
==== Front
BMC Infect Dis
BMC Infect Dis
BMC Infectious Diseases
1471-2334
BioMed Central London

39245731
9793
10.1186/s12879-024-09793-0
Research
Diarrhoeagenic Escherichia coli associated with childhood diarrhoea in Osun state, Nigeria
Olayinka Ademola A. olayinkaademolaa@gmail.com

1
Oginni-Falajiki Ibukunoluwa O. 1
Okeke Iruka N. 2
Aboderin Aaron O. 13
1 https://ror.org/04snhqa82 grid.10824.3f 0000 0001 2183 9444 Department of Medical Microbiology and Parasitology, College of Health Sciences, Obafemi Awolowo University, Ile-Ife, Osun Nigeria
2 https://ror.org/03wx2rr30 grid.9582.6 0000 0004 1794 5983 Department of Pharmaceutical Microbiology, Faculty of Pharmacy, University of Ibadan, Ibadan, Nigeria
3 https://ror.org/05bkbs460 grid.459853.6 0000 0000 9364 4761 Department of Medical Microbiology and Parasitology, Obafemi Awolowo University Teaching Hospitals Complex, Ile-Ife, Nigeria
8 9 2024
8 9 2024
2024
24 92825 4 2024
22 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Introduction

Diarrhoea is a major public health concern in developing countries, usually exacerbated by poor water, sanitation and hygiene but its aetiology is under-studied, particularly away from capital cities. We identified diarrhoeagenic Escherichia coli (DEC) from stools collected in Ile-Ife and Ilesa, Osun state, Nigeria and determined their antibiotic resistance profiles.

Methods

Stool samples from 167 children with diarrhoea and 334 controls under the age of 5 years were cultured for Escherichia coli and Salmonella. Bacterial isolates were identified biochemically and DEC were identified by PCR. Antimicrobial susceptibility testing was by modified Kirby-Bauer disc diffusion method in accordance with the CLSI guidelines. Data were analyzed using Chi-square and Fisher’s exact tests.

Result

Diarrhoea infection is significantly high among children under 12 months (p = 0.002), caregivers without at least primary school education (p = 0.006), breastfeeding for under 6 months (p˂0.001), and caregivers who were siblings (p = 0.004). DEC was detected in 69(41.3%) cases but only 86(25.7%) controls (p < 0.001) and more commonly recovered during the wet season (p < 0.001). Enterotoxigenic E. coli (p = 0.031), enteropathogenic E. coli (p = 0.031) and Shiga-toxin-producing E. coli (p = 0.044) were recovered more commonly from cases than controls. DEC from patients with diarrhoea were commonly resistant to sulphonamides (91.3%), trimethoprim (82.6%), and ampicillin (78.3%) but were largely susceptible to quinolones and carbapenems (97.1%).

Conclusion

Enteropathogenic, enterotoxigenic and Shiga toxin-producing E. coli are associated with diarrhoea in our setting, and show considerable resistance to first-line antimicrobials. Risk factors for DEC diarrhoea include infancy, inadequate breastfeeding and caregivers with education below primary school.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-024-09793-0.

Keywords

Antimicrobial resistance
Diarrhoea
Diarrhoeagenic Escherichia coli
African Research Leader’s AwardMR/L00464X/1 United Kingdom Department for International Development (DFID) under the MRC/DFID Concordat agreement and is also part of the EDCTP2 program supported by the European Union. I. N. O. is a Calestous Juma Fellow supported by the Bill and Melinda Gates FoundationINV-036234 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Globally, diarrhoeal diseases are the second biggest cause of mortality for children under the age of five, accounting for one in nine child fatalities [1]. In resource-limited countries, Nigeria inclusive, diarrhoeal diseases are a major cause of morbidity [2–4] and diarrhoeagenic Escherichia coli (DEC) make an important but uncommonly qualified contribution to the problem [5]. The epidemiological significance of different DEC categories in childhood diarrhoea varies from one geographical area to another, and there are important regional differences in the prevalence of the different categories of DEC over time and seasons. In spite of these differences, few studies have been carried out in Africa to investigate the burden of the pathogens [4, 6–8].

Materials and methods

Study population

A total of 501 children aged between 0 and 60 months were recruited between October, 2016 and October, 2017 from primary, secondary, and tertiary hospitals (Enuwa Primary Health Center, Oke-Ogbo State Hospital Ile-Ife, Wesley Guild Hospital Ilesa, and Obafemi Awolowo University Teaching Hospitals Complex Ile-Ife) in Osun State, Nigeria, with a case and control proportion ratio of 1:2. This was calculated from Kelsey et al. [9] formula; \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$n=\left(\frac{r+1}{r}\right) \frac{(\bar{p})(1-\bar{p})\left(Z_\beta+Z_{\alpha / 2}\right)^2}{\left(p_1-p_2\right)^2}$$\end{document}{where n= Sample size, Zα/2=0.84 (for 80% power), Zβ=1.96 (for 0.05 significance level), r= 2, p1= proportion exposed in the control group 24.9% Onanuga et al. [6], p2= Prevalence of DEC 37.1% Okeke et al. [7], with a 10% attrition rate}. Diarrhoea cases were children less than 5 years old that experienced three or more loose stools within 24-hours, while controls were children without diarrhoea visiting the same healthcare facility during the study period.

Specimen collection and processing

Using clean, sterile, and leak-proof universal bottles, fresh stool samples were collected from diarrhoea children (under five-year-olds) as well as age-matched, apparently healthy counterparts. All fresh stool samples of participants were inoculated into Selenite F broth, and on Eosin Methylene Blue agar and MacConkey agar plates (Oxoid Ltd., Hampshire, England) and incubated aerobically for 24 h at 37ºC. Following aseptic sub-culturing from Selenite F broth, plates of Salmonella Shigella Agar (SSA) were incubated aerobically at 37ºC for 24 h. Up to five distinct lactose-fermenting colonies were aseptically picked from Eosin Methylene Blue agar and MacConkey agar plates, streaked on Nutrient Agar (Oxoid Ltd., Basingstoke, Hampshire, England) and incubated aerobically at 37ºC for 24 h [10] and archived in a glycerol broth and stored in a freezer at -80°. The isolates were identified by conventional tube biochemical tests and confirmed with Microbact™ 24E identification kit (Oxoid Ltd., Basingstoke Hampshire, England). E. coli ATCC 25,922 served as the control strain.

Antimicrobial susceptibility testing

Antibiotic susceptibility testing against thirteen antimicrobials was performed using the modified Kirby-Bauer disc diffusion technique, following the guidelines set by the Clinical Laboratory Standards Institute [11]. The discs tested were ampicillin (10 µg), streptomycin (10 µg), trimethoprim (5 µg), tetracycline (30 µg), Nalidixic acid (30 µg), chloramphenicol (30 µg), ciprofloxacin (5 µg), sulphonamide (300 µg), cefotaxime (30 µg), ceftazidime (30 µg), cefoxitin (30 µg), amoxicillin-clavulanate (20/10µg) and ertapenem (10 µg) (Oxoid Ltd., Basingstoke Hampshire, England). E. coli ATCC 25,922 served as the control strain.

