
==== Front
Biol Res
Biol Res
Biological Research
0716-9760
0717-6287
BioMed Central London

544
10.1186/s40659-024-00544-8
Research Article
Mouse testicular macrophages can independently produce testosterone and are regulated by Cebpb
https://orcid.org/0000-0002-1161-1996
Duan Nengliang 1
Ran Yuanshuai 1
Wang Huapei 1
Luo Ya 1
Gao Zhixiang 1
Lu Xingyu 2
Cui Fengmei cuifengmei@suda.edu.cn

2
Chen Qiu happyqiu@suda.edu.cn

2
Xue Boxin xueboxin1992@suda.edu.cn

1
http://orcid.org/0009-0004-5457-885X
Liu Xiaolong liuxiaolong2005@suda.edu.cn

1
1 https://ror.org/02xjrkt08 grid.452666.5 0000 0004 1762 8363 Department of Urology, The Second Affiliated Hospital of Soochow University, NO.1055 SanXiang Road, Suzhou, Jiangsu Province 215000 China
2 https://ror.org/05kvm7n82 grid.445078.a 0000 0001 2290 4690 State Key Laboratory of Radiation Medicine and Protection, School of Radiation Medicine and Protection, Medical College of Soochow University, Suzhou, China
9 9 2024
9 9 2024
2024
57 6429 4 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Testicular macrophages (TM) have long been recognized for their role in immune response within the testicular environment. However, their involvement in steroid hormone synthesis, particularly testosterone, has not been fully elucidated. This study aims to explore the capability of TM to synthesize and secrete testosterone de novo and to investigate the regulatory mechanisms involved.

Results

Transcriptomic analysis revealed significant expression of Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 in TM, which are key enzymes in the testosterone synthesis pathway. qPCR analysis and immunofluorescence validation confirmed the autonomous capability of TM to synthesize testosterone. Ablation of TM in mice resulted in decreased physiological testosterone levels, underscoring the significance of TM in maintaining testicular testosterone levels. Additionally, the study also demonstrated that Cebpb regulates the expression of these crucial genes, thereby modulating testosterone synthesis.

Conclusions

This research establishes that TM possess the autonomous capacity to synthesize and secrete testosterone, contributing significantly to testicular testosterone levels. The transcription factor Cebpb plays a crucial role in this process by regulating the expression of key genes involved in testosterone synthesis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40659-024-00544-8.

Keywords

Testicular macrophage
Testosterone
De novo synthesis
Cebpb
Youth Excellence Projects of CNNCCNNC-2020 Occupational health research project in Jiangsu ProvinceNo. JSZJ20233201 Youth Excellence Projects of Suzhou HealthNo. GSWS2020031 Suzhou Science and Technology Bureau - Key clinical technologyNo. SKY2023004 Provincial and Ministerial Co-constructed Open Topics for the State Key Laboratory of Radiological Medicine and Radiation ProtectionGZK12023038 Suzhou City Key Core Technology Breakthrough - Social Development Project2023SS19 Suzhou Medical College Joint Project by Four PartiesML12301223 Suzhou City Basic Research Program - Key Clinical Technology ResearchSKY2023004 Jiangsu Province Occupational Health Research ProjectJSZJ20233201 Postgraduate Research & Practice Innovation Program of Jiangsu ProvinceKYCX24_3345 issue-copyright-statement© Sociedad de Biologia de Chile 2024
==== Body
pmcBackground

Testosterone is the primary sex steroid hormone and anabolic hormone in the male body, playing a crucial role in male sexual development, masculinization, and sperm production [1]. Additionally, it has significant effects on health for both males and females, including the regulation of libido, strength, immune function, hematopoietic function, and resistance to osteoporosis [2–5]. In the male body, it is known that, aside from a very small portion synthesized by the adrenal cortex zona reticularis, the majority of testosterone is synthesized by the Leydig cells within the testis [6]. During the developmental, two distinct populations of murine Leydig cells emerge sequentially. Fetal Leydig cells (FLC) appear shortly after the formation of testicular organs, producing androstenedione; subsequently, this androstenedione is converted into testosterone under the influence of Sertoli cells expressing Hsd17b3. Adult Leydig cells (ALC) arise in the pre-pubertal phase, possessing the capability to express Hsd17b3 and independently secrete testosterone [7]. After synthesis, testosterone is secreted into the bloodstream, maintaining male secondary sexual characteristics and functions. It also plays a vital role in promoting the development of germ cells into sperm and influencing the body’s synthetic metabolism. Disruption in testosterone synthesis can lead to a series of adverse consequences.

Research to date has indicated that the majority of white blood cells express steroid receptors, suggesting the possibility of direct regulation by steroids. Moreover, immune cells are not merely passive targets of steroid signal transduction; they represent a cell lineage closely associated with steroids. It has been reported that human alveolar macrophages, guinea pig alveolar macrophages, and human synovial macrophages actively participate in the metabolism and synthesis of sex steroid hormones [8–10]. Local steroid production in other tissues, such as the nervous system, has also been documented [11]. Interestingly, immune-related tissues also exhibit enzyme activity for steroid metabolism, with the intestine and lungs converting precursors into glucocorticoids during type 2 immune activation [12, 13].

In the testis, the primary immune cell population is macrophages, and these macrophages are closely linked to the function of Leydig cells. TM can assist testosterone production by generating 25-hydroxycholesterol, serving as a substrate for Leydig cells [14–17]. Interestingly, macrophages themselves also express the transcription factors required for steroid synthesis and can directly produce pregnenolone. This type of steroid may contribute to a local feedback loop between interstitial cells and macrophages, thereby regulating the production of testosterone [18]. Some studies also suggest that TM can produce a significant amount of corticosterone in vitro, although it remains unexplored whether this corticosterone is derived from the conversion of other steroids or synthesized de novo [19]. Therefore, it is essential to investigate whether TM possess steroidogenic capabilities and to what extent testicular function relies on the generation of these steroids.In this study, we propose that TM actively participate in the synthesis and secretion of testosterone de novo. Simultaneously, we have identified that this process within macrophages is regulated by the transcription factor Cebpb. The research provides a detailed demonstration of the scientific validity and importance of macrophages synthesis and secretion of testosterone. This is crucial for a comprehensive understanding of the intricate connection between immune regulation and sex steroid metabolism in the body.

Materials and methods

Animals

The mice used in the study were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All animals were housed in SPF-grade facilities at the Animal Experiment Management Center of Soochow University. The procurement and use of these experimental animals followed the guidelines for animal care at Soochow University, adhering to the standards of experimental animal management. Before euthanasia, approximately 0.4 ml of blood was collected from each mouse via cardiac puncture. The blood was then centrifuged at 4000 g for 15 min at 4 °C to collect the serum, which was subsequently stored at -80 °C.

Mouse testicular interstitial fluid (TIF) collection

TIF samples were bilaterally collected from the testis of each mouse following a method reported by Li X et al [20]. Briefly, the testes were immediately weighed and decapsulated after removal. They were then placed in HBSS in a proportion of 10 µL per milligram of testicular weight and shaken at 120 rpm for 5 min at room temperature to allow the interstitial fluid to be fully diluted in the HBSS solution. The suspension was then centrifuged at 300× g for 5 min at 4 °C, and the supernatant containing the TIF was stored at -80℃ before testosterone hormone testing. The tissue collected in the sediment was used for subsequent experiments.

Mouse testicular interstitial cell isolation

The tissue sediment from the previous step was immersed in 600 µL HBSS solution containing 0.25 mg/ml Type IV collagenase (Sigma) and shaken at 120 rpm at 37 °C for 15 min to dissociate interstitial cells from the seminiferous tubules. The suspension was passed through a 40 μm filter to remove seminiferous tubules and large cell clumps. The cell suspension was then centrifuged, and the sediment represented the interstitial cells. After washing twice with HBSS, the cells were prepared for subsequent experiments.

Isolation of primary TM

F4/80-positive macrophages were purified from the isolated testicular interstitial cells using MicroBeads conjugated to monoclonal anti-mouse F4/80 antibodies (Miltenyi Biotech, 130-110-443). The testicular single-cell suspension was magnetically labeled according to the protocol provided by Miltenyi Biotech to positively select intact cells expressing F4/80 protein. All cells were counted under a microscope.

Preparation of whole testis single cell suspension

The enzyme solution was prepared using HBSS, which includes 1 mg/mL Type IV collagenase (Sigma), 1 mg/mL DNase I (Sigma), and 1 mg/mL hyaluronidase (Sigma). After the removal of the tunica albuginea from the mouse testis, the tissues were minced into small pieces. Each testis was then digested with 3 mL of the enzyme solution at 37 °C. The specific steps were conducted according to the protocol provided by the GentleMACS Dissociator (Miltenyi Biotech): the solution containing tissue and enzymes was transferred to a GentleMACS C tube and placed in the Dissociator. Three consecutive mechanical dissociations were performed, followed by the collection of the cell suspension.

RNA extraction and gene expression analysis

Ribosomal RNA was removed from the samples using the NEBNext rRNA Depletion Kit (New England Biolabs, Massachusetts, USA). The NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, Massachusetts, USA) was employed for sequencing library construction. Quality control and quantification of the libraries were performed using the BioAnalyzer 2100 system (Agilent Technologies, USA), followed by 150-bp paired-end sequencing on the Illumina NovaSeq platform.

