
==== Front
Trop Life Sci Res
Trop Life Sci Res
Tropical Life Sciences Research
Tropical Life Sciences Research
1985-3718
2180-4249
Penerbit Universiti Sains Malaysia

10.21315/tlsr2024.35.1.2
tlsr_35-1-13
Articles
In silico EST-SSR Identification and Development through EST Sequences from Metroxylon sagu Rottb. for Genetic Diversity Analysis
Purwoko Devit Conceptualization Methodology Writing – original draft Visualization 1*
Zulaeha Siti Resources Visualization 1
Tajuddin Teuku Visualization 1
Mira Farida Rosana Visualization 2
Solikhah Maharani Dewi Visualization 3
Rahmadara Gemilang Resources Visualization 1
Hanifah Nurul Fitri Resources Visualization 1
Rusmanto Investigation Visualization 3
1 Research Centre for Applied Botany, Research Organization for Life Sciences and Environment, National Research and Innovation Agency, Science and Technology Park of Soekarno, Cibinong, Bogor West Java 16911, Indonesia
2 Directorate of Laboratory Management, Building 630, Science and Technology Park of B. J. Habibie, Serpong, South Tangerang 15314, Indonesia
3 Research Centre for Energy Convention and Conservation, National Research and Innovation Agency, Science and Technology Park of B.J. Habibie, Serpong, South Tangerang 15314, Indonesia
* Corresponding author: devi007@brin.go.id; vitocorp@gmail.com
3 2024
30 3 2024
35 1 1332
28 1 2023
24 11 2023
© Penerbit Universiti Sains Malaysia, 2024
2024
https://creativecommons.org/licenses/by/4.0/ This work is licensed under the terms of the Creative Commons Attribution (CC BY) (http://creativecommons.org/licenses/by/4.0/).
Sago plant (Metroxylon sagu Rottb.) is one of the most carbohydrate-producing plants in the world. Microsatellites or simple sequence repeats (SSRs) play an important role in the genome and are used extensively compared to other molecular markers. For the first time, we are exploiting data expressed sequence tags (EST) of sago plants to identify and characterise markers in this species. EST data about sago plants are obtained through the EST database on the National Center for Biotechnology Information (NCBI) website. We obtained data of 458 Kb (412 contig) with a maximum and minimum length of 1,138 and 124 nucleotides, respectively. We successfully identified 820 perfectly patterned SSR using Phobos 3.3.12 software. The type characterisation of EST-SSR was dominated by tri-nucleotides 36% (294), followed by hexa-nucleotides 24% (202), tetra-nucleotides 15% (120), penta-nucleotides 13% (108) and di-nucleotides 12% (96). The most frequency of SSR motifs in each type is AG, AAG and AAAG. Analysis of synteny on the EST sequence with the online application Phytozome found that sequences were distributed on 12 Oryza sativa chromosomes with a likeness percentage between 63% to 100% and e-value between 0 to 0.094. We developed the primer and generated 19 primers. Furthermore, we validated 7 primers that all generated polymorphic alleles. To our knowledge, this report is the first identification and characterisation of EST-SSR for sago species and these markers can be used for genetic diversity analysis, marker assisted selection (MAS), cultivar identification, kinship analysis and genetic mapping analysis.

EST, in silico
Metroxylon sagu
SSR
Genetic Diversity
“Development of Genome Editing Technology to Produce Non-Palm and Palm Oils for Distillate FAME Raw Materials”6251.ABI.006.054
==== Body
pmcHighlights

A computational-based approach was used to develop and identify simple sequence repeat (SSR) markers from a publicly available expressed sequence tags (EST) database.

The identification, characterisation and development of EST-SSR markers can be used for genetic diversity analysis, marker assisted selection (MAS), cultivar identification, kinship analysis and genetic mapping analysis.

New EST-SSR markers were successful used for genetic diversity analysis of sago palm.

INTRODUCTION

Genetic diversity among individuals or populations is the basis of adaptation and evolution and thus plays a major role in dealing with different biotic and abiotic pressures. Diverse genetic resources provide better opportunities for plant breeders to create new, better cultivars with desired traits (Salgotra & Chauhan 2023). The study of genetic diversity in plant species is very useful for the development of breeding programmes and for conservation purposes. To access genetic variation within and between populations, morphological characterisation approaches, biochemical markers and molecular markers are often used (Mondini et al. 2009). Assessment of variation between populations using morphological characters is difficult to study because morphology varies under different plant growth conditions (D’Imperio et al. 2011). DNA markers are critical for assessing genetic diversity between and within different plant species (Amiteye 2021; Hailu & Asfere 2020), because they highlight differences in nucleotide sequences between individuals and are not affected by environmental factors (Aslanbay Guler & Imamoglu 2023).

Simple sequence repeat (SSR) genetic markers are currently widely used for genetic diversity analysis, cultivar identification, pedigree analysis, genetic mapping analysis and marker-assisted selection (MAS). SSR markers, also known as microsatellite markers, if used as genetic markers, are codominant, polymorphic so that they have a high level of allele diversity, and the test is very efficient because it is based on the Polymerase chain reaction (PCR) method (Molla et al. 2010). Therefore, SSR markers can be used to detect the diversity among closely related plant accessions better than other molecular markers (Kumar et al. 2009). SSR markers can be developed through genomic and genic approaches.