Detection of diarrhoeagenic E. coli virulence gene

DNA extraction was done using the Wizard Genomic DNA extraction Kit (Promega Corporation, Madison, USA) in accordance to manufacturer’s protocol [12] using aseptic precautions. A multiplex polymerase chain reaction (PCR) technique was used to screen all Escherichia coli for specific diarrhoea determinant genes [13]. The Multiplex PCR was grouped into PCR 1, PCR 2 and PCR 3 [13, 14]. Multiplex PCR assay 1 utilised three primer pairs and detected the presence of eae (Typical EPEC, atypical EPEC and EHEC are positive), bfpA (Only typical EPEC are positive, and target of CVD432 (typical EAEC are positive). Detection of ETEC, EHEC, STEC, EIEC and Shige PCR assay 2 used five primer pairs and detected the presence of LT and ST genes (ETEC are positive for one or both), stx1, stx2 (EHEC, STEC and Shigella dysentriae type 1 are positive for one or both), and ipaH (Shigella and EIEC are positive), generating PCR products of distinct sizes which were easily distinguished after agarose gel electrophoresis as presented in Table 1 [13]. PCR2 by Aranda et al. [13] seeks five targets. Two of these targets (180 bp) and (190 bp) are very close in size. To overcome the potential of failing to discriminate them in some reactions, in our laboratory, we have separated PCR2 into two reactions leaving us with PCR 3 [13], to detect ipaH (EIEC and Shigella), LT and ST (ETEC); PCR4 detects shiga-toxin 1 and 2 (STEC and EHEC).

Table 1 List of PCR primers and positive controls used [13, 14]

DEC	Primer designation	Primer (5´ to 3´)	Target gene or probe	Amplicon size (bp)	Positive Control	
EPEC	eae1	CTGAACGGCGATTACGCGAA	eae	917	E2348/69	
	eae2	CCAGACGATACGATCCAG				
	bfp1	AATGGTGCTTGCGCTTGCTGC	bfpA	326	E2348/69	
	bfp2	GCCGCTTTATCCAACCTGGTA				
EAEC	CVD432-1	CTGGCGAAAGACTGTATCAT	CVD432	630	17 − 2	
	CVD432-2	CAATGTATAGAAATCCGCTGTT				
ETEC	LT f	GGCGACAGATTATACCGTGC	LT	450	H10407	
	LT r	CGGTCTCTATATTCCCTGTT				
	ST f	ATTTTTMTTTCTGTATTRTCTT	ST	190	H10407	
	ST r	CACCCGGTACARGCAGGATT				
EIEC	ipaH1	GTTCCTTGACCGCCTTTCCGATACCGTC	ipaH	600	E137	
	ipaH2	GCCGGTCAGCCACCCTCTGAGAGTAC				
STEC/EHEC	stx1f	ATAAATCGCCATTCGTTGACTAC	stx1	244	EDL933	
	stx1r	AGAACGCCCACTGAGATCATC				
	stx2f	GGCACTGTCTGAAACTGCTCC	Stx2	190	EDL933	
	stx2r	TCGCCAGTTATCTGACATTCTG				
EPEC- enteropathogenic E. coli EHEC-enterohaemorrhagic E. coli; EAEC-enteroaggregative E. coli ETEC- enterotoxigenic E. coli; EIEC – enteroinvasive E. coli STEC-shiga-toxin-producing E-coli

Data analysis

Bivariate analysis of categorical variables was conducted using the Chi-Square test in Epi Info™ to evaluate the association between variables. When the expected frequency in any category was less than five, Fisher’s exact test was applied. Inferences were made based on the computed percentage positivity, 95% confidence intervals, and p-values. The level of significance was set at p˂ 0.05.

Results

A total of 501 children under the age of five were recruited over the study period (167 cases and 334 controls). Among the diarrhoea cases; there were 38 (22.8%) infants (less than 12 months), with 82 (49.1%) females and 85 (50.9%) males. As presented in Table 2, age < 12 months (38 [49%]), ϰ²(1) = 9.839, p = 0.002); caregivers with education below primary school (40 [46%]), ϰ²(1) = 7.574, p = 0.006); duration of breastfeeding < 6 months (21 [75%]), ϰ²(1) = 23.170, p < 0.001); and caregivers who were siblings (160 [78%]), ϰ²(1) = 8.146, p = 0.004), were significantly associated with diarrhoea.

Table 2 Demographic characteristics and risk factors of the samples used in the study

Socio-demographic parameters	Cases (N = 167)
n(%)	Controls (N = 334)
n(%)	Total (N = 501)
n(%)	χ2 (df)	p-value	
GENDER		1.603 (1)	0.205	
Male	85 (50.90)	150 (63.82)	235 (46.91)			
Female	82 (30.83)	184 (69.17)	266 (53.09)	
AGE (in months)		9.839 (1)	0.002*	
˂ 12 months	38 (48.72)	40 (51.28)	78 (15.57)	
˃ 12 months	129 (30.50)	294 (69.50)	423 (84.43)	
EDUCATION		7.574 (1)	0.006*	
Primary	40 (45.98)	47 (54.02)	87 (17.37)	
Secondary & Tertiary	127 (30.67)	287 (69.32)	414 (82.63)	
WATER SOURCE		2.318 (1)	0.128	
Well	83 (30.40)	190 (69.60)	273 (54.49)	
Tap/Treated water	84 (36.84)	144 (63.15)	228 (45.51)	
BREAST FEEDING DURATION		23.170 (1)	<0.001*	
6 months.	21 (12.60)	7 (25.00)	28 (5.59)			
6 months	146 (30.87)	327 (69.13)	473 (94.41)	
CARE-GIVER		8.146 (1)	0.004*	
Mother	160 (32.52)	332 (67.47)	492 (98.20)	
Sibling	7 (77.78)	2 (22.22)	9 (1.80)	
Total	167 (100.00)	334 (100.00)	501(100.00)	
N = 501; *p < 0.05 (i.e. Statistically Significant); ϰ2= Chi square

Despite enrichment, Salmonella spp. was not recovered from any specimen in the study. A total of 618 E. coli isolates were obtained from the specimens. Out of these, PCR identified 256 as DEC, which originated from 155 unique individuals: 69 from cases and 86 from controls. DEC was recovered significantly more in cases, (69 [41.3%]), ϰ²(1) = 12.630, p < 0.001). As shown in Table 3, the most commonly detected DEC pathotype was enterotoxigenic E. coli (ETEC), which was recovered from 49 cases and 69 controls. Most of these ETEC strains 77 (65.3%) harboured the ST gene, encoding heat stable enterotoxin. Enteropathogenic E. coli isolates were recovered from 22 individuals and seven of these instances were typical EPEC, carrying the bfpA gene. All the specific DEC pathotypes sought, except EAEC and EIEC occurred significantly more in cases than controls: ETEC (49 [41.5%]), ϰ²(1) = 4.662, p = 0.031); EPEC (12 [54.5%]), ϰ²(1) = 4.659, p = 0.031); and STEC (4 [80.0%]), FE = 0.044, p = 0.044), as presented in Table 3.

