3458.2005.tb00053.x 16614735
Gozes I, Morimoto BH, Tiong J, Fox A, Sutherland K, Dangoor D, Holser-Cochav M, Vered K, Newton P, Aisen PS, Matsuoka Y, van Dyck CH, Thal L (2005) NAP: research and development of a peptide derived from activity-dependent neuroprotective protein (ADNP). CNS Drug Rev 11(4):353–368. 10.1111/j.1527-3458.2005.tb00053.x16614735 10.1111/j.1527-3458.2005.tb00053.x
Gozes I Shapira G Lobyntseva A Shomron N Unexpected gender differences in progressive supranuclear palsy reveal efficacy for davunetide in women Transl Psychiatry 2023 13 1 319 10.1038/s41398-023-02618-9 37845254
Gozes I, Shapira G, Lobyntseva A, Shomron N (2023) Unexpected gender differences in progressive supranuclear palsy reveal efficacy for davunetide in women. Transl Psychiatry 13(1):319. 10.1038/s41398-023-02618-937845254 10.1038/s41398-023-02618-9
Gozes I Werner H Fawzi M Abdelatty A Shani Y Fridkin M Koch Y Estrogen regulation of vasoactive intestinal peptide mRNA in rat hypothalamus J Mol Neurosci 1989 1 1 55 61 10.1007/BF02896857 2642065
Gozes I, Werner H, Fawzi M, Abdelatty A, Shani Y, Fridkin M, Koch Y (1989) Estrogen regulation of vasoactive intestinal peptide mRNA in rat hypothalamus. J Mol Neurosci 1(1):55–61. 10.1007/BF028968572642065 10.1007/BF02896857
Grigg I Ivashko-Pachima Y Hait TA Korenkova V Touloumi O Lagoudaki R Van Dijck A Marusic Z Anicic M Vukovic J Kooy RF Grigoriadis N Gozes I Tauopathy in the young autistic brain: novel biomarker and therapeutic target Transl Psychiatry 2020 10 1 228 10.1038/s41398-020-00904-4 32661233
Grigg I, Ivashko-Pachima Y, Hait TA, Korenkova V, Touloumi O, Lagoudaki R, Van Dijck A, Marusic Z, Anicic M, Vukovic J, Kooy RF, Grigoriadis N, Gozes I (2020) Tauopathy in the young autistic brain: novel biomarker and therapeutic target. Transl Psychiatry 10(1):228. 10.1038/s41398-020-00904-432661233 10.1038/s41398-020-00904-4
Guo ML Liao K Periyasamy P Yang L Cai Y Callen SE Buch S Cocaine-mediated microglial activation involves the ER stress-autophagy axis Autophagy 2015 11 7 995 1009 10.1080/15548627.2015.1052205 26043790
Guo ML, Liao K, Periyasamy P, Yang L, Cai Y, Callen SE, Buch S (2015) Cocaine-mediated microglial activation involves the ER stress-autophagy axis. Autophagy 11(7):995–1009. 10.1080/15548627.2015.105220526043790 10.1080/15548627.2015.1052205
Hacohen-Kleiman G Sragovich S Karmon G Gao AYL Grigg I Pasmanik-Chor M Le A Korenkova V McKinney RA Gozes I Activity-dependent neuroprotective protein deficiency models synaptic and developmental phenotypes of autism-like syndrome J Clin Invest 2018 128 11 4956 4969 10.1172/JCI98199 30106381
Hacohen-Kleiman G, Sragovich S, Karmon G, Gao AYL, Grigg I, Pasmanik-Chor M, Le A, Korenkova V, McKinney RA, Gozes I (2018) Activity-dependent neuroprotective protein deficiency models synaptic and developmental phenotypes of autism-like syndrome. J Clin Invest 128(11):4956–4969. 10.1172/JCI9819930106381 10.1172/JCI98199
Hadar A Kapitansky O Ganaiem M Sragovich S Lobyntseva A Giladi E Yeheskel A Avitan A Vatine GD Gurwitz D Ivashko-Pachima Y Gozes I Introducing ADNP and SIRT1 as new partners regulating microtubules and histone methylation Mol Psychiatry 2021 26 11 6550 6561 10.1038/s41380-021-01143-9 33967268
Hadar A, Kapitansky O, Ganaiem M, Sragovich S, Lobyntseva A, Giladi E, Yeheskel A, Avitan A, Vatine GD, Gurwitz D, Ivashko-Pachima Y, Gozes I (2021) Introducing ADNP and SIRT1 as new partners regulating microtubules and histone methylation. Mol Psychiatry 26(11):6550–6561. 10.1038/s41380-021-01143-933967268 10.1038/s41380-021-01143-9
Harp SJ, Martini M, Lynch WJ, Rissman EF (2020) Sexual Differentiation and Substance Use: A Mini-Review. Endocrinology 161(9). 10.1210/endocr/bqaa129
Helsmoortel C Vulto-van Silfhout AT Coe BP Vandeweyer G Rooms L van den Ende J Schuurs-Hoeijmakers JH Marcelis CL Willemsen MH Vissers LE Yntema HG Bakshi M Wilson M Witherspoon KT Malmgren H Nordgren A Anneren G Fichera M Bosco P A SWI/SNF-related autism syndrome caused by de novo mutations in ADNP Nat Genet 2014 46 4 380 384 10.1038/ng.2899 24531329
Helsmoortel C, Vulto-van Silfhout AT, Coe BP, Vandeweyer G, Rooms L, van den Ende J, Schuurs-Hoeijmakers JH, Marcelis CL, Willemsen MH, Vissers LE, Yntema HG, Bakshi M, Wilson M, Witherspoon KT, Malmgren H, Nordgren A, Anneren G, Fichera M, Bosco P et al (2014) A SWI/SNF-related autism syndrome caused by de novo mutations in ADNP. Nat Genet 46(4):380–384. 10.1038/ng.289924531329 10.1038/ng.2899
Helverschou SB Brunvold AR Arnevik EA Treating patients with co-occurring autism spectrum disorder and substance use disorder: a clinical explorative study Subst Abuse 2019 13 1178221819843291 10.1177/1178221819843291 31024216
Helverschou SB, Brunvold AR, Arnevik EA (2019) Treating patients with co-occurring autism spectrum disorder and substance use disorder: a clinical explorative study. Subst Abuse 13:1178221819843291. 10.1177/117822181984329131024216 10.1177/1178221819843291
