
==== Front
Microb Cell Fact
Microb Cell Fact
Microbial Cell Factories
1475-2859
BioMed Central London

2520
10.1186/s12934-024-02520-z
Research
Synthetic redesign of Escherichia coli W for faster metabolism of sugarcane molasses
Kim Gi Yeon 1
Yang Jina 2
Han Yong Hee 13
Seo Sang Woo swseo@snu.ac.kr

145
1 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Interdisciplinary Program in Bioengineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul, 08826 South Korea
2 https://ror.org/05hnb4n85 grid.411277.6 0000 0001 0725 5207 Department of Chemical Engineering, Jeju National University, 102, Jejudaehak-ro, Jeju-si, Jeju-do 63243 Korea
3 https://ror.org/05kzjxq56 grid.14005.30 0000 0001 0356 9399 School of Biological Sciences and Biotechnology, Graduate School, and School of Biological Sciences and Technology, Chonnam National University, Yongbong-ro 77, Gwangju, 61186 South Korea
4 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 School of Chemical and Biological Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul, 08826 South Korea
5 https://ror.org/04h9pn542 grid.31501.36 0000 0004 0470 5905 Institute of Chemical Processes, and Bio-MAX Institute, and Institute of Bio Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul, 08826 South Korea
9 9 2024
9 9 2024
2024
23 24223 4 2024
2 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Background

Sugarcane molasses, rich in sucrose, glucose, and fructose, offers a promising carbon source for industrial fermentation due to its abundance and low cost. However, challenges arise from the simultaneous utilization of multiple sugars and carbon catabolite repression (CCR). Despite its nutritional content, sucrose metabolism in Escherichia coli, except for W strain, remains poorly understood, hindering its use in microbial fermentation. In this study, E. coli W was engineered to enhance sugar consumption rates and overcome CCR. This was achieved through the integration of a synthetically designed csc operon and the optimization of glucose and fructose co-utilization pathways. These advancements facilitate efficient utilization of sugarcane molasses for the production of 3-hydroxypropionic acid (3-HP), contributing to sustainable biochemical production processes.

Results

In this study, we addressed challenges associated with sugar metabolism in E. coli W, focusing on enhancing sucrose consumption and improving glucose-fructose co-utilization. Through targeted engineering of the sucrose utilization system, we achieved accelerated sucrose consumption rates by modulating the expression of the csc operon components, cscB, cscK, cscA, and cscR. Our findings revealed that monocistronic expression of the csc genes with the deletion of cscR, led to optimal sucrose utilization without significant growth burden. Furthermore, we successfully alleviated fructose catabolite repression by modulating the binding dynamics of FruR with the fructose PTS regulon, enabling near-equivalent co-utilization of glucose and fructose. To validate the industrial applicability of our engineered strain, we pursued 3-HP production from sugarcane molasses. By integrating heterologous genes and optimizing metabolic pathways, we achieved improvements in 3-HP titers compared to previous studies. Additionally, glyceraldehyde-3-phosphate dehydrogenase (gapA) repression aids in carbon flux redistribution, enhancing molasses conversion to 3-HP.

Conclusions

Despite limitations in sucrose metabolism, the redesigned E. coli W strain, adept at utilizing sugarcane molasses, is a valuable asset for industrial fermentation. Its synthetic csc operon enhances sucrose consumption, while mitigating CCR improves glucose-fructose co-utilization. These enhancements, coupled with repression of gapA, aim to efficiently convert sugarcane molasses into 3-HP, addressing limitations in sucrose and fructose metabolism for industrial applications.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12934-024-02520-z.

Keywords

Sugarcane molasses
Sugar uptake
Carbon catabolite repression
3-hydroxypropionic acid
Bio & Medical Technology Development ProgramNRF-2021M3A9I4024737 Korea Institute of Marine Science & Technology Promotion20220258 http://dx.doi.org/10.13039/501100003725 National Research Foundation of Korea RS-2024-00345885 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Sugarcane molasses is a byproduct of the sucrose production from sugarcane, and its utilization has many advantages, including its abundance, low cost, and high sugar content [1, 2]. The world’s annual yield of molasses reaches 55 million tons, with the global cane molasses market size setting to be about $8.1 billion by 2030 [2]. It contains not only sucrose but also glucose, fructose, and other nutrients such as vitamins, minerals, and amino acids, which leads to a potentially attractive carbon source for industrial fermentation processes. The utilization of renewable carbon feedstocks for bioprocesses is gaining significant attention, driven by environmental and economic considerations [3, 4]. Sucrose, a disaccharide composed of glucose and fructose, derived from sugarcane emerges as a promising renewable carbon source. While the precise composition varies among different sugarcane varieties, the proportion of sucrose within sugarcane molasses is significantly dominant among all carbon sources. Therefore, optimization of sucrose metabolism is crucial for effective utilization of sugarcane molasses.

Only a few non-pathogenic E. coli strains are known to utilize sucrose, including EC3132, B-62, and W [5–8]. E. coli W stands out as the sole well-known strain proficient in utilizing sucrose as a carbon source, displaying robust growth compared to alternative sources like glucose [9]. Given the limited ability of most E. coli strains to utilize sucrose, previous studies on sucrose metabolism primarily focused on engineering individual strains by introducing the sucrose uptake system from E. coli W [10–12]. Despite previous efforts, engineered strains for sucrose utilization often exhibited slow growth rates and phenotypic instability from unstable plasmid systems requiring antibiotics and cellular burden induced by high-copy number plasmids [6, 11, 13, 14]. Thus, there remains a critical need for efficient sucrose metabolism engineering in E. coli.