SSR markers with a genomic approach (g-SSR) were developed through the identification of genomic sequences while SSR markers with a genic approach (EST-SSR) were developed through expressed sequence tags (EST) sequences (Jain et al. 2014). The development of SSR markers using traditional methods requires a lot of time, money, and laboratory work (Kale et al. 2012). The development of SSR markers from genomic libraries will be time-consuming and require large infrastructure laboratory facilities. An alternative and more effective approach that can be done is searching for SSR in silico in the EST database that has been published in NCBI. This method has been widely used in various molecular studies on various plants (Purwoko et al. 2021; Priyanka et al. 2017; Vieira et al. 2016; Jain et al. 2014; Aberlenc-Bertossi et al. 2014; Duran et al. 2013).

Sago (Metroxylon sagu Rottb.) is one of the palm plants that produce starch. Sago plants can accumulate starch in the trunk up to 200 kg/tree to 220 kg/tree (Jong 1995) and are one of the high carbohydrate-producing plants in the world (Flach 1995). The utilisation of sago is very dependent on the potential of available sago resources. Uncontrolled exploitation of sago is carried out to fulfill the need for food, industrial raw materials and energy which continues to increase, causing productive sago palm species to be threatened with extinction. One way to protect Indonesian germplasm, especially sago palms, is to conduct an inventory and characterisation both phenotypically and genotypically. Genetic markers are known to have an important role in uncovering and studying plant diversity and population genetics with techniques to detect genetic variability between individuals, populations and species. Knowledge of genetic variability is a prerequisite for studying the evolutionary history of a species and also for breeding programs and conservation of plant genetic resources. Data on genetic diversity is needed to protect sago palms and their genetic components, which are thought to be native to Indonesia, from being exploited by other countries.

Recently, SSR markers have been developed using partial genome data to study the genetic diversity of sago palms (Purwoko et al. 2019) but the development of SSRs using EST data for sago palms has not been fully studied. Sago EST data have been generated and published in a publicly accessible database offering the opportunity to create EST-SSR markers in silico. This approach can be used to design specific primers at specific loci that represent functional genes or coding regions. The development of SSR markers using EST sequences has several advantages compared to genomic sequences, such as EST-SSR represents functional components of the genome and can be used between species, can be used to search for genes, and also map genes. Identification of SSR through these two approaches has been widely carried out on palm trees such as oil palm and dates. So far, the identification of SSR in sago palm with the above approach has not been reported. This is the first report of the SSR analysis of sago palms using the genic approach (EST-SSR).

MATERIAL AND METHODS

Plant Material

Plant material from 10 accessions of Metroxylon sagu Rottb. (leaves) were collected from various regions in West Kalimantan (Fig. 1) along with three other accessions: 1 accession from Java (S1), 1 accession from Sumatra (B1), and 1 accession from Maluku (C4).

EST Sequence Source, SSR Analysis and Functional Characterisation

The EST sequence of sago palm was obtained from the NCBI database (http://ncbi.nlm.nih.gov/) with accession number JK731189-JK731600 which is the EST of young leaves of the sago palm. The EST sequences that have been downloaded from the NCBI website are then uploaded to the EGassembler website (https://www.genome.jp/tools/egassembler/) which aims to clean sequences, remove vector contamination, and assemble contig sequences (Nejad et al. 2006). Sequence processing is carried out using standard parameters suggested by the site. Contig sequences resulting from the assembly and processing were then downloaded in FASTA format for further use for SSR analysis, synthesis and functional gene analysis.

SSR analysis was performed using Phobos 3.3.12 software (Mayer et al. 2010) to detect nucleotides at loci with di-, tri-, tetra-, penta- and hexa-nucleotide motifs. Synteny analysis was carried out using the Phytozome online application using the BLASTn programme. From the EST sequences that were detected to have SSR and were selected (at least 20 bp lengths of SSR), synteny analysis was carried out using Oryza sativa chromosome data. The EST sequence containing the SSR motif was then searched for putative genes by comparing the non-redundant protein Arabidopsis database on The Arabidopsis Information Resource (TAIR) (http://www.arabidopsis.org/index.jsp) using the BLASTx programme with an e-value limit of 10−3. The gene ontology (GO) mapping analysis aims to provide annotations of the highest BLAST Hit results (Gotz et al. 2008). After mapping GO, then proceed with GO annotation which aims to provide functional annotations to query sequences (Gotz et al. 2008). The parameters used for GO annotation include annotation cut off of 55, GO weight of 5, Hit-filter e-value of 1.0e-6, and HSP-Hit coverage cut off of 0. Visualisation of GO analysis results using the http web-based REVIGO application (http://revigo.irb.hr/Results.aspx?jobid=738236493) (Supek et al. 2011).

Total DNA Isolation, Primer Design and Validation

After the motifs and synteny analysis results were obtained, the primers were designed using Primer3 1.1.4 software (Untergasser et al. 2012). The parameters used for the primary design are presented in Table 1.

