
==== Front
Planta
Planta
Planta
0032-0935
1432-2048
Springer Berlin Heidelberg Berlin/Heidelberg

39251505
4519
10.1007/s00425-024-04519-7
Short Communication
Female gametophyte development is required for nucellar-tip degeneration during Arabidopsis ovule development
http://orcid.org/0000-0002-9521-7135
Park Chulmin life1@snu.ac.kr

12
Hyun Youbong youbong.hyun@snu.ac.kr

13
Lee Ji-Young jl924@snu.ac.kr

145
1 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 School of Biological Sciences, College of Natural Science, Seoul National University, Seoul, 08826 Korea
2 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Research Institute of Basic Sciences, College of Natural Sciences, Seoul National University, Seoul, 08826 Korea
3 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Research Center for Plant Plasticity, Seoul National University, Seoul, 08826 Korea
4 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Plant Genomics and Breeding Institute, Seoul National University, Seoul, 08826 Korea
5 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Plant Immunity Research Center, Seoul National University, Seoul, 00826 Korea
Communicated by Stefan de Folter.

9 9 2024
9 9 2024
2024
260 4 8729 5 2024
27 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Main conclusion

Genetic ablation of the female gametophyte provides direct evidence for the existence of interregional communication during Arabidopsis ovule development and the importance of the female gametophyte in nucellar-tip degeneration.

The angiosperm ovule consists of three regions: the female gametophyte, the nucellus, and the integuments, all of which develop synchronously and coordinately. Previously, interregional communication enabling cooperative ovule development had been proposed; however, the evidence for these communications mostly relies on the analysis of mutant phenotypes. To provide direct evidence, we specifically ablated the Arabidopsis female gametophyte by expressing the diphtheria toxin fragment A (DTA) under the female gametophyte-specific DD13 promoter and analyzed its effects on the development of the nucellus and the integuments. We found that the female gametophyte is not required for integument development or for the orientation and curvature of the ovule body, but is necessary for nucellar-tip degeneration. The results presented here provide direct evidence for communication from the female gametophyte to the nucellus and demonstrate that Arabidopsis ovules require interregional communication for cooperative development.

Keywords

Arabidopsis
Ovule
Female gametophyte
Nucellus
Integuments
DTA
DD13
National Research Foundation of KoreaNRF-2020R1C1C101348315 NRF-2021R1A5A1032428 NRF-2021R1A2C3006061 Park Chulmin Hyun Youbong Lee Ji-Young http://dx.doi.org/10.13039/501100003725 National Research Foundation of Korea NRF-2021R1A2C101007712 NRF-2018R1A5A1023599 Hyun Youbong Lee Ji-Young Seoul National UniversityOpen Access funding enabled and organized by Seoul National University.

issue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2024
==== Body
pmcIntroduction

Ovules, the developmental precursors of seeds, represent one of the most significant innovations of Spermatophyta (seed plants) (Rudall 2021). The ovule is initiated from the placenta as a small finger-like primordium with three regions: the funiculus, the chalaza, and the nucellus along the proximal–distal axis (Skinner et al. 2004). The nucellus is the most distal region of the ovule primordium. A single inner nucellar cell differentiates into a megasporocyte, a megaspore mother cell, which undergoes meiosis to make a functional megaspore (megasporogenesis) and mitosis to produce a megagametophyte, an embryo sac (megagametogenesis), while the other nucellar cells enclose the megagametophyte. The chalaza is the central region of the ovule primordium where the integuments emerge, and they grow to cover the nucellus, leaving a small opening, the micropyle. The funiculus, the proximal region of the ovule primordium, is a vascularized stalk that links the ovule to the placenta.