Sugarcane molasses contains not only sucrose, but glucose and fructose as carbon sources, posing challenges for simultaneous metabolism of multiple sugars. Carbon catabolite repression (CCR) is a regulatory mechanism where the presence of a preferred carbon source, often glucose, represses the utilization of alternative carbon sources, including fructose [15]. In E. coli, glucose is the preferred carbon substrate, and its abundance triggers CCR, leading to a reduction in the uptake of fructose. This regulatory hurdle limits the simultaneous utilization of multiple sugars, hindering the efficiency of certain bioprocesses [16]. Overcoming the CCR issue is crucial for engineering E. coli strains with improved capabilities for co-utilizing glucose and fructose, especially in industrial applications where the utilization of mixed sugars in common.

In this study, E. coli W was redesigned for faster consumption rates of sugars in molasses. Sugarcane molasses, a valuable resource rich in sucrose, glucose, and fructose, encounters a challenge in simultaneous utilization. The primary sucrose utilization system in E. coli W relies on non-PTS (phosphotransferase system), while glucose and fructose are predominantly utilized through PTS. A synthetically designed csc operon, which regulates the non-PTS sucrose metabolism, was shown to enhance the consumption rate of sucrose. Additionally, the co-utilization of glucose and fructose was improved by preventing the fructose repressor from binding to the fructose PTS regulon and controlling the expression level of the regulon. This approach solved the primary obstacle of CCR in glucose and fructose co-utilization. Furthermore, the increased consumption rates of sucrose, glucose, and fructose could help E. coli to efficiently utilize sugarcane molasses and convert it into 3-hydroxypropionic acid (3-HP). This approach aligns with the concept of utilizing renewable feedstocks, contributing to environmentally friendly and economically viable biochemical production processes.

Methods

Bacterial strains, plasmids, and reagents

E. coli strains and plasmids used in this study are listed in Table 1. Oligonucleotides used in this study are listed in Supplementary materials, Table S1. Reagents used for cell cultivation were purchased from BD Bioscience and Sigma Aldrich. Sugarcane molasses, containing a sucrose, glucose, and fructose ratio of approximately 4:1:1, was purchased from Plantation™ (Blackstrap Organic Unsulphured Molasses). Plasmid DNA was extracted using GeneAll® Exprep™ Plasmid SV Kit, and PCR products were purified using Zymo Research DNA Clean & Concentrator or the GeneAll® Expin Gel SV Kit. For gene cloning, Q5® High-Fidelity DNA Polymerase, Quick Ligase, NEBuilder® HiFi DNA Assembly Master Mix, and restriction enzymes were purchased from NEB (New England Biolabs).

Table 1 Strains and plasmids

Name	Relevant characteristics	Source	
Strains	
Mach1-T1R	F − φ80(lacZ)ΔM15 ΔlacX74 hsdR(r − m +) ΔrecA1398 endA1 tonA	Invitrogen	
E. coli W	Acid tolerant strain	KCTC1039	
WΔcscR	E. coli W/ΔcscR	This study	
Pcsc_poly	E. coli W/ΔcscBKAR/pCDF-csc_poly	This study	
Pcsc_mono	E. coli W/ΔcscBKAR/pCDF-csc_mono	This study	
Rcsc	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA	This study	
WΔfruR	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/ΔfruR	This study	
F1	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR3,231	This study	
F2	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR12,136	This study	
F3	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626	This study	
F4	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR1,386,568	This study	
W_3HP	E. coli W/pUC-KGG/pACYC_B4	This study	
F3_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/pUC-KGG/pACYC_B4	This study	
G100_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/PgapA-UTRgapA::PJ23100-synUTRgapA/pUC-KGG/pACYC_B4	This study	
G102_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/PgapA-UTRgapA::PJ23102-synUTRgapA/pUC-KGG/pACYC_B4	This study	
G107_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/PgapA-UTRgapA::PJ23107-synUTRgapA/pUC-KGG/pACYC_B4	This study	
G108_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/PgapA-UTRgapA::PJ23108-synUTRgapA/pUC-KGG/pACYC_B4	This study	
G115_3HP	E. coli W/ΔcscBKAR::PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA/PFru-UTRFru::Ptac-synUTR62,626/PgapA-UTRgapA::PJ23115-synUTRgapA/pUC-KGG/pACYC_B4	This study	
Plasmids	
pCDFDuet-1	Expression vector, CloDF13 ori, SmR	Novagene	
pCDF-CS	CloDF13 ori, SmR, PJ23100-PCm-CmR-sacB-term	This study	
pCDF-csc_poly	CloDF13 ori, SmR, Ptac-synUTRcscA-cscA-synUTRcscK-cscK-synUTRcscB-cscB	This study	
pCDF-csc_mono	CloDF13 ori, SmR, PJ23100-synUTRcscB-cscB – PJ23106-synUTRcscK-cscK – Ptac-synUTRcscA-cscA	This study	
pUC/K	pMB1 ori, KanR, Ptac-synUTRkgsadh-kgsadh	(40)	
pUC-KGG	pMB1 ori, KanR, Ptac-synUTRkgsadh-kgsadh – Ptac-synUTRgpd1-gpd1 – Ptac-synUTRgpp2-gpp2	This study	
pACYC_B4	p15A ori, CmR, Ptac-synUTR4dhaB1-dhaB1- Ptac-synUTRdhaB2-dhaB2-dhaB3-gdrA-gdrB	(40)	