Total DNA was isolated from sago leaf samples using a modified cetyltrimethylammonium bromide (CTAB) method for DNA isolation from palm leaves (Purwoko et al. 2019; Maskromo et al. 2016; Novero et al. 2012; Pesik et al. 2015; 2017; Tinche et al. 2014). To check the quality and concentration of DNA, electrophoresis was used with 1% agarose gel. The PCR composition was made with a total volume of 25 μL/reaction consisting of Go taq green master mix (12.5 μL), forward primer (2 μL), reverse primer (2 μL), 2 μL DNA template and sterile H2O to a volume of 25 μL. Takara PCR Thermal Cycler Dice® (http://catalog.takara-bio.co.jp/product/basic_info.php?unitid=U100004192) was used for amplification of SSR markers. The PCR program used was as follows: predenaturation at 95°C for 3 min, denaturation at 95°C for 30 s 35 cycles, annealing with Tm − 5°C for 30 s and extension at 72°C for 30 s each for 35 cycles and final extension 72°C for 60 s and hold at 4°C. The PCR products were evaluated using gel electrophoresis in 1% agarose and finally visualised with SYBR safe dye (Invitrogen). The amplified product which is expected to be of band size is further separated on the 8% agarose metaphor gel.

Genetic Analysis

Using a straightforward matching dissimilarity index, we created a dissimilarity matrix for the diploid based on allelic data. Bootstrap analysis with 10,000 iterations was used to calculate the dissimilarity matrices. Using the option to alter 13 axes, the default axis as decided by the principal coordinate analysis (PCoA) was chosen to set the based on dissimilarity. Using the unrooted weighted neighbour-joining strategy, we constructed trees using the computed dissimilarity matrix. Using Dissimilarity Analysis and Representation for WINDOWS (DARWin) software version 6.05 (Perrier & Jacquemoud-Collet 2006; http://darwin.cirad.fr/darwin), the dissimilarity matrix, bootstrapping, PCoA, and tree construction for the sago palm accessions were carried out.

RESULTS

Regarding analysis, the total length of the EST sequence produces 412,716 bp (412 contigs) with a maximum and minimum length of 1,138 and 124 nucleotides, respectively. The results of sequence processing using the EGassembler web-based application showed 412 clean EST sequences without contaminants from vector sequences. EST sequence nucleotides were distributed with a frequency of A: 115,701 (28%), C: 102,089 (25%), G: 83,606 (20%) and T: 111,319 (27%) while the composition of GC: 185,695 (45%) (Fig. 2).

SSR Pattern Frequency and Type

A total of 820 SSRs with perfect motifs have been detected from 349 EST sequences. The frequency of SSR motifs in the EST sequence obtained from the results of this study is 1/0.5 kb of the EST sequence, or there is one SSR motif in every 0.5 kb of the EST sequence. The repeat type characterisation in EST sequences was dominated by tri-nucleotides 36% (294), followed by hexanucleotides 24% (202), tetra-nucleotides 15% (120), penta-nucleotides 13% (108) and di-nucleotides 12% (96) (Fig. 3). The highest frequency of SSR motifs in each type was AG: 49 (51%), AAG: 72 (24.5%), and AAAG: 17 (14.2%) (Fig. 4).

Synteny Analysis

Synteny analysis was carried out using the Phytozome Online application using the BLASTn programme. From the EST sequences that were detected to have SSR and were selected, synteny analysis was carried out using Oryza sativa data. From the analysis, it was found that the EST sequences of sago were spread over 12 chromosomes with the percentage of similarity between 63%–100% and the e-value ranged from 0 to 0.094 (Table 2). Meanwhile, the 15 sequences that were primer designed successfully were spread on 12 rice chromosomes with a similarity percentage between 64%–100% and e-values ranging from 2.00E–19 to 0.094 (Table 2). However, there is one sequence whose synteny is not known but the primer has been successfully synthesised, namely EJK731303.

Primer Design for EST-SSR Markers

Of the 412 EST sequences with the perfect SSR motif, 15 sequences with the SSR motif were selected. A total of 20 SSR motifs from 15 sequences allow for primer design, namely: 1 di-nucleotide, 7 tri-nucleotide, 1 penta-nucleotide and 11 hexa-nucleotides. Only 19 primer pairs of the 20 SSR motifs could be synthesised (Table 2). The primers were designed with the following criteria: optimum primer size 20 bp, melting temperature (Tm): 55°C–60°C, and GC content 45%–60%. The size of the shortest primer design product is 184 bp and the longest is 498 bp with a Tm range of 60°C and a GC value of 45%–55%.

Sequence Annotations Containing SSR

The primers were designed from EST sequences then analysed using BLASTx by selecting the e-value 0.00001 against the NCBI-nr database followed by the TAIR database (Table 3). From 15 sequences analysed, 14 sequences were identified as having a gene ontology and successfully mapped, only 1 sequence that did not have BLASTx Hit (Table 4). The 10 plant species having the highest hit frequency can be seen in Fig. 5. From these results, it can be seen that there were six monocot plants (Elaeis guineensis, Phoenix dactylifera, Oryza sativa japonica, Musa acuminate, Zea mays and O. brachyantha) and four dicot plants (Medicago truncatula, Glycine max, Brachypodium distachyon and Solanum pennellii) which have significant homology.

The BLASTx programme on TAIR was used to search for gene annotations. The results of gene ontology annotations and functional categories based on locus identification can be seen in Fig. 6. Based on the results of the sequence annotations, a total of 290 gene ontologies can be determined and distributed into three categories: molecular functions (71), biological processes (210), and cellular components (53). The molecular function is dominated by nucleotide-binding subcategory about 19.7%, biological process subcategory is dominated by metabolic process subcategory about 62.7%, and cellular components are dominated by membrane subcategory about 62.7%.

