
==== Front
PLoS Biol
PLoS Biol
plos
PLOS Biology
1544-9173
1545-7885
Public Library of Science San Francisco, CA USA

37459343
10.1371/journal.pbio.3001815
PBIOLOGY-D-22-01870
Methods and Resources
Biology and life sciences
Organisms
Viruses
RNA viruses
Astroviruses
Biology and Life Sciences
Microbiology
Medical Microbiology
Microbial Pathogens
Viral Pathogens
Astroviruses
Medicine and Health Sciences
Pathology and Laboratory Medicine
Pathogens
Microbial Pathogens
Viral Pathogens
Astroviruses
Biology and Life Sciences
Organisms
Viruses
Viral Pathogens
Astroviruses
Medicine and Health Sciences
Medical Conditions
Infectious Diseases
Viral Diseases
Astrovirus Infection
Biology and Life Sciences
Microbiology
Virology
Viral Replication
Biology and Life Sciences
Developmental Biology
Cell Differentiation
Neuronal Differentiation
Biology and Life Sciences
Genetics
Genomics
Microbial Genomics
Viral Genomics
Biology and Life Sciences
Microbiology
Microbial Genomics
Viral Genomics
Biology and Life Sciences
Microbiology
Virology
Viral Genomics
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Neurons
Biology and Life Sciences
Neuroscience
Cellular Neuroscience
Neurons
Biology and Life Sciences
Genetics
Genomics
Biology and Life Sciences
Microbiology
Virology
Viral Replication
Viral Packaging
Attenuation hotspots in neurotropic human astroviruses
Genome attenuation in neurotropic astroviruses
Ali Hashim Formal analysis Investigation Methodology Resources Visualization Writing – original draft Writing – review & editing 1
Lulla Aleksei Formal analysis Investigation Methodology Resources Writing – review & editing 2
Nicholson Alex S. Investigation Methodology Resources Writing – review & editing 3
Hankinson Jacqueline Formal analysis Investigation Visualization Writing – review & editing 1
Wignall-Fleming Elizabeth B. Investigation Writing – review & editing 1
O’Connor Rhian L. Investigation Methodology 1
Vu Diem-Lan Investigation Methodology 4
Graham Stephen C. Investigation Methodology Resources Writing – review & editing 1
Deane Janet E. Funding acquisition Investigation Methodology Resources Supervision Writing – review & editing 3
Guix Susana Investigation Methodology Resources Supervision Writing – review & editing 4
https://orcid.org/0000-0002-6605-0727
Lulla Valeria Conceptualization Data curation Formal analysis Funding acquisition Investigation Methodology Project administration Resources Supervision Validation Visualization Writing – original draft Writing – review & editing 1 *
1 Department of Pathology, University of Cambridge, Addenbrookes Hospital, Cambridge, United Kingdom
2 Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom
3 Cambridge Institute for Medical Research, University of Cambridge, Cambridge, United Kingdom
4 Enteric Virus Group, Department of Genetics, Microbiology and Statistics, Research Institute of Nutrition and Food Safety (INSA-UB), University of Barcelona, Barcelona, Spain
Cadwell Ken Academic Editor
New York University School of Medicine, UNITED STATES
The authors have declared that no competing interests exist.

* E-mail: vl284@cam.ac.uk
17 7 2023
7 2023
17 7 2023
21 7 e300181526 8 2022
13 6 2023
© 2023 Ali et al
2023
Ali et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

During the last decade, the detection of neurotropic astroviruses has increased dramatically. The MLB genogroup of astroviruses represents a genetically distinct group of zoonotic astroviruses associated with gastroenteritis and severe neurological complications in young children, the immunocompromised, and the elderly. Using different virus evolution approaches, we identified dispensable regions in the 3′ end of the capsid-coding region responsible for attenuation of MLB astroviruses in susceptible cell lines. To create recombinant viruses with identified deletions, MLB reverse genetics (RG) and replicon systems were developed. Recombinant truncated MLB viruses resulted in imbalanced RNA synthesis and strong attenuation in iPSC-derived neuronal cultures confirming the location of neurotropism determinants. This approach can be used for the development of vaccine candidates using attenuated astroviruses that infect humans, livestock animals, and poultry.

The MLB genogroup of astroviruses are associated with gastroenteritis and severe neurological complications in vulnerable individuals. The development of reverse genetics system for MLB astroviruses reveals genetic elements that are dispensable for viral replication in cell culture but lead to attenuation in human neurons.

http://dx.doi.org/10.13039/100010269 Wellcome Trust 220620/Z/20/Z https://orcid.org/0000-0002-6605-0727
Lulla Valeria http://dx.doi.org/10.13039/501100004815 Isaac Newton Trust Isaac Newton Trust / Wellcome Trust ISSF / University of Cambridge Joint Research Grants Scheme https://orcid.org/0000-0002-6605-0727
Lulla Valeria http://dx.doi.org/10.13039/501100000265 Medical Research Council MR/T000376/1 https://orcid.org/0000-0002-6605-0727
Lulla Valeria http://dx.doi.org/10.13039/100010269 Wellcome Trust 219447/Z/19/Z Deane Janet E. http://dx.doi.org/10.13039/501100000265 Medical Research Council MRC-DTP studentship O’Connor Rhian L. This work was funded by a Sir Henry Dale Fellowship (220620/Z/20/Z) from the Wellcome Trust and the Royal Society, an Isaac Newton Trust/Wellcome Trust ISSF/University of Cambridge Joint Research Grant and MRC project grant (MR/T000376/1) to V.L. J.E.D and A.S.N. are supported by a Wellcome Trust Senior Research Fellowship (219447/Z/19/Z) awarded to J.E.D. R.L.O. is supported by the MRC DTP Studentship https://www.ukri.org/councils/mrc/ https://wellcome.org/ https://www.research-strategy.admin.cam.ac.uk/research-funding/internal-funding-opportunities/institutional-sponsorship-grants/wellcome-trust The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. PLOS Publication Stagevor-update-to-uncorrected-proof
Publication Update2023-07-27
Data AvailabilityAll relevant data are within the paper and its Supporting Information files. Quantitative data can be found in the spreadsheet S1 Data. A separate tab is associated with each Figure and Supporting Information. Uncropped images are found in S1 Raw Images. GenBank accession numbers: ON398705, ON398706.
Data Availability

All relevant data are within the paper and its Supporting Information files. Quantitative data can be found in the spreadsheet S1 Data. A separate tab is associated with each Figure and Supporting Information. Uncropped images are found in S1 Raw Images. GenBank accession numbers: ON398705, ON398706.
==== Body
pmcIntroduction

Human astroviruses (HAstVs) belong to the genus Mamastrovirus, family Astroviridae and are a common cause of gastroenteritis in children, the elderly, and immunocompromised adults [1]. Lately, the HAstV group of the Astroviridae family has expanded to include new groups of viruses unrelated to the 8 previously described classic HAstV serotypes (Fig 1A). These new human astrovirus groups are more closely related to certain animal astroviruses than to the classical HAstVs, suggesting zoonotic transmission [1]. One of these groups is named MLB, after the first novel human astrovirus described in 2008 in Melbourne (Australia) identified in feces of pediatric patients with gastroenteritis. Later, the MLB group of HAstVs was assigned to a neurovirulent group of astroviruses due to the association with severe cases of meningitis/encephalitis, febrile illness, and respiratory syndromes [2–4]. Interestingly, it was recently shown that astroviruses found in the fecal samples of macaque monkeys were genetically similar to human astrovirus MLB and caused chronic diarrhea [5].

10.1371/journal.pbio.3001815.g001 Fig 1 Classification and attenuation of MLB astroviruses.

(A) Simplified phylogenetic tree for the Astrovirus genus. The tree is based on full nucleotide sequences available for indicated species. The pictogram of the intestine or neuron indicates the tropism associated with astrovirus strains. Some astrovirus genotypes labeled with the neuron icon are associated with neuropathology. Neurotropic MLB strains are shown in red. (B) The evolution experiment was performed for MLB1 and MLB2 astroviruses. (C) The coevolution experiment was performed for MLB1 and MLB2 astroviruses. (D) Nucleotide and amino acid sequences of MLB1 and MLB2 viruses containing deletions identified in evolved MLB virus stocks.

HAstVs are small, non-enveloped, icosahedral viruses with positive-sense single-stranded RNA genome containing 5′ untranslated region (UTR), 4 open reading frames (ORF1a, ORF1b, ORFX, and ORF2), and a 3′ UTR with poly A tail [6,7]. ORF1a encodes nonstructural polyprotein nsP1a, ORF1b is expressed via ribosomal frameshifting mechanism and encodes the RNA-dependent RNA polymerase (RdRp). The subgenomic (SG) RNA encodes 2 ORFs–ORF2 and ORFX, the latter encoding a viroporin [7]. The product of the ORF2 coding sequence is translated into the structural capsid polyprotein (CP) of about 72 to 90 kDa, depending on the virus strain [8], which then undergoes C-terminal cleavage by cellular caspases [9]. Despite the required function of caspases, the astrovirus release is described as an unclassified nonlytic process [10]. In some astroviruses, the structural polyprotein is cleaved by trypsin resulting in the formation of truncated (25 to 34 kDa) proteins. Maturation of the astrovirus capsid proteins is a very dynamic process, transforming the virus from a noninfectious intracellular form (VP90) to a primed extracellular form (VP70) and finally generating an icosahedral infectious mature virion (VP34/27/25). However, some concerns remain to be addressed to fully understand the astroviruses capsid assembly and maturation. In particular, what differences in the capsid protein of the MLB genotypes make them different from the classical astroviruses and what determines their infectivity? It has been shown that trypsin treatment of classical astroviruses increases their infectivity [11,12], while not affecting the MLB genotypes [2], further confirmed by recently revealed differences in HAstV and MLB capsid structure [13]. The mechanism of CP cleavage and the functional role of cleaved CP in the MLB group of astroviruses are not yet understood. It is also unclear if MLB astroviruses exploit cellular proteases other than trypsin to process the CP and how this impacts the infectivity of virus particles.

Growing evidence suggests that astroviruses are found globally, infecting a wide range of species, and have the potential for recombination, rapid evolution, and can adapt to different hosts [5,14–19]. Unfortunately, many astrovirus groups have remained overlooked for decades because of the absence of molecular tools, such as infectious clones and replicons. Therefore, developing a robust reverse genetics (RG) system for the nonclassical human astroviruses is essential to understand the basic biology, evolution, and host–virus interplay.

In 1997, Matsui’s group established the first RG system for the human astrovirus serotype 1 to rescue infectious viral particles [20]. This system has been successfully used and has shed light on multiple aspects of astrovirus replication and pathogenesis. HAstV1 RG system requires 2 cell lines to recover infectious particles: the transfection of BHK-21 cells with in vitro transcribed viral RNA and then propagation of the obtained supernatant in the permissive Caco2 cells in the presence of trypsin. Several DNA-based RG systems were developed, including efficient chimeric HAstV1/8 RG system [21,22]; however, all of them relied on 2 cell lines and were limited to classical human astroviruses. So far, RG systems for 2 nonhuman astroviruses were developed: first for the avian astrovirus by using duck astrovirus (DAstV) genome of D51 strain [23] and second for porcine astrovirus (PAstV1-GX1) [24]. Although both nonhuman RG systems allow the recovery of infectious viral particles, these systems also rely on the 2 cell lines.

It is therefore essential to develop the RG system for neurotropic astroviruses to understand the molecular determinants for neurotropism and neurovirulence. Here, we report the RG system for 2 nonclassical human neurotropic astroviruses that relies on a single cell line and can be used to rescue and propagate MLB1 and MLB2 human astroviruses. We also developed a set of detection tools as well as replicon systems for both MLB astroviruses. Using this system, we identified and characterized attenuation hotspots located at the 3′ end of the MLB genomes that impact neurovirulence of these viruses. In the future, this RG system will deepen the understanding of molecular virology of MLB-group astroviruses and allow the design of tools to address open questions on viral evolution, replication, packaging, and pathogenesis.