Construction of the synthetic expression cassettes

Mach1-T1R cells were used for general cloning and cultured in Luria-Bertani (LB) medium containing appropriate antibiotics. All recombinations were done using the DNA fragment from pCDF-CS; selection with chloramphenicol for the 1st recombination (replacement with the CmR-sacB (CS)-cassette), then counter-selection with sucrose for the final recombination (replacement the CS-cassette in genome with editing template) [17]. Primers used for recombination in this study are listed in Supplementary materials, Table S1.

To construct pCDF-csc_mono, cscB_mono, cscK_mono, and cscA_mono were ligated after cut by NcoI and PstI, after each DNA fragment was amplified by cscB_mono-F/cscB _NcoI-R, cscK _NcoI-F/cscK _PstI-R, and cscA_PstI-F/cscA_mono-R, respectively. Then, each cscB-cscK-cscA cassette and pCDFDuet-1 vector was amplified by cscB_mono-F/cscA_mono-R and pCDF-F/pCDF-R, respectively, then ligated through Gibson Assembly. To construct pCDF-csc_poly, cscA_poly, cscK_poly, and cscB_poly were ligated after cut by SpeI and KpnI, after each DNA fragment was amplified by cscA_PstI-F/cscA_SpeI-R, cscK_SpeI-F/cscK_KpnI-R, and cscB_KpnI-F/cscB_BamHI-R, respectively. Then, each cscAKB cassette and pCDF-csc_mono was amplified by cscA_PstI-F/cscB_BamHI-R and pCDF_BamHI-F/pCDF_PstI-R, respectively, then ligated after cut by BamHI and PstI.

To construct pUC-KGG, GPD1 was first cloned to pUC/K. The DNA fragments were ligated after cut with NheI and NdeI, after GPD1 was amplified with GPD1_NdeI-F/GPD1_NheI-R, and pUC/K was amplified with pUC/K_NheI-F/pUC/K_NdeI-R. Then, GPP2 was cloned into the vector after amplified with GPP2_EcoNI-F/GPP2_NheI-R and cut by EcoNI and NheI.

Media and culture conditions

The cells were cultured in a 250-mL baffled flask containing 25 mL of medium, and incubated at 37 ºC with shaking (250 rpm). The modified minimal medium contained 0.5 g/L MgSO4⋅7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L yeast extract, and 100 mM potassium phosphate buffer (pH 7.0); 20 g/L sucrose or 8 g/L of each sucrose, glucose, and fructose for flask-scale cultivation, and 30 g/L of sugarcane molasses with the feed (30 g/L of sugarcane molasses and 4 µM coenzyme B12) for fed-batch cultivation were included as the carbon source. To maintain the plasmids, 50 µg/mL of kanamycin, 34 µg/mL of chloramphenicol, or/and 50 µg/mL of spectinomycin was added. To adjust pH, 10 M NaOH solution was used. For 3-HP production, 0.1 mM of IPTG and 4 µM of coenzyme B12 were added at OD600 0.7. The culture was conducted with three biological replicates for flask-scale cultivation.

Metabolite quantification

Concentrations of sucrose, glucose, fructose, 3-HP, glycerol, and acetate were measured at 40 °C using high-performance liquid chromatography (Agilent 1260 Infinity II LC System) equipped with Agilent Hi-Plex H column (8 μm, 6.5 mm × 300 mm, PL1F70-6830) at a flow rate of 0.6 mL/min using 5 mM H2SO4 as the mobile phase. Signals were monitored at 210 nm of wavelength for UV-Vis and at 35 °C for refractive index detector (RID). Each sample had a 30-min running time. At least five data points of each biochemical were used to draw a standard curve to measure the concentrations.

Fermentation conditions

Fed-batch fermentation was done in a 5-L bioreactor (BioCNS) containing initial 1.5 L of medium at 37 °C, 250 rpm. pH was controlled with 1 M of NaOH to set at 6.7-7.0. And 30 g/L of sugarcane molasses and 4 µM of coenzyme B12 were fed every 24 h [18]. Air was provided at an aeration rate of 0.667 vvm. An electronic zero (0%) on the bioreactor was set first for the DO probe calibration. Prior to inoculation, once the fermentation media was prepared and maintained at 37 °C with agitation at 250 rpm, the DO level was set to 100%. Also, 0.01% of Antifoam 204 (Sigma-Aldrich) was added to the medium prior to the fermentation. The DO level was controlled to 30% of air saturation by automatically increasing the agitation from 200 to 500 rpm first, and then increasing the aeration rate from 0.667 vvm to 3.333 vvm when the agitation was not enough for the control.