Genetic Relationship and Cluster Analysis

In this study, a total of 19 primer pairs were designed and from 15 selected sequences containing SSR motifs, 7 class I primers were synthesised (Table 2), used for validation and polymorphism assessment among 2 accessions of M. sagu (B1 and C4) of which 7 showed amplification and 7 were found to be polymorphic (Fig. 7).

A total of 7 SSR markers were found to be polymorphic in 21 alleles of M. sagu with an average number of 3 alleles per locus. The PIC values were found to range from 0.132 in the primary (EJK 731600-1 and EJK 731391-2) to 0.580 in (EJK 731455), with a mean value of 0.315. The highest (0.680) and the lowest (0.148) expected heterozygosity values were obtained with primers (EJK 731455) and (EJK 731600-1 and EJK 731391-2), respectively, with a mean value of 0.372. The range for the observed heterozygosity (Ho) was 0.154 to 0.769 with a mean value of 0.341 (Table 5).

Unrooted weighted neighbour-joining cluster analysis was constructed to measure genetic diversity and interrelationships between accessions in 13 accessions grouped into three large groups using Darwin software. Cluster I consist of five accessions including SG01, SG02, SG03, SG08 and SG10. Cluster II consists of four accessions S1, SG09, C4 and B1. Cluster III consists of four accessions SG04, SG05, SG06 and SG07 (Fig. 8). The dendrogram grouping classifying various accessions of M. sagu based on response to EST-SSR markers is the first report to the authors’ knowledge. In a previous study, Purwoko et al. (2019) also succeeded in grouping various accessions of M. sagu from various islands in Indonesia. The results of PCoA (Fig. 9) presented a two-dimensional graphical view of the genetic diversity of 13 sago palm accessions originating from four regions in Indonesia. The results observed in the PCoA were in agreement with the cluster analysis.

DISCUSSION

Publicly available EST data have proven to be useful in the identification and development of SSR molecular markers. The EST sequences play a useful role in the establishment of markers, transcriptomic profiling, proteomic research, and gene discovery (Haq et al. 2021). The EST-SSR marker has advantages because it contains candidate genes and can produce molecular markers associated with certain traits (Kalia et al. 2011). According to Haq et al. (2014) and Singh et al. (2019), the EST-SSR marker itself is a functional molecular marker to characterise “a presumed function or a particular gene encoding enzymatic activity” that aids in numerous genomic applications in plants. According to research by Pashley et al. (2006), Ellis and Burke (2007) and Haq et al. (2014), the presence of SSRs in the expressed area or ESTs is more preserved, significant, and transferable across taxonomic boundaries than anonymous SSRs. In numerous analyses of plant genomes, including those that evaluate genetic polymorphism, genetic diversity, population genetics, biodiversity, high-resolution genetic maps, gene mapping, quantitative trait loci, germplasm characterisation, cultivar identification, paternity analysis, marker-assisted breeding taxonomy, and comparative genomic studies, EST-SSR is the preferred molecular marker (Kantety et al. 2002; Eujayl et al. 2004; Varshney et al. 2007; Ukoskit et al. 2018; Haq et al. 2021). EST markers were also known to originate from genomic regions that can be transcribed and conserved across multiple genomes over a wider range than other markers (Pashley et al. 2006).

In this study, 820 SSRs were found from 412 EST sequences of M. sagu or 1/0.5 kb of the EST sequence to find EST-SSR markers. This result is much lower than previous studies on the sago genome, namely 132.57/Mb (Purwoko et al. 2019). We found that the trinucleotide repeat sequence had a dominant frequency (36%) compared to the others. A similar situation was previously reported in C. longa (Purwoko et al. 2021), P. violascens (Cai et al. 2019), and same results were also obtained in date palm ESTs which stated that tri-nucleotides predominated from other motifs (Zhao et al. 2013). Dissimilar things were reported in oil palm plants that di-nucleotides predominated compared to others (Singh et al. 2008). However, the type of dinucleotide motif found to be the most common SSR was AG (51%) followed by AAG (24.5%) then AAAG (14.2%). This is similar to motifs in M. sagu genome, in which the AG and AAG motifs are predominant (Purwoko et al. 2019).

Some SSRs do not produce primers because of their impossible position, at the beginning or end of the sequence. According to Kale et al. (2012), the failure of the design of primer was due to not obtaining a suitable clamping sequence or an impossible melting temperature constraint. Primer validation is carried out to determine the ability of the primer that has been designed to be amplified or not. The primer ability to produce amplification products is influenced by several characters, such as internal stability, melting temperature, secondary structure, or competition between primers (Sint et al. 2012).

For annotation analysis, EST sequences with SSR and having a primer (15 sequences) were performed comparative analysis with the publicly available databases NCBI-nr and TAIR and resulted annotations for 14 (93.33%) sequences. The interesting thing is the highest hits were obtained on Elaeis guineensis and Phoenix dactylifera which are palms, making it possible that the primers synthesised from sago EST could also be used in these two plants for tranferable genotyping study across palms genera. Transferability of SSR markers indicates whether the markers are applicable to comparative mapping studies in plants (Endo et al. 2017). Comparative analysis with TAIR yielded 7,062 functional characteristic hits.