RNA sequencing

The raw data were obtained using the Illumina NovaSeq 6000 sequencing platform. Initially, quality control of the raw data was performed using Q30 values. Cutadapt (v1.9.3) was utilized to remove adapters and low-quality reads, generating high-quality clean reads [21]. The clean reads were aligned to the reference genome using hisat2 (v2.0.4) [22]. Subsequently, guided by the Ensembl GTF gene annotation file, cuffdiff software was employed to obtain the mRNA expression profile [23, 24].

Estimation of cell fractions

To conduct external validation, we gathered publicly annotated single-cell sequencing data from GSE112393 and used it as reference data. We utilized CIBERSORTx to estimate the relative cellular fractions of various testicular cells. This method is aimed at quantifying the relative proportions of different cell types in complex gene expression mixtures and has been extensively used for various diseases [25]. The single-cell expression matrix data were inputted into the CIBERSORTx website to compute Signature Genes. Subsequently, the data to be analyzed were inputted, and the relative cell proportions were calculated based on the reference expression characteristics of the genes.

Single-cell sequencing analysis and gene set correlation analysis

We selected sequencing data from interstitial cells in the testis from GSE112393 for dimensionality reduction and clustering. We defined Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 as the testosterone synthesis gene set, and Apoe, Adgre1, Cd68, Lyz2, and C1qa as the macrophage marker gene set. Utilizing the scMetabolism R package, we scored the expression of these two gene sets in each cell. We then performed a correlation analysis between the two gene sets. The results were displayed as scatter plots using the ggplot2 R package.

Flow cytometry, fluorescence-activated cell sorting (FACS) and cell culture

For cells necessitating identification and sorting, surface staining was immediately conducted post-acquisition using F4/80 antibody (Biolegend, 123120, 1:50), Cd45 (Ebioscience, 15045182, 1:50), Cd11b (Biolegend, 101208, 1:100), Cd68 (Biolegend, 137013, 1:100) and Ctrl Antibody (Biolegend, 400525, 1:50). This was followed by a 30-minute incubation in darkness. Subsequently, the cells underwent three PBS washes, were resuspended, and then tested and sorted on the SH800S automatic flow cell sorter (Sony, Japan). Data collected from this process were meticulously analyzed using FlowJo software. The sorted cells were used for RNA extraction and in vitro cell culture. Cells were cultured in DMEM/F12 medium (WISENT, 319 − 085) containing 100 units/mL of penicillin and 100 µg/mL of streptomycin (WISENT,450 − 201), 5% horse serum (Pricellar, 164215–100), and 2.5% fetal bovine serum (Muticell, 085–150), and placed in an incubator with 5% CO2.

RNA extraction and quantitative real-time PCR

Cells from both the directly collected samples and the cultured cells were collected and washed with PBS. Total RNA was extracted using the Total RNA Isolation kit (Vazyme Biotech, China). Reverse transcription was performed using HiScript III RT SuperMix (+ gDNA wiper) (Vazyme Biotech) according to the manufacturer’s instructions, utilizing 1 µg of RNA for cDNA synthesis. Quantitative PCR (qPCR) was conducted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech) for fluorescence quantification. Target gene expression levels were normalized to Rn18s as a reference gene. The primer sequences are shown in Table 1.

Table 1 Counts values of partial genes in 3 testicular macropage samples

Gene	Forward primer nucleotide sequence (5′→3′)	Reverse primer nucleotide sequence (5′→3′)	
Pecam1	CCAAAGCCAGTAGCATCATGGTC	GGATGGTGAAGTTGGCTACAGG	
Cd3e	GCTCCAGGATTTCTCGGAAGTC	ATGGCTACTGCTGTCAGGTCCA	
Mc2r	CCACAGTGCTCACCTTCACATC	TAGCATGGGAGCGGGCAAGTAA	
Nr2f2	CGCCGAGTATAGCTGCCTCAAG	CTGGCTCCTAACGTACTCTTCC	
Ddx4	GGACGAGATTTGATGGCTTGTGC	AGCGACTGGCAGTTATTCCATCC	
Sult1e1	CTTCCAGGAGATGAAGAACAATCC	GGAAGTGGTTCTTCCAGTCTCC	
Cd68	GGCGGTGGAATACAATGTGTCC	AGCAGGTCAAGGTGAACAGCTG	
Rn18s	AGGCGCGCAAATTACCCAATCC	GCCCTCCAATTGTTCCTCGTTAAG	
Hsd17b3	AAGACCGCCGATGAGTTTGT	TGCTGATGTTGCGTTTGAGG	
Cyp17a1	GCCCAAGTCAAAGACACCTAAT	GTACCCAGGCGAAGAGAATAGA	
Hsd3b1	GTATTCCGACCAGAAACCAAGG	GGCACACTTGCTTGAACACAG	
Cyp11a1	CGCTTTTCCTTTGAGTCCATC	TCTGGAGGCAGGTTGAGCAT	
Lhcgr	AATGGGACGACGCTAATCTCGC	TGAGCGTCTGAATGGACTCCAG	
Cyp11a1-CR	TAGCAGCGTTATTCTGTAGGCA	CACAACTGGTACTGTAAACCAAATC	
Hsd3b1-CR	TCTCCTTGATTCTCAGAATTCTTG	TCAGGGGCAGCTTCAAGGAT	
Cyp17a1-CR	GAGAGATGGCTCAAATGTAATAAAT	CAGGTAAAACACTCATGCCTATAAA	
Hsd17b3-CR	GTCTTCCTACTTCCACTTCTCG	CTCACTTTTAGACCATACTTTCCAG	

Agarose gel electrophoresis

Agarose powder was mixed with 1X TAE buffer and a one ten-thousandth concentration of GelRed to prepare a 3% agarose gel. DNA samples were mixed with 6× loading buffer (Takara). Five microliters of each sample were loaded into the wells. Electrophoresis was conducted at 80–100 V. DNA bands were observed and photographed under ultraviolet light.

Immunofluorescence

Primary macrophages were seeded in a 96-well plate with round coverslip. After 24 h, they were washed with PBS, and the adherent cells were fixed with 4% paraformaldehyde (PFA) for 15 min. Subsequently, they were incubated with anhydrous methanol on ice for 10 min. Prior to applying the primary antibody, the non-specific background was blocked with PBS containing 5% BSA. The primary antibody included: rabbit antibodies against Cyp11a1 (abcam, ab175408, 1:100), Cyp17a1 (proteintech, 14447-1-AP, 1:100), Hsd3b1 (abclonal, a8035, 1:100), Hsd17b3 (proteintech, 13415-1-AP, 1:100), Lhcgr (proteintech, 26424-1-AP, 1:100), Testosterone (Testo) (Biomatik, CAU27861, 1:100) and Rat antibody against F4/80 (BIORAD, MCA497G). The cells were incubated with the primary antibodies overnight at 4 °C. Alexa Fluor 488 conjugated anti-rabbit IgG (Jackson ImmunoResearch, 705-545-147) and Cy3 conjugated anti-rat IgG (Jackson ImmunoResearch, 112-166-143) were used as secondary antibodies. After incubating at room temperature for 2 h, DAPI (Sigma) was used for nuclear staining. After mounting with fluorescent mounting media, laser confocal microscope was used for observation.

Testosterone hormone analysis

The culture medium harvested from cell cultures, along with a control blank medium, collected mouse serum, and testicular interstitial fluid dissolved in HBSS, were all subjected to testosterone hormone analysis using chemiluminescence methods or targeted steroid hormone metabolomics techniques. The hormone concentration in the mouse testicular interstitial fluid was determined based on the concentration after dilution in HBSS solution.

Construction of testicular macrophage-depleted mouse model

To deplete macrophages in the testis of mice, adult wild-type C57BL/6J mice were treated with rat-derived InVivoMAb anti-mouse CSF1, following the methods described in the literature with slight modifications [26]. A total of 12 mice were randomly assigned to the depletion group (n = 6) and the control group (n = 6). Each mouse was injected with 200 µg of InVivoMAb anti-mouse CSF1 (Bio X Cell, clone 5A1) or InVivoMAb rat IgG1 isotype control (Bio X Cell, clone HRPN) every other day. Samples were collected after four consecutive treatments.

Tissue preparation and immunohistochemistry

Testis samples were fixed in modified Davidson’s solution or 4% formaldehyde solution and fixed overnight at room temperature [27]. After trimming and dehydration, the sample was embedded in paraffin and prepared into 4 μm sections for immunohistochemical staining. Slices were dewaxed in dimethylbenzene and treated with a series of decreasing concentrations of ethanol, followed by boiling in antigen retrieval solution for 100 s. The cooled slices were incubated with 3% H2O2 at room temperature for 15 min and blocked with 5% bovine serum for 1 h. The following antibodies were used for immunohistochemistry: rabbit antibodies against Sox9 (abcam, ab185966, 1:3000), Cyp17a1 (proteintech, 14447-1-AP, 1:150), Plzf (abclonal, A5863, 1:100) and Testosterone (Testo) (Biomatik, CAU27861, 1:100). The sections were incubated overnight at 4 °C. GTVisionTM III Detection System/Mo&Rb (Including DAB) Immunoassay Kit (Genetech, GK5007, China) is used for staining.

Prediction of transcription factor

The NCBI database (https://www.ncbi.nlm.nih.gov/) contains genomic sequence information for all genes. In this study, we retrieved the promoter region sequences of the four genes Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3. By analyzing these promoter regions, we identified potential transcription factors and their binding sites that may be associated with the regulation of these genes’ expression. The PROMO database (https://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3) was used to identify the putative binding sites of transcription factors in DNA sequences, assisting in predicting potential transcription factors [28, 29].