Table 3 Occurrence of pathotypes of DEC in cases and controls

DEC	Target gene	No (%) of Participants	Statistical test (df)	p- value	
Cases (N=167)
n (%)	Controls (N=334)
n (%)	
ETEC		49 (41.5)	69 (58.5)	ϰ2(1)=4.662	0.031*	
	LT	7 (36.8)	12 (63.1)			
	ST	36 (46.8)	41 (53.3)			
	LT & ST	6 (22.3)	16 (72.7)			
EIEC (ipaH)		4 (50.0)	4 (50.0)	FE=0.257	0.450	
EPEC		12 (54.5)	10 (45.5)	ϰ2(1)=4.659	0.031*	
	bfp+	3 (42.9)	4 (57.1)			
	bfp-	9 (60.0)	6 (40.0)			
EAEC (CVD432)		0 (0.0)	2 (100.0)	FE=0.444	0.554	
STEC		4 (80.0)	1 (20.0)	FE=0.044	0.044*	
	stx1	2 (66.7)	1 (33.3)			
	stx2	1 (100.0)	0 (0.0)			
	stx1 & stx2	1 (100.0)	0 (0.0)			
Total DEC		69 (44.5)	86 (55.5)	ϰ2(1)=12.630	<0.001*	
*p<0.05 (i.e. Statistically Significant; FE= Fisher’s Exact

EPEC- enteropathogenic E. coli; EAEC-enteroaggregative E. coli; EIEC – enteroinvasive E. coli; EHEC-enterohaemorrhagic E. coli; ETEC- enterotoxigenic E. coli; STEC-shiga-toxin-producing E-coli

Seasonal variation was observed in the occurrence of DEC in terms of number and pathotypes. The rate of recovery of DEC strains from children with diarrhoea was significantly higher in the wet season (March to October) (65 [94.2%]) in contrast to the dry season (4; 5.8%) (p < 0.001) as presented in Fig. 1.

Fig. 1 Seasonal variations of DEC in cases and controls in the study year

Table 4 shows that among the diarrhoeal cases, there was high rates of resistance of the isolated DEC to commonly prescribed antibiotics, namely sulphonamide (63; 91.3%), trimethoprim (57; 82.6%), ampicillin (54; 78.3%) and tetracycline (40; 58.0%). By contrast, resistance to quinolones and carbapenems was uncommon (2.9%).

Table 4 Antimicrobial Resistance Profile of DEC samples

Antibiotics	EIEC (N = 8)	ETEC (N = 118)	EPEC (N = 22)	EAEC (N = 2)	STEC (N = 5)	TOTAL DEC(N = 155)	p-value	
Case n = 4(%)	Control n = 4(%)	Case n = 49(%)	Control n = 69(%)	Case n = 12(%)	Control n = 10(%)	Control n = 2(%)	Case n = 4(%)	Control n = 1(%)	Case n = 69(%)	Control n = 86(%)	
Sulphonamide	2(50.0)	1(25.0)	45(91.8)	36(52.2)	12(100.0)	0(0.0)	2(100.0)	4(100.0)	1(100.0)	63(91.3)	40(46.5)	< 0.001	
Trimethoprim	0(0.0)	1(25.0)	42(85.7)	8(11.6)	11(91.7)	0(0.0)	1(50.0)	4(100.0)	1(100.0)	57(82.6)	11(12.8)	< 0.001	
Ampicillin	0(0.0)	1(25.0)	40(81.6)	26(52.2)	10(83.3)	8(80.0)	1(50.0)	4(100.0)	0(0.0)	54(78.3)	35(40.7)	< 0.001	
Tetracycline	0(0.0)	0(0.0)	29(59.2)	21(30.4)	8(66.7)	0(0.0)	1(50.0)	3(75.0)	1(100.0)	40(57.9)	21(24.4)	< 0.001	
Amoxicillin-clavulanic acid	0(0.0)	1(25.0)	18(36.7)	15(21.7)	9(75.0)	8(80.0)	0(0.0)	3(75.0)	1(100.0)	30(43.5)	25(29.1)	0.007	
Streptomycin	0(0.0)	0(0.0)	12(24.5)	13(18.8)	5(41.7)	0(0.0)	0(0.0)	3(75.0)	0(0.0)	20(28.9)	14(11.6)	0.078	
Cefotaxime	0(0.0)	1(25.0)	10(20.4)	7(10.1)	6(50.0)	5(50.0)	1(50.0)	3(75.0)	0(0.0)	20(28.9)	14(11.6)	0.078	
Ceftazidime	0(0.0)	1(25.0)	9(18.4)	6(8.7)	4(33.3)	3(30.0)	0(0.0)	1(25.0)	0(0.0)	14(20.3)	10(11.6)	0.181	
Cefoxitin	0(0.0)	1(25.0)	4(8.1)	6(8.7)	4(41.7)	1(10.0)	0(0.0)	1(25.0)	0(0.0)	10(21.7)	8(3.4)	0.327	
Chloramphenicol	0(0.0)	0(0.0)	3(6.1)	2(2.9)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	3(4.3)	2(2.3)	0.656	
Ertapenem	0(0.0)	0(0.0)	2(4.1)	2(2.9)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	2(2.9)	2(2.3)	1.000	
Nalidixic acid	0(0.0)	0(0.0)	2(4.1)	1(1.4)	1(8.3)	1(10.0)	0(0.0)	0(0.0)	0(0.0)	2(2.9)	1(1.2)	0.586	
Ciprofloxacin	0(0.0)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	0(0.0)	1(50.0)	2(50.0)	0(0.0)	2(2.9)	1(1.2)	0.586	
*EAEC cases = 0