Results

Evolution and cell culture adaptation of neurotropic MLB astroviruses

The attenuation of viruses by serial cultivation in vitro or in abnormal hosts dates back to the 19th century [25]. Passaging pathogenic viruses in chicken embryos, mice and/or cell cultures led to the development of several vaccine candidates including polio, measles, yellow fever, rubella, and many other pathogens [26,27]. Therefore, we hypothesized that this strategy could be used to attenuate MLB astroviruses. Clinical MLB isolates were obtained from stool (MLB1) and cerebrospinal fluid (MLB2) of infected patients and passaged in susceptible cell lines, as previously described [2] (Fig 1B). Sequencing of a passaged clinical MLB1 isolate revealed a deletion of 30 nucleotides in the 3′ end of the genome spanning into the coding sequence of CP. A similar region was affected in the passaged MLB2 clinical isolate—a single out-of-frame deletion of 5 nucleotides in the 3′ part of the genome (Fig 1D).

Another strategy for directed virus evolution is based on coinfection of closely related virus species [28]. The better replicating “partner” can either out-compete or complement the replication of another virus. Complementation would result in faster evolution of less “fit” viruses. To test this hypothesis, we coinfected Huh7.5.1 cells at a multiplicity of infection (MOI) 0.1 with MLB1 and MLB2 viruses (Fig 1C). This strategy can facilitate complementation after the first cycle of virus replication while avoiding the accumulation of defective interfering genomes common for the high MOI [29]. This resulted in simultaneous replication and propagation of both strains on passaging without detected out-competition or recombination for 10 consecutive passages. Interestingly, no changes were observed in MLB2 genomes; however, a mixture of several in-frame and out-of-frame deletions was detected in the 3′ part of the MLB1 genome further confirming the instability of the 3′ region in this virus (Fig 1D).

Elucidating the functional significance of the identified deletions requires MLB astrovirus detection tools and would be dramatically accelerated by the establishment of a robust RG system. We, therefore, aimed to create these essential tools.

Cell culture models and detection tools for neurotropic MLB1 and MLB2 astroviruses

First, we developed a set of essential tools for specific immune detection of virus infection. The folded region of MLB1 capsid protein corresponding to amino acids 61–396 of ORF2-encoded polyprotein possessing a C-terminal 8×His-tag (Fig 2A) was used for bacterial expression and affinity purification, resulting in homogeneous CPNTD protein (Fig 2B). The purified recombinant protein was used for the production of highly sensitive antibodies allowing the detection of ≤1 ng of the purified CPNTD of MLB1 (Fig 2C). Due to 95% identity between corresponding domains of MLB1 and MLB2 CPs, polyclonal antibodies were expected to cross-detect capsid proteins derived from both strains. Indeed, it specifically recognized capsid proteins from MLB1- and MLB2-infected cells (Fig 2C).

10.1371/journal.pbio.3001815.g002 Fig 2 Purification of CPNTD and immunodetection of MLB1- and MLB2-infected Huh7.5.1 cells and iPSC-derived neurons.

(A) Schematic representation of MLB1 genome and location of CPNTD. Lower panel represents the sequence of recombinant CPNTD. ORF, open reading frame; CP, capsid polyprotein; NTD, N-terminal domain. (B) Coomassie-stained SDS-PAGE profile of the purified CPNTD from E. Coli. (C) Huh7.5.1 cells were infected with MLB1 and MLB2 viruses at MOI 0.1 and incubated for 48 h. CP was detected using the antibody generated against CPNTD. Purified CPNTD was used for detection limit assessment (1–9 ng). (D) Experimental setup to determine the CPE and titration for MLB1 and MLB2 infection. (E) Huh7.5.1 cells were infected at an MOI 1 and incubated for indicated periods, then stained and imaged. Hoechst-stained nuclei were counted from 12 images (approximately 200 cells per image) and normalized to mock-infected samples. Data are mean ± SD. ***p < 0.001, ****p < 0.0001 using two-way ANOVA test against mock. (F) Huh7.5.1 cells were seeded on 96-well plate and infected with 10-fold serial dilutions of MLB1 and MLB2 astroviruses, fixed at 20 hpi, permeabilized, stained with anti-CP antibody, and imaged by LI-COR. (G) Huh7.5.1 cells were infected with MLB1 and MLB2 viruses and incubated for 24 h. Representative confocal images of fixed and permeabilized cells visualized for CP (green) and stained for nuclei (Hoechst, blue) are shown. Scale bars are 10 μm. (H) Huh7.5.1 cells were infected with MLB1 and MLB2 virus stocks at MOI 0.1 and incubated for 72–120 h. Virus titers were determined from 6 independent experiments. Data are mean ± SD. (I) Partially differentiated i3Neurons were seeded on IBIDI plates, differentiated into mature glutamatergic neurons, infected with MLB1 and MLB2 viruses, and incubated for 48 (MLB2) or 96 (MLB1) h. Representative confocal images of fixed and permeabilized cells visualized for MLB CP (green), neuronal marker MAP2 (magenta) and stained for nuclei (Hoechst, blue) are shown. Scale bars are 50 μm. All uncropped images can be found in the Supporting information file as S1 Raw Images. All individual quantitative observations that underlie the data can be found in S1 Data file. CPE, cytopathic effect; hpi, hours post infection; MOI, multiplicity of infection.

When passaging clinical isolates, we noticed that the Huh7.5.1 cell line supports MLB replication and results in a moderate cytopathic effect (CPE). MLB clade viruses were previously reported to replicate in Huh7 and Huh7.5 cell lines with the ability to establish a persistent infection on passaging [2]. Presumably, in contrast to the immune-competent Huh7 cells, the more susceptible Huh7.5.1 cell line [7] can allow for enhanced replication and development of CPE. This cell line was also reported to support active replication of the classical human astrovirus 1 (HAstV1) [30]. The CPE was apparent for MLB2 at 24 to 48 h post infection (hpi), whereas slower replicating MLB1 showed CPE at 48 to 72 hpi, reaching >60% cell death at 3 days post infection for MLB2 and at 4 days post infection for MLB1 (Fig 2D and 2E). The differences in CPE were also confirmed in the independent automated cytotoxicity screening using live-cell imaging (S1 Fig).

The permissiveness of the Huh7.5.1 cell line allowed the development of a virus titration system. Cells cultured on 96-well plates were infected with 10-fold dilutions of MLB1 and MLB2 stocks, fixed and stained with CPNTD-antibody using in-cell near-infrared fluorescence-based detection (Fig 2D and 2F). The cytoplasmic distribution of CP was confirmed by confocal microscopy further demonstrating that both MLB1 and MLB2 can be detected 24 hpi (Fig 2G). Since no released virus could be detected after 20 hpi, this timepoint was utilized for single-round infection experiments like titration of the virus stocks. Efficient virus release was detected at 48 to 72 hpi for MLB2 and at 96 to 120 hpi for MLB1, reaching 1–3 × 106 infectious units (IU) per ml (Fig 2H).

Finally, to confirm the neurotropic properties of MLB astroviruses, we developed a physiologically relevant system to infect and monitor MLB infection in neurons. The neurotropism of MLB astroviruses was previously described and indicates their ability to infect cells of neuronal origin [2,4]. The recently developed methodology to efficiently differentiate human-induced pluripotent stem cells (iPSCs) into isogenic cortical glutamatergic neurons (i3Neurons) [31] provided a suitable platform to experimentally assess neurotropic properties of MLB1 and MLB2 viruses. Both viruses resulted in efficient infection at 48 hpi (MLB2) and 96 hpi (MLB1) further confirming the ability of these viruses to infect postmitotic neuronal cells (Fig 2I).

Development, annotation, and assessment of infectious clones for MLB1 and MLB2 viruses

The 5′ and 3′ terminal consensus sequences were used to design specific primers to amplify MLB1 (MK089434) and MLB2 (JF742759) full-length genomes. The entire genomes of MLB1 (Fig 3A) and MLB2 (Fig 3B) were cloned into the T7 promoter-containing plasmid using a single-step ligation-independent cloning. The obtained plasmids were sequenced and the ORFs and functional elements were annotated based on homology with other astroviruses (GenBank accession numbers: ON398705, ON398706). The resulting differences between recombinant and clinical isolate sequences have arisen due to polymorphisms present in initial clinical isolates. To produce recombinant viruses, the infectious clones of MLB1 and MLB2 were linearized and full genomic RNAs were synthesized in vitro using T7 RNA polymerase.

10.1371/journal.pbio.3001815.g003 Fig 3 Generation and validation of RG system for MLB1 and MLB2 astroviruses.

(A, B) Schematic representation of MLB1 (A) and MLB2 (B) genomes used to generate infectious clones. MLB genome elements: ORF, open reading frame; RdRp, RNA-dependent RNA polymerase; CP, capsid polyprotein; FS, frameshift site; SG, subgenomic promoter. (C) Strategy for a plasmid-derived RG system for MLB1 and MLB2. MLB cDNAs contain the entire genome flanked by the T7 promoter and XhoI linearization site. Huh7.5.1 cells were electroporated with full-genome T7 transcripts, the collected virus was used for serial passages in the same cell line. (D, E) Multistep growth curves of MLB1 (D) and MLB2 (E) on Huh7.5.1 cells (the second passage). Cells were infected at an MOI 0.1, and virus titer was measured from the intracellular and extracellular fractions in triplicates. Data are mean ± SD. (F) Cells were infected at an MOI 0.1, harvested at 48 hpi, and analyzed by western blotting with anti-CP and anti-tubulin antibodies. (G) Huh7.5.1 cells were infected with MLB1 and MLB2 at an MOI 0.1 and incubated for 72 h. The cell- and media-derived samples were harvested and analyzed by western blotting. (H, I) Huh7.5.1 cells were infected in triplicates with MLB1 (H) and MLB2 (I) at an MOI 0.1 and incubated for 72–120 h until full CPE. Total virus titers of 10 serial passages were determined in triplicates (n = 2 independent experiments). Data are mean ± SD. (J, K) Analysis of CP expression in Huh7.5.1 cells infected with 2–10 passage of MLB1 (J) and MLB2 (K). Cells were infected at an MOI 0.1, harvested at 48 hpi, and analyzed by western blotting. All uncropped images can be found in the Supporting information file as S1 Raw Images. All individual quantitative observations that underlie the data can be found in S1 Data file. CPE, cytopathic effect; hpi, hours post infection; MOI, multiplicity of infection; RG, reverse genetics.

The ability of MLB astroviruses to replicate in Huh7.5.1 cells provides a great advantage for the development of the RG system: A single cell line can be used for both virus rescue and propagation—something that is not possible for other astroviruses with cell tropism restricted to non-transfectable cell lines [22]. Huh7.5.1 cells were electroporated with transcribed RNAs and incubated for 48 h (MLB2) or 72 h (MLB1) until the appearance of CPE. The supernatants were titrated and passaged at MOI 0.1 followed by titration and sequencing of resulting viral genomes (Fig 3C). The obtained recombinant viruses recapitulated the growth properties of the original clinically isolated MLB astroviruses [2], reaching final titers of 106 to 107 IU/ml. Consistent with previous findings [2], the increase of the virus in the extracellular fraction was higher for MLB2 than for MLB1 (Fig 3D and 3E). The infection process coincided with the accumulation of capsid proteins, corresponding to observed increased virus production in these samples (Fig 3F). To get an estimation of the nature of smaller CP products, CP-specific products derived from cellular and media samples were analyzed. Interestingly, we predominantly observed cleaved CP form in the media-derived samples suggesting possible extracellular cleavage (Fig 3G) in analogy to classical HAstV strains [32]. Passaging of the MLB1 and MLB2 viruses resulted in similar virus titers (Fig 3H and 3I) and consistent production of capsid proteins (Fig 3J and 3K).

Assessing genome stability of MLB1 and MLB2 viruses

To evaluate the MLB virus genome stabilities, we performed serial passaging by using RG-derived MLB1 and MLB2 recombinant viruses. The passaging was performed in biological duplicate, starting from in vitro RNA transcripts. No changes were detected in the passaged recombinant MLB2 virus, suggesting that its genome is stable in Huh7.5.1 cells. The slower replicating recombinant MLB1 was less stable and accumulated mutations in the 3′ part of the genome. An out-of-frame single-nucleotide insertion was detected at passage 3, that coexisted with wild-type (wt) MLB1 resulting in continuous coinfection for 7 consecutive passages (Table 1). A distinct cluster of mutations at the C-terminal end of CP was identified in the second experiment (Table 1) suggesting instability of RG MLB1 genomes during longer virus passaging.