Results and discussion

Enhancing sucrose consumption rate

The varied consumption pattern of sugars in E. coli W, notably delayed sucrose uptake and fructose catabolite repression, stems from the strain’s transport and metabolic characteristics [7, 8]. Sucrose, relying on the non-PTS, requires an additional hydrolysis step, hindering its immediate utilization (Supplementary Fig. S1). Meanwhile, glucose and fructose, facilitated by the PTS, exhibit a more efficient uptake [15]. The sequential sugar consumption reflects the regulatory hierarchy in W, prioritizing glucose followed by fructose. Additionally, pH control in the cultivation environment was required to consume other sugars than glucose.

We first engineered the uptake system of the primary component of sugarcane molasses, sucrose, to improve its consumption rate. The main non-PTS sucrose metabolism regulon in W is Csc regulon harboring four genes: cscB (permease), cscK (fructokinase), cscA (invertase), and cscR (transcriptional repressor) (Fig. 1A). To augment the sucrose consumption rate, a strategic approach was implemented by initially targeting the transcriptional repressor [7, 19]. While the deletion of cscR within the strain was proven effective in enabling complete sucrose consumption, there appeared to be no noticeable differences in the sucrose uptake rate (Supplementary Fig. S2). This observation suggested that the absence of cscR might primarily influence the regulatory aspects of the sucrose metabolism pathway, facilitating enhanced utilization without necessarily impacting the rate of sucrose uptake.

Fig. 1 Enhancing the sucrose consumption rate by optimizing the expression level of csc operon. (A) csc operon in native genome, (B) plasmid design of the synthetic csc operon cassette for both polycistronic and monocistronic expression, with the native csc operon-knocked out strain, (C) genome-integration of the synthetic csc operon; physiology tests of Pcsc_poly (synthetic polycistronic Csc expression through plasmid, green), Pcsc_mono (synthetic monocistronic Csc expression through plasmid, blue), and Rcsc (synthetic monocistronic Csc expression through recombination, red) (D) cell growth, (E) sucrose consumption, (F) glucose consumption, (G) fructose consumption graphs

To optimize the expression level of csc operon, two different expression cassettes were constructed (polycistronic (Pcsc_poly) and monocistronic (Pcsc_mono)) based on a plasmid with a medium copy number (Fig. 1B and Table 1). The polycistronic cassette was designed, featuring a synthetic robust promoter, Ptac, and synthetic 5’ UTRs, with the intent of enhancing the overall operon expression (Supplementary Table S2) [20, 21]. cscA and cscK were strategically positioned upstream of cscB, the membrane protein, mirroring the arrangement in the native operon where they follow a bidirectional promoter. Conversely, the monocistronic cassette involved the individual construction of cscB, cscK, and cscA, each equipped with synthetic 5’ UTRs and constitutive promoters, specifically J23100, J23106, and Ptac, respectively. Based on Registry of Standard Biological Parts [22], the promoter strength in E. coli ranks as follows: Ptac, J23100, and J23106, in descending order [23–25]. Additionally, synthetic 5’ UTRs for both polycistronic and monocistronic cassettes exhibited significantly higher translation rates compared to native 5’ UTRs. Overexpression of cscB led to an increased presence of permease molecules on the cell membrane, which facilitated the more rapid import of sucrose into the cell. Simultaneously, overexpression of cscA enabled the cell to more efficiently hydrolyze the imported sucrose into glucose and fructose, which could then be swiftly utilized in central metabolic pathways like glycolysis. This process helped sucrose entering the cell to break down quickly and to be metabolized, avoiding potential bottlenecks in utilization. Combined, the overexpression of cscB and cscA optimized both the uptake and conversion of sucrose, resulting in a more efficient and accelerated consumption rate [7]. However, the strength of the promoter for cscK was not as strong as for other genes because the overexpression of cscK, being a kinase requiring ATP for phosphorylation, exhibited a threshold effect due to limitations in ATP availability. Also, each gene was codon-optimized at the N-terminal for higher expression level, and synthetic strong terminators were used [26] (Supplementary Table S1). These plasmids were subsequently introduced into the cscBKAR-deleted strain, thereby creating a targeted genetic context conducive to examining the impact of altered expression patterns on sucrose metabolism. Pcsc_poly exhibited a less favorable performance attributed to potential growth burden, likely led by disrupted metabolic flux (Fig. 1D-G).

The superior performance of Pcsc_mono, characterized by its absence of growth burden and accelerated sucrose consumption rate, proved its selection as the optimal genetic configuration. The synthetically designed monocistronic csc cassette was integrated into the cscBKAR-deleted genome (Rcsc) to maintain its stable expression and minimize the metabolic burden caused by a heterologous plasmid (Fig. 1C). Despite the deployment of a lower copy number, Rcsc exhibited stable consumption of sucrose and better cellular growth than Pcsc_mono (Fig. 1D-G). Furthermore, the overexpression of invertase expedited the cleavage of sucrose into glucose and fructose, facilitating their rapid transport to the extracellular space (Fig. 1F, G). While this alternation might diverge from a conventional sucrose uptake mechanism, it aligned with the physiological context of sugarcane molasses, which contains a mixture of sucrose, glucose, and fructose. Nevertheless, further engineering is required for the removal of CCR. Enhanced sucrose consumption efficiency, reduced growth burden, and sustained metabolic stability, Rcsc is an advantageous candidate for bioprocess applications requiring optimized sucrose utilization and metabolic control.