Transient transfection

Isolated primary TM were cultured in vitro for 2 h until the cells adhered to the surface. Subsequently, the culture medium was replaced, and siRNA targeting Cebpb was introduced into the cells using RNAiMAX transfection reagent (Invitrogen). Simultaneously, a plasmid overexpressing Cebpb was introduced into the cells using Entranster-H4000 transfection reagent (Engreen). After transfection for 24 h, the culture medium was changed, and the cells were further cultured for an additional 24 h. Finally, cell culture supernatants were collected and stored at -80 °C. The siRNA sequences used were as follows: SS sequence: CUGAGCGACGAGUACAAGA; AS sequence: UUGUACUCGUCGCUCAGCU.

CUT-RUN experiment

Rabbit anti-Cebpb (Genetex, GTX15050) and normal rabbit IgG (Millipore, PP648) were used in this experiment, with 3 × 10^5 freshly separated primary TM used for each experimental group. The experiment was conducted according to the recommended method of the Hyperactive pG-MNase CUT&RUN Assay Kit for PCR/qPCR (Vazyme Biotech, HD101). The amplified DNA fragments were subjected to gel electrophoresis in 3% agarose. The primer sequences are shown in Table 1; The primers for Spike in DNA are provided by the aforementioned kit.

Statistics

Statistical analysis was performed using Student’s t-test, one-way ANOVA followed by Dunnett’s or Tukey’s multiple comparison tests as appropriate. Significance was set at p < 0.05. Unless stated otherwise, values are presented as means ± SEM (*indicates p<0.05, **indicates p<0.01, ***indicates p<0.001, ****indicates p<0.0001, ns indicates no significance).

Result

Transcriptomics reveals the involvement of TM in de novo steroid synthesis

We successfully isolated TM from wild-type mice using F4/80 magnetic beads and subsequently performed transcriptomic sequencing on the harvested cells. The sequencing data revealed a marked expression of genes crucial for de novo testosterone synthesis, specifically Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 (Table 2) [30]. Typically, Cyp11a1 catalyzes the conversion of cholesterol into pregnenolone, which is then transformed into progesterone by Hsd3b1. This is followed by Cyp17a1 converting progesterone into androstenedione, and ultimately, Hsd17b3 synthesizes testosterone. This process mainly occurs in the Leydig cells of testis, and DHEA secreted by the adrenal glands can also participate in it (Fig. 1A).

Table 2 Counts values of partial genes in 3 testicular macropage samples

gene_name	Cyp11a1	Cyp17a1	Hsd3b1	Hsd17b3	
NC-1_count	4420.28	21632.9	4658.33	2652.68	
NC-2_count	5737.13	27157.2	6953.69	2258.94	
NC-3_count	5555.44	19088.9	4701.26	1629.81	
Note Counts refer to the number of sequencing reads aligned to each gene, indicating the level of gene expression. Higher counts suggest higher gene expression levels

Fig. 1 TM and Testosterone Synthesis Genes. A: A schematic representation of the complete pathway for de novo testosterone synthesis; B: A UMAP plot showing the distribution of different cell clusters in the testis, with each colored dot representing a cell; C: The estimated proportions of various cell types following deconvolution analysis of transcriptomic sequencing from three groups of TM; D: A scatter plot illustrating the correlation analysis results after scoring each cell for two gene sets; E: The results from targeted steroid hormone metabolomics revealed the levels of various steroid hormones in macrophage culture medium and in control blank culture medium

Employing the mouse testicular Drop-seq dataset by Green CD et al., in conjunction with CIBERSORTx for the deconvolution analysis of our sequencing data [31], we ascertained that approximately 70% of the cells identified in the transcriptomic sequencing were TM, while roughly 20% were Leydig cells (Fig. 1B, C). Consequently, this data might not comprehensively represent the authentic expression profile of these four genes specifically in macrophages.

Single-cell sequencing allows for higher-resolution detection of gene expression in tissue cells. However, the low sequencing depth characteristic of Drop-seq limited our ability to interpret the results accurately [32]. Alternatively, we used Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 as the Testosterone Synthesis Gene Set and Apoe, Adgre1, Cd68, Lyz2, and C1qa as the Macrophage Marker Gene Set. We conducted a correlation analysis between these two sets of genes to macroscopically examine the expression of testosterone synthesis genes in macrophages. The results suggest that a considerable proportion of macrophages can express the series of genes involved in testosterone synthesis (Fig. 1D). Additionally, we detected an extremely high concentration of testosterone in the culture medium of F4/80-positive TM (Fig. 1E).

Macrophages can autonomously synthesize and secrete testosterone

FACS is a highly sophisticated technique for purifying cell populations of interest, achieving a very high purity (95–100%) of the sorted population [33]. To investigate the macrophages within the testis, we collected interstitial cells from the testis of normal wild-type mice and stained them with an Alexa Fluor® 488 conjugated anti-mouse F4/80 antibody. Through the application of FACS techniques, we discovered that under the 488 nm wavelength laser channel, cells were divided into four groups, designated as L, O, N, and M groups (Fig. 2A). As reported, normal interstitial cells produce spontaneous fluorescence under 488 nm laser excitation, forming a separate group, namely Group N, while Groups L and O primarily consist of interstitial stem cells and germ cells, respectively [34]. Based on the marker genes of various testicular cells, we performed qPCR validation for cells in each group [35–37]. The results indicated that Group L contains a rich presence of T cells (Cd3e), endothelial cells (Pecam1), FLC (Mc2r), and Leydig stem cells (Nr2f2). Group O comprised FLC (Mc2r), germ cells (Ddx4), and Leydig stem cells (Nr2f2). Group N predominantly consists of ALC (Sult1e1), while Group M mainly contained TM (Cd68) (Fig. 2B). The macrophage content in Group M reached approximately 98% (Fig.S1). Among these, the ratio of the Group N to the Group M is approximately 3:2 (Fig. 2C).

Fig. 2 Sorting and Identification of TM and Adult Leydig Cells. A: Flow cytometry results of testicular interstitial cells following F4/80–488 staining; B: Quantitative PCR results for various marker genes in each cell group

We analyzed the mRNA levels of four genes and Lhcgr involved in testosterone synthesis in ALC (N group) and TM (M group). The results indicated significant expression of these genes in both cell types, but with higher expression levels in Leydig cells. Among these, Hsd17b3 and Lhcgr exhibited weaker expression in TM (Fig. 3A). At the protein level, immunofluorescence staining revealed that proteins Cyp11a1, Cyp17a1, Hsd3b1, Hsd17b3 and Lhcgr are all expressed in F4/80 positive cells (macrophages) (Fig. 3B). Furthermore, we used a testosterone hormone-specific fluorescent antibody for direct immunostaining of primary macrophages. This revealed a substantial presence of testosterone in the cytoplasm of TM, whereas testosterone was not detectable in peritoneal macrophages (Fig. 3C).

Fig. 3 Expression of Testosterone Synthesis Genes in TM. A: Comparison of mRNA expression levels of key genes and Lhcgr involved in testosterone synthesis in Adult Leydig cells and TM; B: Immunofluorescence images of the four key enzymes, Lhcgr, and the macrophage marker protein F4/80 in mouse TM. Scale bars, 5 μm; C: Immunofluorescence images of testosterone and F4/80 in mouse TM and peritoneal macrophages. Scale bars, 100 μm

Equal numbers of cells from groups O, N, and M were cultured in vitro for 24 h. We observed that the O group possessed only limited secretory capabilities, whereas TM from the M group were able to secrete testosterone at levels approximately one-third of those produced by the N group (ALC) (Fig. 4A). However, this secretory ability significantly decreased within 72 h and eventually ceased entirely (Fig. 4B). By tracking the expression changes of four key genes, we discovered that this loss of function was associated with the cessation of Cyp17a1 and Hsd17b3 expression (Fig. 4C).

Fig. 4 Quantification and Tracking of Testicular Macrophage Secretory Capability. A: Testosterone secretion levels in equal O, N, and M cell groups; B: Time-dependent changes in testosterone secretion by TM in vitro culture; C: Changes in mRNA levels of four key genes in macrophages at different culture times

Depletion of TM affects physiological testosterone levels in mice

To more directly evaluate the significance of autonomous testosterone production and secretion by TM, we ablated macrophages within the mouse testis using a CSF1 neutralizing antibody (Fig. 5A). Flow cytometry was used to verify the depletion efficiency: compared to the control group, the proportion of macrophages in the experimental group decreased from 2% to approximately 0.2%, indicating successful macrophage depletion (Fig. 5B). To assess whether this treatment affected other cells in the testicular tissue, we performed immunohistochemical staining for various cell marker proteins. The results demonstrated a modest increase in the number of spermatogonial stem cells (Plzf) in the short term (p < 0.01). In contrast, no statistically significant differences were observed in the counts of interstitial cells (Cyp17a1) and Sertoli cells (Sox9) before and after the treatment (p > 0.05) (Fig. 5C, D, E).

Fig. 5 Construction and Validation of Macrophage Depletion Mouse Model. A: Schematic diagram of the construction of the testicular macrophage depletion model in mice; B: Flow cytometry validation of the proportion of F4/80 positive cells in the total testis of macrophage-depleted mice compared to control mice; C, D, E, F: Immunohistochemical analysis showing changes in spermatogonial stem cells (Plzf), Interstitial cells (Cyp17a1), Sertoli cells (Sox9), and Testosterone after macrophage depletion, with bar graphs summarizing the results of the immunohistochemical analysis

In mice, the reduction of macrophages in the testis led to a notable phenotype characterized by the loss of whiskers (Fig. 6A). Additionally, there was a significant decrease in testosterone levels in both serum and TIF (p < 0.05) (Fig. 6B). Immunohistochemical examination of the testicular tissues showed that the staining intensity of testosterone was reduced by approximately 50% (Fig. 5F).