10.1371/journal.pbio.3001815.t001 Table 1 Genome changes in evolved recombinant MLB1 and MLB2 astroviruses.

Virus	Mutations (position in the genome)	
Recombinant MLB1	Experiment 1:
 • insertion of A (6017) at passage 3, premature termination of CP at 729 aa, coexist with wt for the next 7 passages
Experiment 2:
 • C5059T (P406L in CP) at passage 10
Cluster of mutations in CP: A6030G (K730E), AA6035GG (R732G), A6046G (Y735C) at passages 2–10	
Recombinant MLB2	no changes detected	

To put these mutations and previously identified deletions (Fig 1D) in the context of naturally occurring changes in MLB genomes, the analysis of all available GenBank MLB astrovirus sequences was performed. As expected, the 3′ region of the MLB2 genome was very conserved: Few amino acid variations and no deletions were found in publicly available MLB2 genome sequences (Fig 4A). In contrast, the 3′ region of MLB1 was more diverse, containing multiple changes throughout the analyzed region as well as 1 amino acid deletion upstream of the experimentally observed deletion region (Fig 4B), consistent with the mutation- and deletion-prone nature of the 3′ region of MLB1 genome.

10.1371/journal.pbio.3001815.g004 Fig 4 Analysis of C-terminal part of MLB1 and MLB2 astrovirus CP.

(A) Analysis of publicly available sequences of C-terminal part of MLB2 CP. (B) Analysis of publicly available sequences of C-terminal part of MLB1 CP. The deletion region is indicated on top of MLB1 and MLB2 alignments (A, B). (C) Analysis of the C-terminal part of MLB1 and MLB2 CP for putative caspase cleavage sites using Procleave software [33]. The sequences in bold indicate caspase 1, 3, and 6 putative cleavage sites with a probability score of >0.7. The regions of MLB1 (top) and MLB2 (bottom) deletions are shown. (D) Huh7.5.1 cells were infected with indicated recombinant viruses of MLB1 (left) and MLB2 (right) at an MOI 0.5 in triplicates, the virus was collected at indicated times post infection, and titer was measured for both extracellular and intracellular fractions. Data are mean ± SD. (E) Analysis of CP expression in Huh7.5.1 cells infected with second passage of MLB1 and MLB2 wt and mutant viruses (MOI 0.1). Cell lysates were harvested at 48 hpi and analyzed by western blotting with anti-CP and anti-tubulin antibodies. GNN is RdRp knock-out recombinant virus (GDD to GNN). (F) The effect of pan-caspase inhibitor z-VAD-fmk on CP processing during infection with classical human astrovirus 4 (HAstV4), MLB1 and MLB2 astroviruses. Caco2 cells were infected with HAstV4 and Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses at MOI 1 in the presence or absence of z-VAD-fmk. Cell lysates were harvested at indicated hpi and analyzed by western blotting with 8E7 antibody against HAstV CP (for HAstV4), anti-CP (for MLB), and anti-tubulin antibodies. The average inhibition of CP cleavage was quantified from 3 independent experiments. (G) The schematic representation of the virus competition experiment where Huh7.5.1 cells were coinfected with wt and mutant viruses and passaged. Virus RNA was isolated and used for RT-PCR to detect virus-specific fragments. (H) The RT-PCR fragments from the competition experiment were analyzed by agarose electrophoresis. The fragments corresponding to the expected size of each PCR product are shown on the right. All uncropped images can be found in the Supporting information file as S1 Raw Images. All individual quantitative observations that underlie the data can be found in S1 Data file. CP, capsid polyprotein; hpi, hours post infection; MOI, multiplicity of infection; wt, wild-type.

Generation and characterization of recombinant MLB viruses with deletions

To investigate the individual roles of truncations identified in the passaging experiments (Fig 1D), we employed the RG system to create a set of recombinant viruses with the identified deletions (Fig 4C). The growth properties of recombinant viruses were analyzed for both intra- and extracellular virus production (Fig 4D). Compared to wt MLB1, both in-frame mutants (Δ30 and Δ93) showed faster virus release, whereas out-of-frame MLB1-Δ74OF showed delayed growth kinetics. Intracellular virus production was similar between MLB1 and mutant viruses. Another out-of-frame mutant, MLB1-Δ42OF, grew to low titers (≤104 IU/ml) and displayed decreased protein production (Fig 4E) that precluded the use of this mutant in comparative experiments. MLB2-Δ5OF demonstrated a slight delay in virus growth, eventually replicating to wt levels for both extra- and intracellular viruses (Fig 4D). All mutant viruses demonstrated reduced cytotoxicity in infected cells (S1 Fig), supporting previous results that suggested a greater propensity to establish persistent infection [2].

The analysis of infected cells was performed using a CPNTD-recognizing antibody, which was expected to recognize only N-terminal products of CP (Fig 4E). Similarly to related HAstVs, the C-terminal domain of MLB1 and MLB2 CP contains putative caspase cleavage sites, which could lead to the programmed C-terminal cleavage of CP. The predicted caspase cleavage sites were mapped for both MLB1 and MLB2 C-terminal domains of the CP (Fig 4C). Consistent with experimental observations, the cleaved product of MLB2 CP corresponds to the size of CP in MLB2-Δ5OF mutant suggesting caspase cleavage is taking place in this region (Fig 4C and 4E). The shorter forms of MLB1 deletion mutants seem to locate downstream of predicted caspase cleavage sites and potentially affect the C-terminal cleavage of CP in different ways: Δ30 and Δ93 follow the wt-like processing of CP, Δ74OF results in a shorter CP form, whereas Δ42 have both CP forms present. Notably, both Δ74OF and Δ42 lack the lower cleavage product, presumably one of the C-terminal truncated forms (Fig 4C and 4D). The integrity and stability of resulting mutant viruses over 3 passages were confirmed by RT-PCR and sequencing. To confirm the predicted caspase cleavage of CP, the Caco2 cells infected with classical human astrovirus 4 (HAstV4) and Huh7.5.1 cells infected with MLB1 and MLB2 were incubated in the absence or presence of pan-caspase inhibitor z-VAD-fmk. Consistent with the previously published results for classical HAstVs [9], both HAstV4 and MLB2 viruses resulted in the inhibition of CP cleavage in response to caspase inhibition (Fig 4F). In contrast, MLB1 was not sensitive to the inhibition of caspase-mediated processes (Fig 4F), suggesting that other cellular or viral proteases may be involved in the maturation of structural polyprotein of MLB1. These results support differences observed in the processing of CP that contains deletions in the C-terminal region.

The growth delay and altered CP processing in mutant viruses with deletions have raised the question of what selective advantage these mutations confer during passaging. The initial evolution experiments resulted in a mixture of defective genomes that could trans-complement each other but did not have a distinct “winner” except for MLB1-Δ30 which was the only mutant found in passaged clinical MLB1 (Fig 1B). Thus, we performed direct competition experiments between the wt and mutant MLB viruses (Fig 4G). Consistent with previous findings (Fig 1B) and virus growth experiments (Fig 4D), in-frame MLB1-Δ30 out-competed wt MLB1, thus confirming its advantage in Huh7.5.1 cells (Fig 4H, left panel). Another in-frame mutant (MLB1-Δ93) was out-competed either by other deletions that arose from unstable MLB1 or by coexisting with wt MLB1 during passaging (Fig 4H, middle panel). Out-of-frame deletion viruses (MLB1-Δ74OF and MLB2-Δ5OF) were outcompeted by wt viruses (Fig 4H), confirming their slower replication properties in virus growth experiments (Fig 4D). Taken together, these results indicate a growth advantage for the smaller in-frame deletion mutant MLB1-Δ30 that was previously shown to solely out-compete wt MLB1 during the evolution of clinical MLB1 (Fig 1B).

Analysis of RNA replication properties of truncated MLB viruses

The deletions that occurred in the 3′ end of the genome could potentially affect the replication properties of the virus, considering the unequivocal importance of 3′ UTR in the replication of (+)ssRNA viruses. Multiple structured RNA elements are predicted in the 3′ UTR of MLB1 and MLB2 genomes, including 3 stable stem-loops mapped to the MLB1 deletion region (Fig 5A). The 5-nucleotide deletion in MLB2 was not mapped to the structured RNA region, suggesting possible involvement of short- and/or long-range RNA interactions or other compensatory mechanisms including the processing of CP (Fig 4E). All 4 deletions in MLB1 were mapped to the predicted stem-loop RNA structures (Fig 5A) and could directly affect the RNA replication process.

10.1371/journal.pbio.3001815.g005 Fig 5 RNA replication properties in truncated MLB replicons and viruses.

(A) The prediction of the RNA secondary structure and location of identified deletions in MLB1 3′ UTR. (B) Schematic of the MLB1 and MLB2 astrovirus replicons. The 2A-RLuc cassette is fused in the ORF2 followed by the stop codon and extended 3′ UTR. (C) Huh7.5.1 cells were transfected with MLB1 and MLB2 replicons expressing mCherry, incubated for 24 h, fixed and imaged, nuclei were counterstained with Hoechst (blue). Scale bars are 100 μm. (D) Relative MLB1 and MLB2 replicon luciferase activities were measured after RNA transfection of Huh7.5.1 or HEK293T cells. Values are normalized so that the mean wt replicon value at each time point is 100%. The replication fold difference between wt and GNN mutant replicon is provided for the final time point. (E) Relative MLB1 and MLB2 replicon luciferase activities were measured after RNA transfection of Huh7.5.1 or HEK293T cells. The resulting replicon activities were normalized to wt replicon values at each time point. (F, G) Extracellular and intracellular RNA levels were measured for MLB1 (F) and MLB2 (G) infections. Huh7.5.1 cells were infected with indicated recombinant viruses of MLB1 and MLB2 at an MOI 0.5 in triplicate, the virus was collected at indicated times post infection, and RNA levels were measured for both extracellular and intracellular fractions. These samples were collected in parallel with those shown in Fig 4D to match the observations. Data are mean ± SEM (n = 3, ≥3 independent experiments, graphs D–G). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 using two-way ANOVA test against wt replicon/infection (E–G). All individual quantitative observations that underlie the data can be found in S1 Data file. MOI, multiplicity of infection; ORF, open reading frame; UTR, untranslated region; wt, wild-type.

To evaluate this hypothesis and assess the importance of overlapping 3′ RNA structures, replicon systems for MLB1 and MLB2 were created. In replicon systems, the RNA replication is evaluated via a fluorescent or luminescent reporter gene that replaces the structural proteins. The preserved RNA elements contain intact SG promoter, 5′ and 3′ UTRs, functional RdRp, and other components of the RNA replication machinery. This enables visualization and/or quantification of the SG reporter activity while avoiding the packaging step via deletion of the capsid region. Similar to a previously developed HAstV1-based replicon system [7], the genomes of MLB1 and MLB2 infectious clones were modified as demonstrated in Fig 5B. The 2A-cleavage-mediated Renilla luciferase (RLuc) or mCherry reporters were used to quantify and visualize the protein expression from the SG promoter. The transfection of both MLB1R-mCherry and MLB2R-mCherry replicons resulted in the expression of reporter mCherry (Fig 5C). The activity of MLB replicons expressing RLuc was monitored over time in 2 different cell lines (Fig 5D). Strong replication was detected for MLB2 replicon in Huh7.5.1 (1,251-fold) and HEK293T (568-fold) cells, when compared to replication-deficient but translation-competent GNN mutant replicon (with GDD catalytic RdRp motif changed to GNN). Lower replication levels were observed for MLB1 replicon in both Huh7.5.1 (379-fold) and HEK293T (100-fold) cells, which is consistent with slower growth kinetics observed for wt MLB1 virus (Fig 3D and 3E).