Hering H Sheng M Dendritic spines: structure, dynamics and regulation Nat Rev Neurosci 2001 2 12 880 888 10.1038/35104061 11733795
Hering H, Sheng M (2001) Dendritic spines: structure, dynamics and regulation. Nat Rev Neurosci 2(12):880–888. 10.1038/3510406111733795 10.1038/35104061
Hu M Crombag HS Robinson TE Becker JB Biological basis of sex differences in the propensity to self-administer cocaine Neuropsychopharmacology 2004 29 1 81 85 10.1038/sj.npp.1300301 12955098
Hu M, Crombag HS, Robinson TE, Becker JB (2004) Biological basis of sex differences in the propensity to self-administer cocaine. Neuropsychopharmacology 29(1):81–85. 10.1038/sj.npp.130030112955098 10.1038/sj.npp.1300301
Hutten NR Kuypers KP van Wel JH Theunissen EL Toennes SW Verkes RJ Ramaekers JG A single dose of cocaine enhances prospective memory performance J Psychopharmacol 2018 32 8 883 892 10.1177/0269881118783299 29947572
Hutten NR, Kuypers KP, van Wel JH, Theunissen EL, Toennes SW, Verkes RJ, Ramaekers JG (2018) A single dose of cocaine enhances prospective memory performance. J Psychopharmacol 32(8):883–892. 10.1177/026988111878329929947572 10.1177/0269881118783299
Ivashko-Pachima Y Ganaiem M Ben-Horin-Hazak I Lobyntseva A Bellaiche N Fischer I Levy G Sragovich S Karmon G Giladi E Shazman S Barak B Gozes I SH3- and actin-binding domains connect ADNP and SHANK3, revealing a fundamental shared mechanism underlying autism Mol Psychiatry 2022 27 8 3316 3327 10.1038/s41380-022-01603-w 35538192
Ivashko-Pachima Y, Ganaiem M, Ben-Horin-Hazak I, Lobyntseva A, Bellaiche N, Fischer I, Levy G, Sragovich S, Karmon G, Giladi E, Shazman S, Barak B, Gozes I (2022) SH3- and actin-binding domains connect ADNP and SHANK3, revealing a fundamental shared mechanism underlying autism. Mol Psychiatry 27(8):3316–3327. 10.1038/s41380-022-01603-w35538192 10.1038/s41380-022-01603-w
Ivashko-Pachima Y Hadar A Grigg I Korenkova V Kapitansky O Karmon G Gershovits M Sayas CL Kooy RF Attems J Gurwitz D Gozes I Discovery of autism/intellectual disability somatic mutations in Alzheimer's brains: mutated ADNP cytoskeletal impairments and repair as a case study Mol Psychiatry 2021 26 5 1619 1633 10.1038/s41380-019-0563-5 31664177
Ivashko-Pachima Y, Hadar A, Grigg I, Korenkova V, Kapitansky O, Karmon G, Gershovits M, Sayas CL, Kooy RF, Attems J, Gurwitz D, Gozes I (2021) Discovery of autism/intellectual disability somatic mutations in Alzheimer's brains: mutated ADNP cytoskeletal impairments and repair as a case study. Mol Psychiatry 26(5):1619–1633. 10.1038/s41380-019-0563-531664177 10.1038/s41380-019-0563-5
Ivashko-Pachima Y Sayas CL Malishkevich A Gozes I ADNP/NAP dramatically increase microtubule end-binding protein-Tau interaction: a novel avenue for protection against tauopathy Mol Psychiatry 2017 22 9 1335 1344 10.1038/mp.2016.255 28115743
Ivashko-Pachima Y, Sayas CL, Malishkevich A, Gozes I (2017) ADNP/NAP dramatically increase microtubule end-binding protein-Tau interaction: a novel avenue for protection against tauopathy. Mol Psychiatry 22(9):1335–1344. 10.1038/mp.2016.25528115743 10.1038/mp.2016.255
Jawad MY, Qasim S, Ni M, Guo Z, Di Vincenzo JD, d'Andrea G, Tabassum A, McKenzie A, Badulescu S, Grande I, McIntyre RS (2023) The role of ketamine in the treatment of bipolar depression: a scoping review. Brain Sci 13(6). 10.3390/brainsci13060909
Justice AJ de Wit H Acute effects of estradiol pretreatment on the response to d-amphetamine in women Neuroendocrinology 2000 71 1 51 59 10.1159/000054520 10644899
Justice AJ, de Wit H (2000) Acute effects of estradiol pretreatment on the response to d-amphetamine in women. Neuroendocrinology 71(1):51–59. 10.1159/00005452010644899 10.1159/000054520
Kapitansky O Gozes I ADNP differentially interact with genes/proteins in correlation with aging: a novel marker for muscle aging Geroscience 2019 41 3 321 340 10.1007/s11357-019-00079-x 31264075
Kapitansky O, Gozes I (2019) ADNP differentially interact with genes/proteins in correlation with aging: a novel marker for muscle aging. Geroscience 41(3):321–340. 10.1007/s11357-019-00079-x31264075 10.1007/s11357-019-00079-x
Kapitansky O, Karmon G, Sragovich S, Hadar A, Shahoha M, Jaljuli I, Bikovski L, Giladi E, Palovics R, Iram T, Gozes I (2020) Single cell ADNP predictive of human muscle disorders: mouse knockdown results in muscle wasting. Cells 9(10). 10.3390/cells9102320
Karmon G Sragovich S Hacohen-Kleiman G Ben-Horin-Hazak I Kasparek P Schuster B Sedlacek R Pasmanik-Chor M Theotokis P Touloumi O Zoidou S Huang L Wu PY Shi R Kapitansky O Lobyntseva A Giladi E Shapira G Shomron N Novel ADNP syndrome mice reveal dramatic sex-specific peripheral gene expression with brain synaptic and Tau pathologies Biol Psychiatry 2022 92 1 81 95 10.1016/j.biopsych.2021.09.018 34865853