Improving glucose-fructose co-utilization

The removal of the fructose catabolite repression in W was pursued by deleting the transcriptional repressor, fruR, also recognized as cra in numerous bacteria [27]. This genetic modification successfully abolished CCR on fructose, resulting in a faster fructose consumption rate than glucose (Supplementary Fig. S3). However, a notable consequence of WΔfruR was the accumulation of acetate, indicative of potential disruptions in metabolic flux. The observed accumulation suggested that Cra, catabolite repressor/activator, as a global transcriptional regulator, might exert control over multiple cellular pathways beyond fructose metabolism. This result underscored the need for a balanced approach when manipulating global regulators, as their deletion could inadvertently impact various metabolic pathways, potentially leading to undesirable byproducts [28, 29].

Instead of direct deletion of fruR, a refined strategy was employed to control CCR on fructose by modulating the binding dynamics of FruR with the fructose PTS regulon [30]. The regulon is composed of fruA, fruB, and fruK; FruAB, the fructose PTS permease, also known as the Enzyme IIFru complex, and fruK, fructose-1-kinase (Fig. 2A). We replaced the native promoter, operator, and 5’ UTR with a synthetically designed promoter-5’ UTR cassette (Fig. 2B). Furthermore, 5’ UTR library was employed to fine-tune both CCR control and consumption rates, and the strains were labeled based on their predicted translation rates, with F1 representing the lowest and F4 the highest (Table 2) [20, 21]. F1 and F2 demonstrated limited efficacy in alleviating CCR, similar to the control strain presumably due to low translational rates of enzymes (Fig. 2C-E). Conversely, F4 exhibited an accelerated uptake rate of fructose, surpassing that of glucose due to an excessively high translational rate (Fig. 2G). Based on the expression level of Fru regulon, the glucose consumption rate exhibited variability, likely due to competition for phosphoenolpyruvate (PEP) [31]. As the fructose uptake rate increased, the glucose uptake rate correspondingly decreased (Fig. 2D-G). Furthermore, glucose was still consumed even after the hydrolysis of sucrose (Supplementary Fig. S3). These observations suggest the presence of competition for phosphorylation within the cell, particularly involving PEP [32]. The optimal strain, F3, showed effective CCR removal (Fig. 2F). F3 demonstrated near-equivalent co-utilization of glucose and fructose, coupled with the highest sugar consumption rate, underscoring its potential as an industrially relevant variant for enhanced sugar metabolism.

Fig. 2 Co-utilization of glucose and fructose by controlling the expression level of fructose PTS regulon with the synthetically designed promoter-5’ UTR cassettes. (A) sucrose, glucose, and fructose uptake system in W strain, (B) replacement of the native Fru regulon promoter-5’ UTR cassette containing the fruR binding site with the synthetic tac promoter-5’ UTR cassette, along with 5’ UTR library; physiology tests for cell growth (blue), sucrose consumption (pink), glucose consumption (green), and fructose consumption (orange) of (C) Rcsc, (D) F1, (E) F2, (F) F3, (G) F4 strains

Table 2 5’ UTR sequences for expression of Fru regulon

Strain	5’ UTR sequence (5’-3’)*	Predicted expression level (a.u.)	
F1	CTTTTTCACTATTTATTCACACAT	3,231	
F2	TCAAATAAAATCTAAGAAAACAAGAATC	12,136	
F3	CAGACTATCTATCTATAAGGTTTTTTT	62,626	
F4	AGCTACAAAGCCAACAACAATAAGGAGTTTTTTA	1,386,568	
*Underlined letters indicate the ribosome binding site

With the alleviation of CCR, there were more carbon sources available for metabolism, leading to the accumulation of acetate (Supplementary Fig. S4). Due to the increased flow rate, acetate could not be eliminated completely, but a reduction by approximately 16% in the F3 strain was observed at 30 h., just before acetate becoming the primary carbon source. FruR is modulated by the concentration of fructose-1,6-biphosphate (FBP) produced by fruK [33]. However, some research suggested that there was no direct relationship between FruR and FBP, indicating that FruR is only affected by fructose-1-phosphate (F1P) [34]. Despite these controversies regarding whether FruR is regulated by FBP, it is clear that FBP is directly regulated by fruK and F1P which is directely influenced by FruR. Constructing a synthetic cassette of the fructose PTS regulon independent of fruR expression enhanced fructose metabolism but could potentially disrupt overall cellular metabolism [35]. FruR regulates approximately 79 regulons, some of which are other transcription factors [36, 37]. Continuous production of FBP can deactivate FruR, potentially leading to the overexpression of genes unrelated to fructose metabolism and a consequent waste of cellular resources. Further improvements might be achieved by inducing mutations in fruR or through adaptive laboratory evolution (ALE) to enhance overall metabolic efficiency [38]. The integration of simultaneous sugar uptake strategies thus represents a promising avenue for biotechnological applications.