To assess the replicon activity for MLB1 and MLB2 deletion mutants, all mutations (Fig 1D) were transferred into corresponding RLuc replicon systems and activity was measured during the early (4 h) and later (20, 24, and 30 h) replication stages. A consistent 50% to 150% increase in replicon activity was observed for MLB1R-RLuc-Δ30 and MLB1R-RLuc-Δ74OF mutants when compared to corresponding wt replicons in Huh7.5.1 cells (p < 0.001 for 20, 24, and 30 h). In HEK293T cells, MLB1R-RLuc-Δ74OF was replicating above wt levels (p < 0.0001 for all time points) with other mutants having nonsignificant or less pronounced effects. A wt-like level was detected for MLB1R-RLuc-Δ42, MLB1R-RLuc-Δ93, and MLB2R-RLuc-Δ5OF replicons at most time points (Fig 5E). These results suggest a beneficial or dispensable nature of identified 3′ RNA structures in the context of replicon system.

Intrigued by these findings, we examined RNA levels in virus-infected Huh7.5.1 cells as well as in media-derived samples. This resulted in increased RNA levels for MLB1-Δ30, wt-like RNA levels for MLB1-Δ74OF and reduced RNA levels for MLB1-Δ93 (Fig 5F). RNA levels in MLB2-Δ5OF-infected cells were decreased during initial infection, followed by an increase in all samples at the late infection stage (Fig 5G), coinciding with higher cytotoxicity levels (S1 Fig). Taken together, our results indicate a role of 3′-located elements in the regulation of viral RNA synthesis.

MLB viruses with 3′ deletions are attenuated in iPSC-derived neurons

To assess the neurotropism of MLB viruses, we infected differentiated i3Neurons with wt and mutant recombinant MLB viruses at MOI 0.5 (Fig 6A). The infection with wt MLB2 reached 40.8% efficiency, whereas MLB2-Δ5OF showed weak signs of infection (4.8%), limited to single infected cells and not showing the spread of infection (Fig 6B and 6D). The infection with wt MLB1 resulted in non-uniform distribution of infected cells with overall 8.6% CP-positive neurons. Conversely, the cells infected with MLB1-Δ30, MLB1-Δ74OF, and MLB1-Δ93 resulted in a decrease in infection efficiency (6.9%, 4.8%, and 1.1% CP-positive cells, respectively) with MLB1-Δ93 being the most attenuated in primary neurons (Fig 6C and 6D).

10.1371/journal.pbio.3001815.g006 Fig 6 Infection of iPSC-derived i3Neurons with MLB astroviruses.

(A) The schematic representation of the experiment where partially differentiated i3Neurons were seeded on IBIDI (imaging) or 12-well (other analyses) plates, differentiated into mature i3Neurons, infected with indicated MLB1 and MLB2 recombinant viruses at MOI 0.5. (B, C) iPSC-derived neurons were infected with MLB2 (B) and MLB1 (C). Representative confocal images of fixed and permeabilized cells visualized for MLB CP (green) and MAP2 (magenta). Nuclei were stained with Hoechst (blue). Scale bars are 50 μm. (D) At least 15 images (150–250 cells per image) were analyzed for CP-positive cells. ***p < 0.001, ****p < 0.0001, ns nonsignificant, using two-tailed Mann–Whitney test against wt virus infection. (E) iPSC-derived neurons were infected with MLB viruses in quadruplicate at MOI 0.5 and passaged in neurons using 1/100th volume of the previous passage. Each virus was titrated on Huh7.5.1 cells. *p < 0.05, ****p < 0.0001, using two-way ANOVA test against wt infection. (F) Representative confocal images of fixed and permeabilized infected i3Neurons were taken, scale bars are 25 μm. (G) Intracellular RNA levels were quantified using qPCR. The virus-specific signal was normalized to GAPDH RNA and calculated as fold increase to the input RNA levels. *p < 0.05, ***p < 0.001, using one-way ANOVA test against wt infection (MLB1) and **p < 0.01, using Student’s t test (MLB2). Data are mean ± SD (D, E, G). (H) Schematic representation of MLB genome organization. MLB genome elements: ORF, open reading frame; NTD, N-terminal domain; TM, transmembrane domain; Pro, protease; VPg, virus protein genome-linked; HVR, hypervariable region; RdRp, RNA-dependent RNA polymerase; XP, X protein; FS, frameshift site; SG, subgenomic promoter. All individual quantitative observations that underlie the data can be found in S1 Data file. CP, capsid polyprotein; iPSC, induced pluripotent stem cell; MOI, multiplicity of infection; wt, wild-type.

Next, we examined the infectivity of the particles released from the infected neurons by titration on susceptible Huh7.5.1 cells. The analysis of virus release demonstrated that all viruses with deletions have significantly reduced production of infectious particles confirming that MLB astroviruses with deletions are strongly attenuated in neurons and result in decreased infectious virus release. Furthermore, only wt viruses could productively infect neurons on passaging (Fig 6E and 6F), whereas infection with truncated MLB viruses resulted in undetectable virus levels after 3 consecutive passages (Fig 6E). Cytotoxicity in neurons was assessed for both wt and mutant viruses and confirmed the reduced toxicity for all mutant virus infections (S1 Fig). Sequencing of MLB1 and MLB2 viruses passaged in neurons did not reveal any changes throughout the genome, in contrast to deletion- and mutation-prone MLB1 in Huh7.5.1 cells (Table 1).

Next, we measured the levels of intracellular virus RNA in infected neurons. Consistent with lower infectivity (Fig 6B, 6D, and 6E), the virus-specific RNA transcripts were significantly reduced in MLB2-Δ5OF (Fig 6G). These results were also in agreement with the Huh7.5.1 data at early stages of infection (Fig 5G), where cytotoxicity was also low (S1 Fig). Surprisingly, the intracellular virus RNA levels were increased in all MLB1 deletion mutants (Fig 6G) despite lower CP-positive cells and reduced virus release (Fig 6C–6E). Coupled with similar observations in the replicon system (Fig 5E) and in infected Huh7.5.1 cells (Fig 5F), this suggests that RNA replication is strongly unbalanced in MLB1 deletion mutants and may lead to decreased infectivity and particle release in infected neurons. These findings indicate that the 3′ region of MLB1 and MLB2 genome is required for establishing efficient infection in the neuronal cells; however, this is likely achieved in different ways for MLB1 and MLB2 mutants.

Taken together, we developed a powerful platform to investigate neurotropic properties of MLB1 and MLB2 astroviruses and confirmed attenuation of the panel of recombinant viruses with specific 3′ deletions.

Discussion

A novel MLB group of human astroviruses has gained increasing attention because of invading the non-gastrointestinal tract [4,34–36] and their zoonotic potential [1,14]. However, the basic molecular biology of these viruses is still in its infancy because of the absence of genetically tractable in vitro infection models. Here, we report a robust RG system for MLB1 and MLB2 genotypes of human astroviruses that allows the generation of recombinant viruses. We have used this to develop tools to efficiently propagate, visualize, and quantify MLB-infected cells, and utilized this system to characterize MLB genomes with deletions in the 3′ region. Unlike previously reported astrovirus RG systems, MLB RG requires only 1 cell line for both rescue and virus passaging, enabling interrogation of early infection processes such as virus entry, uncoating, and replication. This is particularly important for mutation-prone virus strains when prolonged infection results in substantial changes in the virus genome. As we observed for 2 recombinant MLB astroviruses, one of them (MLB2) had remarkable stability and no changes were detected after 10 serial passages. In contrast, MLB1 was less stable and had more variations, consistent with greater variability of previously reported sequences. This observation, coupled with the developed RG system highlights how investigating MLB represents an opportunity to study differential genomic stability in closely related viruses. Interestingly, clinically isolated MLB2 eventually resulted in 1 deletion upon passaging (MLB2-Δ5OF), which can be attributed to the quasispecies-nature of clinically isolated viruses.

The processing of CP, virion assembly and maturation in MLB viruses is regulated by several cellular proteases, such as caspases. What is the role of C-terminal deletions in the context of ORF2-encoded polyprotein? The removal of the significant part of the acidic CP portion could affect CP localization, trafficking, particle formation, and potential pro-viral roles that are yet to be characterized for astroviruses. In infected cells, we observed a major large polyprotein precursor and several smaller products (Figs 2C and 3F), suggesting intracellular cleavage of CP. The analysis of media-derived samples revealed a prevalence of smaller CP cleavage products of about 55 kDa (Fig 3G), indicating that CP is cleaved by additional unknown intracellular and/or extracellular proteases. The C-terminal cleavage of CP in MLB2 is likely to be regulated by cellular caspases (Fig 4F), similar to classical human astroviruses [9]. Despite the presence of the predicted cleavage sites (Fig 4C), the processing of MLB1 capsid is not sensitive to cellular caspase inhibitors (Fig 4F), resembling another neurotropic astrovirus, VA1 [37]. In contrast to neurotropic VA1 and MLB groups of astroviruses, the infectivity of classical astroviruses strongly depends on exogenous trypsin activation [2,37]. Since trypsin is primarily a gut-specific enzyme, this may also explain the extra-gastrointestinal tract tropism of MLB astroviruses, including their ability to infect cell lines of different origins, such as Huh7 (hepatocarcinoma) and A549 (lung adenocarcinoma) [2]. However, it should be noted that brain tissues contain several trypsin-like proteases [38] that may also support the replication of trypsin-dependent viruses [39,40]. Taken together, the requirements for the proteolytic maturation of astrovirus CP represent a powerful strategy to control virus entry, infectivity, and virion maturation, with a likely impact on cellular tropism and pathogenesis.

The deletions identified in the 3′ part of the MLB genomes can result in dual functional defect due to the overlap of structured RNA elements and ORF2 coding sequence. MLB1 and MLB2 have multiple differences in the key properties related to the functionality of the 3′ part of the genome: (i) RNA stem-loop structure was predicted for MLB1 (Fig 5A), but not for MLB2; (ii) sensitivity to caspase inhibition was observed for MLB2, but not MLB1 (Fig 4E); (iii) increased RNA replication in neurons and more significant increase of replicon activity was a hallmark for MLB1 deletion mutants (Figs 5E and 6G). It was logical to expect that the 3′ attenuation in these 2 closely related MLB viruses could have differences in associated RNA and protein-related effects. All deletion mutants identified in MLB1 were mapped to the predicted structured stem-loops that could be beneficial for RdRp processivity in susceptible cells supporting active RNA replication. Enhanced genome replication was indeed observed for MLB1R-RLuc-Δ30 and -Δ74OF replicons (Fig 5E), MLB1-Δ30 in infected Huh7.5.1 cells (Fig 5F), and MLB1-Δ30, -Δ74OF and -Δ93 viruses during infection in neurons (Fig 6G), highlighting the importance of this region in the replication of MLB1 genome. The enhanced replication could have led to the imbalance of RNA replication-translation-packaging and resulted in lower infectious virus particle release and infectivity in neurons (Fig 6C–6E). In contrast, attenuation of MLB2 virus with a small 5-nucleotide out-of-frame deletion resulted in modest differences in replicon activity (Fig 5E), varying RNA levels depending on infection stage in Huh7.5.1 cells (Fig 5G), and 10-fold decreased RNA levels in neuronal infection (Fig 6G), suggesting that differences in cleaved C-terminal part of CP (Fig 1D) could play a major role in attenuation of MLB2. This, however, does not exclude associated RNA defects (Figs 5E and 5G and 6G) due to the overlapping nature of functional elements and tight association between RNA replication, translation, packaging, and virus–host interactions. Observing an imbalanced virus RNA synthesis in several systems and different cell types, we identified a region in the 3′ end of the MLB genome that regulates RNA replication (Fig 6H).