Discussion

Diarrhoeagenic Escherichia coli strains are pathogens of great public health importance, affecting both adults and children worldwide, but are infrequently sought because molecular or tissue culture methods are required to delineate them from commensals [6, 14]. While rotavirus often takes center stage as a leading cause of childhood diarrhoea, particularly in Africa, DEC strains, especially ETEC, EAEC, and EPEC, can contribute significantly to the overall burden [5, 14, 15]. The epidemiological significance of each DEC pathotypes in childhood diarrhoea varies from one geographical area to another [5]. Also, there are important regional differences in the prevalence of the different categories of DEC over time and seasons [5, 8, 14–18]. The prevalence of three DEC categories (ETEC, EAEC, and EPEC), was significantly higher in cases than in the controls (p˂0 001). Similar outcomes have also been reported in western (Ghana and Nigeria) [6, 19, 20] and south-eastern Africa (Mozambique) [21]. The fact that DEC was recovered from 23.7% of the controls in this study area shows that healthy children, who might act as reservoirs for transmission and/or suffer long term consequences of colonization [22], also harbour these pathogens. In this study, the five common pathotypes of E. coli—ETEC, EIEC, EPEC, EAEC, and STEC were identified; where ETEC, EPEC and STEC were significantly recovered more in diarrhoea cases than controls. This is consistent with the findings of other researchers from other developing countries, where the frequencies of recovery of ETEC [21, 23–25], EPEC [21], and STEC [23] were significantly higher in the cases than in the controls. Enterotoxigenic Escherichia coli (ETEC)-associated diarrhoea has been reported by many studies as the most common bacterial diarrhoea affecting children under 5 years old living in developing countries, as well as travellers to these countries [26]. In this study, ETEC was the most prevalent DEC pathotype, among both cases and controls, and was significantly associated with diarrhoea. This figure was comparable to findings from many [23, 27–29], but not all [6, 30, 31] other resource-limited countries. In addition, in a study on DEC among children with and without diarrhoea in Burkina Faso by Bonkoungou et al., ETEC was highly significantly associated with diarrhoea [32]. Altogether, reviews on DEC in sub-Saharan Africa stated that ETEC is associated with infantile diarrhoea in African countries and also the most common cause of acute diarrhoea [5, 33].

As in other studies, DEC were most predominantly recovered from children under one year of age [14, 8, 20, 25, 34, 35]. This age group represents a particularly vulnerable population to DEC infections due to factors such as immature immune systems and increased susceptibility to environmental pathogens [7, 14, 36]. Additionally, our study highlighted the significance of inadequate breastfeeding (less than 6 months) as another notable risk factor for DEC infection. This is comparable to what Ali et al. [37] and Akinlabi et al. [38] observed in northern and southwestern Nigeria. Breastfeeding provides infants with essential nutrients and antibodies that bolster their immune defences against infections, including DEC-related ones [14, 36–38]. Therefore, the absence or early cessation of breastfeeding may leave infants more susceptible to diarrhoeal illnesses, including those caused by DEC. Our finding and similar reports from elsewhere emphasize the importance of promoting exclusive breastfeeding for the first six months of life as an infectious diarrhoea prevention measure [38, 39].

Our study revealed a significant association between caregivers with a limited educational background and DEC infection. This finding underscores the multifactorial nature of diarrhoeal illnesses in children, highlighting the impact of socioeconomic factors on disease transmission [39, 40]. Caregivers with lower levels of education may have limited access to health education and resources, leading to suboptimal hygiene practices and increased susceptibility to DEC contamination in the household environment [39–41]. Our study also identified caregivers who are siblings as being associated with DEC infection among children. This suggests the potential contribution of intra-familial transmission routes in DEC spread. Siblings may facilitate close contact and shared exposure to contaminated environments, thereby increasing the risk of transmission within households [42].

This study revealed a seasonal variation in the prevalence of DEC infection in the environment. When compared to the dry season, the overall prevalence of DEC was shown to be significantly higher in the rainy season (p < 0.001). The peak prevalence of DEC (ETEC and EPEC) was observed in August, which is regarded as one of the months with the most rainfall in the study area, and is characterized by the contamination of surface waterways by sewage spills, faeces spills, and other waste spills. This finding is consistent with earlier research on the seasonal variation of DEC infection, including those by Onanuga et al., Tumwine et al., and El Metwally et al. [6, 43, 44].

Antimicrobial drug resistance in bacteria that cause diarrhoeal disease is a serious and growing problem [45]. Antimicrobials are not indicated for the treatment of most childhood diarrhoea diseases [46] but should be administered to children with invasive or protracted infections. Moreover, resistance in enteric isolates provides a picture of the gut reservoir of resistance genes, which can be transmitted to enteric organisms causing infections in other niches [14].

This study revealed high rates of antibiotic resistance among different DEC categories, in particular, resistance to sulphonamide, trimethoprim, amoxicillin clavulanic-acid, streptomycin, ampicillin and tetracycline, probably as a result of its increased availability of multiple generic formulations in the markets [8, 47] but also because mobile genes encoding resistance to these antimicrobials are often linked and transmitted together [14]. Substandard oral drugs, which are common in our setting [6, 14], often fail to be fully absorbed, leaving behind enough drug in the intestine to select for resistant enteric bacteria [48, 49]. Notably, the DEC isolates in this study remained susceptible to quinolones and carbapenems, highlighting the importance of preserving these critically-important antibiotics for severe infections [50]. Salmonella spp. was not recovered in this study despite enrichment and have been found uncommon in childhood diarrhoea studies performed in or close to our study area [6, 14, 38, 51]. As with some of those studies, we additionally did not identify any Shigella or many EIEC.

This study has several limitations. To begin with, controls were not time-matched with cases, possibly introducing temporal confounding. Secondly, only 1–2 isolates per specimen were screened for DEC by PCR. This limited screening might have affected our results, as typically screening 3–5 colonies can increase the yield of DEC, especially in children without diarrhoea who often carry multiple E. coli lineages. Akinlabi et al. [51] recently reported that the Aranda et al. [13] multiplex PCR protocol, which they compared with whole genome sequencing, had suboptimal sensitivity and specificity for certain DEC lineages that are common elsewhere in south western Nigeria. As we did not also identify DEC by whole genome sequencing, the degree to which this might affect our results is unclear. These limitations notwithstanding, the data point to a high incidence of DEC infections and a strong association with diarrhoea for multiple pathotypes. This highlights the need for more in-depth investigations using predictive tools in this study area, as well as further study of the isolates we obtained.

Conclusion

This study shows that DEC, particularly ETEC, EPEC, and STEC are important diarrhoeagenic agents in Ile-Ife and Ilesa, Nigeria. These findings highlight the need for routine surveillance and focused tool development against diarrhoeal disease. The prevalence of ETEC and EPEC, especially during the wet season, underscores the need for routine surveillance and targeted interventions to curb their spread. Notably, the study identified crucial risk factors like infancy, inadequate breast feeding and caregivers with education below primary school, emphasizing the importance of strengthening public health programs that promote optimal infant feeding practices, hygiene education, and safe water access. Furthermore, the substantial antibiotic resistance observed among DEC isolates necessitates the judicious use of antimicrobials and the exploration of alternative treatment strategies. By delving deeper into the specific virulence factors of prevalent DEC pathotypes and their environmental interactions, future research can pave the way for the development of effective diagnostics, and targeted interventions. This study not only contributes valuable knowledge to the fight against childhood diarrhoeal disease in Nigeria but also serves as a springboard for further research efforts aimed at protecting the health and well-being of vulnerable children, particularly those under five years of age, globally.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

We thank Dr. Olabisi C. Akinlabi for helpful suggestions and staff of the health facilities for assistance with enrolling and caring for participants.