Our findings support the usefulness of EST-SSR markers for sago cultivar differentiation and genetic diversity and grouping analysis. Additionally, we have demonstrated the value of the created EST-SSR marker in examining the genetic diversity of the sago plant. Given that gene function is frequently established (Parida et al. 2009), the use of DNA coding regions for the construction of SSR is a further benefit in genetic associations (Feingold et al. 2005) and linkage analysis. Recently constructed EST-SSR markers have been successfully used to study association mapping for traits of interest in various commodities such as Syringa oblata (Yang et al. 2020) and Hibiscus cannabinus (An et al. 2023).

CONCLUSION

The results of the current study demonstrate the successful identification and development of SSR markers in sago palms based on in silico EST data. A computational-based approach was used to develop and identify SSR markers from a publicly available EST database, which were further validated through a wet lab. The development of markers from DNA coding regions has a great advantage because previously known gene functions can assist in exploiting markers for specific traits. The resulting EST-SSR marker was successfully used to evaluate the genetic diversity of sago palms. In the future, the EST-SSR marker will be useful for the conservation and breeding activities of the underutilised carbohydrate-producing plants.

ACKNOWLEDGEMENTS

The author would like to thank the funding for the research activity “Development of Genome Editing Technology to Produce Non-Palm and Palm Oils for Distillate FAME Raw Materials” with funding number 6251.ABI.006.054 through the List of Budget Implementation Forms (DIPA) scheme. Funders had no role in study design, data collection, and analysis, the decision to publish, or the preparation of the manuscript.

Figure 1 Coordinate map the origin West Borneo of sago palm samples used to analyse the genetic diversity using EST-SSR markers. (Source: Google Earth Engine).

Figure 2 Nucleotide distribution in EST sequences of sago palms.

Figure 3 Distribution of SSR types in EST sequences of sago.

Figure 4 The best four SSR motif frequencies for di-, tri- and tetra-nucleotides.

Figure 5 Frequency of the 10 plants with the most hits.

Figure 6 Gene ontology (GO) classification annotated for the sequence containing SSR in the cellular component, molecular function and biological processes.

Figure 7 Validation of seven primers on two accessions of sago with 1% agarose gel (1–7: primer).

Figure 8 Unrooted weighted neighbour-joining cluster analysis of genetic dissimilarity as measured using amplified simple sequence repeat (SSR) markers. Blue: West Borneo accessions; Green: Java accession; Red: Sumatera and Maluku accessions.

Figure 9 Factorial analysis based on Eigen values calculated from seven SSR markers.

Table 1 Parameters for designing primer.

No.	Criteria	Minimum	Maximum	Optimum	
1	Amplicon size (bp)	100	500	–	
2	Primer size (bp)	18	20	20	
3	Melting temperature (°C)	55	60	55	
4	G/C content (%)	45	60	–	

Table 2 Description of the primers that were successfully synthesised.

No	Primer ID	Primer sequence (5′-3′)	SSR motif	Product size (bp)	Oryza sativa chromosome	e-value	
1	EJK731455	F: GCCGACTTTCTCAGCTTGTT
R: TAAGTTGCAGGGGCTTTCTC	AGGCCG	405	Chr5	2.00E–19	
2	EJK731303	F: TCCAGCCTTTTCCCAACTAA
R: AAGTCATGCCCATCATGTCA	AAAAAT	468	unknown	unknown	
3	EJK731212	F: TGGTGGTTGACGTTGATGAT
R: TAATGCAAGGGTGAGGCTTT	AACCCT	222	Chr1,2,3,5,6,10,11,12	2.00E–06	
4	EJK731600	F: TCGCAGATAGCATCGAACAC
R: ATCGATCGCGAGTACGTCTT	AAGGAG	374	Chr2,4,5,8,11,12	2.00E–06	
5	EJK731455	F: TTCAGCTCATCCCCTTGAAT
R: ATCGCTTGGTCTCGATCATT	AGC	231	Chr5	2.00E–19	
6	EJK731391-1	F: ACCTCCTCCCTCACAAACCT
R: AGAGGCTGTGGAGATCCTGA	AAGGAG	498	Chr2,4,5,8,11,12	2.00E–06	
7	EJK731204	F: GTGCTGCTCACTGTCTCAGG
R: CATGGAACAGTCCACACTGG	AATTCC	413	Chr3,4,8,9	0.047	
8	EJK731454	F: ATCAGGAACACGGGACTTTG
R: ACCAAGGGTATGAGCCCTCT	ATC	257	Chr1,4,10,11,12	0.052	
9	EJK731329	F: GGCTTCTTGGCCTCTTCTTT
R: GCAACATCTTCGACCCTTTC	ACCTCC	421	Chr1,2,3,4,7,8,9,11	0.035	
10	EJK731206	F: GAACAACTGGCACCAAGGAT
R: ATGTCTTCAAAGCCGACCTC	ACCTCC	357	Chr1,2,3,4,6,7,8,9	0.094	
11	EJK731238	F: GACCCATGGCTTAGAACCAG
R: GAGATCCTCCCGAAGAAGGT	ACACC	436	Chr2,4	0.04	
12	EJK731600-1	F: GGAACATTGCAGGGTCCTTA
R: GCTTTCGAAGAGGAGCTGAA	AGC	461	Chr2,4,5,8,11,12	2.00E–06	
13	EJK731418	F: CCACCAGAATCTCAGTGGAA
R: CCAAGACCCAACAACCACTT	AAGATG	329	Chr2,3,4	2.00E–07	
14	EJK731600-2	F: GGAACATTGCAGGGTCCTTA
R: TTCAACAAGGTGTTCGATGC	AAG	269	Chr2,4,5,8,11,12	2.00E–06	
15	EJK731391-2	F: GGAACATTGCAGGGTCCTTA
R: AGGTTTGTGAGGGAGGAGGT	AGC	338	Chr2,4,5,8,11,12	2.00E–06	
16	EJK731391-3	F: GGAACATTGCAGGGTCCTTA
R: TCGAAGAGGAGCTGAAGAGC	AAG	457	Chr2,4,5,8,11,12	2.00E–06	
17	EJK731557	F: GCAGCAGCCAAAATAACTCC
R: TGGAGCTGGATGAGTGTGAG	AAGATG	184	Chr1,2,3,4,8	0.052	
18	EJK731197	F: AGGCATGATGGTCCTGAACT
R: AGGATGGAGGATTGAGACGA	AG	442	Chr7,8,10,11,12	0.043	
19	EJK731203	F: TCAGCCGCTGCATATGTTAC
R:GCAGAGCTTCTTGGATGGTC	ATC	237	Chr2,4,5,6,8,10,12	0.051	