The selection for deletion-prone viruses through serial passaging in highly susceptible cells is a well-known strategy for the generation of vaccine candidates [26]. The viruses with deletions are usually more capable in cell culture and replicate to higher titers, but are highly attenuated in natural hosts, which makes them ideal candidates for live vaccines. Consistently, the deletion of the large portion of the acidic region in the context of the MLB genome could be well tolerated in a highly susceptible Huh7.5.1 cell line but have a distinct role in the terminally differentiated neurons. To our knowledge, this is the first demonstration of attenuation strategy for neurotropic astroviruses, paving the way to the characterization of attenuation mechanisms and elucidation of the corresponding cell- and host-specific pathways. Similar vaccine candidates with deletions in accessory genome regions have been developed for various pathogenic viruses, including delta-6K and delta-5 (nsP3) mutants in Chikungunya virus [41], 30 nucleotide 3′ UTR deletion in Dengue virus [42], SARS-CoV-2 deletions in the multi-basic cleavage sites of spike protein [43], or combination of several known attenuation approaches that can provide a safer strategy to prevent reversion to virulence [44]. Besides attenuation in vivo, trade-offs for enhanced cell culture replication may result in reduced particle stability [45]. Taken together, the identification of the attenuation region in the MLB group of astroviruses brings us a step forward in understanding the mechanisms responsible for virulence in this group of viruses.

There is no animal model for human astroviruses reported so far to elucidate the attenuation mechanism in the context of systemic infection, but it would be interesting to introduce similar deletions in the genomes of closely related neuropathogenic animal astroviruses (Fig 1A) to develop vaccine candidates against circulating astrovirus strains that cause outbreaks in animal farms [17,46,47].

In summary, we have developed a new RG system for MLB astroviruses and have exploited it to identify elements in the 3′ end of the genome that are dispensable for the replication in cell culture but attenuated in human neurons (Fig 6H), thus improving our understanding of the molecular biology of MLB-group astroviruses and facilitating the development of therapeutics and vaccines. The identification of the regions responsible for the neurotropism in the MLB group of astroviruses represents first insights into molecular determinants of neuropathology of astroviruses, advances our understanding in mechanisms involved in this process and help identify virus strains with similar properties. This attenuation strategy can be further applied to other pathogenic human and animal astroviruses.

Materials and methods

Cells

HEK293T cells (ATCC) were maintained at 37°C in DMEM supplemented with 10% fetal bovine serum (FBS), 1 mM L-glutamine, and antibiotics. Huh7.5.1 (obtained from Apath, Brooklyn, New York, United States of America) [48] and Caco2 (ATCC) cells were maintained in the same media supplemented with non-essential amino acids (NEAA). All cells were tested mycoplasma negative throughout the work (MycoAlert Mycoplasma Detection Kit, Lonza).

Plasmids

For bacterial expression of CNPNTD, the relevant MLB1 CP-coding sequence corresponding to 61–396 aa in ORF2 was PCR amplified and inserted into the T7 promoter-based pExp-MBP-TEV-CHis expression plasmid with an N-terminal MBP fusion tag, followed by TEV protease cleavage site and C-terminal 8×His-tag (Fig 1A).

To create RG clones for MLB1 and MLB2, the 5′ and 3′ terminal consensus sequences [2] were used to design specific primers to amplify MLB1 and MLB2 full-length genomes using Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific). The amplified genomes of MLB1 and MLB2 were cloned into the T7 promoter-containing plasmid [20] using a single-step ligation independent cloning. Each 20 μl reaction was prepared using 2 PCR amplicons containing 15 to 20 nucleotide-long overlapping sequences mixed in equimolar proportions (50 ng for shorter product), 1× Buffer 2.1 (NEB), 2 μg BSA, and 3 units of T4 DNA polymerase (NEB) and incubated at 20°C for 30 min. The reaction was stopped by adding 1 μl of 20 mM dGTP, heated to 50°C for 2.5 min, cooled down to room temperature for 20 min, and used for the transformation of XL1 blue competent cells (Agilent). All identified mutations (Fig 5A) were introduced in the MLB1 and MLB2 RG clones using site-directed mutagenesis.

To create MLB1 and MLB2 replicon systems, both MLB RG clones were left intact up to the end of ORFX followed by a 2A sequence and a RLuc or mCherry sequence with a stop codon, followed by the last 624 nt of the virus genome and a 35 nt poly-A tail (Fig 5B). All mutations were introduced into corresponding replicon plasmids using available restriction sites. The GenBank accession numbers for the pMLB1 and pMLB2 are ON398705 and ON398706, respectively.

All obtained plasmids were sequenced and annotated. The resulting RG and replicon plasmids were linearized with XhoI restriction enzyme prior to T7 transcription.

Purification of His-tagged CPNTD and generation of CP-specific antibody

The MLB1 CPNTD protein was produced in Rosetta 2 (DE3) cells (Novagen) cultured in 2×YT media with overnight expression at 18°C induced with 0.4 mM IPTG. The protein was purified first by immobilized metal affinity chromatography using PureCube Ni-NTA resin and then by affinity chromatography using amylose resin (NEB). N-terminal MBP fusion tag was removed by the cleavage with TEV protease (produced in-house). The MLB1 CPNTD protein was further purified by heparin chromatography using HiTrap Heparin HP 5 ml column (Cytiva) and, finally, by size exclusion chromatography using a Superdex 200 16/600 column (Cytiva). Protein solution in 50 mM Na-phosphate (pH 7.4), 300 mM NaCl, 5% glycerol was concentrated to 2 mg/ml and used for immunization.

Antibody against CPNTD was generated in rabbits using 5-dose 88-day immunization protocol. Sera were used for CPNTD-specific affinity purification, followed by purification of specific IgG fractions (BioServUK).

Recovery of MLB1 and MLB2 viruses from T7 RNAs

The linearized RG plasmids were used as templates to produce capped T7 RNA transcripts using T7 mMESSAGE mMACHINE T7 Transcription kit (Invitrogen) according to the manufacturer’s instructions. For a virus recovery, 107 Huh7.5.1 cells were trypsinized, washed with PBS, and electroporated with 20 μg T7 RNA in 800 μl PBS pulsed twice at 800 V and 25 μF using a Bio-Rad Gene Pulser Xcell electroporation system. The cell suspension was supplemented with 10% FBS-containing media and incubated at 37°C. After 3 h of incubation and full cell attachment, the media was replaced with serum free media, and cells were incubated until appearance of CPE. To produce recombinant MLB1 virus stocks, electroporated cells were incubated for 72 to 96 h, freeze–thawed twice, filtered through 0.2 μm filter, supplemented with 5% glycerol and stored in small aliquots at −70°C. For recombinant MLB2 virus stocks, electroporated cells were incubated for 48 to 72 h, the supernatant was clarified by filtration through 0.2 μm filter, supplemented with 5% glycerol, and stored in small aliquots at −70°C.

Virus passaging, growth curves, and titration

To passage recombinant MLB1 virus stocks, Huh7.5.1 cells were infected at an MOI 0.1 for 2 h in serum-free media, then 5% FBS-containing media was added and incubated for 16 to 24 h, then replaced with serum-free media and incubated for 72 to 96 h until the appearance of CPE, freeze–thawed twice, filtered through 0.2 μm filter, and supplemented with 5% glycerol. To passage recombinant MLB2 virus stocks, Huh7.5.1 cells were infected at an MOI 0.1 for 2 h in serum-free media, then 5% FBS-containing media was added and incubated for 16 to 24 h, then replaced with serum-free media and incubated for 48 to 72 h until the appearance of CPE; the supernatant was clarified by filtration through 0.2 μm filter and supplemented with 5% glycerol. Virus RNA was isolated by Direct-zol RNA MicroPrep (Zymo research), followed by RT-PCR and Sanger sequencing of the virus genome. The genome ends were sequenced using 5′/3′ RACE kit (Roche).

To concentrate media-derived samples, the infected Huh7.5.1 cells were incubated for 96 h, the media was collected, clarified using 0.2 μm filter, and pelleted at 54,000 rpm (180,000 ×g) for 2 h at 4°C in a TLA-55 rotor in an Optima Max-XP tabletop ultracentrifuge (Beckman). The supernatant was removed, the pellet was resuspended in 50 mM Tris (pH 6.8) to obtain 20× concentrated sample and analyzed by SDS-PAGE followed by western blotting.

Multistep growth curves were performed using an MOI of 0.1 (Fig 3D and 3E) or 0.5 (Fig 4D). Individual infections were performed in triplicates. Both cell- and media-derived samples were collected in equal volume at indicated times post infection and saved for virus quantification.

Virus competition assay was performed in duplicates using equal amounts of wt and mutant viruses at MOI 0.1. The passaging was performed using 1/1,000 volume of the previous passage. RNA was extracted using the Qiagen QIAamp viral RNA mini kit. Reverse transcription was performed using the Superscript III reverse transcriptase (Thermo Fisher Scientific) as per manufacturer’s protocol. The PCR primers were designed to amplify 350(wt)/320(Δ30)/276(Δ74OF)/257(Δ93) bp fragments for MLB1 and 60(wt)/55(Δ5OF) bp fragments for MLB2.

The immunofluorescence-based detection with anti-CPNTD MLB1 antibody (1:300) was combined with infrared detection readout and automated LI-COR software-based quantification. Briefly, 24 h before infection, Huh7.5.1 cells were plated into 96-well plates (2–3×104 cells/well). The 10-fold serial dilutions of virus stock in a round-bottom 96-well plate were prepared using serum-free media supplemented with 0.2% BSA. The cells were infected with prepared virus dilutions in duplicates, incubated for 24 h, fixed with 4% paraformaldehyde (PFA), processed for immunofluorescence staining, scanned and counted as the number of capsid-positive signals. The titers were determined as infectious units per ml (IU/ml).

SDS-PAGE and immunoblotting

Protein samples were analyzed using 8% SDS-PAGE. The resolved proteins were then transferred to 0.2 μm nitrocellulose membranes and blocked with 4% Marvel milk powder in PBS. Immunoblotting of MBL1 and MLB2 capsid proteins was performed using anti-CPNTD MLB1 antibody (custom-made rabbit polyclonal antibody, 1:3,000). Anti-tubulin antibody (Abcam, ab6160, 1:1,000) was used for the cellular target. Secondary antibodies (LI-COR IRDye 800 and 680, 1:3,000) were used for IR-based detection. Immunoblots were imaged on a LI-COR ODYSSEY CLx imager and analyzed using Image Studio version 5.2.

Inhibition of caspase cleavage in astrovirus-infected cells

Caco2 cells were infected with HAstV4, Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 1) in the presence or absence of 20 μm z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection, cells were lysed and analyzed by immunoblotting using virus-specific antibodies. The CP of HAstV4 was detected using astrovirus 8E7 antibody (Santa Cruz Biotechnology, sc-53559, 1:750).

Analysis of CPE and fluorescent microscopy

For the analysis of virus-induced CPE, plasma membranes of infected cells were stained with Wheat Germ Agglutinin Alexa Fluor 488 Conjugate (WGA, Thermo Fisher Scientific, 1:250) for 20 min, followed by fixation with 4% PFA for 20 min, permeabilization with 0.05% Triton X-100 in PBS for 15 min, and nuclei counter-staining with Hoechst (Thermo Fisher Scientific) for 15 min. Cells were washed twice with PBS and imaged using EVOS fluorescence microscope. For the analysis of CP localization, the infected Huh7.5.1 cells were incubated for 24 h, fixed and permeabilized as above. CP was detected using anti-CPNTD MLB1 antibody followed by incubation with secondary antibody (Alexa Fluor 488-conjugated goat anti-rabbit, Thermo Fisher, A21441). Nuclei were counter-stained with Hoechst. The images are single plane images taken with a Leica SP5 Confocal Microscope using a water-immersion 63× objective.