An ovule is established via highly dynamic and synchronous development of the female gametophyte, the nucellus, and the integuments. In the model plant Arabidopsis, the ovule primordium undergoes the following three major processes: 1) female gametophyte development, 2) nucellar-tip degeneration, and 3) integuments development (Fig. 1a) (Schneitz et al. 1995; Vijayan et al. 2021). 1) Female gametophyte development is a series of sequential progression. A subepidermal cell differentiates into a megaspore mother cell, which undergoes meiosis to produce four megaspores (megasporogenesis). Only the chalazal megaspore survives, expands, and curves, accompanied by three rounds of mitosis without cytokinesis, followed by nuclear migration and cellularization. These eventually give rise to the mature curved female gametophyte with eight nuclei in seven cells (megagametogenesis). The female gametophyte expands nine-fold in volume during this process and bends gynapically (Vijayan et al. 2021). 2) The single-layered nucellar tip and the nucellar cells surrounding the female gametophyte degenerate through vacuolar cell death in concert with female gametophyte development, providing space for the expanding embryo sac (Wang et al. 2021). 3) The inner and outer integuments emerge from the chalazal epidermis, undergo planar or laminar growth to form sheet-like lateral organs, asymmetrically surround the female gametophyte to create the micropyle on the gynapical side, and eventually shape the curved ovule body. These coordinated processes establish a campylotropous tenuinucellate bitegmic ovule (Robinson-Beers et al. 1992; Shamrov 2018).Fig. 1 Arabidopsis ovule development and expression patterns of pDD13::H2B-GFP a Schematic representation of Arabidopsis ovule development. Different colors represent different tissues: dark blue (female gametophyte), gray (nucellar tip), light blue (nucellus), yellow (inner integument), light green (outer integument), violet (chalaza), and dark green (funiculus). Circled numbers indicate the regions where the processes occur. b-i Expression patterns of pDD13::H2B-GFP during Arabidopsis ovule development. Upper images (b-i) are merged images of bright field images and the lower GFP images (b`-i`). P (primordia), MMC (megaspore mother cell). White-dashed lines outline the outer edge of the nucellus and yellow-dashed lines encircle the megaspore mother cell and the developing female gametophyte. Arrowheads indicate female gametophyte nuclei until FG5 and antipodal cells at FG7. Scale bars: 20 μm

In addition to synchronous and coordinated ovule development, molecular and genetic analyses of genes controlling ovule development also support the idea that ovule development is a cooperative process requiring interregional communication among the female gametophyte, the nucellus, and the integuments (Gasser et al. 1998; Gross-Hardt et al. 2002; Grossniklaus and Schneitz 1998). However, it remains elusive which processes exactly require interregional communication. Current studies of gene expression patterns and their mutant phenotypes during ovule development cannot fully address interregional communication. Therefore, independent experiments are necessary to demonstrate the presence of interregional communication in specific processes during ovule development.

Here, we elucidated the roles of the female gametophyte in cooperative ovule development. To eliminate the effects of the female gametophyte on nucellus and integuments development, we specifically ablated the Arabidopsis female gametophyte by expressing the diphtheria toxin fragment A (DTA) under the female gametophyte-specific DD13 promoter (Steffen et al. 2007; Yu et al. 2016; Yuan et al. 2016) and analyzed its effects on nucellus and integuments development. We found that the female gametophyte is not required for integuments development nor the orientation and curvature of the ovule body, but it is necessary for nucellar-tip degeneration. These results demonstrate that Arabidopsis ovule development is cooperative and requires communication among the female gametophyte, the nucellus, and the integuments, and, particularly, the female gametophyte plays a crucial role in nucellar-tip degeneration.

Materials and methods

Plant materials and growth conditions

Arabidopsis (Arabidopsis thaliana) ecotype Columbia (Col-0) was used. pDD13::H2B-GFP and pDR5revV2::n3GFP – pTCSn::ntdTomato were previously described (Smet et al. 2019; Yu et al. 2016). The plants were grown under a 16-h–light/8-h–dark cycle at 22°–23 °C in a plant growth chamber.