Table 3 Distribution of contig sequences from Blast2Go analysis.

Sequence analysis criteria	Number of sequences	
Analysed with Blast2Go	15	
Ontology genes	14	
BLASTx Hit	14	
Non-BLASTx Hit	1	
Mapped	14	
The most species hits Elaeis guineensis	63	

Table 4 Annotatability statistics for sequences containing SSR.

Sequence ID	Description	Length	BLAST Hit	e-value	sim mean	GO	
JK731455	Zinc finger (CCCH-type) family	1,044	4	2.11E–22	52.89	1	
JK731391	Phenylalanine ammonia-lyase 2	1,062	4	9.46E–149	87.30	14	
JK731600	Phenylalanine ammonia-lyase 2	972	4	6.83E–121	85.28	14	
JK731204	ACT domain repeat 3	967	10	4.90E–97	70.23	8	
JK731203	Phosphatase 2C family	1,052	20	1.47E–109	59.08	14	
JK731206	HSP20-like chaperones superfamily	569	16	5.99E–44	70.10	13	
JK731329	HSP20-like chaperones superfamily	724	15	5.45E–56	68.29	12	
JK731212	BEL1-like homeodomain 4	916	12	2.46E–26	80.05	31	
JK731197	RNA-binding	889	6	1.95E–11	81.79	7	
JK731454	Global transcription factor C	1,066	2	1.71E–49	82.40	9	
JK731557	DNAJ heat shock family	1,077	20	2.02E–135	57.45	19	
JK731418	DNAJ heat shock family	1,063	20	1.69E–121	58.25	20	
JK731303	LAG1 and CLN8 (TLC) lipid-sensing domain containing	1,049	1	1.06E–10	83.72	1	
JK731238	NA	822					

Table 5 Summary of observed allele number (N), polymorphism information content (PIC), observed and expected heterozygosity (Ho and He) for 13 sago palm accession.

No	SSR loci ID	Estimated allele size (bp)	N	Ho	He	PIC	
1	EJK 731455	150–200	3	0.385	0.68	0.58	
2	EJK 731454	200–250	3	0.769	0.591	0.472	
3	EJK 731600-1	400–500	2	0.154	0.148	0.132	
4	EJK 731600-2	200–290	2	0.231	0.212	0.183	
5	EJK 731391-2	290–350	2	0.154	0.148	0.132	
6	EJK 731391-3	400–500	3	0.231	0.342	0.303	
7	EJK 731203	240–300	3	0.462	0.48	0.404	
	Average		3	0.341	0.372	0.315	

AUTHORS’ CONTRIBUTIONS: Devit Purwoko: Designed the study, conceptualisation, methodology, writing – original draft, manuscript preparation.

Siti Zulaeha: Dry lab work, manuscript preparation.

Teuku Tajuddin: Manuscript preparation.

Farida Rosana Mira: Manuscript preparation.

Maharani Dewi Solikhah: Manuscript preparation.

Gemilang Rahmadara:, Lab work, manuscript preparation.

Nurul Fitri Hanifah: Lab work, manuscript preparation.