Fig. 6 Whiskers and Steroid Hormone Levels in Macrophage Depletion Mice. A: Whiskers of control group and macrophage depletion mice, indicated by arrows; B: Changes in testosterone levels in serum and testicular interstitial fluid

Cebpb regulates macrophage testosterone secretion

We used PROMO to predict the upstream transcription factors of a series of genes involved in testosterone synthesis and identified Cebpb as a potential regulatory factor (Fig. 7A, B). To determine the regulatory role of Cebpb in testosterone synthesis, plasmids overexpressing Cebpb and siRNAs targeting Cebpb were transfected into primary TM and the Leydig cell line MLTC-1, which also synthesize testosterone. The qPCR experiments showed that the transcription levels of Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 in both cell types synchronously increased or decreased with the upregulation or downregulation of Cebpb (Fig. 7C). Additionally, testosterone levels in the culture medium of TM and MLTC-1 cells significantly increased following Cebpb overexpression and decreased after Cebpb knockdown (Fig. 7D). CUT-RUN assays demonstrated the binding of Cebpb to the promoters of Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 in TM (Fig. 7E). Overall, our data suggest that Cebpb can regulate de novo synthesis of testosterone in TM by modulating the expression of these four key genes and can exert similar effects in MLTC-1 cells.

Fig. 7 Cebpb is an upstream regulator of testosterone secretion in TM. A: Network diagram showing all transcription factors predicted based on the four target genes, with the thickness of the arrows corresponding to the RE values; B: A schematic illustrating the binding sites of Cebpb with various gene promoter regions; C: Bar graphs showing the changes in relative mRNA expression levels of different genes in cells with overexpression and knockdown of Cebpb; D: Bar graphs depicting the variations in testosterone hormone secretion in two groups of cells following overexpression and knockdown of Cebpb; E: Agarose gel electrophoresis displaying the content of different gene 5` regulatory region fragments, with Spike in DNA serving as an internal control to ensure equal total DNA content in both groups

Discussion

For decades, the potential functions of TM have been extensively studied. They represent the second most abundant cell population in the testicular interstitium, with an average ratio of one macrophage to every eight Leydig cells [38]. Structurally, TM and Leydig cells are coupled through specialized membrane structures composed of microvilli from Leydig cells within the macrophage-coating vesicles, forming an essential structure for Leydig cell function [38]. Functionally, TM secrete 25-hydroxycholesterol, providing substrates for Leydig cell testosterone synthesis [39]. Multiple studies by Gaytan and colleagues have shown that in the absence of TM, Leydig cell proliferation, differentiation, and response to LH/hCG are significantly affected [14, 40, 41]。Cohen and Kmicikiewicz further confirmed that the in vivo depletion of TM reduces testosterone levels, while co-culturing Leydig cells with TM or directly using testicular macrophage-conditioned medium (TMCM) can significantly increase testosterone production [42–46]. Therefore, based on existing reports, it can be confirmed that TM play an important role in testosterone hormone synthesis. Research on the Leydig cell ablation model indicates that even after the loss of Leydig cells, the testes can still maintain a certain level of testosterone synthesis. This suggesting that other cells within the testes can produce testosterone [47, 48].Our study directly demonstrates that TM have the capacity to synthesize testosterone by detecting the expression of the testosterone synthesis pathway in TM.

Compared to traditional RNA sequencing (RNA-seq), single-cell RNA sequencing (scRNA-seq) offers a more accurate and extensive approach for depicting changes and mechanisms at the cellular level [49]. scRNA-seq allows us to explore gene expression in tissue cells with higher resolution. In single-cell studies of the testis, the expression of Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3 is typically confined to Leydig cells rather than TM [50–53]. However, some researchers, based on the adhesion characteristics of different cells, have isolated TM and discovered their innate ability to synthesize progesterone and express Cyp11a1 normally, consistent with the findings of our study [18]. This discrepancy between single-cell sequencing results and actual gene expression may be attributed to the inherent sensitivity limitations of single-cell sequencing, which may not fully capture the complete gene expression profile of macrophages [54].

To accurately investigate whether TM can autonomously synthesize testosterone de novo, a comprehensive validation from the genetic to the functional level is necessary. We discovered that TM are capable of expressing the key enzymes required for de novo synthesis of testosterone: Cyp11a1, Cyp17a1, Hsd3b1, Hsd17b3, and related receptors Lhcgr. Moreover, extremely high levels of testosterone were detectable both in the culture medium of TM and within the cytoplasm. Our findings suggest that the ratio of ALC to TM is approximately 3:2, with their secretory capacities in a 2:1 ratio under equal cell conditions, indicating that TM contribute significantly to testicular testosterone levels. Furthermore, we observed that TM lose the expression of Cyp17a1 and Hsd17b3 and the ability to secrete testosterone within 72 h of in vitro culture. A similar phenomenon is observed in other testicular cells. For instance, Pdgfr-α positive peritubular myoid cells gradually lose the expression of Cyp11, Hsd3b1, and Cyp17 within 7 days of culture, while rat ALC progressively lose the capability to synthesize testosterone within 5 days of in vitro culture [55, 56]. In the study by Gary R. Klinefelter et al., the amount of testosterone production by testicular Leydig cells decreases to 30–40% of the control group after 4 days of in vitro culture, with Cyp17a1 enzyme content at 39% of the control group; after 12 days, the enzyme content is only 12% of the control group [57]. This suggests that both testicular macrophages and Leydig cells cannot maintain long-term testosterone synthesis functions in vitro, indicating significant differences between in vitro and in vivo environments.

Similar to TM, Bidesh Mahata et al. discovered that T cells can synthesize pregnenolone de novo [58]. Milewich L et al. found that human alveolar macrophages can convert androstenedione to testosterone and other steroids through the catalytic activities of enzymes like 3β-HSD, 3α-HSD, 17β-HSD, and 5α-reductase. These steroidogenic enzymes are also present in porcine alveolar macrophages [59, 60]. Similarly, testosterone is converted into androstenedione and dihydrotestosterone in primary cultured human synovial macrophages [10, 61]. Additionally, in the presence of LPS, human monocyte-derived macrophages (but not monocytes) preferentially convert dehydroepiandrosterone into physiologically relevant amounts of downstream steroid hormones, including testosterone, androstenedione, estrone, and estradiol [62, 63]. These results collectively suggest that macrophages have the capability to generate and transform steroid hormones, and their functional roles may vary depending on the microenvironment and their state of differentiation.

CSF1 is a crucial cytokine that regulates the proliferation, differentiation, maturation, and survival of the mononuclear phagocyte system. Continuous CSF1R signaling is essential for maintaining the macrophage population in adult mice [64–67]. Blocking CSF1 action is a well-established method for depleting resident tissue macrophages in various organs. In our study, CSF1 neutralizing antibodies were used to reduce TM by approximately 90%, while avoiding effects on the number of Sertoli cells and Leydig cells. The unchanged area of Cyp17a1-positive cells is attributed to the fact that TM only constitute 1/9 of the interstitial cells, making their reduction unlikely to significantly affect the overall levels of the positive cell population. The short-term increase in spermatogonial stem cells may be related to the regulatory role of CSF1 and changes in the functional activities of macrophages [42, 66]. Moreover, following macrophage depletion, we observed a dramatic decline in testosterone levels both within the testis and in serum, which was accompanied by noticeable whisker loss in mice, closely related to the decrease in testosterone levels [68]. These findings underscore the critical role of TM in testosterone synthesis within the testis.

Transcription factors play a crucial role in regulating gene expression by binding to the promoter regions of target genes [69–71]. Through bioinformatics predictions, we identified potential binding sites for Cebpb in the promoter regions of Cyp11a1, Cyp17a1, Hsd3b1, and Hsd17b3. In this study, supported by bioinformatic analysis, qPCR, testosterone hormone secretion assays, and CUT-RUN, we have established that Cebpb can regulate the expression of these four genes within the testosterone synthesis pathway. Crucially, we verified that Cebpb directly influences testosterone secretion levels. Thus, Cebpb positively modulates the synthesis and secretion of testosterone in TM by regulating the transcription of genes involved in the testosterone synthesis pathway.

In summary, we have confirmed a groundbreaking discovery that TM are capable of secreting testosterone. Traditionally, TM were primarily considered effector cells in immune responses, responsible for clearing viruses, bacteria, and damaged cells [72]. Conversely, testosterone production was primarily attributed to Leydig cells. The revelation that macrophages can also produce testosterone indicates that their functions in the reproductive and endocrine systems extend beyond immune regulation. This discovery enhances our comprehension of hormonal regulation, suggesting that other cells, besides the well-established primary hormone-producing cells, can also influence hormone levels. It unveils a more intricate endocrine regulatory network within the human body. If the testosterone production by macrophages is related to certain diseases or physiological conditions, such as male infertility or other hormonal imbalances, targeting macrophages for treatment could become a new therapeutic strategy. Moreover, the development of new drugs targeting testosterone production by macrophages or their interactions with other hormones or signaling pathways could offer novel treatment strategies for related diseases. In summary, the ability of TM to secrete testosterone will redefine their roles in reproductive physiology and may open up new avenues for research and treatment.