Construction of transgenic plants

Gateway cloning technology (Invitrogen) was used for DNA manipulations. The DD13 promoter region (Yu et al. 2016) was amplified from Arabidopsis Col-0 genomic DNA by PCR using pDD13-F-attB4 (GGGGACAACTTTGTATAGAAAAGTTGCGatctttttgataaatgagagtactatattgtg) and pDD13-R-attB1r (GGGGACTGCTTTTTTGTACAAACTTGCTCTCAAAATCTGCATATATCTTTTTAATGAC), and inserted into pDONR P4_P1R via a BP reaction. The DTA CDS was amplified using DTA-F (caccATGGATCCTGATGATGTTGTT) and DTA-R (TTAGAGCTTTAAATCTCTGTA G), and cloned into pENTR/D-TOPO. pDD13::DTA was constructed into dpGreen-BarT by means of Multisite Gateway LR recombination and transformed into Agrobacterium GV3101 with pSOUP for Arabidopsis transformation via floral dipping. Transgenic plants were selected with a 2,000-fold diluted Basta (Bayer Crop Science) solution on soil.

Phenotype and segregation analysis

Morphologic observations of rosettes and inflorescences were conducted using an optical camera (Nikon D7000). A Zeiss Stemi 508 stereomicroscope coupled with an Axiocam 208 color camera was used to observe and analyze the phenotypes of siliques and seeds. For quantitative analysis of fertilization rates, siliques were dissected under the stereomicroscope, and fertilized and unfertilized ovules were manually counted. Three and five siliques from individual plants were analyzed in T1 and T2, respectively. For segregation analysis, the basta resistance of approximately a hundred seeds on MS plates supplemented with 10 ug/ml basta was examined.

Microscopy

For DIC microscopy images of developing ovules, ovules were cleared at the mentioned stages in a chloral hydrate solution (chloral hydrate/water/glycerol, 8/3/1, w/v/v) and imaged with a ZEISS A1 microscope coupled to an Axiocam 712 color camera. For confocal images of developing ovules, ovules were mounted in a 10% glycerol solution and imaged directly using a Nikon ECLIPSE Ti2 laser scanning confocal microscope with excitation/detection wavelengths of 488 nm/493 to 547 nm for GFP, and 552 nm/557 to 737 nm for autofluorescence.

Results

The DD13 promoter is exclusively active in female gametophytic cells

To investigate the roles of the female gametophyte in interregional communication during ovule development, we searched for a promoter that is exclusively active in the female gametophyte. As a result, we found that the DD13 promoter is ideal for this purpose. DD13 (At3g59260), encoding a pirin-like protein, was identified as an antipodal cell-specific gene in the mature ovule (Steffen et al. 2007), and the DD13 promoter has been used to generate an antipodal cell marker (Yu et al. 2016; Yuan et al. 2016). When we examined the expression of histone H2B-GFP driven by DD13 promoter (pDD13::H2B-GFP) (Yu et al. 2016) throughout Arabidopsis ovule development, we confirmed that the pDD13::H2B-GFP signal is only detected in the antipodal cells in the mature ovule (Fig. 1i). However, in earlier stages of ovule development, we observed previously unreported pDD13::H2B-GFP signals from the functional megaspore (Fig. 1e) and the subsequent female gametophytic nuclei (Fig. 1f–h). Since we did not observe any pDD13::H2B-GFP signals in the ovule primordia and the megaspore mother cell (Fig. 1b-d), we concluded that the DD13 promoter is active not only in the antipodal cells after the cellularization of the female gametophyte but also in every female gametophyte nucleus during the syncytial stage (Fig. 1e-i). These findings suggest that the DD13 promoter can be used as an undifferentiated syncytial stage marker of the female gametophyte, in addition to an antipodal cell marker.