Author contributions

AOA and INO conceived this study and came up with the adapted methodology. AAO and IOO carried out the sample collection and performed the experiments. AAO and IOO carried out the data analysis and wrote the manuscript. AAO prepared all the tables and figures with the guidance of AOA and INO. Grants for this research are obtained by INO. All authors read and approved the final manuscript.

Funding

This work was supported by African Research Leader’s Award MR/L00464X/1 (to I. N. O.), which was jointly funded by the United Kingdom Medical Research Council (MRC) and the United Kingdom Department for International Development (DFID) under the MRC/DFID Concordat agreement and is also part of the EDCTP2 program supported by the European Union. I. N. O. is a Calestous Juma Fellow supported by the Bill and Melinda Gates Foundation (Grant no. INV-036234).

Data availability

The datasets used during the current study are available from the corresponding author (olayinkaademolaa@gmail.com) upon reasonable request.

Declarations

Ethics approval and consent to participate

The study was approved by the ethics committee of the Obafemi Awolowo University Teaching Hospitals Complex, Ile-Ife (IRB/IEC/0004553; NHREC/27/02/2009a) and the University of Ibadan/University College Hospital ethics committee (UI/EC/15/0093). Parents or guardians of the children gave written informed consent and filled out a questionnaire to provide demographic data and the breastfeeding pattern for each child.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