Karmon G, Sragovich S, Hacohen-Kleiman G, Ben-Horin-Hazak I, Kasparek P, Schuster B, Sedlacek R, Pasmanik-Chor M, Theotokis P, Touloumi O, Zoidou S, Huang L, Wu PY, Shi R, Kapitansky O, Lobyntseva A, Giladi E, Shapira G, Shomron N et al (2022) Novel ADNP syndrome mice reveal dramatic sex-specific peripheral gene expression with brain synaptic and Tau pathologies. Biol Psychiatry 92(1):81–95. 10.1016/j.biopsych.2021.09.01834865853 10.1016/j.biopsych.2021.09.018
Kaushik S Ahmad F Choudhary S Mathkor DM Mishra BN Singh V Haque S Critical appraisal and systematic review of genes linked with cocaine addiction, depression and anxiety Neurosci Biobehav Rev 2023 152 105270 10.1016/j.neubiorev.2023.105270 37271299
Kaushik S, Ahmad F, Choudhary S, Mathkor DM, Mishra BN, Singh V, Haque S (2023) Critical appraisal and systematic review of genes linked with cocaine addiction, depression and anxiety. Neurosci Biobehav Rev 152:105270. 10.1016/j.neubiorev.2023.10527037271299 10.1016/j.neubiorev.2023.105270
Knouse MC Briand LA Behavioral sex differences in cocaine and opioid use disorders: The role of gonadal hormones Neurosci Biobehav Rev 2021 128 358 366 10.1016/j.neubiorev.2021.06.038 34214512
Knouse MC, Briand LA (2021) Behavioral sex differences in cocaine and opioid use disorders: The role of gonadal hormones. Neurosci Biobehav Rev 128:358–366. 10.1016/j.neubiorev.2021.06.03834214512 10.1016/j.neubiorev.2021.06.038
Kokane SS Perrotti LI Sex differences and the role of estradiol in mesolimbic reward circuits and vulnerability to cocaine and opiate addiction Front Behav Neurosci 2020 14 74 10.3389/fnbeh.2020.00074 32508605
Kokane SS, Perrotti LI (2020) Sex differences and the role of estradiol in mesolimbic reward circuits and vulnerability to cocaine and opiate addiction. Front Behav Neurosci 14:74. 10.3389/fnbeh.2020.0007432508605 10.3389/fnbeh.2020.00074
Krebs S Fischaleck M Blum H A simple and loss-free method to remove TRIzol contaminations from minute RNA samples Anal Biochem 2009 387 1 136 138 10.1016/j.ab.2008.12.020 19146820
Krebs S, Fischaleck M, Blum H (2009) A simple and loss-free method to remove TRIzol contaminations from minute RNA samples. Anal Biochem 387(1):136–138. 10.1016/j.ab.2008.12.02019146820 10.1016/j.ab.2008.12.020
Kushnir M Dresner E Mandel S Gozes I Silencing of the ADNP-family member, ADNP2, results in changes in cellular viability under oxidative stress J Neurochem 2008 105 2 537 545 10.1111/j.1471-4159.2007.05173.x 18179478
Kushnir M, Dresner E, Mandel S, Gozes I (2008) Silencing of the ADNP-family member, ADNP2, results in changes in cellular viability under oxidative stress. J Neurochem 105(2):537–545. 10.1111/j.1471-4159.2007.05173.x18179478 10.1111/j.1471-4159.2007.05173.x
Lacy RT Strickland JC Feinstein MA Robinson AM Smith MA The effects of sex, estrous cycle, and social contact on cocaine and heroin self-administration in rats Psychopharmacology (Berl) 2016 233 17 3201 3210 10.1007/s00213-016-4368-9 27370020
Lacy RT, Strickland JC, Feinstein MA, Robinson AM, Smith MA (2016) The effects of sex, estrous cycle, and social contact on cocaine and heroin self-administration in rats. Psychopharmacology (Berl) 233(17):3201–3210. 10.1007/s00213-016-4368-927370020 10.1007/s00213-016-4368-9
Liu SJ Fang ZY Yang Y Deng HM Wang JZ Alzheimer-like phosphorylation of tau and neurofilament induced by cocaine in vivo Acta Pharmacol Sin 2003 24 6 512 518 12791176
Liu SJ, Fang ZY, Yang Y, Deng HM, Wang JZ (2003) Alzheimer-like phosphorylation of tau and neurofilament induced by cocaine in vivo. Acta Pharmacol Sin 24(6):512–518 https://www.ncbi.nlm.nih.gov/pubmed/12791176 12791176
Lopez AJ Johnson AR Euston TJ Wilson R Nolan SO Brady LJ Thibeault KC Kelly SJ Kondev V Melugin P Kutlu MG Chuang E Lam TT Kiraly DD Calipari ES Cocaine self-administration induces sex-dependent protein expression in the nucleus accumbens Commun Biol 2021 4 1 883 10.1038/s42003-021-02358-w 34272455
Lopez AJ, Johnson AR, Euston TJ, Wilson R, Nolan SO, Brady LJ, Thibeault KC, Kelly SJ, Kondev V, Melugin P, Kutlu MG, Chuang E, Lam TT, Kiraly DD, Calipari ES (2021) Cocaine self-administration induces sex-dependent protein expression in the nucleus accumbens. Commun Biol 4(1):883. 10.1038/s42003-021-02358-w34272455 10.1038/s42003-021-02358-w
Madangopal R Rapid cocaine-induced spine changes in the nucleus accumbens Biol Psychiatry 2017 82 11 e85 e87 10.1016/j.biopsych.2017.09.019 29110820
Madangopal R (2017) Rapid cocaine-induced spine changes in the nucleus accumbens. Biol Psychiatry 82(11):e85–e87. 10.1016/j.biopsych.2017.09.01929110820 10.1016/j.biopsych.2017.09.019
Magen I Gozes I Microtubule-stabilizing peptides and small molecules protecting axonal transport and brain function: focus on davunetide (NAP) Neuropeptides 2013 47 6 489 495 10.1016/j.npep.2013.10.011 24210139
Magen I, Gozes I (2013) Microtubule-stabilizing peptides and small molecules protecting axonal transport and brain function: focus on davunetide (NAP). Neuropeptides 47(6):489–495. 10.1016/j.npep.2013.10.01124210139 10.1016/j.npep.2013.10.011