DD13 promoter-driven DTA induces defects in the female gametophyte

To examine the roles of the female gametophyte in ovule development through specific ablation of the female gametophyte, we generated pDD13::DTA transgenic plants expressing DTA under the DD13 promoter. DTA kills cells by blocking protein synthesis (Collier 1967) and the encoding gene has been used to ablate specific tissues in plants (Day et al. 1995; Nilsson et al. 1998; Tsugeki and Fedoroff 1999; Weijers et al. 2003). We analyzed 10 independent transgenic T1 plants and found that pDD13::DTA plants had no defects in any organs besides siliques (Fig. 2a–h). Siliques of pDD13::DTA plants were shorter than those of the wild-type, and the fertilization rates were around 50% (Fig. 2b–d, f–i). To test whether the phenotype is transmitted sporophytically or gametophytically, we checked the segregation ratio in T2 plants. If the seedlings have the transgene, they could survive on the basta plate because they carry a basta-resistant gene used as a selection marker. All T2 plants from 10 independent T1 plants showed around 50% survival rates, indicating a 1:1 segregation ratio (Fig. 2j). Similarly, 50% fertilization rates and a 1:1 segregation ratio were observed in T2 siliques and T3 seedlings, respectively (Fig. 2k, l). It is noteworthy that all tested-T2 plants were hemizygous for the transgene, and we could not obtain any homozygous of transgene based on the segregation ratio in T3 plants (Fig. 2l). These segregation distortion (SD) results indicate that the pDD13::DTA transgene fails to transmit through the female gametophyte by triggering gametophytic lethality (Christensen et al. 1998; Drews and Koltunow 2011; Howden et al. 1998).Fig. 2 Analysis of phenotype and segregation rate of pDD13::DTA transgenic plants Phenotypes of rosettes (a, e), inflorescences (b, f), siliques (c, g), and seeds (d, h) in the wild-type (a-d) and pDD13::DTA/- (e–h) plants. i Fertilization rates of the wild-type and ten-independent pDD13::DTA T1 plants. j Segregation ratio of pDD13::DTA T2 seeds from ten-independent T1 plants on agar plates containing basta. k Fertilization rates of the wild-type and ten-individual plants of two representative T2 lines. l Segregation ratio of pDD13::DTA T3 seeds from ten-individual plants of two representative T2 lines

Next, we analyzed the ovule phenotypes of pDD13::DTA plants and found that around 50% of ovules of pDD13::DTA plants did not develop female gametophytes, and the others were identical to the wild-type ovules (Fig. 3f, l). Since these transgenic plants were hemizygous, pDD13::DTA likely triggered the ablation of the female gametophytes.Fig. 3 Cytologic analysis and auxin response of developing ovules in the wild-type and pDD13::DTA/-plants a-l DIC microscopy images of the wild-type (a-f) and pDD13::DTA/- (g-l) ovules at the indicated stages. m-x Confocal images of the wild-type (m-r) and pDD13::DTA/- (s-x) plants carrying an auxin-signaling reporter (pDR5revV2::n3GFP). Upper images (m-x) are merged images of the bright field and the lower fluorescence images (m`-x`). MMC, megaspore mother cell. White-dashed lines outline the outer edge of the nucellus and yellow-dashed lines encircle the megaspore mother cell and the developing female gametophyte. Scale bars: 20 μm

The ablation of the female gametophyte induces defects in nucellar-tip degeneration

After confirming that pDD13::DTA specifically ablates the female gametophyte, we investigated the roles of the female gametophyte in ovule development. Between wild-type and female gametophyte-ablated mature ovules, there was no difference in asymmetric integuments development to establish curvature and micropyle (Fig. 3f, l). However, the nucellar tip remained in around 50% of ovules from pDD13::DTA hemizygous plants, in contrast to wild-type mature ovules where the nucellar tip degenerated (Fig. 3f, l).