E. coli Escherichia coli

DEC Diarrhoeagenic E. coli

CLSI Clinical Laboratory Standard Institute

EPEC Enteropathogenic Escherichia coli

ETEC Enterotoxigenic Escherichia coli

EIEC Enteroinvasive Escherichia coli

EAEC Enteroaggregative Escherichia coli

EHEC / STEC Enterohemorrhagic (Shiga toxin- producing) Escherichia coli

DAEC Diffusely adherent Escherichia coli

STEC Shiga toxin producing E. coli

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. World Health Organization. (2023). Diarrhoeal disease. Retrieved January 21, 2023, from https://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease
2. Mokomane M Kasvosve I de Melo E Pernica JM Goldfarb DM The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management Therapeutic Adv Infect Disease 2018 5 1 29 43 10.1177/2049936117744429
Mokomane M, Kasvosve I, de Melo E, Pernica JM, Goldfarb DM. The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. Therapeutic Adv Infect Disease. 2018;5(1):29–43.10.1177/2049936117744429
3. UNICEF. (2020). Under five mortality. http://data.unicef.org/topic/child-survival/under-five-mortality/
4. Ugboko HU, Nwinyi OC, Oranusi SU, Fagbeminiyi FF. (2021). Risk factors of diarrhoea among children under five years in Southwest Nigeria. Int J Microbiol pp. 1–9.
5. Kotloff KL Nasrin D Blackwelder WC Wu Y Farag T Panchalingham S Sow SO Sur D Zaidi AKM Faruque ASG Saha D Alonso PL Tamboura B Sanogo D Onwuchekwa U Manna B Ramamurthy T Kanungo S Ahmed S Qureshi S Levine MM The incidence, aetiology, and adverse clinical consequences of less severe diarrhoeal episodes among infants and children residing in low-income and middle-income countries: a 12-month case-control study as a follow-on to the global enteric Multicenter Study (GEMS) Lancet Global Health 2019 7 5 e568 84 10.1016/S2214-109X(19)30076-2 31000128
Kotloff KL, Nasrin D, Blackwelder WC, Wu Y, Farag T, Panchalingham S, Sow SO, Sur D, Zaidi AKM, Faruque ASG, Saha D, Alonso PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T, Kanungo S, Ahmed S, Qureshi S, Levine MM. The incidence, aetiology, and adverse clinical consequences of less severe diarrhoeal episodes among infants and children residing in low-income and middle-income countries: a 12-month case-control study as a follow-on to the global enteric Multicenter Study (GEMS). Lancet Global Health. 2019;7(5):e568–84.31000128 10.1016/S2214-109X(19)30076-2
6. Onanuga A Igbeneghu O Lamikanra A A study of the prevalence of diarrhoeagenic Escherichia coli in children from Gwagwalada, Federal Capital, Nigeria Pan Afr Med J 2014 17 146 10.11604/pamj.2014.17.146.3369 25379115
Onanuga A, Igbeneghu O, Lamikanra A. A study of the prevalence of diarrhoeagenic Escherichia coli in children from Gwagwalada, Federal Capital, Nigeria. Pan Afr Med J. 2014;17:146.25379115 10.11604/pamj.2014.17.146.3369
7. Okeke IN Lamikanra A Steinruck H Kaper JB Characterization of Escherichia coli strains from cases of childhood diarrhoea in provincial southwestern Nigeria J Clin Microbiol 2000 38 7 12 10.1128/JCM.38.1.7-12.2000 10618054
Okeke IN, Lamikanra A, Steinruck H, Kaper JB. Characterization of Escherichia coli strains from cases of childhood diarrhoea in provincial southwestern Nigeria. J Clin Microbiol. 2000;38:7–12.10618054 10.1128/JCM.38.1.7-12.2000
8. Opintan JA Newman MJ Arhin RE Donkor ES Laboratory- based nationwide surveillance of antimicrobial resistance in Ghana Infect Drug Resist 2015 54 191
Opintan JA, Newman MJ, Arhin RE, Donkor ES. Laboratory- based nationwide surveillance of antimicrobial resistance in Ghana. Infect Drug Resist. 2015;54:191.
9. Kelsey JL Whittemore AS Evans AS Thompson WD Kelsey JL Whittemore AS Evans AS Thompson WD Methods of sampling and estimation of sample size Methods in Observational Epidemiology 1996 New York Oxford University Press
Kelsey JL, Whittemore AS, Evans AS, Thompson WD. Methods of sampling and estimation of sample size. In: Kelsey JL, Whittemore AS, Evans AS, Thompson WD, editors. Methods in Observational Epidemiology. New York: Oxford University Press; 1996.
10. Okeke I Ojo O Lamikanra A Kaper J Etiology of acute diarrhoea in adults in southwestern, Nigeria J Clin Microbiol 2003 41 4525 30 10.1128/JCM.41.10.4525-4530.2003 14532177
Okeke I, Ojo O, Lamikanra A, Kaper J. Etiology of acute diarrhoea in adults in southwestern, Nigeria. J Clin Microbiol. 2003;41:4525–30.14532177 10.1128/JCM.41.10.4525-4530.2003
11. Clinical and Laboratory Standards Institute (CLSI). (2024). Supplement M100: Performance Standards for Antimicrobial Susceptibility Testing. (L. L. Kristy and M. Laura, editors; 34th ed.).
12. Promega Corporation Wizard genomic DNA purification kit Technical Manual 2019 Madison, WI Promega Corporation
Promega Corporation. Wizard genomic DNA purification kit Technical Manual. Madison, WI: Promega Corporation; 2019.
13. Aranda K Fagundes-Neto U Scaletsky I Evaluation of multiplex PCRs for diagnosis of infection with diarrhoeagenic Escherichia coli and Shigella spp J Clin Microbiol 2004 42 5849 53 10.1128/JCM.42.12.5849-5853.2004 15583323
Aranda K, Fagundes-Neto U, Scaletsky I. Evaluation of multiplex PCRs for diagnosis of infection with diarrhoeagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42:5849–53.15583323 10.1128/JCM.42.12.5849-5853.2004
14. Odetoyin BW Hofmann J Aboderin AO Okeke IN Diarrhoeagenic Escherichia coli in mother-child pairs in Ile-Ife, South Western Nigeria BMC Infect Disease 2015 16 28 10.1186/s12879-016-1365-x
Odetoyin BW, Hofmann J, Aboderin AO, Okeke IN. Diarrhoeagenic Escherichia coli in mother-child pairs in Ile-Ife, South Western Nigeria. BMC Infect Disease. 2015;16:28.10.1186/s12879-016-1365-x
15. Rolande M Mabika RM Liabagui SL Moundounga HK Mounioko F Souza A Yala JF Molecular prevalence and Epidemiological Characteristics of Diarrhoeagenic E. Coli in Children under 5 Years Old in the City of Koula-Moutou, East-Central Gabon Open J Med Microbiol 2021 11 157 75 10.4236/ojmm.2021.113013
Rolande M, Mabika RM, Liabagui SL, Moundounga HK, Mounioko F, Souza A, Yala JF. Molecular prevalence and Epidemiological Characteristics of Diarrhoeagenic E. Coli in Children under 5 Years Old in the City of Koula-Moutou, East-Central Gabon. Open J Med Microbiol. 2021;11:157–75.10.4236/ojmm.2021.113013
16. Ugboko HU, Nwinyi OC, Oranusi SU, Oyewale JO. (2020). Childhood diarrhoeal diseases in developing countries. Heliyon. 13;6(4):e03690.
17. Acosta GJ Vigo NI Durand D Riveros M Arango S Zambruni M Ochoa TJ Diarrhoeagenic Escherichia coli: prevalence and pathotype distribution in children from Peruvian Rural communities Am J Trop Med Hyg 2016 95 3 574 9 10.4269/ajtmh.16-0220 27382080
Acosta GJ, Vigo NI, Durand D, Riveros M, Arango S, Zambruni M, Ochoa TJ. Diarrhoeagenic Escherichia coli: prevalence and pathotype distribution in children from Peruvian Rural communities. Am J Trop Med Hyg. 2016;95(3):574–9.27382080 10.4269/ajtmh.16-0220