Mahoney JJ Cognitive dysfunction in individuals with cocaine use disorder: Potential moderating factors and pharmacological treatments Exp Clin Psychopharmacol 2019 27 3 203 214 10.1037/pha0000245 30556731
Mahoney JJ (2019) Cognitive dysfunction in individuals with cocaine use disorder: Potential moderating factors and pharmacological treatments. Exp Clin Psychopharmacol 27(3):203–214. 10.1037/pha000024530556731 10.1037/pha0000245
Majewska MD Cocaine addiction as a neurological disorder: implications for treatment NIDA Res Monogr 1996 163 1 26 8809851
Majewska MD (1996) Cocaine addiction as a neurological disorder: implications for treatment. NIDA Res Monogr 163:1–26 https://www.ncbi.nlm.nih.gov/pubmed/8809851 8809851
Malishkevich A Amram N Hacohen-Kleiman G Magen I Giladi E Gozes I Activity-dependent neuroprotective protein (ADNP) exhibits striking sexual dichotomy impacting on autistic and Alzheimer's pathologies Transl Psychiatry 2015 5 2 e501 10.1038/tp.2014.138 25646590
Malishkevich A, Amram N, Hacohen-Kleiman G, Magen I, Giladi E, Gozes I (2015) Activity-dependent neuroprotective protein (ADNP) exhibits striking sexual dichotomy impacting on autistic and Alzheimer's pathologies. Transl Psychiatry 5(2):e501. 10.1038/tp.2014.13825646590 10.1038/tp.2014.138
Malishkevich A Marshall GA Schultz AP Sperling RA Aharon-Peretz J Gozes I Blood-borne activity-dependent neuroprotective protein (ADNP) is correlated with premorbid intelligence, clinical stage, and Alzheimer's disease biomarkers J Alzheimers Dis 2016 50 1 249 260 10.3233/JAD-150799 26639975
Malishkevich A, Marshall GA, Schultz AP, Sperling RA, Aharon-Peretz J, Gozes I (2016) Blood-borne activity-dependent neuroprotective protein (ADNP) is correlated with premorbid intelligence, clinical stage, and Alzheimer's disease biomarkers. J Alzheimers Dis 50(1):249–260. 10.3233/JAD-15079926639975 10.3233/JAD-150799
Mandel S Rechavi G Gozes I Activity-dependent neuroprotective protein (ADNP) differentially interacts with chromatin to regulate genes essential for embryogenesis Dev Biol 2007 303 2 814 824 10.1016/j.ydbio.2006.11.039 17222401
Mandel S, Rechavi G, Gozes I (2007) Activity-dependent neuroprotective protein (ADNP) differentially interacts with chromatin to regulate genes essential for embryogenesis. Dev Biol 303(2):814–824. 10.1016/j.ydbio.2006.11.03917222401 10.1016/j.ydbio.2006.11.039
Mandel S Spivak-Pohis I Gozes I ADNP differential nucleus/cytoplasm localization in neurons suggests multiple roles in neuronal differentiation and maintenance J Mol Neurosci 2008 35 2 127 141 10.1007/s12031-007-9013-y 18286385
Mandel S, Spivak-Pohis I, Gozes I (2008) ADNP differential nucleus/cytoplasm localization in neurons suggests multiple roles in neuronal differentiation and maintenance. J Mol Neurosci 35(2):127–141. 10.1007/s12031-007-9013-y18286385 10.1007/s12031-007-9013-y
Mash DC Adi N Duque L Pablo J Kumar M Ervin FR Alpha synuclein protein levels are increased in serum from recently abstinent cocaine abusers Drug Alcohol Depend 2008 94 1-3 246 250 10.1016/j.drugalcdep.2007.09.020 18055133
Mash DC, Adi N, Duque L, Pablo J, Kumar M, Ervin FR (2008) Alpha synuclein protein levels are increased in serum from recently abstinent cocaine abusers. Drug Alcohol Depend 94(1-3):246–250. 10.1016/j.drugalcdep.2007.09.02018055133 10.1016/j.drugalcdep.2007.09.020
McKinney RA Excitatory amino acid involvement in dendritic spine formation, maintenance and remodelling J Physiol 2010 588 Pt 1 107 116 10.1113/jphysiol.2009.178905 19933758
McKinney RA (2010) Excitatory amino acid involvement in dendritic spine formation, maintenance and remodelling. J Physiol 588(Pt 1):107–116. 10.1113/jphysiol.2009.17890519933758 10.1113/jphysiol.2009.178905
Merenlender-Wagner A Malishkevich A Shemer Z Udawela M Gibbons A Scarr E Dean B Levine J Agam G Gozes I Autophagy has a key role in the pathophysiology of schizophrenia Mol Psychiatry 2015 20 1 126 132 10.1038/mp.2013.174 24365867
Merenlender-Wagner A, Malishkevich A, Shemer Z, Udawela M, Gibbons A, Scarr E, Dean B, Levine J, Agam G, Gozes I (2015) Autophagy has a key role in the pathophysiology of schizophrenia. Mol Psychiatry 20(1):126–132. 10.1038/mp.2013.17424365867 10.1038/mp.2013.174
Morimoto BH Schmechel D Hirman J Blackwell A Keith J Gold M Study AL A double-blind, placebo-controlled, ascending-dose, randomized study to evaluate the safety, tolerability and effects on cognition of AL-108 after 12 weeks of intranasal administration in subjects with mild cognitive impairment Dement Geriatr Cogn Disord 2013 35 5-6 325 336 10.1159/000348347 23594991
Morimoto BH, Schmechel D, Hirman J, Blackwell A, Keith J, Gold M, Study AL (2013) A double-blind, placebo-controlled, ascending-dose, randomized study to evaluate the safety, tolerability and effects on cognition of AL-108 after 12 weeks of intranasal administration in subjects with mild cognitive impairment. Dement Geriatr Cogn Disord 35(5-6):325–336. 10.1159/00034834723594991 10.1159/000348347