Conclusions

This study demonstrates that TM can independently synthesize and secrete testosterone, significantly contributing to testosterone levels within the testes. This research highlights the critical role of the transcription factor Cebpb in regulating the expression of genes related to testosterone synthesis in macrophages, unveiling the potential regulatory mechanism of Cebpb in this process.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Additional file 1: Figure S1. Analysis of Surface Markers in F4/80 Positive Cell Populations. A: Flow cytometry results showing the positivity rates of CD45, CD11b, and CD68 in F4/80 positive cell populations. B: Bar graph summarizing the proportions of CD45, CD11b, and CD68 positive cells within the F4/80 positive cell population

Acknowledgements

We appreciated Jianmei Wan, Jing Nie and others for their help in the experimental technical guidance.

Author contributions

D.N. and C.Q. conceived and coordinated the study; D.N. conducted all the major experiments and wrote the manuscript. L.X., C.F and C.Q. supervised the biochemistry experiments, R.Y. and Y.X. partic ipated in the construction of the mouse model; W.H. and L.X. performed IHC staining. G.Z. and L.Y. analyzed the experiments. L.X., C.F, C.Q. and X.B. revised the article. All authors approved the final article. All authors reviewed the results and approved the final version of the article.

Funding

This study was supported by the Youth Excellence Projects of CNNC (CNNC-2020), the Occupational health research project in Jiangsu Province (No. JSZJ20233201), Youth Excellence Projects of Suzhou Health (No. GSWS2020031), Suzhou Science and Technology Bureau - Key clinical technology (No. SKY2023004), Provincial and Ministerial Co-constructed Open Topics for the State Key Laboratory of Radiological Medicine and Radiation Protection (GZK12023038), Suzhou City Key Core Technology Breakthrough - Social Development Project (2023SS19), Suzhou Medical College Joint Project by Four Parties (ML12301223), Suzhou City Basic Research Program - Key Clinical Technology Research (SKY2023004), Jiangsu Province Occupational Health Research Project (JSZJ20233201) and Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX24_3345).

Data availability

The raw RNA sequence data reported in this paper were deposited at the National Genomics Data Center (www.ngdc.cncb.ac.cn), under the accession number CRA013364. The codes supporting the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