18. Ifeanyi CI Ikeneche NF Bassey BE Al-Gallas N Ben-Aissa R Boudabous A Diarrheagenic Escherichia coli pathotypes isolated from children with diarrhea in the Federal Capital Territory Abuja. Nigeria J Infect Developing Ctries 2015 19 2 165 74 10.3855/jidc.5528
Ifeanyi CI, Ikeneche NF, Bassey BE, Al-Gallas N, Ben-Aissa R, Boudabous A. Diarrheagenic Escherichia coli pathotypes isolated from children with diarrhea in the Federal Capital Territory Abuja. Nigeria. J Infect Developing Ctries. 2015;19(2):165–74.10.3855/jidc.5528
19. Addy PAK Antepim G Frimpong EH Prevalence of pathogenic Escherichia coli and parasites in infants with diarrhoea in Kumasi, Ghana East Afr Med J 2004 81 7 353 7 10.4314/eamj.v81i7.9190 15490707
Addy PAK, Antepim G, Frimpong EH. Prevalence of pathogenic Escherichia coli and parasites in infants with diarrhoea in Kumasi, Ghana. East Afr Med J. 2004;81(7):353–7.15490707 10.4314/eamj.v81i7.9190
20. Saka HK Dabo NT Muhammad B García-Soto S Ugarte-Ruiz M Alvarez J Diarrheagenic Escherichia coli Pathotypes from children younger than 5 years in Kano State, Nigeria Front Public Health 2019 7 348 10.3389/fpubh.2019.00348 31828054
Saka HK, Dabo NT, Muhammad B, García-Soto S, Ugarte-Ruiz M, Alvarez J. Diarrheagenic Escherichia coli Pathotypes from children younger than 5 years in Kano State, Nigeria. Front Public Health. 2019;7:348.31828054 10.3389/fpubh.2019.00348
21. Rappelli P Folgosa E Solinas ML Pathogenic enteric Escherichia coli in children with and without diarrhoea in Maputo, Mozambique FEMS Immunol Med Microbiol 2005 43 1 67 72 10.1016/j.femsim.2004.07.006 15607638
Rappelli P, Folgosa E, Solinas ML. Pathogenic enteric Escherichia coli in children with and without diarrhoea in Maputo, Mozambique. FEMS Immunol Med Microbiol. 2005;43(1):67–72.15607638 10.1016/j.femsim.2004.07.006
22. Kaper JB, Nataro JP, Mobley HL. (2004). Pathogenic Escherichia coli. Nature Reviews Microbiology. (2004) 2:123–40. 10.1038
23. Haghi F Zeighami H Hajiahmadi F Khoshvaght H Bayat M Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran J Med Microbiol 2014 63 427 32 10.1099/jmm.0.064600-0 24281909
Haghi F, Zeighami H, Hajiahmadi F, Khoshvaght H, Bayat M. Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran. J Med Microbiol. 2014;63:427–32.24281909 10.1099/jmm.0.064600-0
24. Vilchez S Reyes D Paniagua M Bucardo F Möllby R Weintraub A Prevalence of diarrhoeagenic Escherichia coli in children from León, Nicaragua J Med Microbiol 2009 58 630 7 10.1099/jmm.0.007369-0 19369525
Vilchez S, Reyes D, Paniagua M, Bucardo F, Möllby R, Weintraub A. Prevalence of diarrhoeagenic Escherichia coli in children from León, Nicaragua. J Med Microbiol. 2009;58:630–7.19369525 10.1099/jmm.0.007369-0
25. Prah I Ayibieke A Nguyen TTH Iguchi A Mahazu S Sato W Hayashi T Yamaoka S Suzuki T Iwanaga S Ablordey A Saito R Virulence profiles of Diarrheagenic Escherichia coli isolated from the Western Region of Ghana Jpn J Infect Dis 2020 24 2 115 21 10.7883/yoken.JJID.2020.356
Prah I, Ayibieke A, Nguyen TTH, Iguchi A, Mahazu S, Sato W, Hayashi T, Yamaoka S, Suzuki T, Iwanaga S, Ablordey A, Saito R. Virulence profiles of Diarrheagenic Escherichia coli isolated from the Western Region of Ghana. Jpn J Infect Dis. 2020;24(2):115–21.10.7883/yoken.JJID.2020.356
26. Levine MM Kotloff KL Nataro JP Muhsen K The global enteric Multicenter Study (GEMS): impetus, rationale, and genesis Clin Infect Disease 2012 55 Suppl 4 S215 24 10.1093/cid/cis761 23169934
Levine MM, Kotloff KL, Nataro JP, Muhsen K. The global enteric Multicenter Study (GEMS): impetus, rationale, and genesis. Clin Infect Disease. 2012;55(Suppl 4):S215–24.23169934 10.1093/cid/cis761
27. Okoh AI Osode AN Enterotoxigenic Escherichia coli (ETEC): a recurring decimal in infants’ and travelers’ diarrhoea Rev Environ Health 2008 23 135 48 10.1515/REVEH.2008.23.2.135 18763541
Okoh AI, Osode AN. Enterotoxigenic Escherichia coli (ETEC): a recurring decimal in infants’ and travelers’ diarrhoea. Rev Environ Health. 2008;23:135–48.18763541 10.1515/REVEH.2008.23.2.135
28. Qadri F Ahmed A Tarique A Begum T Svennerholm AM Disease burden due to enterotoxigenic Escherichia coli in the first 2 years of life in an urban community in Bangladesh Infect Immunol 2007 75 8 3961 8 10.1128/IAI.00459-07 17548483
Qadri F, Ahmed A, Tarique A, Begum T, A. and, Svennerholm AM. Disease burden due to enterotoxigenic Escherichia coli in the first 2 years of life in an urban community in Bangladesh. Infect Immunol. 2007;75(8):3961–8.17548483 10.1128/IAI.00459-07
29. Moyo SJ Maselle SY Matee MI Langeland N Mylvaganam H Identification of diarrhoeagenic Escherichia coli isolated from infants and children in Dares Salaam, Tanzania BioMed Cent Infect Disease 2007 7 92 10.1186/1471-2334-7-92
Moyo SJ, Maselle SY, Matee MI, Langeland N, Mylvaganam H. Identification of diarrhoeagenic Escherichia coli isolated from infants and children in Dares Salaam, Tanzania. BioMed Cent Infect Disease. 2007;7:92.10.1186/1471-2334-7-92
30. Khairy RMM Fathy ZA Mahrous DM Mohamed ES Abdelrahim SS Prevalence, phylogeny, and antimicrobial resistance of Escherichia coli pathotypes isolated from children less than 5 years old with community acquired- diarrhoea in Upper Egypt BMC Infect Dis 2020 1:20 1 908 10.1186/s12879-020-05664-6 33256619
Khairy RMM, Fathy ZA, Mahrous DM, Mohamed ES, Abdelrahim SS. Prevalence, phylogeny, and antimicrobial resistance of Escherichia coli pathotypes isolated from children less than 5 years old with community acquired- diarrhoea in Upper Egypt. BMC Infect Dis. 2020;1:20(1):908.33256619 10.1186/s12879-020-05664-6
31. Zhou Y Zhu X Hou H Lu Y Yu J Mao L Mao L Sun Z Characteristics of diarrhoeagenic Escherichia coli among children under 5 years of age with acute diarrhoea: a hospital-based study BMC Infect Dis 2018 1:18 1 63 10.1186/s12879-017-2936-1
Zhou Y, Zhu X, Hou H, Lu Y, Yu J, Mao L, Mao L, Sun Z. Characteristics of diarrhoeagenic Escherichia coli among children under 5 years of age with acute diarrhoea: a hospital-based study. BMC Infect Dis. 2018;1:18(1):63.10.1186/s12879-017-2936-1
32. Bonkoungou IJO Lienemann T Martikainen O Dembele R Sanou I Traore AS Siitonen A Barro N Haukka K Diarrhoeagenic Escherichia coli detected by 16-plex PCR in children with and without diarrhoea in Burkina Faso Clin Microbiol Infect 2012 18 9 10.1111/j.1469-0691.2011.03675.x 23137134
Bonkoungou IJO, Lienemann T, Martikainen O, Dembele R, Sanou I, Traore AS, Siitonen A, Barro N, Haukka K. Diarrhoeagenic Escherichia coli detected by 16-plex PCR in children with and without diarrhoea in Burkina Faso. Clin Microbiol Infect. 2012;18:9.23137134 10.1111/j.1469-0691.2011.03675.x
33. Okeke IN Diarrhoeagenic Escherichia coli in sub-saharan Africa: status, uncertainties and necessities J Infect Developing Ctries 2009 3 11 817 42 10.3855/jidc.586
Okeke IN. Diarrhoeagenic Escherichia coli in sub-saharan Africa: status, uncertainties and necessities. J Infect Developing Ctries. 2009;3(11):817–42.10.3855/jidc.586