Nestler EJ Molecular neurobiology of addiction Am J Addict 2001 10 3 201 217 10.1080/105504901750532094 11579619
Nestler EJ (2001) Molecular neurobiology of addiction. Am J Addict 10(3):201–217. 10.1080/10550490175053209411579619 10.1080/105504901750532094
Noonan MA Bulin SE Fuller DC Eisch AJ Reduction of adult hippocampal neurogenesis confers vulnerability in an animal model of cocaine addiction J Neurosci 2010 30 1 304 315 10.1523/JNEUROSCI.4256-09.2010 20053911
Noonan MA, Bulin SE, Fuller DC, Eisch AJ (2010) Reduction of adult hippocampal neurogenesis confers vulnerability in an animal model of cocaine addiction. J Neurosci 30(1):304–315. 10.1523/JNEUROSCI.4256-09.201020053911 10.1523/JNEUROSCI.4256-09.2010
Offen D Sherki Y Melamed E Fridkin M Brenneman DE Gozes I Vasoactive intestinal peptide (VIP) prevents neurotoxicity in neuronal cultures: relevance to neuroprotection in Parkinson's disease Brain Res 2000 854 1-2 257 262 10.1016/s0006-8993(99)02375-6 10784133
Offen D, Sherki Y, Melamed E, Fridkin M, Brenneman DE, Gozes I (2000) Vasoactive intestinal peptide (VIP) prevents neurotoxicity in neuronal cultures: relevance to neuroprotection in Parkinson's disease. Brain Res 854(1-2):257–262. 10.1016/s0006-8993(99)02375-610784133 10.1016/s0006-8993(99)02375-6
Oikawa T Nonaka T Terada M Tamaoka A Hisanaga S Hasegawa M Alpha-synuclein fibrils exhibit gain of toxic function, promoting tau aggregation and inhibiting microtubule assembly J Biol Chem 2016 291 29 15046 15056 10.1074/jbc.M116.736355 27226637
Oikawa T, Nonaka T, Terada M, Tamaoka A, Hisanaga S, Hasegawa M (2016) Alpha-synuclein fibrils exhibit gain of toxic function, promoting tau aggregation and inhibiting microtubule assembly. J Biol Chem 291(29):15046–15056. 10.1074/jbc.M116.73635527226637 10.1074/jbc.M116.736355
Oliveira-Lima AJ Marinho E Santos-Baldaia R Hollais AW Baldaia MA Talhati F Ribeiro LT Wuo-Silva R Berro LF Frussa-Filho R Context-dependent efficacy of a counter-conditioning strategy with a typical neuroleptic drugs in mice previously sensitized to cocaine Prog Neuropsychopharmacol Biol Psychiatry 2017 73 49 55 10.1016/j.pnpbp.2016.10.004 27789219
Oliveira-Lima AJ, Marinho E, Santos-Baldaia R, Hollais AW, Baldaia MA, Talhati F, Ribeiro LT, Wuo-Silva R, Berro LF, Frussa-Filho R (2017) Context-dependent efficacy of a counter-conditioning strategy with a typical neuroleptic drugs in mice previously sensitized to cocaine. Prog Neuropsychopharmacol Biol Psychiatry 73:49–55. 10.1016/j.pnpbp.2016.10.00427789219 10.1016/j.pnpbp.2016.10.004
Oz S Kapitansky O Ivashco-Pachima Y Malishkevich A Giladi E Skalka N Rosin-Arbesfeld R Mittelman L Segev O Hirsch JA Gozes I The NAP motif of activity-dependent neuroprotective protein (ADNP) regulates dendritic spines through microtubule end binding proteins Mol Psychiatry 2014 19 10 1115 1124 10.1038/mp.2014.97 25178163
Oz S, Kapitansky O, Ivashco-Pachima Y, Malishkevich A, Giladi E, Skalka N, Rosin-Arbesfeld R, Mittelman L, Segev O, Hirsch JA, Gozes I (2014) The NAP motif of activity-dependent neuroprotective protein (ADNP) regulates dendritic spines through microtubule end binding proteins. Mol Psychiatry 19(10):1115–1124. 10.1038/mp.2014.9725178163 10.1038/mp.2014.97
Pascual M Guerri C The peptide NAP promotes neuronal growth and differentiation through extracellular signal-regulated protein kinase and Akt pathways, and protects neurons co-cultured with astrocytes damaged by ethanol J Neurochem 2007 103 2 557 568 10.1111/j.1471-4159.2007.04761.x 17623041
Pascual M, Guerri C (2007) The peptide NAP promotes neuronal growth and differentiation through extracellular signal-regulated protein kinase and Akt pathways, and protects neurons co-cultured with astrocytes damaged by ethanol. J Neurochem 103(2):557–568. 10.1111/j.1471-4159.2007.04761.x17623041 10.1111/j.1471-4159.2007.04761.x
Peart DR Andrade AK Logan CN Knackstedt LA Murray JE Regulation of cocaine-related behaviours by estrogen and progesterone Neurosci Biobehav Rev 2022 135 104584 10.1016/j.neubiorev.2022.104584 35189163
Peart DR, Andrade AK, Logan CN, Knackstedt LA, Murray JE (2022) Regulation of cocaine-related behaviours by estrogen and progesterone. Neurosci Biobehav Rev 135:104584. 10.1016/j.neubiorev.2022.10458435189163 10.1016/j.neubiorev.2022.104584
Poggi SH Goodwin K Hill JM Brenneman DE Tendi E Schinelli S Abebe D Spong CY The role of activity-dependent neuroprotective protein in a mouse model of fetal alcohol syndrome Am J Obstet Gynecol 2003 189 3 790 793 10.1067/s0002-9378(03)00834-2 14526315
Poggi SH, Goodwin K, Hill JM, Brenneman DE, Tendi E, Schinelli S, Abebe D, Spong CY (2003) The role of activity-dependent neuroprotective protein in a mouse model of fetal alcohol syndrome. Am J Obstet Gynecol 189(3):790–793. 10.1067/s0002-9378(03)00834-214526315 10.1067/s0002-9378(03)00834-2