Optimizing 3-HP production

To validate the industrial applicability of strains exhibiting increased sucrose consumption rate while simultaneously being able to consume multiple carbon sources, 3-HP was produced using raw material, sugarcane molasses. Multiple heterologous genes were introduced for the construction of the 3-HP pathway in the engineered strain. Harnessing the glycerol pathway as the fundamental route for 3-HP biosynthesis from sugarcane molasses, renowned for its efficiency and productivity, the selection of this pathway was based on the identification of the required enzymes facilitating the conversion from sucrose to glycerol [18]. To convert the carbon sources from sucrose to glycerol, two genes coding for glycerol-3-phosphate dehydrogenase (gpd1) and glycerol-3-phosphatase (gpp2) were expressed [39]. Also, from glycerol to 3-HP, two enzymatic reactions were required, dehydration of glycerol to 3-hydroxypropionaldehyde (3-HPA) and oxidation of 3-HPA, which were catalyzed by glycerol dehydratase (GDHt) and aldehyde dehydrogenase (ALDH), respectively. Synthetically designed 3-HP pathway genes were used in this study to rebalance the pathway for preventing the accumulation of 3-HPA which was toxic, from the previous study [40]. Two plasmids, each designed to accommodate and drive the overexpression of the pathway genes – namely gpd1, gpp2, dhaB1,2,3, gdrA, B, and kgsadh – were used (Fig. 3A and B).

Fig. 3 3-HP production by optimizing the expression level of gapA. (A) synthetic design of the 3-HP pathway plasmids, (B) 3-HP pathway from sucrose, glucose, and fructose along with the enzymes (red, over-expression; blue, repression) that were engineered in the 3-HP producing strain, (C) replacement of the native gapA promoter-5’ UTR cassette with the synthetic promoter-UTR cassette, along with promoter library, (D) 3-HP production (red) bar graph of each strain with cell growth (blue), (E) fed-batch fermentation of the final strain, G100_3HP, using sugarcane molasses as a substrate; cell growth (blue), 3-HP (red), sugar, combination of sucrose, glucose, and fructose (purple), glycerol (green), and acetate (mint)

Previous studies reported that downregulating or replacing native GAPDH to enhance NAD(P)H availability and mitigate futile cycles between endogenous and heterologous enzymes [41, 42]. To assess the potential improvement in 3-HP production, the expression level of gapA was rebalanced with alterations in the upstream carbon flux. This targeted repression aimed to reduce glycolytic pathway fluxes, concurrently enhancing 3-HP production through the glycerol pathway [43, 44]. The expression level of the glycolytic enzyme, gapA was diversified via a promoter library: J23100, J23102, J23107, J23108, J23115 (Fig. 3C) [45]. This regulatory intervention yielded a 1.76-fold increase in the 3-HP titer in G100_3HP strain compared to the control strain (Fig. 3D). Excessive repression of gapA (G115_3HP) yielded suboptimal physiological outcome, highlighting the importance of identifying the optimal flux. Compared to the previous studies utilizing a glycerol pathway and sugar(s) as substrates in E. coli for 3-HP production, this study demonstrated a significant elevated titer, yield, and productivity in batch culture : 5.123 g/L, 0.337 g/g, and 0.142 g/L-h [46, 47].

Fed-batch cultivation of G100_3HP strain with a substrate of sugarcane molasses demonstrated the 3-HP titer of 13.487 g/L and the productivity of 0.180 g/L-h (Fig. 3E; Table 3). In the results of the fed-batch culture, accumulation of acetate was observed, likely due to an overabundance of glycolytic substrates, which demanded a greater presence of respiratory chain proteins to produce ATP through respiration [48]. This could result in a higher proteomic cost for ATP production via respiration than by fermentation. Also, the acetate accumulation might be caused by variations in the composition and amount of multiple carbon sources present in sugarcane molasses [49, 50]. To mitigate acetate accumulation and enhance 3-HP production, redirecting the flux of carbon sources toward cell growth and 3-HP production, rather than byproduct formation, could improve yield. Potential strategies include the overexpression of acetyl-CoA synthetase (acs) to convert acetate to acetyl-CoA, or the deletion of pyruvate oxidase (poxB) to prevent the conversion of pyruvate to acetate [51].

Table 3 Comparison of titer, yield, and productivity of each 3-HP producing strain

Strain	Titer (g/L)	Yield (g/g)	Productivity (g/L-h)	Substrate	Cultivation	
W_3HP	2.904	0.172	0.081	Sucrose (8 g/L) + glucose (8 g/L) + fructose (8 g/L)	Shake-flask/batch	
F3_3HP	3.504	0.248	0.097	
G100_3HP	5.123	0.337	0.142	
G102_3HP	4.634	0.337	0.129	
G107_3HP	3.251	0.144	0.090	
G108_3HP	2.128	0.105	0.059	
G115_3HP	1.319	0.096	0.037	
G100_3HP	13.487	0.182	0.180	Sugarcane molasses (30 g/L, with 30 g/L feed)	Bioreactor/fed-batch	

Despite reducing the expression level of gapA, the presence of available glucose (additional glucose from sucrose breakdown) might induce overflow metabolism to manage the excess resources. Optimization of metabolic flux through a systematic approach could further enhance biochemical production [52]. This outcome not only validated the effectiveness of the engineered regulatory control over gapA, but also highlighted the potential scalability and industrial viability of G100_3HP strain for advanced 3-HP biosynthesis in a fed-batch cultivation setting. The results showed a step forward in optimizing the production of 3-HP, positioning the engineered strain as a promising candidate for bioconversion processes on a larger scale.