34. Agho KE Ezeh OK Ghimire PR Uchechukwu OL Stevens GJ Tannous WK Fleming C Ogbo FA Global Maternal and Child Health Research collaboration (GloMACH). Exclusive Breastfeeding Rates and Associated Factors in 13 Economic Community of West African States (ECOWAS) Countries Nutrients 2019 11 12 3007 10.3390/nu11123007 31818035
Agho KE, Ezeh OK, Ghimire PR, Uchechukwu OL, Stevens GJ, Tannous WK, Fleming C, Ogbo FA. Global Maternal and Child Health Research collaboration (GloMACH). Exclusive Breastfeeding Rates and Associated Factors in 13 Economic Community of West African States (ECOWAS) Countries. Nutrients. 2019;11(12):3007.31818035 10.3390/nu11123007
35. Acosta GJ Vigo NI Durand D Riveros M Arango S Zambruni M Ochoa TJ Diarrhoeagenic Escherichia coli: prevalence and pathotype distribution in children from Peruvian Rural communities Am J Trop Med Hyg 2016 7 3 574 9 10.4269/ajtmh.16-0220
Acosta GJ, Vigo NI, Durand D, Riveros M, Arango S, Zambruni M, Ochoa TJ. Diarrhoeagenic Escherichia coli: prevalence and pathotype distribution in children from Peruvian Rural communities. Am J Trop Med Hyg. 2016;7(3):574–9.10.4269/ajtmh.16-0220
36. Egbontan AE Ojo OA Jacob SJ Prevalence of Diarrhoea causing microorganisms among children that are exclusively breastfed and those on Weaning Foods Pac J Sci Technol 2013 14 1 334 41
Egbontan AE, Ojo OA, Jacob SJ. Prevalence of Diarrhoea causing microorganisms among children that are exclusively breastfed and those on Weaning Foods. Pac J Sci Technol. 2013;14(1):334–41.
37. Ali M, Ahmed I, Yusha’u M, Shehu AA. (2023). Prevalence of Diarrhoea and Risk Associated factors among children under 5 years in Kano, North-western Nigeria. Archives Pharm Pharmacol Res. 3(3).
38. Akinlabi OC, Nwoko EQ, Dada RA, Ekpo S, Omotuyi A, Nwimo CC, et al. Epidemiology and risk factors for diarrheagenic escherichia coli carriage among children in Northern Ibadan, Nigeria. Am J Trop Med Hyg. 2023;109(6):1223–32.
39. Duche RT Amali O Umeh EU Bacterial contamination of children’s Weaning foods in Asase, North Bank, Makurdi Int J Sci Eng Res 2013 4 8 2184 225
Duche RT, Amali O, Umeh EU. Bacterial contamination of children’s Weaning foods in Asase, North Bank, Makurdi. Int J Sci Eng Res. 2013;4(8):2184–225.
40. Das R Palit P Haque MA Ahmed T Faruque ASG Association between Pathogenic Variants of Diarrhoeagenic Escherichia coli and Growth in Children under 5 years of age in the global enteric Multicenter Study Am J Trop Med Hyg 2022 6 1071 72 81 10.4269/ajtmh.22-0096
Das R, Palit P, Haque MA, Ahmed T, Faruque ASG. Association between Pathogenic Variants of Diarrhoeagenic Escherichia coli and Growth in Children under 5 years of age in the global enteric Multicenter Study. Am J Trop Med Hyg. 2022;6(1071):72–81.10.4269/ajtmh.22-0096
41. GebreSilasie YM Tullu KD Yeshanew AG Resistance pattern and maternal knowledge, attitude and practices of suspected Diarrhoeagenic Escherichia coli among children under 5 years of age in Addis Ababa, Ethiopia: cross sectional study Antimicrob Resist Infect Control 2018 7 110 10.1186/s13756-018-0402-5 30214719
GebreSilasie YM, Tullu KD, Yeshanew AG. Resistance pattern and maternal knowledge, attitude and practices of suspected Diarrhoeagenic Escherichia coli among children under 5 years of age in Addis Ababa, Ethiopia: cross sectional study. Antimicrob Resist Infect Control. 2018;7:110.30214719 10.1186/s13756-018-0402-5
42. Mattioli MC Boehm AB Davis J Harris AR Mrisho M Enteric Pathogens in Stored Drinking Water and on Caregiver’s hands in Tanzanian households with and without reported cases of child diarrhoea PLoS ONE 2014 9 1 e84939 10.1371/journal.pone.0084939 24392161
Mattioli MC, Boehm AB, Davis J, Harris AR, Mrisho M. Enteric Pathogens in Stored Drinking Water and on Caregiver’s hands in Tanzanian households with and without reported cases of child diarrhoea. PLoS ONE. 2014;9(1):e84939.24392161 10.1371/journal.pone.0084939
43. Tumwine JK Thompson J Katua-Katua M Mujwajuzi M Johnstone N Porras I Diarrhoea and effects of different water sources, sanitation and hygiene behaviour in East Africa Trop Med Int Health 2002 7 9 750 6 10.1046/j.1365-3156.2002.00927.x 12225505
Tumwine JK, Thompson J, Katua-Katua M, Mujwajuzi M, Johnstone N, Porras I. Diarrhoea and effects of different water sources, sanitation and hygiene behaviour in East Africa. Trop Med Int Health. 2002;7(9):750–6.12225505 10.1046/j.1365-3156.2002.00927.x
44. El Metwally HAR Ibrahim HAH El-Athamna MN Amer MA Multiplex PCR for detection of Diarrheagenic Escherichia coli in Egyptian Children J Med Sci 2007 7 2 255 62 10.3923/jms.2007.255.262
El Metwally HAR, Ibrahim HAH, El-Athamna MN, Amer MA. Multiplex PCR for detection of Diarrheagenic Escherichia coli in Egyptian Children. J Med Sci. 2007;7(2):255–62.10.3923/jms.2007.255.262
45. WHO (World Health Organisation). (2020). Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. In World Health Organization (pp. 1–7).
46. Bruzzese E Giannattasio A Guarino A Antibiotic treatment of acute gastroenteritis in children F1000Research 2018 15 7
Bruzzese E, Giannattasio A, Guarino A. Antibiotic treatment of acute gastroenteritis in children. F1000Research. 2018;15:7.
47. Von Baum H Marre R Antimicrobial resistance of Escherichia coli and therapeutic implications Int J Med Microbiol 2005 295 503 11 10.1016/j.ijmm.2005.07.002 16238024
Von Baum H, Marre R. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int J Med Microbiol. 2005;295:503–11.16238024 10.1016/j.ijmm.2005.07.002
48. Cavany S Nanyonga S Hauk C The uncertain role of substandard and falsified medicines in the emergence and spread of antimicrobial resistance Nat Commun 2023 14 6153 10.1038/s41467-023-41542-w 37788991
Cavany S, Nanyonga S, Hauk C. The uncertain role of substandard and falsified medicines in the emergence and spread of antimicrobial resistance. Nat Commun. 2023;14:6153.37788991 10.1038/s41467-023-41542-w
49. Holmes AH Moore LS Sundsfjord A Steinbakk M Regmi S Karkey A Guerin PJ Piddock LJ Understanding the mechanisms and drivers of antimicrobial resistance Lancet 2016 387 176 87 10.1016/S0140-6736(15)00473-0 26603922
Holmes AH, Moore LS, Sundsfjord A, Steinbakk M, Regmi S, Karkey A, Guerin PJ, Piddock LJ. Understanding the mechanisms and drivers of antimicrobial resistance. Lancet. 2016;387:176–87.26603922 10.1016/S0140-6736(15)00473-0
50. Antimicrobial Resistance Collaborators Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis Lancet 2022 399 629 55 10.1016/S0140-6736(21)02724-0 35065702
Antimicrobial Resistance Collaborators. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022;399:629–55.35065702 10.1016/S0140-6736(21)02724-0
51. Akinlabi OC Dada RA Nwoko EQA Okeke IN PCR diagnostics are insufficient for the detection of Diarrhoeagenic Escherichia coli in Ibadan, Nigeria PLOS Global Public Health 2023 7 8 e0001539 10.1371/journal.pgph.0001539
Akinlabi OC, Dada RA, Nwoko EQA, Okeke IN. PCR diagnostics are insufficient for the detection of Diarrhoeagenic Escherichia coli in Ibadan, Nigeria. PLOS Global Public Health. 2023;7(8):e0001539.10.1371/journal.pgph.0001539