Ramage SN Anthony IC Carnie FW Busuttil A Robertson R Bell JE Hyperphosphorylated tau and amyloid precursor protein deposition is increased in the brains of young drug abusers Neuropathol Appl Neurobiol 2005 31 4 439 448 10.1111/j.1365-2990.2005.00670.x 16008828
Ramage SN, Anthony IC, Carnie FW, Busuttil A, Robertson R, Bell JE (2005) Hyperphosphorylated tau and amyloid precursor protein deposition is increased in the brains of young drug abusers. Neuropathol Appl Neurobiol 31(4):439–448. 10.1111/j.1365-2990.2005.00670.x16008828 10.1111/j.1365-2990.2005.00670.x
Ressel M Thompson B Poulin MH Normand CL Fisher MH Couture G Iarocci G Systematic review of risk and protective factors associated with substance use and abuse in individuals with autism spectrum disorders Autism 2020 24 4 899 918 10.1177/1362361320910963 32429819
Ressel M, Thompson B, Poulin MH, Normand CL, Fisher MH, Couture G, Iarocci G (2020) Systematic review of risk and protective factors associated with substance use and abuse in individuals with autism spectrum disorders. Autism 24(4):899–918. 10.1177/136236132091096332429819 10.1177/1362361320910963
Riccardi A, Guarino M, Serra S, Spampinato MD, Vanni S, Shiffer D, Voza A, Fabbri A, De Iaco F, Study, & Research Center of the Italian Society of Emergency, Medicine (2023) Narrative review: low-dose ketamine for pain management. J Clin Med 12(9). 10.3390/jcm12093256
Robbins SJ Ehrman RN Childress AR O'Brien CP Comparing levels of cocaine cue reactivity in male and female outpatients Drug Alcohol Depend 1999 53 3 223 230 10.1016/s0376-8716(98)00135-5 10080048
Robbins SJ, Ehrman RN, Childress AR, O'Brien CP (1999) Comparing levels of cocaine cue reactivity in male and female outpatients. Drug Alcohol Depend 53(3):223–230. 10.1016/s0376-8716(98)00135-510080048 10.1016/s0376-8716(98)00135-5
Robinson TE Kolb B Alterations in the morphology of dendrites and dendritic spines in the nucleus accumbens and prefrontal cortex following repeated treatment with amphetamine or cocaine Eur J Neurosci 1999 11 5 1598 1604 10.1046/j.1460-9568.1999.00576.x 10215912
Robinson TE, Kolb B (1999) Alterations in the morphology of dendrites and dendritic spines in the nucleus accumbens and prefrontal cortex following repeated treatment with amphetamine or cocaine. Eur J Neurosci 11(5):1598–1604. 10.1046/j.1460-9568.1999.00576.x10215912 10.1046/j.1460-9568.1999.00576.x
Sangroula D Motiwala F Wagle B Shah VC Hagi K Lippmann S Modafinil treatment of cocaine dependence: a systematic review and meta-analysis Subst Use Misuse 2017 52 10 1292 1306 10.1080/10826084.2016.1276597 28350194
Sangroula D, Motiwala F, Wagle B, Shah VC, Hagi K, Lippmann S (2017) Modafinil treatment of cocaine dependence: a systematic review and meta-analysis. Subst Use Misuse 52(10):1292–1306. 10.1080/10826084.2016.127659728350194 10.1080/10826084.2016.1276597
Schirer Y Malishkevich A Ophir Y Lewis J Giladi E Gozes I Novel marker for the onset of frontotemporal dementia: early increase in activity-dependent neuroprotective protein (ADNP) in the face of Tau mutation PLoS One 2014 9 1 e87383 10.1371/journal.pone.0087383 24489906
Schirer Y, Malishkevich A, Ophir Y, Lewis J, Giladi E, Gozes I (2014) Novel marker for the onset of frontotemporal dementia: early increase in activity-dependent neuroprotective protein (ADNP) in the face of Tau mutation. PLoS One 9(1):e87383. 10.1371/journal.pone.008738324489906 10.1371/journal.pone.0087383
Schwartz EKC Wolkowicz NR De Aquino JP MacLean RR Sofuoglu M Cocaine use disorder (CUD): current clinical perspectives Subst Abuse Rehabil 2022 13 25 46 10.2147/SAR.S337338 36093428
Schwartz EKC, Wolkowicz NR, De Aquino JP, MacLean RR, Sofuoglu M (2022) Cocaine use disorder (CUD): current clinical perspectives. Subst Abuse Rehabil 13:25–46. 10.2147/SAR.S33733836093428 10.2147/SAR.S337338
Sequeira MK Swanson AM Kietzman HW Gourley SL Cocaine and habit training cause dendritic spine rearrangement in the prelimbic cortex iScience 2023 26 4 106240 10.1016/j.isci.2023.106240 37153443
Sequeira MK, Swanson AM, Kietzman HW, Gourley SL (2023) Cocaine and habit training cause dendritic spine rearrangement in the prelimbic cortex. iScience 26(4):106240. 10.1016/j.isci.2023.10624037153443 10.1016/j.isci.2023.106240
Shazman S Celniker G Haber O Glaser F Mandel-Gutfreund Y Patch finder plus (PFplus): a web server for extracting and displaying positive electrostatic patches on protein surfaces Nucleic Acids Res 2007 35 Web Server issue W526 W530 10.1093/nar/gkm401 17537808
Shazman S, Celniker G, Haber O, Glaser F, Mandel-Gutfreund Y (2007) Patch finder plus (PFplus): a web server for extracting and displaying positive electrostatic patches on protein surfaces. Nucleic Acids Res 35(Web Server issue):W526–W530. 10.1093/nar/gkm40117537808 10.1093/nar/gkm401
Shen HW Toda S Moussawi K Bouknight A Zahm DS Kalivas PW Altered dendritic spine plasticity in cocaine-withdrawn rats J Neurosci 2009 29 9 2876 2884 10.1523/JNEUROSCI.5638-08.2009 19261883