All animal experiments were reviewed and approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University (approval number JD-LK-2020-019-02).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Lawrence BM, O’Donnell L, Smith LB, Rebourcet D. New insights into Testosterone Biosynthesis: novel observations from HSD17B3 deficient mice. Int J Mol Sci 2022, 23(24).
2. Storer TW Basaria S Traustadottir T Harman SM Pencina K Li Z Travison TG Miciek R Tsitouras P Hally K Effects of Testosterone Supplementation for 3 years on muscle performance and physical function in older men J Clin Endocrinol Metab 2017 102 2 583 93 27754805
Storer TW, Basaria S, Traustadottir T, Harman SM, Pencina K, Li Z, Travison TG, Miciek R, Tsitouras P, Hally K, et al. Effects of Testosterone Supplementation for 3 years on muscle performance and physical function in older men. J Clin Endocrinol Metab. 2017;102(2):583–93.27754805
3. Buendia-Gonzalez FO, Legorreta-Herrera M. The Similarities and Differences between the Effects of Testosterone and DHEA on the Innate and Adaptive Immune Response. Biomolecules 2022, 12(12).
4. Guo W Schmidt PJ Fleming MD Bhasin S Hepcidin is not essential for mediating testosterone’s effects on erythropoiesis Andrology 2020 8 1 82 90 10.1111/andr.12622 31001931
Guo W, Schmidt PJ, Fleming MD, Bhasin S. Hepcidin is not essential for mediating testosterone’s effects on erythropoiesis. Andrology. 2020;8(1):82–90.31001931 10.1111/andr.12622
5. Tuck S Francis R Testosterone, bone and osteoporosis Front Horm Res 2009 37 123 32 10.1159/000176049 19011293
Tuck S, Francis R. Testosterone, bone and osteoporosis. Front Horm Res. 2009;37:123–32.19011293 10.1159/000176049
6. Littleton-Kearney M Hurn PD Testosterone as a modulator of vascular behavior Biol Res Nurs 2004 5 4 276 85 10.1177/1099800403262927 15068657
Littleton-Kearney M, Hurn PD. Testosterone as a modulator of vascular behavior. Biol Res Nurs. 2004;5(4):276–85.15068657 10.1177/1099800403262927
7. Shima Y Miyabayashi K Haraguchi S Arakawa T Otake H Baba T Matsuzaki S Shishido Y Akiyama H Tachibana T Contribution of Leydig and sertoli cells to testosterone production in mouse fetal testes Mol Endocrinol 2013 27 1 63 73 10.1210/me.2012-1256 23125070
Shima Y, Miyabayashi K, Haraguchi S, Arakawa T, Otake H, Baba T, Matsuzaki S, Shishido Y, Akiyama H, Tachibana T, et al. Contribution of Leydig and sertoli cells to testosterone production in mouse fetal testes. Mol Endocrinol. 2013;27(1):63–73.23125070 10.1210/me.2012-1256
8. Hennebold JD Daynes RA Regulation of macrophage dehydroepiandrosterone sulfate metabolism by inflammatory cytokines Endocrinology 1994 135 1 67 75 10.1210/endo.135.1.8013393 8013393
Hennebold JD, Daynes RA. Regulation of macrophage dehydroepiandrosterone sulfate metabolism by inflammatory cytokines. Endocrinology. 1994;135(1):67–75.8013393 10.1210/endo.135.1.8013393
9. Weidler C Struharova S Schmidt M Ugele B Scholmerich J Straub RH Tumor necrosis factor inhibits conversion of dehydroepiandrosterone sulfate (DHEAS) to DHEA in rheumatoid arthritis synovial cells: a prerequisite for local androgen deficiency Arthritis Rheum 2005 52 6 1721 9 10.1002/art.21112 15934093
Weidler C, Struharova S, Schmidt M, Ugele B, Scholmerich J, Straub RH. Tumor necrosis factor inhibits conversion of dehydroepiandrosterone sulfate (DHEAS) to DHEA in rheumatoid arthritis synovial cells: a prerequisite for local androgen deficiency. Arthritis Rheum. 2005;52(6):1721–9.15934093 10.1002/art.21112
10. Cutolo M Accardo S Villaggio B Barone A Sulli A Balleari E Bason C Felli L Granata OM Amodio R Androgen metabolism and inhibition of interleukin-1 synthesis in primary cultured human synovial macrophages Mediators Inflamm 1995 4 2 138 43 10.1155/S096293519500024X 18475631
Cutolo M, Accardo S, Villaggio B, Barone A, Sulli A, Balleari E, Bason C, Felli L, Granata OM, Amodio R, et al. Androgen metabolism and inhibition of interleukin-1 synthesis in primary cultured human synovial macrophages. Mediators Inflamm. 1995;4(2):138–43.18475631 10.1155/S096293519500024X
11. Baulieu EE Robel P Schumacher M Neurosteroids: beginning of the story Int Rev Neurobiol 2001 46 1 32 10.1016/S0074-7742(01)46057-0 11599297
Baulieu EE, Robel P, Schumacher M. Neurosteroids: beginning of the story. Int Rev Neurobiol. 2001;46:1–32.11599297 10.1016/S0074-7742(01)46057-0
12. Cima I Corazza N Dick B Fuhrer A Herren S Jakob S Ayuni E Mueller C Brunner T Intestinal epithelial cells synthesize glucocorticoids and regulate T cell activation J Exp Med 2004 200 12 1635 46 10.1084/jem.20031958 15596520
Cima I, Corazza N, Dick B, Fuhrer A, Herren S, Jakob S, Ayuni E, Mueller C, Brunner T. Intestinal epithelial cells synthesize glucocorticoids and regulate T cell activation. J Exp Med. 2004;200(12):1635–46.15596520 10.1084/jem.20031958
13. Hostettler N Bianchi P Gennari-Moser C Kassahn D Schoonjans K Corazza N Brunner T Local glucocorticoid production in the mouse lung is induced by immune cell stimulation Allergy 2012 67 2 227 34 10.1111/j.1398-9995.2011.02749.x 22111694
Hostettler N, Bianchi P, Gennari-Moser C, Kassahn D, Schoonjans K, Corazza N, Brunner T. Local glucocorticoid production in the mouse lung is induced by immune cell stimulation. Allergy. 2012;67(2):227–34.22111694 10.1111/j.1398-9995.2011.02749.x
14. Gaytan F Bellido C Aguilar E van Rooijen N Requirement for testicular macrophages in Leydig cell proliferation and differentiation during prepubertal development in rats J Reprod Fertil 1994 102 2 393 9 10.1530/jrf.0.1020393 7861393
Gaytan F, Bellido C, Aguilar E, van Rooijen N. Requirement for testicular macrophages in Leydig cell proliferation and differentiation during prepubertal development in rats. J Reprod Fertil. 1994;102(2):393–9.7861393 10.1530/jrf.0.1020393
15. Afane M Dubost JJ Sauvezie B Issoual D Dosgilbert A Grizard G Boucher D Modulation of Leydig cell testosterone production by secretory products of macrophages Andrologia 1998 30 2 71 8 10.1111/j.1439-0272.1998.tb01149.x 9629426
Afane M, Dubost JJ, Sauvezie B, Issoual D, Dosgilbert A, Grizard G, Boucher D. Modulation of Leydig cell testosterone production by secretory products of macrophages. Andrologia. 1998;30(2):71–8.9629426 10.1111/j.1439-0272.1998.tb01149.x
16. Bhushan S Meinhardt A The macrophages in testis function J Reprod Immunol 2017 119 107 12 10.1016/j.jri.2016.06.008 27422223
Bhushan S, Meinhardt A. The macrophages in testis function. J Reprod Immunol. 2017;119:107–12.27422223 10.1016/j.jri.2016.06.008
17. Chen JJ Lukyanenko Y Hutson JC 25-hydroxycholesterol is produced by testicular macrophages during the early postnatal period and influences differentiation of Leydig cells in vitro Biol Reprod 2002 66 5 1336 41 10.1095/biolreprod66.5.1336 11967195
Chen JJ, Lukyanenko Y, Hutson JC. 25-hydroxycholesterol is produced by testicular macrophages during the early postnatal period and influences differentiation of Leydig cells in vitro. Biol Reprod. 2002;66(5):1336–41.11967195 10.1095/biolreprod66.5.1336
18. Yamauchi S, Yamamoto K, Ogawa K. Testicular macrophages produce progesterone De Novo promoted by cAMP and inhibited by M1 polarization inducers. Biomedicines 2022, 10(2).
19. Wang M Fijak M Hossain H Markmann M Nüsing RM Lochnit G Hartmann MF Wudy SA Zhang L Gu H Characterization of the Micro-environment of the Testis that shapes the phenotype and function of testicular macrophages J Immunol 2017 198 11 4327 40 10.4049/jimmunol.1700162 28461571
Wang M, Fijak M, Hossain H, Markmann M, Nüsing RM, Lochnit G, Hartmann MF, Wudy SA, Zhang L, Gu H, et al. Characterization of the Micro-environment of the Testis that shapes the phenotype and function of testicular macrophages. J Immunol. 2017;198(11):4327–40.28461571 10.4049/jimmunol.1700162
20. Li X Yao J Hu J Deng C Xie Y Wang Z iTRAQ-based proteomics of testicular interstitial fluid during aging in mice Theriogenology 2021 175 44 53 10.1016/j.theriogenology.2021.08.034 34482126
Li X, Yao J, Hu J, Deng C, Xie Y, Wang Z. iTRAQ-based proteomics of testicular interstitial fluid during aging in mice. Theriogenology. 2021;175:44–53.34482126 10.1016/j.theriogenology.2021.08.034
21. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 2011, 17(1):3.
22. Kim D Paggi JM Park C Bennett C Salzberg SL Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Nat Biotechnol 2019 37 8 907 15 10.1038/s41587-019-0201-4 31375807
Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907–15.31375807 10.1038/s41587-019-0201-4
23. Trapnell C Williams BA Pertea G Mortazavi A Kwan G van Baren MJ Salzberg SL Wold BJ Pachter L Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation Nat Biotechnol 2010 28 5 511 5 10.1038/nbt.1621 20436464
Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511–5.20436464 10.1038/nbt.1621
24. Trapnell C Hendrickson DG Sauvageau M Goff L Rinn JL Pachter L Differential analysis of gene regulation at transcript resolution with RNA-seq Nat Biotechnol 2013 31 1 46 53 10.1038/nbt.2450 23222703
Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat Biotechnol. 2013;31(1):46–53.23222703 10.1038/nbt.2450
25. Wang YH Hou HA Lin CC Kuo YY Yao CY Hsu CL Tseng MH Tsai CH Peng YL Kao CJ A CIBERSORTx-based immune cell scoring system could independently predict the prognosis of patients with myelodysplastic syndromes Blood Adv 2021 5 22 4535 48 10.1182/bloodadvances.2021005141 34614508
Wang YH, Hou HA, Lin CC, Kuo YY, Yao CY, Hsu CL, Tseng MH, Tsai CH, Peng YL, Kao CJ, et al. A CIBERSORTx-based immune cell scoring system could independently predict the prognosis of patients with myelodysplastic syndromes. Blood Adv. 2021;5(22):4535–48.34614508 10.1182/bloodadvances.2021005141
26. Lokka E Lintukorpi L Cisneros-Montalvo S Mäkelä JA Tyystjärvi S Ojasalo V Gerke H Toppari J Rantakari P Salmi M Generation, localization and functions of macrophages during the development of testis Nat Commun 2020 11 1 4375 10.1038/s41467-020-18206-0 32873797