To understand the roles of the female gametophyte in nucellar-tip degeneration in more detail, we sequentially analyzed ovule development after functional megaspore formation in both wild-type and female gametophyte-ablated ovules. In the wild-type ovule, the haploid functional megaspore undergoes three rounds of mitotic divisions, enlarges, and becomes vacuolated (Fig. 3a–f, m–r). Concurrently with this megagametogenesis, the nucellar tip degenerates, providing space for the expanding female gametophyte (Lu and Magnani 2018). In contrast to the wild-type, around 50% of ovules from pDD13::DTA hemizygous plants retained the nucellar tip even though the megagametophyte was absent (Fig. 3g–l, s–x).

To confirm these results, we examined the auxin response, which is high in the degenerating nucellar cells and plays an important role in nucellar-tip degeneration (Wang et al. 2021). In wild-type ovules, the auxin response was strong in the nucellar tip until FG2 (Fig. 3m–o), and as nucellar cell degeneration progressed from the distal nucellar tip toward the proximal nucellus, the auxin response also moved accordingly, as previously reported (Fig. 3p–r) (Wang et al. 2021). In contrast, in around 50% of ovules from pDD13::DTA hemizygous plants, the auxin response persisted in the distal nucellar cells throughout ovule development (Fig. 3s–x), supporting the notion that the distal cells with high auxin responses are the nucellar-tip cells that did not degenerate.

These data suggest that the female gametophyte is not required for integument development but is necessary for nucellar-tip degeneration.

Discussion

Ovule development is a highly dynamic and synchronous process involving interactions among the female gametophyte, the nucellus, and the integuments. These processes and their interactions have mainly been studied based on mutant phenotypes with defective ovule development. Here, we provide direct evidence for the existence of interregional communication during ovule development. By utilizing a genetic tool that specifically ablates the female gametophyte, we demonstrate that the female gametophyte is not required for integument development nor the orientation and curvature of the ovule body; however, it is necessary for nucellar-tip degeneration.

Although several genes regulating ovule development have been identified, it remains difficult to determine the effect of the female gametophyte on integument development based solely on mutant phenotypes. For example, both SPL/NZZ and WUS are expressed in the nucellar tip, and their mutants exhibit defects in megasporogenesis. However, these mutants display different integument phenotypes: while the spl/nzz mutant develops normal integuments, the wus mutant lacks integuments (Gross-Hardt et al. 2002; Lieber et al. 2011; Vijayan et al. 2021). The data presented here provide a clear answer to this question: the female gametophyte is not required for integument development.

Regarding cooperative ovule development, INNER NO OUTER (INO) is one of the most studied genes. INO is expressed in the outer integument, and its mutant ovule exhibits defects in megagametogenesis (blocked at the mono-nuclear embryo sac stage) and nucellar-tip degeneration. This implies that INO regulates megagametogenesis and nucellar tip degeneration in a non-cell-autonomous manner (Baker et al. 1997; Schneitz et al. 1997; Vijayan et al. 2021). However, it remains unclear whether INO regulates nucellar-tip degeneration in parallel with or through the female gametophyte. Here, we found that the female gametophyte is necessary for nucellar-tip degeneration, favoring the idea that INO indirectly regulates nucellar-tip degeneration through the female gametophyte.

Recently, Wang et al. found that the polar transport of distal maternal auxin into the nucellar tip via auxin efflux carriers is crucial for nucellar-tip degeneration (Wang et al. 2021). Interestingly, we found that in the female gametophyte-ablated ovule, auxin signaling remains strong in the nucellar tip, yet the nucellar tip does not degenerate. This suggests that both auxin signaling and the presence of the female gametophyte are necessary for nucellar-tip degeneration.

The results presented here substantiate the presence of interregional communication among the female gametophyte, the nucellus, and the integuments, which enables cooperative ovule development, highlighting the importance of the female gametophyte for nucellar-tip degeneration.

Acknowledgements

We thank Prof. Meng-xiang Sun for pDD13::H2B-GFP seeds and Prof. Bert De Rybel for pDR5revV2::n3GFP–pTCSn::ntdTomato seeds. This work is supported by the National Research Foundation of Korea (NRF-2020R1C1C101348315) to C.P., NRF-2021R1A2C101007712 and NRF-2021R1A5A1032428 to Y. H., and NRF-2021R1A2C3006061 and NRF-2018R1A5A1023599 to J.Y.L.