Shen HW, Toda S, Moussawi K, Bouknight A, Zahm DS, Kalivas PW (2009) Altered dendritic spine plasticity in cocaine-withdrawn rats. J Neurosci 29(9):2876–2884. 10.1523/JNEUROSCI.5638-08.200919261883 10.1523/JNEUROSCI.5638-08.2009
Shiryaev N Jouroukhin Y Giladi E Polyzoidou E Grigoriadis NC Rosenmann H Gozes I NAP protects memory, increases soluble tau and reduces tau hyperphosphorylation in a tauopathy model Neurobiol Dis 2009 34 2 381 388 10.1016/j.nbd.2009.02.011 19264130
Shiryaev N, Jouroukhin Y, Giladi E, Polyzoidou E, Grigoriadis NC, Rosenmann H, Gozes I (2009) NAP protects memory, increases soluble tau and reduces tau hyperphosphorylation in a tauopathy model. Neurobiol Dis 34(2):381–388. 10.1016/j.nbd.2009.02.01119264130 10.1016/j.nbd.2009.02.011
Solinas M Belujon P Fernagut PO Jaber M Thiriet N Dopamine and addiction: what have we learned from 40 years of research J Neural Transm (Vienna) 2019 126 4 481 516 10.1007/s00702-018-1957-2 30569209
Solinas M, Belujon P, Fernagut PO, Jaber M, Thiriet N (2019) Dopamine and addiction: what have we learned from 40 years of research. J Neural Transm (Vienna) 126(4):481–516. 10.1007/s00702-018-1957-230569209 10.1007/s00702-018-1957-2
Spronk DB van Wel JH Ramaekers JG Verkes RJ Characterizing the cognitive effects of cocaine: a comprehensive review Neurosci Biobehav Rev 2013 37 8 1838 1859 10.1016/j.neubiorev.2013.07.003 23876288
Spronk DB, van Wel JH, Ramaekers JG, Verkes RJ (2013) Characterizing the cognitive effects of cocaine: a comprehensive review. Neurosci Biobehav Rev 37(8):1838–1859. 10.1016/j.neubiorev.2013.07.00323876288 10.1016/j.neubiorev.2013.07.003
Sragovich S Malishkevich A Piontkewitz Y Giladi E Touloumi O Lagoudaki R Grigoriadis N Gozes I The autism/neuroprotection-linked ADNP/NAP regulate the excitatory glutamatergic synapse Transl Psychiatry 2019 9 1 2 10.1038/s41398-018-0357-6 30664622
Sragovich S, Malishkevich A, Piontkewitz Y, Giladi E, Touloumi O, Lagoudaki R, Grigoriadis N, Gozes I (2019a) The autism/neuroprotection-linked ADNP/NAP regulate the excitatory glutamatergic synapse. Transl Psychiatry 9(1):2. 10.1038/s41398-018-0357-630664622 10.1038/s41398-018-0357-6
Sragovich S, Merenlender-Wagner A, Gozes I (2017) ADNP Plays a Key Role in Autophagy: From Auti sm to Schizophrenia and Alzheimer’s Disease. BioEssays : news andreviews in molecular, cellular and developmental biology 39. 10.1002/bies.201700054
Sragovich S Ziv Y Vaisvaser S Shomron N Hendler T Gozes I The autism-mutated ADNP plays a key role in stress response Transl Psychiatry 2019 9 1 235 10.1038/s41398-019-0569-4 31534115
Sragovich S, Ziv Y, Vaisvaser S, Shomron N, Hendler T, Gozes I (2019b) The autism-mutated ADNP plays a key role in stress response. Transl Psychiatry 9(1):235. 10.1038/s41398-019-0569-431534115 10.1038/s41398-019-0569-4
Steketee JD Cortical mechanisms of cocaine sensitization Crit Rev Neurobiol 2005 17 2 69 86 10.1615/critrevneurobiol.v17.i2.20 16808728
Steketee JD (2005) Cortical mechanisms of cocaine sensitization. Crit Rev Neurobiol 17(2):69–86. 10.1615/critrevneurobiol.v17.i2.2016808728 10.1615/critrevneurobiol.v17.i2.20
Sudai E Croitoru O Shaldubina A Abraham L Gispan I Flaumenhaft Y Roth-Deri I Kinor N Aharoni S Ben-Tzion M Yadid G High cocaine dosage decreases neurogenesis in the hippocampus and impairs working memory Addict Biol 2011 16 2 251 260 10.1111/j.1369-1600.2010.00241.x 20731634
Sudai E, Croitoru O, Shaldubina A, Abraham L, Gispan I, Flaumenhaft Y, Roth-Deri I, Kinor N, Aharoni S, Ben-Tzion M, Yadid G (2011) High cocaine dosage decreases neurogenesis in the hippocampus and impairs working memory. Addict Biol 16(2):251–260. 10.1111/j.1369-1600.2010.00241.x20731634 10.1111/j.1369-1600.2010.00241.x
Sun X Peng X Cao Y Zhou Y Sun Y ADNP promotes neural differentiation by modulating Wnt/beta-catenin signaling Nat Commun 2020 11 1 2984 10.1038/s41467-020-16799-0 32533114
Sun X, Peng X, Cao Y, Zhou Y, Sun Y (2020) ADNP promotes neural differentiation by modulating Wnt/beta-catenin signaling. Nat Commun 11(1):2984. 10.1038/s41467-020-16799-032533114 10.1038/s41467-020-16799-0
Tan A Moratalla R Lyford GL Worley P Graybiel AM The activity-regulated cytoskeletalassociated protein arc is expressed in different striosome-matrix patterns following exposure to amphetamine and cocaine J Neurochem 2000 74 5 2074 2078 10.1046/j.1471-4159.2000.0742074.x 10800951
Tan A, Moratalla R, Lyford GL, Worley P, Graybiel AM (2000) The activity-regulated cytoskeletalassociated protein arc is expressed in different striosome-matrix patterns following exposure to amphetamine and cocaine. J Neurochem 74(5):2074–2078. 10.1046/j.1471-4159.2000.0742074.x10800951 10.1046/j.1471-4159.2000.0742074.x
Thompson AM Gosnell BA Wagner JJ Enhancement of long-term potentiation in the rat hippocampus following cocaine exposure Neuropharmacology 2002 42 8 1039 1042 10.1016/s0028-3908(02)00059-x 12128005