To achieve higher 3-HP titers, genetic engineering efforts had been undertaken, including pathway optimization. This involved the design and implementation of synthetic pathways, to enhance the expression of key pathway genes. Specifically, synthetic promoters and 5’ UTRs had been utilized to drive overexpression of these genes, thereby increasing the flux through the 3-HP biosynthetic pathway. Additionally, flux control mechanisms had been incorporated to redirect metabolic flux more effectively towards 3-HP production. By strategically engineering these pathways and optimizing the associated regulatory element (gapA), the overall efficiency and yield of 3-HP production had been improved. However, some fermentation optimizations can be potential further work to improve the titer. To enhance 3-HP production, various parameters could be optimized, including substrate concentration control, two-stage aeration strategies, two-stage pH control, and medium optimization, among others [42, 53–55].

Conclusions

Despite certain limitations in sucrose metabolism in E. coli, the redesigned E. coli W strain, proficient in utilizing sugarcane molasses, emerges as a valuable asset for industrial fermentation. The integration of synthetic csc operon, enhancing sucrose consumption, and the mitigation of CCR for improved co-utilization of glucose and fructose highlight its significance. Additionally, gapA repression contributes to carbon flux redistribution, further amplifying its potential for converting molasses into 3-HP efficiently. This optimized strain not only addresses current limitations in sucrose and fructose metabolism but also paves the way for future applications in sustainable and cost-effective industrial biotechnology.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Supplementary Material 4

Acknowledgements

Not applicable.

Author contributions

GYK: conceptualization, formal analysis, investigation, methodology, visualization, writing, revision. JY: supervision, revision. YHH: revision. SWS: conceptualization, project administration, supervision, revision.

Funding

This work was supported by the Bio & Medical Technology Development Program [NRF-2021M3A9I4024737, NRF-2021M3A9I5023245, and RS-2024-00352569] and a grant [RS-2024-00345885] of the National Research Foundation (NRF) funded by the Korean government (MSIT). We also acknowledge that this work was supported by the Korea Institute of Marine Science & Technology Promotion (KIMST) funded by the Ministry of Oceans and Fisheries [20220258].