Author contributions

CP conceived the project, performed the experiments, analyzed the data, and prepared the figures; YH and J-YL supervised the experiments and data analysis; CP wrote the article with contributions from all authors.

Funding

Open Access funding enabled and organized by Seoul National University.

Declarations

Conflict of interest

The authors declare no conflict of interest.

Data availability

All relevant data can be found within the manuscript.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

Christensen CA Subramanian S Drews GN Identification of gametophytic mutations affecting female gametophyte development in Arabidopsis Dev Biol 1998 202 1 136 151 10.1006/dbio.1998.8980 9758709
Christensen CA, Subramanian S, Drews GN (1998) Identification of gametophytic mutations affecting female gametophyte development in Arabidopsis. Dev Biol 202(1):136–151. 10.1006/dbio.1998.89809758709 10.1006/dbio.1998.8980
Collier RJ Effect of diphtheria toxin on protein synthesis: inactivation of one of the transfer factors J Mol Biol 1967 25 1 83 98 10.1016/0022-2836(67)90280-x 4291872
Collier RJ (1967) Effect of diphtheria toxin on protein synthesis: inactivation of one of the transfer factors. J Mol Biol 25(1):83–98. 10.1016/0022-2836(67)90280-x4291872 10.1016/0022-2836(67)90280-x
Day CD Galgoci BF Irish VF Genetic ablation of petal and stamen primordia to elucidate cell interactions during floral development Development 1995 121 9 2887 2895 10.1242/dev.121.9.2887 7555715
Day CD, Galgoci BF, Irish VF (1995) Genetic ablation of petal and stamen primordia to elucidate cell interactions during floral development. Development 121(9):2887–2895. 10.1242/dev.121.9.28877555715 10.1242/dev.121.9.2887
Drews GN Koltunow AM The Female Gametophyte Arabidopsis Book 2011 9 e0155 10.1199/tab.0155 22303279
Drews GN, Koltunow AM (2011) The Female Gametophyte Arabidopsis Book 9:e0155. 10.1199/tab.015522303279 10.1199/tab.0155
Gasser CS Broadhvest J Hauser BA Genetic analysis of ovule development Annu Rev Plant Physiol Plant Mol Biol 1998 49 1 24 10.1146/annurev.arplant.49.1.1 15012225
Gasser CS, Broadhvest J, Hauser BA (1998) Genetic analysis of ovule development. Annu Rev Plant Physiol Plant Mol Biol 49:1–24. 10.1146/annurev.arplant.49.1.115012225 10.1146/annurev.arplant.49.1.1
Gross-Hardt R Lenhard M Laux T WUSCHEL signaling functions in interregional communication during Arabidopsis ovule development Genes Dev 2002 16 9 1129 1138 10.1101/gad.225202 12000795
Gross-Hardt R, Lenhard M, Laux T (2002) WUSCHEL signaling functions in interregional communication during Arabidopsis ovule development. Genes Dev 16(9):1129–1138. 10.1101/gad.22520212000795 10.1101/gad.225202
Grossniklaus U Schneitz K The molecular and genetic basis of ovule and megagametophyte development Semin Cell Dev Biol 1998 9 2 227 238 10.1006/scdb.1997.0214 9599420
Grossniklaus U, Schneitz K (1998) The molecular and genetic basis of ovule and megagametophyte development. Semin Cell Dev Biol 9(2):227–238. 10.1006/scdb.1997.02149599420 10.1006/scdb.1997.0214