Rusmanto: sample collection, manuscript preparation.
==== Refs
REFERENCES

Aberlenc-Bertossi F Castillo K Tranchant-Dubreuil C Chérif E Ballardini M Abdoulkader S Gros-Balthazard M Chabrillange N Santoni S Mercuri A Pintaud J-C 2014 In silico mining of microsatellites in coding sequences of the date palm (Arecaceae) genome, characterization, and transferability Applications in Plant Sciences 2 1 1300058 10.3732/apps.1300058
Amiteye S 2021 Basic concepts and methodologies of DNA marker systems in plant molecular breeding Heliyon 7 10 e08093 10.1016/j.heliyon.2021.e08093 34765757
An X Liu Q Ying J Wei J Dong G Luo X Li W Liu T Zhou H Zou L Chen C 2023 Development of expressed sequence tag–simple sequence repeat markers related to the salt-stress response of Kenaf (Hibiscus cannabinus) Agronomy 13 7 1946 10.3390/agronomy13071946
Aslanbay Guler B Imamoglu E 2023 Molecular marker technologies in food plant genetic diversity studies: An overview Foods and Raw Materials 11 2 282 292 10.21603/2308-4057-2023-2-575
Cai K Zhu L Zhang K Li L Zhao Z Zeng W Lin X 2019 Development and characterization of EST-SSR markers from RNA-seq data in Phyllostachys violascens Frontiers in Plant Science 10 50 10.3389/fpls.2019.00050 30774640
D’Imperio M Viscosi V Scarano MT D’Andrea M 2011 Integration between molecular and morphological markers for the exploitation of olive germplasm (Olea europaea) Science Horticulture 130 229 240 10.1016/j.scienta.2011.06.050
Duran C Singhania R Raman H Batley J Edwards D 2013 Predicting polymorphic EST-SSRs in silico Molecular Ecology Resources 13 3 538 545 10.1111/1755-0998.12078 23398650
Ellis JR Burke JM 2007 EST-SSRs as a resource for population genetic analyses Heredity 99 2 125 132 10.1038/sj.hdy.6801001 17519965
Endo C Yamamoto N Kobayashi M Nakamura Y Yokoyama K 2017 Development of simple sequence repeat markers in the halophytic turf grass Sporobolus virginicus and transferable genotyping across multiple grass genera/species/genotypes Euphytica 213 2 1 12 10.1007/s10681-017-1846-z
Eujayl I Sledge MK Wang L May GD Chekhovskiy K Zwonitzer JC Mian MA 2004 Medicago truncatula EST-SSRs reveal cross-species genetic markers for Medicago spp Theoretical and Applied Genetics 108 414 422 13679975
Feingold S Lloyd J Norero N Bonierbale M Lorenzen J 2005 Mapping and characterization of new EST-derived microsatellites for potato (Solanum tuberosum L.) Theoretical and Applied Genetics (Theoretische und angewandte Genetik) 111 3 456 466 10.1007/s00122-005-2028-2 15942755
Flach M 1995 Research priorities for sago palm development in Indonesia and Sarawak: An agenda for research ISHS Acta Horticulturae 389 19 40 10.17660/ActaHortic.1995.389.1
Gotz S Garcia-Gomez JM Terol J Williams TD Nagaraj SH Nueda MJ Robles M Talon M Dopazo J Conesa A 2008 High-throughput functional annotation and data mining with the Blast2GO suite Nucleic Acids Research 36 10 3420 3435 10.1093/nar/gkn176 18445632
Hailu G Asfere Y 2020 The role of molecular markers in crop improvement and plant breeding programs: A review Agricultural Journal 15 6 171 175
Haq SU Dhingra P Sharma M Kothari SL Kachhwaha S 2021 Plasticity of tandem repeats in expressed sequence tags of angiospermic and nonangiospermic species: Insight into cladistic, phenetic and elementary explorations Journal of Applied Biology and Biotechnology 9 2 36 59 10.7324/JABB.2021.9204
Haq SU Jain R Sharma M Kachhwaha S Kothari SL 2014 Identification and characterization of microsatellites in expressed sequence tags and their cross transferability in different plants International Journal of Genomics 2014 863948 10.1155/2014/863948 25389527
Jain N Patil GB Bhargava P Nadgauda RS 2014 In silico mining of EST-SSRs in Jatropha curcas L. towards assessing genetic polymorphism and marker development for selection of high oil yielding clones American Journal of Plant Sciences 5 1521 1541 10.4236/ajps.2014.511167
Jong FS 1995 Research for the development of sago palm (Metroxylon sagu Rottb.) cultivation in Sarawak, Malaysia Kuching, Sarawak Department of Agriculture 139
Kale SM Pardeshi VC Kadoo NY Ghorpade PB Jana MM Gupta VS 2012 Development of genomic simple sequence repeat markers for linseed using next generation sequencing technology Moleculer Breeding 30 597 606 10.1007/s11032-011-9648-9
Kalia RK Rai MK Kalia S Singh R Dhawan AK 2011 Microsatellite markers: An overview of the recent progress in plants Euphytica 177 309 334 10.1007/s10681-010-0286-9
Kantety RV La Rota M Matthews DE Sorrells ME 2002 Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat Plant Molecular Biology 48 501 510 10.1023/A:1014875206165 11999831
Kumar P Gupta VK Misra AK Modi DR Pandey BK 2009 Potential of molecular markers in plant biotechnology Plant Omics Journal 2 141 162
Maskromo I Larekeng SH Novarianto H Sudarsono S 2016 Xenia negatively affecting kopyor nut yield in Kalianda Tall Kopyor and Pati Dwarf Kopyor coconuts Emirates Journal of Food and Agriculture 28 644 652
Mayer C Leese F Tollrian R 2010 Genome-wide analysis of tandem repeats in Daphnia pulex: A comparative approach BMC Genomics 11 1 277 20433735