MLB replicon assay

Linearized replicon-encoding plasmids were utilized to produce T7 RNAs using mMESSAGE mMACHINE T7 Transcription kit, purified using Zymo RNA Clean & Concentrator kit and quantified. Huh7.5.1 and HEK293T cells were transfected in triplicate with Lipofectamine 2000 reagent (Invitrogen), using the reverse transfection protocol. Briefly, a mixture of 0.5 μl Lipofectamine 2000 and 0.5 μl OMRO (OptiMEM containing 40 units/ml RNaseOUT) was incubated for 5 min at room temperature before adding to a mixture of 100 ng T7 replicon RNA, 10 ng T7 Firefly luciferase-encoding RNA, and 10 μl OMRO per transfection. After 20 min incubation at room temperature, 100 μl of the prewashed cells (105 cells) were added to the transfection mixture, incubated at room temperature for 5 min, supplemented with 5% FBS, transferred to a 96-well plate, and incubated for indicated time at 37°C (4 to 30 h). Replicon activity was calculated as the ratio of Renilla (subgenomic reporter) to Firefly (co-transfected loading control RNA, cap-dependent translation) using Dual Luciferase Stop & Glo Reporter Assay System (Promega) and normalized by the same ratio for the control wt replicon. Three independent experiments, each in triplicate, were performed to confirm the reproducibility of the results. To control for the transfection efficiency, MLB1 and MLB2 replicons encoding mCherry fluorescent protein were also transfected and visualized using EVOS fluorescent microscope (Thermo Fisher Scientific).

Growth and infection of iPSC-derived i3Neurons

i3Neuron stem cells were maintained at 37°C in complete E8 medium (Gibco) on plates coated with Matrigel (Corning) diluted 1:50 in DMEM. Initial three-day differentiation was induced with DMEM/F-12, HEPES (Gibco) supplemented with 1× N2 supplement (Thermo), 1× NEAA, 1× Glutamax, and 2 μg/ml doxycycline. Approximately 10 μm Rock Inhibitor (Y-27632, Tocris) was added during initial plating of cells to be differentiated and cells were plated onto Matrigel-coated plates. Differentiation medium was replaced daily and after 3 days of differentiation, partially differentiated neurons were re-plated into Cortical Neuron (CN) media in IBIDI wells coated with 100 μg/ml poly-L-ornithine (Sigma). CN media consisted of: Neurobasal Plus medium (Gibco) supplemented with 1× B27 supplement (Gibco), 10 ng/ml BDNF (Peprotech), 10 ng/ml NT-3 (Peptrotech), 1 μg/ml laminin (Gibco), and 1 μg/ml doxycycline. After initial replating, neurons were then maintained in CN media without doxycycline for a further 11 days until mature.

The fully differentiated neurons were infected with MLB astroviruses at an MOI 0.5 in neuronal media. After 2 h, the virus inoculum was removed and replaced with 50% fresh– 50% conditioned media. After 48 hpi (MLB2) or 96 hpi (MLB1), the cells grown on IBIDI wells were fixed, permeabilized, and stained with anti-CPNTD MLB1 antibody followed by incubation with Alexa 488-conjugated secondary antibody, followed by the staining with antibody against neuronal marker MAP2 (Abcam, ab11268) or anti-dsRNA IgG2a monoclonal antibody (Scicons J2, 10010500) and Alexa 594-conjugated secondary antibody. Nuclei were counter-stained with Hoechst. The confocal images are a projection of a z-stack images taken with a Leica SP5 Confocal Microscope using a water-immersion 63× objective. To analyze the percentage of CP-positive cells, the images were taken with EVOS fluorescence microscope. At least 15 images (150 to 250 cells per image) were analyzed. The infectivity of the particles released from the infected neurons was determined by titration on susceptible Huh7.5.1 cells as described above. Reinfection experiments were performed using 1/100 volumes of the media obtained from the previous passage.

Analysis of RNA levels in samples collected from infected cells and virus stocks

Terminally differentiated neurons grown on 12-well plates (400,000 cells per well) were infected at MOI 0.5 and collected at 72 hpi. Huh7.5.1 cells grown on 12-well plates (400,000 cells per well) were infected at MOI 0.5 and collected at indicated hpi. RNA was isolated by Direct-zol RNA MicroPrep (Zymo research), followed by quantitative reverse transcription-PCR (RT-qPCR) detection of virus (MLB1, MLB2) and cell-specific (GAPDH) RNAs. Results were normalized to the amount of GAPDH RNA in the same sample. Fold differences in RNA concentration were calculated using the 2−ΔΔCT method.

The absolute amount of MLB RNA in virus stock was determined by RT-qPCR. A 20 μl aliquot of each sample was mixed with 4 × 106 plaque-forming units of purified Sindbis virus (SINV) stock, which was used to control the quality of RNA isolation. RNA was extracted using the Qiagen QIAamp viral RNA mini kit. Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG), MLB1 (GTTGCACTGGCACCAGAGTC), MLB2 (GTGATAGTGAGGGATCTTCTGC). The known genome copy MLB standards were prepared using quantified purified T7 RNA transcripts of full-length MLB genomes.

Quantitative PCR was performed in triplicate using SsoFast EvaGreen Supermix (Bio-Rad) in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with 2 steps per cycle. MLB and SINV-specific primers were used to quantify corresponding virus RNAs; the primer efficiency was within 95% to 105%.

qPCR primers: SINV-F (GAAACAATAGGAGTGATAGGCA), SINV-R (TGCATACCCCTCAGTCTTAGC), GAPDH-F (GCAAATTCCATGGCACCGT), GAPDH-R (TCGCCCCACTTGATTTTGG), MLB1-F (TTGCCAAGTGAGCCTTACAAAC), MLB1-R (TGCCATCAACAACTGGAAGCAC), MLB2-F (GATGTCTTTGGAATGTGGGTAAAG), MLB2-R (CTAGGTGCAGGTCCTTTCTTAG).

Cytotoxicity analysis

Terminally differentiated neurons and Huh7.5.1 cells grown on 96-well plates (100,000 cells per well) were infected at MOI 0.5 in quintuplicate. Cytotoxicity was assessed by live-cell imaging using an Incucyte SX5, an automated phase-contrast and fluorescence microscope within a humidified incubator, using Cytotox NIR Dye (Sartorius) at 1:1,000 dilution added directly during virus infection. At 4-hour intervals, 3 images per well were taken and used to estimate NIR-positive cells per well using the integrated software. For each experiment, the data were plotted as NIR object count per image normalized to the 0 hpi time point.

Analysis of MLB1 and MLB2 sequences using the NCBI database

Available MLB1 and MLB2 complete and ORF2-specific genome sequences from NCBI deposited before January 2022 were identified and extracted from NCBI using Blastp. These sequences were then aligned using MUSCLE (https://www.ebi.ac.uk/Tools/msa/muscle/) and visualized using Bioedit software.

RNAfold analysis of 3′ terminal MLB sequences

The secondary structures of the 3′ terminal MLB1 and MLB2 sequences were predicted by the RNAfold Server using default settings [49].

Prediction of caspase putative cleavage sites

The putative caspase cleavage sites in C-terminal part of the MLB1 and MLB2 CP were analyzed by Procleave software [33] using default settings. Only predicted cleavage sites with probability score of >0.7 were considered.

Statistical analyses

Data were graphed and analyzed using GraphPad Prism and MS Excel. Where appropriate, data were analyzed using one-way, two-way ANOVA, Student’s t test or two-tailed Mann–Whitney test. Significance values are shown as ****p < 0.0001, ***p < 0.001, **p < 0.01, *p < 0.05, ns–nonsignificant.

Supporting information

S1 Fig Cytotoxicity assay.

Terminally differentiated neurons and Huh7.5.1 cells grown on 96-well plates were infected at MOI 0.5 in quintuplicates. Cytotoxicity was assessed by live-cell imaging using Cytotox NIR Dye added directly during virus infection. (A) NIR object counts data for Huh7.5.1 cells infected with MLB1 and MLB2, normalized to 0 hpi. (B) Representative images of MLB-infected Huh7.5.1 cells at 96 hpi. (C) Cytotoxicity analysis of MLB1 and mutant infected Huh7.5.1 cells, normalized to maximum MLB1 toxicity. (D) Cytotoxicity analysis of MLB2 and mutant infected Huh7.5.1 cells, normalized to maximum MLB2 toxicity. (E) NIR object counts data for i3Neurons infected with MLB1 and MLB2, normalized to 0 hpi. (F) Representative images of MLB-infected i3Neurons at 60 hpi. (G) Cytotoxicity analysis of MLB1 and mutant infected i3Neurons, normalized to maximum MLB1 toxicity. (H) Cytotoxicity analysis of MLB2 and mutant infected i3Neurons, normalized to maximum MLB2 toxicity. All data are mean ± SEM (n = 5), ns, nonsignificant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 using two-way ANOVA with repeated measures test against wt MLB infection. All individual quantitative observations that underlie the data can be found in S1 Data file.

(TIF)

S1 Data Quantitative data underlying each figure (Figs 2–6 and S1).

Each tab contains the panels relative to the indicated figure for which a quantitative analysis was required.

(XLSX)

S1 Raw Images Raw images relative to the blots and gel images included in the manuscript.

(PDF)

Authors thank Andrew Firth and Marko Hyvӧnen (University of Cambridge) for their support at the beginning of this project. We thank the Cambridge NIHR BRC Cell Phenotyping Hub for access to confocal microscopy.

Abbreviations

CP capsid polyprotein

CPE cytopathic effect

HAstV human astrovirus

hpi hours post infection

IU infectious unit

iPSC induced pluripotent stem cell

MOI multiplicity of infection

ORF open reading frame

PFA paraformaldehyde

RdRp RNA-dependent RNA polymerase

RG reverse genetics

SG subgenomic

UTR untranslated region

wt wild-type

10.1371/journal.pbio.3001815.r001
Decision Letter 0
Jauregui, PhD Paula Senior Editor
© 2023 Paula Jauregui, PhD
2023
Paula Jauregui, PhD
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
2 Sep 2022

Dear Dr. Lulla,

Thank you for submitting your manuscript entitled "Attenuation hotspots in neurotropic human astroviruses" for consideration as a Research Article by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff, as well as by an academic editor with relevant expertise, and I am writing to let you know that we would like to send your submission out for external peer review. In our discussion we thought that your manuscript will work better as a Methods and Resources paper. Please, select this option when re-submitting your manuscript.

PLOS Biology ‘Methods’ should report a novel method or improvements to current methodologies that significantly outperform the existing state-of-the-art methods or that show the potential to address, for the first time, a pressing biological question. Ideally, these Methods papers should be of broad interest. PLOS Biology Resources should be truly exceptional, in such a way as to spur future research. While we value the inclusion of novel biological insight in our ‘Methods and Resources’ articles, this is not a condition for consideration in PLOS Biology.

Before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. After your manuscript has passed the checks it will be sent out for review. To provide the metadata for your submission, please Login to Editorial Manager (https://www.editorialmanager.com/pbiology) within two working days, i.e. by Sep 04 2022 11:59PM.

If your manuscript has been previously peer-reviewed at another journal, PLOS Biology is willing to work with those reviews in order to avoid re-starting the process. Submission of the previous reviews is entirely optional and our ability to use them effectively will depend on the willingness of the previous journal to confirm the content of the reports and share the reviewer identities. Please note that we reserve the right to invite additional reviewers if we consider that additional/independent reviewers are needed, although we aim to avoid this as far as possible. In our experience, working with previous reviews does save time.

If you would like us to consider previous reviewer reports, please edit your cover letter to let us know and include the name of the journal where the work was previously considered and the manuscript ID it was given. In addition, please upload a response to the reviews as a 'Prior Peer Review' file type, which should include the reports in full and a point-by-point reply detailing how you have or plan to address the reviewers' concerns.

During the process of completing your manuscript submission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Paula

---

Paula Jauregui, PhD,

Senior Editor

PLOS Biology

pjaureguionieva@plos.org

10.1371/journal.pbio.3001815.r002
Decision Letter 1
Jauregui, PhD Paula Senior Editor
© 2023 Paula Jauregui, PhD
2023
Paula Jauregui, PhD
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
29 Nov 2022

Dear Dr. Lulla,

Please allow me to first apologize for the delay in the processing of your manuscript. This delay is caused by my difficulty in recruiting reviewers for your manuscript. I am sorry for this unexpected event, and I thank you for your patience while your manuscript "Attenuation hotspots in neurotropic human astroviruses" was peer-reviewed at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by several independent reviewers.