Howden R Park SK Moore JM Orme J Grossniklaus U Twell D Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis Genetics 1998 149 2 621 631 10.1093/genetics/149.2.621 9611178
Howden R, Park SK, Moore JM, Orme J, Grossniklaus U, Twell D (1998) Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis. Genetics 149(2):621–631. 10.1093/genetics/149.2.6219611178 10.1093/genetics/149.2.621
Lu J Magnani E Seed tissue and nutrient partitioning, a case for the nucellus Plant Reprod 2018 31 3 309 317 10.1007/s00497-018-0338-1 29869727
Lu J, Magnani E (2018) Seed tissue and nutrient partitioning, a case for the nucellus. Plant Reprod 31(3):309–317. 10.1007/s00497-018-0338-129869727 10.1007/s00497-018-0338-1
Nilsson O Wu E Wolfe DS Weigel D Genetic ablation of flowers in transgenic Arabidopsis Plant J 1998 15 6 799 804 10.1046/j.1365-313x.1998.00260.x 9807818
Nilsson O, Wu E, Wolfe DS, Weigel D (1998) Genetic ablation of flowers in transgenic Arabidopsis. Plant J 15(6):799–804. 10.1046/j.1365-313x.1998.00260.x9807818 10.1046/j.1365-313x.1998.00260.x
Robinson-Beers K Pruitt RE Gasser CS Ovule development in wild-type Arabidopsis and two female-sterile mutants Plant Cell 1992 4 10 1237 1249 10.1105/tpc.4.10.1237 12297633
Robinson-Beers K, Pruitt RE, Gasser CS (1992) Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4(10):1237–1249. 10.1105/tpc.4.10.123712297633 10.1105/tpc.4.10.1237
Rudall PJ Evolution and patterning of the ovule in seed plants Biol Rev Camb Philos Soc 2021 96 3 943 960 10.1111/brv.12684 33432779
Rudall PJ (2021) Evolution and patterning of the ovule in seed plants. Biol Rev Camb Philos Soc 96(3):943–960. 10.1111/brv.1268433432779 10.1111/brv.12684
Schneitz K Hulskamp M Pruitt RE Wild-type ovule development in arabidopsis-thaliana - a light-microscope study of cleared whole-mount tissue Plant J 1995 7 5 731 749 10.1046/j.1365-313X.1995.07050731.x
Schneitz K, Hulskamp M, Pruitt RE (1995) Wild-type ovule development in arabidopsis-thaliana - a light-microscope study of cleared whole-mount tissue. Plant J 7(5):731–749. 10.1046/j.1365-313X.1995.07050731.x10.1046/j.1365-313X.1995.07050731.x
Shamrov II Diversity and typification of ovules in flowering plants Wulfenia 2018 25 81 109
Shamrov II (2018) Diversity and typification of ovules in flowering plants. Wulfenia 25:81–109
Skinner DJ Hill TA Gasser CS Regulation of ovule development Plant Cell 2004 16 S32 45 10.1105/tpc.015933 15131247
Skinner DJ, Hill TA, Gasser CS (2004) Regulation of ovule development. Plant Cell 16:S32-45. 10.1105/tpc.01593315131247 10.1105/tpc.015933
Smet W Sevilem I de Luis Balaguer MA Wybouw B Mor E Miyashima S Blob B Roszak P Jacobs TB Boekschoten M Hooiveld G Sozzani R Helariutta Y De Rybel B DOF21 controls cytokinin-dependent vascular cell proliferation downstream of TMO5/LHW Curr Biol 2019 29 3 520 529 10.1016/j.cub.2018.12.041 30686737
Smet W, Sevilem I, de Luis Balaguer MA, Wybouw B, Mor E, Miyashima S, Blob B, Roszak P, Jacobs TB, Boekschoten M, Hooiveld G, Sozzani R, Helariutta Y, De Rybel B (2019) DOF21 controls cytokinin-dependent vascular cell proliferation downstream of TMO5/LHW. Curr Biol 29(3):520–529. 10.1016/j.cub.2018.12.04130686737 10.1016/j.cub.2018.12.041