Molla MR Islam MN Rohman MM Rahman L 2010 Microsatellite allele size profiling to determine varietal identity and genetic diversity among groundnut varieties in Bangladesh Natural Sciences 8 123 127
Mondini L Noorani A Pagnotta MA 2009 Assessing plant genetic diversity by molecular tools Diversity 1 1 19 35 10.3390/d1010019
Nejad AM Tonomura K Kawashima S Moriya Y Suzuki M Itoh M Kanehisa M Endo T Goto S 2006 EGassembler: Online bioinformatics service for large-scale processing, clustering and assembling ESTs and genomic DNA fragments Nucleic Acids Research 34 459–462 459 462 10.1093/nar/gkl066
Novero AU Ma BM Hannah JE 2012 Epigenetic inheritance of spine formation in sago palm (Metroxylon sagu Roettb.) Plant Omics Journal 5 559 566
Parida SK Kalia SK Kaul S Dalal V Hemaprabha G Selvi A Pandit A Singh A Gaikwad K Sharma TR Srivastava PS Singh NK Mohapatra T 2009 Informative genomic microsatellite markers for efficient genotyping applications in sugarcane TAG Theoretical and Applied Genetics (Theoretische und angewandte Genetik) 118 2 327 338 10.1007/s00122-008-0902-4 18946655
Pashley CH Ellis JR McCauley DE Burke JM 2006 EST databases as a source for molecular markers: Lessons from Helianthus Journal of Heredity 97 381 388 10.1093/jhered/esl013 16840524
Perrier X Jacquemoud-Collet JP 2006 DARWin software http://darwin.cirad.fr/darwin
Pesik A Efendi D Novarianto H Dinarti M Maskromo I Tenda ET Sudarsono S 2015 Keragaman dan hubungan genetik antara kelapa tetua genjah kuning nias Buletin Palma 16 129 140
Pesik A Efendi D Novarianto H Dinarti D Sudarsono S 2017 Development of SNAP markers based on nucleotide variability of WRKY genes in coconut and their validation using multiplex PCR Biodiversitas Journal of Biological Diversity 18 465 475
Priyanka P Kumar D Yadav A Yadav K Dwivedi U 2017 Analysis of simple sequence repeats information from floral expressed sequence tags resources of papaya (Carica papaya L.) American Journal of Plant Sciences 8 2315 2331 10.4236/ajps.2017.89155
Purwoko D Cartealy IC Tajuddin T Dinarti D Sudarsono S 2019 SSR identification and marker development for sago palm based on NGS genome data Breeding Science 69 1 1 10 10.1270/jsbbs.18061 31086478
Purwoko D Zulaeha S Tajuddin T Khairiyah H Fauzi RZ Priyanti 2021 SSR markers characterization for Temu Ireng (Curcuma aeruginosa Roxb.) generated from EST of Curcuma longa Jurnal Bioteknologi dan Biosains Indonesia 8 2 160 173 10.29122/jbbi.v8i2.4763
Salgotra RK Chauhan BS 2023 Genetic diversity, conservation, and utilization of plant genetic resources Genes 14 1 174 10.3390/genes14010174 36672915
Singh R Zaki NM Ting NC Rosli R Tan SG Low ETL Ithnin M Cheah SC 2008 Exploiting an oil palm EST database for the development of gene-derived SSR markers and their exploitation for assessment of genetic diversity Biologia 63 227 235 10.2478/s11756-008-0041-z
Singh RB Singh B Singh RK 2019 Development of potential dbEST-derived microsatellite markers for genetic evaluation of sugarcane and related cereal grasses Industrial Crops and Products 128 38 47 10.1016/j.indcrop.2018.10.071
Sint D Raso L Traugott M 2012 Advances in multiplex PCR: Balancing primer efficiencies and improving detection success Methods in Ecology and Evolution 3 898 905 10.1111/j.2041-210X.2012.00215.x 23549328
Supek F Bošnjak M Škunca N Šmuc T 2011 REVIGO summarizes and visualizes long lists of gene ontology terms PLoS ONE 6 7 e21800 10.1371/journal.pone.0021800 21789182
Tinche Asmono D Dinarty D Sudarsono S 2014 Genetic diversity oil palm (Elaeis guineensis Jacq.) Nigeria population based on SSR (Simple Sequence Repeats) marker analysis Buletin Palma 15 14 23
Ukoskit K Posudsavang G Pongsiripat N Chatwachirawong P Klomsaard P Poomipant P Tragoonrung S 2018 Detection and validation of EST-SSR markers associated with sugar-related traits in sugarcane using linkage and association mapping Genomics 111 1 9 29608956
Untergasser A Cutcutache I Koressaar T Ye J Faircloth BC Remm M Rozen SG 2012 Primer3: New capabilities and interfaces Nucleic Acids Research 40 15 e115 10.1093/nar/gks596 22730293
Varshney RK Marcel TC Ramsay L Russell J Röder MS Stein N Waugh R Langridge P Niks RE Graner A 2007 A high density barley microsatellite consensus map with 775 SSR loci Theoretical and Applied Genetics 114 6 1091 1103 10.1007/s00122-007-0503-7 17345060
Vieira LD da Silva JO Pereira CCO de Carvalho SA Silveira RDD Malafaia G de Menezes IPP 2016 In silico identification of putative expressed sequence tag (EST)-simple sequence repeats (SSRs) markers of resistance to Meloidogyne spp. in common bean African Journal of Agricultural Research 11 23 2007 2012 10.5897/AJAR2016.11113
Yang Y He R Zheng J Hu Z Wu J Leng P 2020 Development of EST-SSR markers and association mapping with floral traits in Syringa oblata BMC Plant Biology 20 436 10.1186/s12870-020-02652-5 32957917
Zhao Y Williams R Prakash CS He G 2013 Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.) BMC Plant Biology 12 237 http://www.biomedcentral.com/1471-2229/12/237