Lokka E, Lintukorpi L, Cisneros-Montalvo S, Mäkelä JA, Tyystjärvi S, Ojasalo V, Gerke H, Toppari J, Rantakari P, Salmi M. Generation, localization and functions of macrophages during the development of testis. Nat Commun. 2020;11(1):4375.32873797 10.1038/s41467-020-18206-0
27. Latendresse JR Warbrittion AR Jonassen H Creasy DM Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid Toxicol Pathol 2002 30 4 524 33 10.1080/01926230290105721 12187944
Latendresse JR, Warbrittion AR, Jonassen H, Creasy DM. Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid. Toxicol Pathol. 2002;30(4):524–33.12187944 10.1080/01926230290105721
28. Messeguer X Escudero R Farré D Núñez O Martínez J Albà MM PROMO: detection of known transcription regulatory elements using species-tailored searches Bioinformatics 2002 18 2 333 4 10.1093/bioinformatics/18.2.333 11847087
Messeguer X, Escudero R, Farré D, Núñez O, Martínez J, Albà MM. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics. 2002;18(2):333–4.11847087 10.1093/bioinformatics/18.2.333
29. Farré D Roset R Huerta M Adsuara JE Roselló L Albà MM Messeguer X Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN Nucleic Acids Res 2003 31 13 3651 3 10.1093/nar/gkg605 12824386
Farré D, Roset R, Huerta M, Adsuara JE, Roselló L, Albà MM, Messeguer X. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003;31(13):3651–3.12824386 10.1093/nar/gkg605
30. Ye L Su ZJ Ge RS Inhibitors of testosterone biosynthetic and metabolic activation enzymes Molecules 2011 16 12 9983 10001 10.3390/molecules16129983 22138857
Ye L, Su ZJ, Ge RS. Inhibitors of testosterone biosynthetic and metabolic activation enzymes. Molecules. 2011;16(12):9983–10001.22138857 10.3390/molecules16129983
31. Green CD Ma Q Manske GL Shami AN Zheng X Marini S Moritz L Sultan C Gurczynski SJ Moore BB A Comprehensive Roadmap of Murine Spermatogenesis defined by single-cell RNA-Seq Dev Cell 2018 46 5 651 e667610 10.1016/j.devcel.2018.07.025 30146481
Green CD, Ma Q, Manske GL, Shami AN, Zheng X, Marini S, Moritz L, Sultan C, Gurczynski SJ, Moore BB, et al. A Comprehensive Roadmap of Murine Spermatogenesis defined by single-cell RNA-Seq. Dev Cell. 2018;46(5):651–e667610.30146481 10.1016/j.devcel.2018.07.025
32. Zhang X Li T Liu F Chen Y Yao J Li Z Huang Y Wang J Comparative analysis of Droplet-based Ultra-high-throughput single-cell RNA-Seq systems Mol Cell 2019 73 1 130 e142135 10.1016/j.molcel.2018.10.020 30472192
Zhang X, Li T, Liu F, Chen Y, Yao J, Li Z, Huang Y, Wang J. Comparative analysis of Droplet-based Ultra-high-throughput single-cell RNA-Seq systems. Mol Cell. 2019;73(1):130–e142135.30472192 10.1016/j.molcel.2018.10.020
33. Basu S, Campbell HM, Dittel BN, Ray A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp 2010(41).
34. Luo P Feng X Deng R Wang F Zhang Y Li X Zhang M Wan Z Xiang AP Xia K An autofluorescence-based isolation of Leydig cells for testosterone deficiency treatment Mol Cell Endocrinol 2021 535 111389 10.1016/j.mce.2021.111389 34229003
Luo P, Feng X, Deng R, Wang F, Zhang Y, Li X, Zhang M, Wan Z, Xiang AP, Xia K, et al. An autofluorescence-based isolation of Leydig cells for testosterone deficiency treatment. Mol Cell Endocrinol. 2021;535:111389.34229003 10.1016/j.mce.2021.111389
35. Rebourcet D O’Shaughnessy PJ Pitetti JL Monteiro A O’Hara L Milne L Tsai YT Cruickshanks L Riethmacher D Guillou F Sertoli cells control peritubular myoid cell fate and support adult Leydig cell development in the prepubertal testis Development 2014 141 10 2139 49 10.1242/dev.107029 24803659
Rebourcet D, O’Shaughnessy PJ, Pitetti JL, Monteiro A, O’Hara L, Milne L, Tsai YT, Cruickshanks L, Riethmacher D, Guillou F, et al. Sertoli cells control peritubular myoid cell fate and support adult Leydig cell development in the prepubertal testis. Development. 2014;141(10):2139–49.24803659 10.1242/dev.107029
36. Wu K Li Y Pan P Li Z Yu Y Huang J Ma F Tian L Fang Y Wang Y Gestational vinclozolin exposure suppresses fetal testis development in rats Ecotoxicol Environ Saf 2020 203 111053 10.1016/j.ecoenv.2020.111053 32888615
Wu K, Li Y, Pan P, Li Z, Yu Y, Huang J, Ma F, Tian L, Fang Y, Wang Y, et al. Gestational vinclozolin exposure suppresses fetal testis development in rats. Ecotoxicol Environ Saf. 2020;203:111053.32888615 10.1016/j.ecoenv.2020.111053
37. Sararols P Stévant I Neirijnck Y Rebourcet D Darbey A Curley MK Kühne F Dermitzakis E Smith LB Nef S Specific transcriptomic signatures and dual regulation of Steroidogenesis between fetal and adult mouse Leydig cells Front Cell Dev Biol 2021 9 695546 10.3389/fcell.2021.695546 34262907
Sararols P, Stévant I, Neirijnck Y, Rebourcet D, Darbey A, Curley MK, Kühne F, Dermitzakis E, Smith LB, Nef S. Specific transcriptomic signatures and dual regulation of Steroidogenesis between fetal and adult mouse Leydig cells. Front Cell Dev Biol. 2021;9:695546.34262907 10.3389/fcell.2021.695546
38. Hutson JC Development of cytoplasmic digitations between Leydig cells and testicular macrophages of the rat Cell Tissue Res 1992 267 2 385 9 10.1007/BF00302977 1600565
Hutson JC. Development of cytoplasmic digitations between Leydig cells and testicular macrophages of the rat. Cell Tissue Res. 1992;267(2):385–9.1600565 10.1007/BF00302977
39. Lukyanenko YO Chen JJ Hutson JC Production of 25-hydroxycholesterol by testicular macrophages and its effects on leydig cells Biol Reprod 2001 64 3 790 6 10.1095/biolreprod64.3.790 11207193
Lukyanenko YO, Chen JJ, Hutson JC. Production of 25-hydroxycholesterol by testicular macrophages and its effects on leydig cells. Biol Reprod. 2001;64(3):790–6.11207193 10.1095/biolreprod64.3.790
40. Gaytan F Bellido C Morales C Reymundo C Aguilar E van Rooijen N Selective depletion of testicular macrophages and prevention of Leydig cell repopulation after treatment with ethylene dimethane sulfonate in rats J Reprod Fertil 1994 101 1 175 82 10.1530/jrf.0.1010175 8064678
Gaytan F, Bellido C, Morales C, Reymundo C, Aguilar E, van Rooijen N. Selective depletion of testicular macrophages and prevention of Leydig cell repopulation after treatment with ethylene dimethane sulfonate in rats. J Reprod Fertil. 1994;101(1):175–82.8064678 10.1530/jrf.0.1010175
41. Gaytan F Bellido C Morales C Reymundo C Aguilar E Van Rooijen N Effects of macrophage depletion at different times after treatment with ethylene dimethane sulfonate (EDS) on the regeneration of Leydig cells in the adult rat J Androl 1994 15 6 558 64 10.1002/j.1939-4640.1994.tb00499.x 7721658
Gaytan F, Bellido C, Morales C, Reymundo C, Aguilar E, Van Rooijen N. Effects of macrophage depletion at different times after treatment with ethylene dimethane sulfonate (EDS) on the regeneration of Leydig cells in the adult rat. J Androl. 1994;15(6):558–64.7721658 10.1002/j.1939-4640.1994.tb00499.x
42. DeFalco T Potter SJ Williams AV Waller B Kan MJ Capel B Macrophages contribute to the Spermatogonial Niche in the adult Testis Cell Rep 2015 12 7 1107 19 10.1016/j.celrep.2015.07.015 26257171
DeFalco T, Potter SJ, Williams AV, Waller B, Kan MJ, Capel B. Macrophages contribute to the Spermatogonial Niche in the adult Testis. Cell Rep. 2015;12(7):1107–19.26257171 10.1016/j.celrep.2015.07.015
43. Cohen PE Chisholm O Arceci RJ Stanley ER Pollard JW Absence of colony-stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice results in male fertility defects Biol Reprod 1996 55 2 310 7 10.1095/biolreprod55.2.310 8828834
Cohen PE, Chisholm O, Arceci RJ, Stanley ER, Pollard JW. Absence of colony-stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice results in male fertility defects. Biol Reprod. 1996;55(2):310–7.8828834 10.1095/biolreprod55.2.310
44. Cohen PE Hardy MP Pollard JW Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice Mol Endocrinol 1997 11 11 1636 50 10.1210/mend.11.11.0009 9328346
Cohen PE, Hardy MP, Pollard JW. Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice. Mol Endocrinol. 1997;11(11):1636–50.9328346 10.1210/mend.11.11.0009
45. Cohen PE Nishimura K Zhu L Pollard JW Macrophages: important accessory cells for reproductive function J Leukoc Biol 1999 66 5 765 72 10.1002/jlb.66.5.765 10577508
Cohen PE, Nishimura K, Zhu L, Pollard JW. Macrophages: important accessory cells for reproductive function. J Leukoc Biol. 1999;66(5):765–72.10577508 10.1002/jlb.66.5.765
46. Kmicikiewicz I Wojtusiak A Bilińska B The effect of testicular macrophages, macrophage-conditioned medium and interleukin-1alpha on bank Vole Leydig cell steroidogenesis Exp Clin Endocrinol Diabetes 1999 107 4 262 71 10.1055/s-0029-1212110 10433066
Kmicikiewicz I, Wojtusiak A, Bilińska B. The effect of testicular macrophages, macrophage-conditioned medium and interleukin-1alpha on bank Vole Leydig cell steroidogenesis. Exp Clin Endocrinol Diabetes. 1999;107(4):262–71.10433066 10.1055/s-0029-1212110
47. Padua MB Jiang T Morse DA Fox SC Hatch HM Tevosian SG Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes Endocrinology 2015 156 5 1873 86 10.1210/en.2014-1907 25668066
Padua MB, Jiang T, Morse DA, Fox SC, Hatch HM, Tevosian SG. Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes. Endocrinology. 2015;156(5):1873–86.25668066 10.1210/en.2014-1907
48. Penny GM Cochran RB Pihlajoki M Kyrönlahti A Schrade A Häkkinen M Toppari J Heikinheimo M Wilson DB Probing GATA factor function in mouse leydig cells via testicular injection of adenoviral vectors Reproduction 2017 154 4 455 67 10.1530/REP-17-0311 28710293
Penny GM, Cochran RB, Pihlajoki M, Kyrönlahti A, Schrade A, Häkkinen M, Toppari J, Heikinheimo M, Wilson DB. Probing GATA factor function in mouse leydig cells via testicular injection of adenoviral vectors. Reproduction. 2017;154(4):455–67.28710293 10.1530/REP-17-0311
49. Potter SS Single-cell RNA sequencing for the study of development, physiology and disease Nat Rev Nephrol 2018 14 8 479 92 10.1038/s41581-018-0021-7 29789704