Thompson AM, Gosnell BA, Wagner JJ (2002) Enhancement of long-term potentiation in the rat hippocampus following cocaine exposure. Neuropharmacology 42(8):1039–1042. 10.1016/s0028-3908(02)00059-x12128005 10.1016/s0028-3908(02)00059-x
Tsang VWL Tao B Dames S Walsh Z Kryskow P Safety and tolerability of intramuscular and sublingual ketamine for psychiatric treatment in the Roots To Thrive ketamine-assisted therapy program: a retrospective chart review Ther Adv Psychopharmacol 2023 13 20451253231171512 10.1177/20451253231171512 37256163
Tsang VWL, Tao B, Dames S, Walsh Z, Kryskow P (2023) Safety and tolerability of intramuscular and sublingual ketamine for psychiatric treatment in the Roots To Thrive ketamine-assisted therapy program: a retrospective chart review. Ther Adv Psychopharmacol 13:20451253231171512. 10.1177/2045125323117151237256163 10.1177/20451253231171512
Vaisburd S Shemer Z Yeheskel A Giladi E Gozes I Risperidone and NAP protect cognition andnormalize gene expression in a schizophrenia mouse model Sci Rep 2015 5 16300 10.1038/srep16300 26553741
Vaisburd S, Shemer Z, Yeheskel A, Giladi E, Gozes I (2015) Risperidone and NAP protect cognition andnormalize gene expression in a schizophrenia mouse model. Sci Rep 5:16300. 10.1038/srep1630026553741 10.1038/srep16300
Vulih-Shultzman I Pinhasov A Mandel S Grigoriadis N Touloumi O Pittel Z Gozes I Activity dependent neuroprotective protein snippet NAP reduces tau hyperphosphorylation and enhances learning in a novel transgenic mouse model J Pharmacol Exp Ther 2007 323 2 438 449 10.1124/jpet.107.129551 17720885
Vulih-Shultzman I, Pinhasov A, Mandel S, Grigoriadis N, Touloumi O, Pittel Z, Gozes I (2007) Activity dependent neuroprotective protein snippet NAP reduces tau hyperphosphorylation and enhances learning in a novel transgenic mouse model. J Pharmacol Exp Ther 323(2):438–449. 10.1124/jpet.107.12955117720885 10.1124/jpet.107.129551
Wink LK O'Melia AM Shaffer RC Pedapati E Friedmann K Schaefer T Erickson CA Intranasal ketamine treatment in an adult with autism spectrum disorder J Clin Psychiatry 2014 75 8 835 836 10.4088/JCP.13cr08917 25191906
Wink LK, O'Melia AM, Shaffer RC, Pedapati E, Friedmann K, Schaefer T, Erickson CA (2014) Intranasal ketamine treatment in an adult with autism spectrum disorder. J Clin Psychiatry 75(8):835–836. 10.4088/JCP.13cr0891725191906 10.4088/JCP.13cr08917
Winklbaur B Ebner N Sachs G Thau K Fischer G Substance abuse in patients with schizophrenia Dialogues Clin Neurosci 2006 8 1 37 43 10.31887/DCNS.2006.8.1/bwinklbaur 16640112
Winklbaur B, Ebner N, Sachs G, Thau K, Fischer G (2006) Substance abuse in patients with schizophrenia. Dialogues Clin Neurosci 8(1):37–43. 10.31887/DCNS.2006.8.1/bwinklbaur16640112 10.31887/DCNS.2006.8.1/bwinklbaur
Yamaguchi M Suzuki T Seki T Namba T Juan R Arai H Hori T Asada T Repetitive cocaine administration decreases neurogenesis in adult rat hippocampus Ann N Y Acad Sci 2004 1025 351 362 10.1196/annals.1316.043 15542736
Yamaguchi M, Suzuki T, Seki T, Namba T, Juan R, Arai H, Hori T, Asada T (2004) Repetitive cocaine administration decreases neurogenesis in adult rat hippocampus. Ann N Y Acad Sci 1025:351–362. 10.1196/annals.1316.04315542736 10.1196/annals.1316.043
Yuste R Bonhoeffer T Morphological changes in dendritic spines associated with long-term synaptic plasticity Annu Rev Neurosci 2001 24 1071 1089 10.1146/annurev.neuro.24.1.1071 11520928
Yuste R, Bonhoeffer T (2001) Morphological changes in dendritic spines associated with long-term synaptic plasticity. Annu Rev Neurosci 24:1071–1089. 10.1146/annurev.neuro.24.1.107111520928 10.1146/annurev.neuro.24.1.1071
Zamostiano R Pinhasov A Gelber E Steingart RA Seroussi E Giladi E Bassan M Wollman Y Eyre HJ Mulley JC Brenneman DE Gozes I Cloning and characterization of the human activitydependent neuroprotective protein J Biol Chem 2001 276 1 708 714 10.1074/jbc.M007416200 11013255
Zamostiano R, Pinhasov A, Gelber E, Steingart RA, Seroussi E, Giladi E, Bassan M, Wollman Y, Eyre HJ, Mulley JC, Brenneman DE, Gozes I (2001) Cloning and characterization of the human activitydependent neuroprotective protein. J Biol Chem 276(1):708–714. 10.1074/jbc.M00741620011013255 10.1074/jbc.M007416200
Ziv Y Rahamim N Lezmy N Even-Chen O Shaham O Malishkevich A Giladi E Elkon R Gozes I Barak S Activity-dependent neuroprotective protein (ADNP) is an alcohol-responsive gene and negative regulator of alcohol consumption in female mice Neuropsychopharmacology 2019 44 2 415 424 10.1038/s41386-018-0132-7 30008470
Ziv Y, Rahamim N, Lezmy N, Even-Chen O, Shaham O, Malishkevich A, Giladi E, Elkon R, Gozes I, Barak S (2019) Activity-dependent neuroprotective protein (ADNP) is an alcohol-responsive gene and negative regulator of alcohol consumption in female mice. Neuropsychopharmacology 44(2):415–424. 10.1038/s41386-018-0132-730008470 10.1038/s41386-018-0132-7