Steffen JG Kang IH Macfarlane J Drews GN Identification of genes expressed in the Arabidopsis female gametophyte Plant J 2007 51 2 281 292 10.1111/j.1365-313X.2007.03137.x 17559508
Steffen JG, Kang IH, Macfarlane J, Drews GN (2007) Identification of genes expressed in the Arabidopsis female gametophyte. Plant J 51(2):281–292. 10.1111/j.1365-313X.2007.03137.x17559508 10.1111/j.1365-313X.2007.03137.x
Tsugeki R Fedoroff NV Genetic ablation of root cap cells in Arabidopsis Proc Natl Acad Sci U S A 1999 96 22 12941 12946 10.1073/pnas.96.22.12941 10536027
Tsugeki R, Fedoroff NV (1999) Genetic ablation of root cap cells in Arabidopsis. Proc Natl Acad Sci U S A 96(22):12941–12946. 10.1073/pnas.96.22.1294110536027 10.1073/pnas.96.22.12941
Vijayan A Tofanelli R Strauss S Cerrone L Wolny A Strohmeier J Kreshuk A Hamprecht FA Smith RS Schneitz K A digital 3D reference atlas reveals cellular growth patterns shaping the Arabidopsis ovule Elife 2021 10.7554/eLife.63262 33404501
Vijayan A, Tofanelli R, Strauss S, Cerrone L, Wolny A, Strohmeier J, Kreshuk A, Hamprecht FA, Smith RS, Schneitz K (2021) A digital 3D reference atlas reveals cellular growth patterns shaping the Arabidopsis ovule. Elife. 10.7554/eLife.6326233404501 10.7554/eLife.63262
Wang J Guo X Xiao Q Zhu J Cheung AY Yuan L Vierling E Xu S Auxin efflux controls orderly nucellar degeneration and expansion of the female gametophyte in Arabidopsis New Phytol 2021 230 6 2261 2274 10.1111/nph.17152 33338267
Wang J, Guo X, Xiao Q, Zhu J, Cheung AY, Yuan L, Vierling E, Xu S (2021) Auxin efflux controls orderly nucellar degeneration and expansion of the female gametophyte in Arabidopsis. New Phytol 230(6):2261–2274. 10.1111/nph.1715233338267 10.1111/nph.17152
Weijers D Van Hamburg JP Van Rijn E Hooykaas PJ Offringa R Diphtheria toxin-mediated cell ablation reveals interregional communication during arabidopsis seed development Plant Physiol 2003 133 4 1882 1892 10.1104/pp.103.030692 14605218
Weijers D, Van Hamburg JP, Van Rijn E, Hooykaas PJ, Offringa R (2003) Diphtheria toxin-mediated cell ablation reveals interregional communication during arabidopsis seed development. Plant Physiol 133(4):1882–1892. 10.1104/pp.103.03069214605218 10.1104/pp.103.030692
Yu X Luo A Sun MX An efficient antipodal cell isolation method for screening of cell type-specific genes in arabidopsis thaliana PLoS ONE 2016 11 11 e0166390 10.1371/journal.pone.0166390 27875553
Yu X, Luo A, Sun MX (2016) An efficient antipodal cell isolation method for screening of cell type-specific genes in arabidopsis thaliana. PLoS ONE 11(11):e0166390. 10.1371/journal.pone.016639027875553 10.1371/journal.pone.0166390
Yuan L Liu ZN Song XY Johnson C Yu XL Sundaresan V The CKI1 histidine kinase specifies the female gametic precursor of the endosperm Dev Cell 2016 37 1 34 46 10.1016/j.devcel.2016.03.009 27046830
Yuan L, Liu ZN, Song XY, Johnson C, Yu XL, Sundaresan V (2016) The CKI1 histidine kinase specifies the female gametic precursor of the endosperm. Dev Cell 37(1):34–46. 10.1016/j.devcel.2016.03.00927046830 10.1016/j.devcel.2016.03.009