As you will see in the reviewer reports, which can be found at the end of this email, although the reviewers find the work potentially interesting, they have also raised a substantial number of important concerns. Based on their specific comments and following discussion with the Academic Editor, it is clear that a substantial amount of work would be required to meet the criteria for publication in PLOS Biology. However, given our and the reviewer interest in your study, we would be open to inviting a comprehensive revision of the study that thoroughly addresses all the reviewers' comments. Given the extent of revision that would be needed, we cannot make a decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript would need to be seen by the reviewers again, but please note that we would not engage them unless their main concerns have been addressed.

Having discussed the reviews with the Academic Editor, we think that it is important for you to demonstrate the neural tropism of the viruses and the utility and faithfulness of the recombinant system. It would be particularly compelling if the results are validated by real world phylogenetic comparisons, if the sequences exist. If not, passaging in neuronal cells and fortifying those experiments would be needed.

We appreciate that these requests represent a great deal of extra work, and we are willing to relax our standard revision time to allow you 6 months to revise your study. Please email us (plosbiology@plos.org) if you have any questions or concerns, or envision needing a (short) extension.

At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may withdraw it.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Revised Article with Changes Highlighted " file type.

*Resubmission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Paula

---

Paula Jauregui, PhD,

Senior Editor

PLOS Biology

pjaureguionieva@plos.org

-----------------------------------------

REVIEWS:

Reviewer #1: Astrovirus pathogenesis.

Reviewer #2: Virus evolution.

Reviewer #3: Astroviruses.

Reviewer #1: In this manuscript, Ali et al undertake an ambitious and comprehensive series of experiments to define regions of the astrovirus MLB genome required for replication in neuronal cells. The authors take a directed evolution approach to adapt clinical MLB isolates and then develop a battery of tools to identify the genomic changes associated with replication in cells including human i3 neurons. Yet, the manuscript primarily focuses on tool development/characterization and using their newly described reverse genetics system to assess genomic stability, analyze naturally occurring mutations in the genomes, and creating recombinant viruses with deletions to assess growth in Huh7.5 cells. There are minimal studies characterizing growth in neuronal cells and no evidence that MLB1 or 2 productively replicates in these cells. This is a major concern about the studies. Further, replication in a single neuronal cell ex vivo fails to address neurotropism. Based on the presented data, the authors are strongly encouraged to refocus the manuscript on characterization of the new reverse genetics system and understanding the areas of the genome involved in replication in Huh7.5 cells, which is the strongest part of the studies.

Major

1. The majority of the studies focus on understanding adaptations generated in serially passaging MLB1 and MLB2 co-infected Huh7.5 cells. There is no discussion on why co-infections are used. There is no evidence from human studies that MLB1 and 2 co-infect people. It is also unclear why both strains are used rather than focusing on the more frequently isolated MLB1 strain.

2. Is there evidence from comparative phylogenetic studies, that the genomes of CNS-isolated MLB strains differ from those obtained from the intestines? Given that these viruses are a major cause of CNS-associated infections in several animal species, these sequences should be available for analysis.

3. More information is needed on the source of the clinical isolates used and whether they were derived from enteric or CNS infection.

4. A major premise of the study is identifying the regions of the viral genome associated with neurotropism. The author's tackle this by adapting clinical MLB viruses in cell culture and constructing recombinant viruses to study replication in particular neuronal cells in culture. Yet, the adaptation takes place in non-neuronal, non-biologically relevant Huh 7.5 cells. It is unclear how this would translate the in vivo situation. These studies should be repeated in neuronal cells to assess the molecular changes that occur.

5. The authors fail to demonstrate that MLB viruses productively replicate in neuronal cells in vitro. Further, the references cited do not support their claim that these viruses infect cells of neuronal origin.

Reviewer #2: This article describes a novel reverse genetics system that should help us understand the biology of the MLB genogroup of astroviruses. The main advantage over previous systems is that transfection, recovery, and subsequent viral propagation are performed in the same cell line, as opposed to previous systems using two cell lines (one for recovery and another for propagation). The article is essentially methodological and, although the proposed techniques should be relevant, no major advances in our understanding of these astroviruses is reported here. I thus find it questionable whether this manuscript brings sufficient advance for publication in a generalist journal such as PLoS Biol, or should be preferably published in a more specialized journal in the field of virology.

Specific comments:

1- To better appreciate the advantages of the reverse genetics system developed here, the authors should further discuss the limitations of the previous strategies. Given that recovery is apparently straightforward (transfection of a T7 in vitro transcript), why the previous systems cannot be implemented in a single cell line?

2- How was the sequencing performed? Specifically, how were the 5´and 3´ genome ends sequenced?

3- lines 113-120: I don´t see how these two viruses could complement if the MOI was 0.1.

4- Why was the recovered virus stable in permissive cells (Huh7.5), whereas the clinical isolates evolved more mutations? Information about how these clinical isolates were passaged is missing.

5- The deletions that emerged in the serially passaged viruses should be beneficial under the conditions of this evolution experiment, unless there is a specific reason for their emergence other than positive selection. Could the authors perform competition assays to test this? This benefit is suggested by the replicon experiments, but could be further shown using full viruses. Interestingly, the mutants seem to exhibit accelerated replication in neurons but an overall fitness cost due to deficient virus gene expression, assembly or release. It would be interesting to also have data on replication kinetics and total viral fitness in the permissive cell line to more precisely identify the stage of the infection cycle where differences between Huh7.5 cells and neurons take place.

Reviewer #3: The manuscript by Ali et al. provides an exciting new advance to the study of human astroviruses, MLB1 and MLB2, in the form of molecular clones and replicon systems. With these new systems the authors define a difference in genomic stability between the two viruses as well as a difference in reliance on caspase cleavage for capsid production. Furthermore, this study demonstrates the novelty of using replication deficient astroviruses as a means to drive attenuation and the prospect of developing live-attenuated strains for vaccines. Overall the data and experimentation are clear and provide sound conclusions. However, the following suggestions would help clarify a few key points in the manuscript:

Major

Revisions of Fig1a and accompanying figure legend should be considered since most, or possibly all, sequences in the tree were obtained from stool samples collected during gastrointestinal illness. Therefore, it is difficult to assign strictly neuronal tropism to all members of those clades. Additionally, 2 classical HAstV cases of neurological disease have been identified (Koukou 2019, Wunderli 2011) but the neuron picture was not included for that clade.

In the competition experiment (Fig 1c), it is noted that there was no evidence of out-competition for 10 consecutive passages. As a point of clarification- were the same levels (ie. titer) of the virus found after each passage or were the titers after each passage not significantly different than when the viruses are passaged separately?

Fig 6G and the accompanying data convincingly show that the deletion mutants result in much higher ratios of defective particles. Was there evidence of this during the sequencing of passaged viruses?

Line 422: While trypsin is typically thought as being gut-specific, the brain also houses several trypsin-like proteases. Therefore, this explanation for extra-gastrointestinal disease associated with MLB and VA1 strains may be insufficient.

While the attenuation noted in Fig6 indicates reduced infection, the presence of virus particles, including defective particles, may still trigger inflammation and cell death of neurons. Such experiments may be needed in future evaluation of live-attenuated strains for vaccine development.

Minor

Can the authors include the passage number that was used to obtain the data in Fig3D and E?

Line 160: was it previously shown that passaging the virus in Huh7.5.1 results in enhanced replication and CPE compared to Huh7?

Line 240: Point of clarification- "…all related WT MLB astrovirus sequences" were those available in GenBank?

10.1371/journal.pbio.3001815.r003
Author response to Decision Letter 1
Submission Version2
18 Apr 2023

Attachment Submitted filename: Responses to reviewers 2023-04-16.docx

10.1371/journal.pbio.3001815.r004
Decision Letter 2
Jauregui, PhD Paula Senior Editor
© 2023 Paula Jauregui, PhD
2023
Paula Jauregui, PhD
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
19 May 2023

Dear Dr. Lulla,

Thank you for your patience while we considered your revised manuscript "Attenuation hotspots in neurotropic human astroviruses" for publication as a Methods and Resources at PLOS Biology. This revised version of your manuscript has been evaluated by the PLOS Biology editors, the Academic Editor, and the original reviewers.

Based on the reviews and on our Academic Editor's assessment of your revision, we are likely to accept this manuscript for publication, provided you satisfactorily address the remaining points raised by reviewer #2. To address the remaining concerns from reviewer #2, we suggests that you make a more nuanced conclusion explicitly stating that complementation is the likely explanation. It is important that you maintain a focus on describing the data.

Please also make sure to address the following data and other policy-related requests.

1. DATA POLICY:

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it: 2EH, 3DEHI, 4D, 5DEFG, 6DEG, S1ACDEGH (We are aware that you provided the underlying data).

NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

Please also ensure that figure legends in your manuscript include information on where the underlying data can be found, and ensure your supplemental data file/s has a legend.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

2. BLOT AND GEL REPORTING REQUIREMENTS:

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. We need this for figure 2B.

Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

3. We suggest a more appropriate title for a Methods and Resources manuscript: "Identification of attenuation hotspots in human neurotropic astroviruses uncovers determinants of neurotropism and provides a platform for attenuated vaccine development". Please feel free to modify as you think fits better.

As you address these items, please take this last chance to review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the cover letter that accompanies your revised manuscript.

We expect to receive your revised manuscript within two weeks.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

- a cover letter that should detail your responses to any editorial requests, if applicable, and whether changes have been made to the reference list

- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)

- a track-changes file indicating any changes that you have made to the manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Press*

Should you, your institution's press office or the journal office choose to press release your paper, please ensure you have opted out of Early Article Posting on the submission form. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please do not hesitate to contact me should you have any questions.

Sincerely,

Paula

---

Paula Jauregui, PhD,

Senior Editor,

pjaureguionieva@plos.org,

PLOS Biology

------------------------------------------------------------------------

Reviewer remarks:

Reviewer #1: No further concerns. Interesting manuscript bringing important new information to the field.

Reviewer #2: As indicated in my previous review, this paper presents an interesting experimental setup that could help in the development of astrovirus culture and attenuated vaccines, but in my opinion does not report major advances in our understanding of astrovirus biology. For example, encephalitis-causing astroviruses have previously been cultured in neurons. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6747723/. The fact that serial transfer in a permissive cell line such as Huh7.5 leads to the accumulation of conditionally deleterious mutations is not surprising. Some of these mutations (but potentially many others) could be exploited for the development of live attenuated vaccines.

Regarding my previous point 3, even if the MOI rises above 1 in secondary infection cycles, complementation is wiped out in each transfer. The rationale and interpretation of this passaging strategy remains therefore unclear.

Reviewer #3: All comments have been adequately addressed, thank you and well done!

10.1371/journal.pbio.3001815.r005
Author response to Decision Letter 2
Submission Version3
5 Jun 2023

Attachment Submitted filename: Responses to reviewers and editor 2023-05-26.docx

10.1371/journal.pbio.3001815.r006
Decision Letter 3
Jauregui, PhD Paula Senior Editor
© 2023 Paula Jauregui, PhD
2023
Paula Jauregui, PhD
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version3
13 Jun 2023

Dear Dr. Lulla,

Thank you for the submission of your revised Methods and Resources "Attenuation hotspots in neurotropic human astroviruses" for publication in PLOS Biology. On behalf of my colleagues and the Academic Editor, Ken Cadwell, I am pleased to say that we can in principle accept your manuscript for publication, provided you address any remaining formatting and reporting issues. These will be detailed in an email you should receive within 2-3 business days from our colleagues in the journal operations team; no action is required from you until then. Please note that we will not be able to formally accept your manuscript and schedule it for publication until you have completed any requested changes.

Please take a minute to log into Editorial Manager at http://www.editorialmanager.com/pbiology/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production process.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have previously opted in to the early version process, we ask that you notify us immediately of any press plans so that we may opt out on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for choosing PLOS Biology for publication and supporting Open Access publishing. We look forward to publishing your study. 