Potter SS. Single-cell RNA sequencing for the study of development, physiology and disease. Nat Rev Nephrol. 2018;14(8):479–92.29789704 10.1038/s41581-018-0021-7
50. Stévant I Neirijnck Y Borel C Escoffier J Smith LB Antonarakis SE Dermitzakis ET Nef S Deciphering cell lineage specification during male sex determination with single-cell RNA sequencing Cell Rep 2018 22 6 1589 99 10.1016/j.celrep.2018.01.043 29425512
Stévant I, Neirijnck Y, Borel C, Escoffier J, Smith LB, Antonarakis SE, Dermitzakis ET, Nef S. Deciphering cell lineage specification during male sex determination with single-cell RNA sequencing. Cell Rep. 2018;22(6):1589–99.29425512 10.1016/j.celrep.2018.01.043
51. Chen Y Zheng Y Gao Y Lin Z Yang S Wang T Wang Q Xie N Hua R Liu M Single-cell RNA-seq uncovers dynamic processes and critical regulators in mouse spermatogenesis Cell Res 2018 28 9 879 96 10.1038/s41422-018-0074-y 30061742
Chen Y, Zheng Y, Gao Y, Lin Z, Yang S, Wang T, Wang Q, Xie N, Hua R, Liu M, et al. Single-cell RNA-seq uncovers dynamic processes and critical regulators in mouse spermatogenesis. Cell Res. 2018;28(9):879–96.30061742 10.1038/s41422-018-0074-y
52. Shami AN Zheng X Munyoki SK Ma Q Manske GL Green CD Sukhwani M Orwig KE Li JZ Hammoud SS Single-cell RNA sequencing of Human, Macaque, and mouse testes uncovers conserved and divergent features of mammalian spermatogenesis Dev Cell 2020 54 4 529 e547512 10.1016/j.devcel.2020.05.010 32504559
Shami AN, Zheng X, Munyoki SK, Ma Q, Manske GL, Green CD, Sukhwani M, Orwig KE, Li JZ, Hammoud SS. Single-cell RNA sequencing of Human, Macaque, and mouse testes uncovers conserved and divergent features of mammalian spermatogenesis. Dev Cell. 2020;54(4):529–e547512.32504559 10.1016/j.devcel.2020.05.010
53. Di Persio S Tekath T Siebert-Kuss LM Cremers JF Wistuba J Li X Meyer Zu Hörste G Drexler HCA Wyrwoll MJ Tüttelmann F Single-cell RNA-seq unravels alterations of the human spermatogonial stem cell compartment in patients with impaired spermatogenesis Cell Rep Med 2021 2 9 100395 10.1016/j.xcrm.2021.100395 34622232
Di Persio S, Tekath T, Siebert-Kuss LM, Cremers JF, Wistuba J, Li X, Meyer Zu Hörste G, Drexler HCA, Wyrwoll MJ, Tüttelmann F, et al. Single-cell RNA-seq unravels alterations of the human spermatogonial stem cell compartment in patients with impaired spermatogenesis. Cell Rep Med. 2021;2(9):100395.34622232 10.1016/j.xcrm.2021.100395
54. Ziegenhain C Vieth B Parekh S Reinius B Guillaumet-Adkins A Smets M Leonhardt H Heyn H Hellmann I Enard W Comparative analysis of single-cell RNA sequencing methods Mol Cell 2017 65 4 631 e643634 10.1016/j.molcel.2017.01.023 28212749
Ziegenhain C, Vieth B, Parekh S, Reinius B, Guillaumet-Adkins A, Smets M, Leonhardt H, Heyn H, Hellmann I, Enard W. Comparative analysis of single-cell RNA sequencing methods. Mol Cell. 2017;65(4):631–e643634.28212749 10.1016/j.molcel.2017.01.023
55. Landreh L Stukenborg JB Söder O Svechnikov K Phenotype and steroidogenic potential of PDGFRα-positive rat neonatal peritubular cells Mol Cell Endocrinol 2013 372 1–2 96 104 10.1016/j.mce.2013.03.019 23545158
Landreh L, Stukenborg JB, Söder O, Svechnikov K. Phenotype and steroidogenic potential of PDGFRα-positive rat neonatal peritubular cells. Mol Cell Endocrinol. 2013;372(1–2):96–104.23545158 10.1016/j.mce.2013.03.019
56. Wang Y Huang S Wang Z Chen F Chen P Zhao X Lin H Ge R Zirkin B Chen H Long-term maintenance of luteinizing hormone-responsive testosterone formation by primary rat leydig cells in vitro Mol Cell Endocrinol 2018 476 48 56 10.1016/j.mce.2018.04.008 29702242
Wang Y, Huang S, Wang Z, Chen F, Chen P, Zhao X, Lin H, Ge R, Zirkin B, Chen H. Long-term maintenance of luteinizing hormone-responsive testosterone formation by primary rat leydig cells in vitro. Mol Cell Endocrinol. 2018;476:48–56.29702242 10.1016/j.mce.2018.04.008
57. Klinefelter GR Hall PF Ewing LL Effect of luteinizing hormone deprivation in situ on Steroidogenesis of Rat Leydig cells purified by a Multistep Procedure12 Biol Reprod 1987 36 3 769 83 10.1095/biolreprod36.3.769 3496123
Klinefelter GR, Hall PF, Ewing LL. Effect of luteinizing hormone deprivation in situ on Steroidogenesis of Rat Leydig cells purified by a Multistep Procedure12. Biol Reprod. 1987;36(3):769–83.3496123 10.1095/biolreprod36.3.769
58. Mahata B Zhang X Kolodziejczyk AA Proserpio V Haim-Vilmovsky L Taylor AE Hebenstreit D Dingler FA Moignard V Göttgens B Single-cell RNA sequencing reveals T helper cells synthesizing steroids de novo to contribute to immune homeostasis Cell Rep 2014 7 4 1130 42 10.1016/j.celrep.2014.04.011 24813893
Mahata B, Zhang X, Kolodziejczyk AA, Proserpio V, Haim-Vilmovsky L, Taylor AE, Hebenstreit D, Dingler FA, Moignard V, Göttgens B, et al. Single-cell RNA sequencing reveals T helper cells synthesizing steroids de novo to contribute to immune homeostasis. Cell Rep. 2014;7(4):1130–42.24813893 10.1016/j.celrep.2014.04.011
59. Milewich L Lipscomb MF Whisenant MG MacDonald PC Conversion of androstenedione to testosterone and other androgens in guinea-pig alveolar macrophages J Steroid Biochem 1983 19 5 1611 5 10.1016/0022-4731(83)90378-3 6645497
Milewich L, Lipscomb MF, Whisenant MG, MacDonald PC. Conversion of androstenedione to testosterone and other androgens in guinea-pig alveolar macrophages. J Steroid Biochem. 1983;19(5):1611–5.6645497 10.1016/0022-4731(83)90378-3
60. Lukyanenko Y Chen JJ Hutson JC Testosterone regulates 25-hydroxycholesterol production in testicular macrophages Biol Reprod 2002 67 5 1435 8 10.1095/biolreprod.102.007575 12390873
Lukyanenko Y, Chen JJ, Hutson JC. Testosterone regulates 25-hydroxycholesterol production in testicular macrophages. Biol Reprod. 2002;67(5):1435–8.12390873 10.1095/biolreprod.102.007575
61. Cutolo M Villaggio B Barone A Sulli A Accardo S Granata OM Castagnetta L Primary cultures of human synovial macrophages metabolize androgens Ann N Y Acad Sci 1996 784 534 41 10.1111/j.1749-6632.1996.tb16277.x 8651613
Cutolo M, Villaggio B, Barone A, Sulli A, Accardo S, Granata OM, Castagnetta L. Primary cultures of human synovial macrophages metabolize androgens. Ann N Y Acad Sci. 1996;784:534–41.8651613 10.1111/j.1749-6632.1996.tb16277.x
62. Schmidt M Kreutz M Löffler G Schölmerich J Straub RH Conversion of dehydroepiandrosterone to downstream steroid hormones in macrophages J Endocrinol 2000 164 2 161 9 10.1677/joe.0.1640161 10657851
Schmidt M, Kreutz M, Löffler G, Schölmerich J, Straub RH. Conversion of dehydroepiandrosterone to downstream steroid hormones in macrophages. J Endocrinol. 2000;164(2):161–9.10657851 10.1677/joe.0.1640161
63. Gu X Li SY Matsuyama S DeFalco T Immune cells as critical regulators of steroidogenesis in the Testis and Beyond Front Endocrinol (Lausanne) 2022 13 894437 10.3389/fendo.2022.894437 35573990
Gu X, Li SY, Matsuyama S, DeFalco T. Immune cells as critical regulators of steroidogenesis in the Testis and Beyond. Front Endocrinol (Lausanne). 2022;13:894437.35573990 10.3389/fendo.2022.894437
64. Chitu V Stanley ER Colony-stimulating factor-1 in immunity and inflammation Curr Opin Immunol 2006 18 1 39 48 10.1016/j.coi.2005.11.006 16337366
Chitu V, Stanley ER. Colony-stimulating factor-1 in immunity and inflammation. Curr Opin Immunol. 2006;18(1):39–48.16337366 10.1016/j.coi.2005.11.006
65. Hume DA The mononuclear phagocyte system Curr Opin Immunol 2006 18 1 49 53 10.1016/j.coi.2005.11.008 16338128
Hume DA. The mononuclear phagocyte system. Curr Opin Immunol. 2006;18(1):49–53.16338128 10.1016/j.coi.2005.11.008
66. Hume DA MacDonald KP Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling Blood 2012 119 8 1810 20 10.1182/blood-2011-09-379214 22186992
Hume DA, MacDonald KP. Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling. Blood. 2012;119(8):1810–20.22186992 10.1182/blood-2011-09-379214
67. Pollard JW Trophic macrophages in development and disease Nat Rev Immunol 2009 9 4 259 70 10.1038/nri2528 19282852
Pollard JW. Trophic macrophages in development and disease. Nat Rev Immunol. 2009;9(4):259–70.19282852 10.1038/nri2528
68. Inui S Itami S Androgen actions on the human hair follicle: perspectives Exp Dermatol 2013 22 3 168 71 10.1111/exd.12024 23016593
Inui S, Itami S. Androgen actions on the human hair follicle: perspectives. Exp Dermatol. 2013;22(3):168–71.23016593 10.1111/exd.12024
69. Starks RR, Abu Alhasan R, Kaur H, Pennington KA, Schulz LC, Tuteja G. Transcription factor PLAGL1 is Associated with angiogenic gene expression in the Placenta. Int J Mol Sci 2020, 21(21).
70. Liu H Yang Y Liu D Wang X Zhang L Transcription factor TabHLH49 positively regulates dehydrin WZY2 gene expression and enhances drought stress tolerance in wheat BMC Plant Biol 2020 20 1 259 10.1186/s12870-020-02474-5 32503498
Liu H, Yang Y, Liu D, Wang X, Zhang L. Transcription factor TabHLH49 positively regulates dehydrin WZY2 gene expression and enhances drought stress tolerance in wheat. BMC Plant Biol. 2020;20(1):259.32503498 10.1186/s12870-020-02474-5
71. Wu H Gu J Zhou D Cheng W Wang Y Wang Q Wang X LINC00160 mediated paclitaxel-and doxorubicin-resistance in breast cancer cells by regulating TFF3 via transcription factor C/EBPβ J Cell Mol Med 2020 24 15 8589 602 10.1111/jcmm.15487 32652877
Wu H, Gu J, Zhou D, Cheng W, Wang Y, Wang Q, Wang X. LINC00160 mediated paclitaxel-and doxorubicin-resistance in breast cancer cells by regulating TFF3 via transcription factor C/EBPβ. J Cell Mol Med. 2020;24(15):8589–602.32652877 10.1111/jcmm.15487
72. Meinhardt A Dejucq-Rainsford N Bhushan S Testicular macrophages: development and function in health and disease Trends Immunol 2022 43 1 51 62 10.1016/j.it.2021.11.003 34848166
Meinhardt A, Dejucq-Rainsford N, Bhushan S. Testicular macrophages: development and function in health and disease. Trends Immunol. 2022;43(1):51–62.34848166 10.1016/j.it.2021.11.003