Sincerely, 

Paula

---

Paula Jauregui, PhD,

Senior Editor

PLOS Biology

pjaureguionieva@plos.org
==== Refs
References

1 Vu D-LL , Bosch A , Pintó RM , Guix S . Epidemiology of Classic and Novel Human Astrovirus: Gastroenteritis and Beyond. MDPI AG. 2017. doi: 10.3390/v9020033 28218712
2 Vu D-L , Bosch A , Pintó RM , Ribes E , Guix S . Human Astrovirus MLB Replication In Vitro: Persistence in Extraintestinal Cell Lines. J Virol. 2019;93 . doi: 10.1128/JVI.00557-19 31019055
3 Sato M , Kuroda M , Kasai M , Matsui H , Fukuyama T , Katano H , et al . Acute encephalopathy in an immunocompromised boy with astrovirus-MLB1 infection detected by next generation sequencing. J Clin Virol. 2016;78 :66–70. doi: 10.1016/j.jcv.2016.03.010 26991054
4 Cordey S , Vu DL , Schibler M , L’Huillier AG , Brito F , Docquier M , et al . Astrovirus MLB2, a New Gastroenteric Virus Associated with Meningitis and Disseminated Infection. Emerg Infect Dis. 2016;22 :846–853. doi: 10.3201/eid2205.151807 27088842
5 Kawasaki J , Kojima S , Tomonaga K , Horie M . Hidden Viral Sequences in Public Sequencing Data and Warning for Future Emerging Diseases. mBio. 2021:12 . doi: 10.1128/mBio.01638-21 34399612
6 Bosch A , Pintó RM , Guix S . Human astroviruses. Clin Microbiol Rev. 2014;27 :1048–1074. doi: 10.1128/CMR.00013-14 25278582
7 Lulla V , Firth AE . A hidden gene in astroviruses encodes a viroporin. Nat Commun. 2020:11 . doi: 10.1038/s41467-020-17906-x 32792502
8 Monroe SS , Jiang B , Stine SE , Koopmans M , Glass RI . Subgenomic RNA sequence of human astrovirus supports classification of Astroviridae as a new family of RNA viruses. J Virol. 1993;67 :3611–3614. doi: 10.1128/JVI.67.6.3611-3614.1993 8497068
9 Méndez E , Salas-Ocampo E , Arias CF . Caspases mediate processing of the capsid precursor and cell release of human astroviruses. J Virol. 2004;78 :8601–8608. doi: 10.1128/JVI.78.16.8601-8608.2004 15280469
10 Owusu IA , Quaye O , Passalacqua KD , Wobus CE . Egress of non-enveloped enteric RNA viruses. J Gen Virol. 2021:102 . doi: 10.1099/jgv.0.001557 33560198
11 Bass DM , Qiu S . Proteolytic processing of the astrovirus capsid. J Virol. 2000;74 :1810–1814. doi: 10.1128/jvi.74.4.1810-1814.2000 10644354
12 Méndez E , Fernández-Luna T , López S , Méndez-Toss M , Arias CF . Proteolytic processing of a serotype 8 human astrovirus ORF2 polyprotein. J Virol. 2002;76 :7996–8002. doi: 10.1128/jvi.76.16.7996-8002.2002 12134004
13 Delgado-Cunningham K , López T , Khatib F , Arias CF , DuBois RM . Structure of the divergent human astrovirus MLB capsid spike. Structure. 2022;30 :1573–1581.e3. doi: 10.1016/j.str.2022.10.010 36417907
14 De Benedictis P , Schultz-Cherry S , Burnham A , Cattoli G . Astrovirus infections in humans and animals—molecular biology, genetic diversity, and interspecies transmissions. Infect Genet Evol. 2011;11 :1529–1544. doi: 10.1016/j.meegid.2011.07.024 21843659
15 Wohlgemuth N , Honce R , Schultz-Cherry S . Astrovirus evolution and emergence. Infect Genet Evol. 2019;69 :30–37. doi: 10.1016/j.meegid.2019.01.009 30639546
16 Hata A , Kitajima M , Haramoto E , Lee S , Ihara M , Gerba CP , et al . Next-generation amplicon sequencing identifies genetically diverse human astroviruses, including recombinant strains, in environmental waters. Sci Rep. 2018:8 . doi: 10.1038/s41598-018-30217-y 30087387
17 Boujon CL , Koch MC , Wüthrich D , Werder S , Jakupovic D , Bruggmann R , et al . Indication of Cross-Species Transmission of Astrovirus Associated with Encephalitis in Sheep and Cattle. Emerg Infect Dis. 2017;23 :1604–1606. doi: 10.3201/eid2309.170168 28820378
18 Shi M , Lin XD , Chen X , Tian JH , Chen LJ , Li K , et al . The evolutionary history of vertebrate RNA viruses. Nature. 2018;556 :197–202. doi: 10.1038/s41586-018-0012-7 29618816
19 Roach SN , Langlois RA . Intra- and Cross-Species Transmission of Astroviruses. Viruses. 2021:13 . doi: 10.3390/v13061127 34208242
20 Geigenmüller U , Ginzton NH , Matsui SM . Construction of a genome-length cDNA clone for human astrovirus serotype 1 and synthesis of infectious RNA transcripts. J Virol. 1997;71 :1713–1717. doi: 10.1128/JVI.71.2.1713-1717.1997 8995706
21 Sandoval-Jaime C , Guzmán-Ruiz L , López S , Arias CF . Development of a novel DNA based reverse genetic system for classic human astroviruses. Virology. 2019;535 :130–135.31299489
22 Sandoval-Jaime C. Astrovirus reverse genetics systems, a story of success. Curr Opin Virol. 2020;44 :57–65. doi: 10.1016/j.coviro.2020.06.009 32683123
23 Zhang R , Lan J , Li H , Chen J , Yang Y , Lin S , et al . A novel method to rescue and culture duck Astrovirus type 1 in vitro. Virol J. 2019;16 . doi: 10.1186/s12985-019-1218-5 31488178
24 Qin Y , Fang Q , Liu H , Ji C , Chen Y , Ouyang K , et al . Construction of a reverse genetic system for porcine astrovirus. Arch Virol. 2018;163 :1511–1518. doi: 10.1007/s00705-018-3771-4 29450743
25 Barranco C. The first live attenuated vaccines. Nature Research 2021. 2020. Available from: https://www.nature.com/articles/d42859-020-00008-5 (accessed 2023 Apr 12).
26 Plotkin SA , Plotkin SL . The development of vaccines: how the past led to the future. Nat Rev Microbiol. 2011;9 (12 ):889–893. doi: 10.1038/nrmicro2668 21963800
27 Plotkin S. History of vaccination. Proc Natl Acad Sci U S A. 2014;111 :12283–12287. doi: 10.1073/pnas.1400472111 25136134
28 Dolan PT , Whitfield ZJ , Andino R . Mechanisms and Concepts in RNA Virus Population Dynamics and Evolution. Annu Rev Virol. 2018; 5 :69–92. doi: 10.1146/annurev-virology-101416-041718 30048219
29 Manzoni TB , López CB . Defective (interfering) viral genomes re-explored: impact on antiviral immunity and virus persistence. Future Virol. 2018;13 :493–503.30245734
30 Velázquez-Moctezuma R , Baños-Lara Mdel R , Acevedo Y , Méndez E . Alternative cell lines to improve the rescue of infectious human astrovirus from a cDNA clone. J Virol Methods. 2012;179 :295–302. doi: 10.1016/j.jviromet.2011.11.005 22115787
31 Fernandopulle MS , Prestil R , Grunseich C , Wang C , Gan L , Ward ME . Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Curr Protoc Cell Biol. 2018:79. doi: 10.1002/cpcb.51 29924488
32 Arias C , DuBois R . The Astrovirus Capsid: A Review. Viruses. 2017;9 :15. doi: 10.3390/v9010015 28106836
33 Li F , Leier A , Liu Q , Wang Y , Xiang D , Akutsu T , et al . Procleave: Predicting Protease-specific Substrate Cleavage Sites by Combining Sequence and Structural Information. Genomics Proteomics Bioinformatics. 2020;18 :52–64. doi: 10.1016/j.gpb.2019.08.002 32413515
34 Holtz LR , Wylie KM , Sodergren E , Jiang Y , Franz CJ , Weinstock GM , et al . Astrovirus MLB2 viremia in febrile child. Emerg Infect Dis. 2011;17 :2050–2052. doi: 10.3201/eid1711.110496 22099095
35 Reuter G , Pankovics P , Boros Á . Nonsuppurative (Aseptic) Meningoencephalomyelitis Associated with Neurovirulent Astrovirus Infections in Humans and Animals. Clin Microbiol Rev. 2018:31 . doi: 10.1128/CMR.00040-18 30158300
36 Janowski AB , Klein RS , Wang D . Differential in vitro infection of neural cells by astroviruses. mBio. 2019;10 . doi: 10.1128/mBio.01455-19 31289185
37 Aguilera-Flores C , López T , Zamudio F , Sandoval-Jaime C , Pérez EI , López S , et al . The Capsid Precursor Protein of Astrovirus VA1 Is Proteolytically Processed Intracellularly. J Virol. 2022:96 . doi: 10.1128/jvi.00665-22 35762760
38 Wang Y , Luo W , Reiser G . Trypsin and trypsin-like proteases in the brain: proteolysis and cellular functions. Cell Mol Life Sci. 2008;65 :237–252. doi: 10.1007/s00018-007-7288-3 17965832
39 Koukou G , Niendorf S , Hornei B , Schlump JU , Jenke AC , Jacobsen S . Human astrovirus infection associated with encephalitis in an immunocompetent child: a case report. J Med Case Rep. 2019:13 . doi: 10.1186/S13256-019-2302-6 31757225
40 Wunderli W , Meerbach A , Guengoer T , Berger C , Greiner O , Caduff R , et al . Astrovirus infection in hospitalized infants with severe combined immunodeficiency after allogeneic hematopoietic stem cell transplantation. PLoS ONE. 2011:6 . doi: 10.1371/journal.pone.0027483 22096580
41 Hallengard D , Kakoulidou M , Lulla A , Kummerer BM , Johansson DX , Mutso M , et al . Novel attenuated Chikungunya vaccine candidates elicit protective immunity in C57BL/6 mice. J Virol. 2014;88 :2858–2866. doi: 10.1128/JVI.03453-13 24371047
42 Durbin AP , Karron RA , Sun W , Vaughn DW , Reynolds MJ , Perreault JR , et al . Attenuation and immunogenicity in humans of a live dengue virus type-4 vaccine candidate with a 30 nucleotide deletion in its 3’-untranslated region. Am J Trop Med Hyg. 2001;65 :405–413. doi: 10.4269/ajtmh.2001.65.405 11716091
43 Johnson BA , Xie X , Bailey AL , Kalveram B , Lokugamage KG , Muruato A et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature. 2021;591 (7849 ):293–299. doi: 10.1038/s41586-021-03237-4 33494095
44 Te YM , Bujaki E , Dolan PT , Smith M , Wahid R , Konz J , et al . Engineering the Live-Attenuated Polio Vaccine to Prevent Reversion to Virulence. Cell Host Microbe. 2020;27 :736–751.e8. doi: 10.1016/j.chom.2020.04.003 32330425
45 Lanahan MR , Maples RW , Pfeiffer JK . Tradeoffs for a viral mutant with enhanced replication speed. Proc Natl Acad Sci U S A. 2021:118 . doi: 10.1073/pnas.2105288118 34282021
46 Bouzalas IG , Wüthrich D , Walland J , Drögemüller C , Zurbriggen A , Vandevelde M , et al . Neurotropic astrovirus in cattle with nonsuppurative encephalitis in Europe. J Clin Microbiol. 2014;52 :3318–3324. doi: 10.1128/JCM.01195-14 24989603
47 Blomström AL , Widén F , Hammer AS , Belák S , Berg M . Detection of a novel astrovirus in brain tissue of mink suffering from shaking mink syndrome by use of viral metagenomics. J Clin Microbiol. 2010;48 :4392–4396. doi: 10.1128/JCM.01040-10 20926705
48 Zhong J , Gastaminza P , Cheng G , Kapadia S , Kato T , Burton DR , et al . Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci U S A. 2005;102 :9294–9299. doi: 10.1073/pnas.0503596102 15939869
49 Mathews DH , Disney MD , Childs JL , Schroeder SJ , Zuker M , Turner DH . Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc Natl Acad Sci U S A. 2004;101 :7287–7292. doi: 10.1073/pnas.0401799101 15123812