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Guan Y Tang Q Fu X Yu S Wu S Chen M Preparation of antioxidants from sugarcane molasses Food Chem 2014 152 552 7 10.1016/j.foodchem.2013.12.016 24444974
Guan Y, Tang Q, Fu X, Yu S, Wu S, Chen M. Preparation of antioxidants from sugarcane molasses. Food Chem. 2014;152:552–7.24444974 10.1016/j.foodchem.2013.12.016
2. Zhang S Wang J Jiang H Microbial production of value-added bioproducts and enzymes from molasses, a by-product of sugar industry Food Chem 2021 346 128860 10.1016/j.foodchem.2020.128860 33385915
Zhang S, Wang J, Jiang H. Microbial production of value-added bioproducts and enzymes from molasses, a by-product of sugar industry. Food Chem. 2021;346:128860.33385915 10.1016/j.foodchem.2020.128860
3. Koutinas AAW Webb R Evaluation of wheat as generic feedstock for chemical production Ind Crops Prod 2004 20 1 19 10.1016/j.indcrop.2003.12.013
Koutinas AAW, Webb R. Evaluation of wheat as generic feedstock for chemical production. Ind Crops Prod. 2004;20(1):19.10.1016/j.indcrop.2003.12.013
4. Bevan MW Franssen MC Investing in green and white biotech Nat Biotechnol 2006 24 7 765 7 10.1038/nbt0706-765 16841055
Bevan MW, Franssen MC. Investing in green and white biotech. Nat Biotechnol. 2006;24(7):765–7.16841055 10.1038/nbt0706-765
5. Tsunekawa H Azuma S Okabe M Okamoto R Aiba S Acquisition of a sucrose utilization system in Escherichia coli K-12 derivatives and its application to industry Appl Environ Microbiol 1992 58 6 2081 8 10.1128/aem.58.6.2081-2088.1992 1622287
Tsunekawa H, Azuma S, Okabe M, Okamoto R, Aiba S. Acquisition of a sucrose utilization system in Escherichia coli K-12 derivatives and its application to industry. Appl Environ Microbiol. 1992;58(6):2081–8.1622287 10.1128/aem.58.6.2081-2088.1992
6. Bockmann J Heuel H Lengeler JW Characterization of a chromosomally encoded, non-PTS metabolic pathway for sucrose utilization in Escherichia coli EC3132 Mol Gen Genet 1992 235 1 22 32 10.1007/BF00286177 1435727
Bockmann J, Heuel H, Lengeler JW. Characterization of a chromosomally encoded, non-PTS metabolic pathway for sucrose utilization in Escherichia coli EC3132. Mol Gen Genet. 1992;235(1):22–32.1435727 10.1007/BF00286177
7. Sabri S Nielsen LK Vickers CE Molecular control of sucrose utilization in Escherichia coli W, an efficient sucrose-utilizing strain Appl Environ Microbiol 2013 79 2 478 87 10.1128/AEM.02544-12 23124236
Sabri S, Nielsen LK, Vickers CE. Molecular control of sucrose utilization in Escherichia coli W, an efficient sucrose-utilizing strain. Appl Environ Microbiol. 2013;79(2):478–87.23124236 10.1128/AEM.02544-12
8. Steen JA Bohlke N Vickers CE Nielsen LK The trehalose phosphotransferase system (PTS) in E. Coli W can transport low levels of sucrose that are sufficient to facilitate induction of the csc sucrose catabolism operon PLoS ONE 2014 9 2 e88688 10.1371/journal.pone.0088688 24586369
Steen JA, Bohlke N, Vickers CE, Nielsen LK. The trehalose phosphotransferase system (PTS) in E. Coli W can transport low levels of sucrose that are sufficient to facilitate induction of the csc sucrose catabolism operon. PLoS ONE. 2014;9(2):e88688.24586369 10.1371/journal.pone.0088688
9. Archer CT Kim JF Jeong H Park JH Vickers CE Lee SY The genome sequence of E. Coli W (ATCC 9637): comparative genome analysis and an improved genome-scale reconstruction of E. Coli BMC Genomics 2011 12 9 10.1186/1471-2164-12-9 21208457
Archer CT, Kim JF, Jeong H, Park JH, Vickers CE, Lee SY, et al. The genome sequence of E. Coli W (ATCC 9637): comparative genome analysis and an improved genome-scale reconstruction of E. Coli. BMC Genomics. 2011;12:9.21208457 10.1186/1471-2164-12-9
10. Bruschi M Boyes SJ Sugiarto H Nielsen LK Vickers CE A transferable sucrose utilization approach for non-sucrose-utilizing Escherichia coli strains Biotechnol Adv 2012 30 5 1001 10 10.1016/j.biotechadv.2011.08.019 21907272
Bruschi M, Boyes SJ, Sugiarto H, Nielsen LK, Vickers CE. A transferable sucrose utilization approach for non-sucrose-utilizing Escherichia coli strains. Biotechnol Adv. 2012;30(5):1001–10.21907272 10.1016/j.biotechadv.2011.08.019
11. Lee JW Choi S Park JH Vickers CE Nielsen LK Lee SY Development of sucrose-utilizing Escherichia coli K-12 strain by cloning beta-fructofuranosidases and its application for L-threonine production Appl Microbiol Biotechnol 2010 88 4 905 13 10.1007/s00253-010-2825-7 20711572
Lee JW, Choi S, Park JH, Vickers CE, Nielsen LK, Lee SY. Development of sucrose-utilizing Escherichia coli K-12 strain by cloning beta-fructofuranosidases and its application for L-threonine production. Appl Microbiol Biotechnol. 2010;88(4):905–13.20711572 10.1007/s00253-010-2825-7
12. Mohamed ET Mundhada H Landberg J Cann I Mackie RI Nielsen AT Generation of an E. coli platform strain for improved sucrose utilization using adaptive laboratory evolution Microb Cell Fact 2019 18 1 116 10.1186/s12934-019-1165-2 31255177
Mohamed ET, Mundhada H, Landberg J, Cann I, Mackie RI, Nielsen AT, et al. Generation of an E. coli platform strain for improved sucrose utilization using adaptive laboratory evolution. Microb Cell Fact. 2019;18(1):116.31255177 10.1186/s12934-019-1165-2
13. Shukla VB Zhou S Yomano LP Shanmugam KT Preston JF Ingram LO Production of D(-)-lactate from sucrose and molasses Biotechnol Lett 2004 26 9 689 93 10.1023/B:BILE.0000024088.36803.4e 15195965
Shukla VB, Zhou S, Yomano LP, Shanmugam KT, Preston JF, Ingram LO. Production of D(-)-lactate from sucrose and molasses. Biotechnol Lett. 2004;26(9):689–93.15195965 10.1023/B:BILE.0000024088.36803.4e
14. Moon TS Engineering the Future through Synthetic Biology Biotechnol Bioprocess Eng 2023 28 3 10.1007/s12257-022-0191-9
Moon TS. Engineering the Future through Synthetic Biology. Biotechnol Bioprocess Eng. 2023;28:3.10.1007/s12257-022-0191-9
15. Deutscher J The mechanisms of carbon catabolite repression in bacteria Curr Opin Microbiol 2008 11 2 87 93 10.1016/j.mib.2008.02.007 18359269
Deutscher J. The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol. 2008;11(2):87–93.18359269 10.1016/j.mib.2008.02.007
16. Carreon-Rodriguez OE, Gosset G, Escalante A, Bolivar F. Glucose Transport in Escherichia coli: from basics to Transport Engineering. Microorganisms. 2023;11(6).
17. Nasvall J Knoppel A Andersson DI Duplication-insertion recombineering: a fast and scar-free method for efficient transfer of multiple mutations in bacteria Nucleic Acids Res 2017 45 5 e33 10.1093/nar/gkw1078 27899661
Nasvall J, Knoppel A, Andersson DI. Duplication-insertion recombineering: a fast and scar-free method for efficient transfer of multiple mutations in bacteria. Nucleic Acids Res. 2017;45(5):e33.27899661 10.1093/nar/gkw1078
18. Kim JW Ko YS Chae TU Lee SY High-level production of 3-hydroxypropionic acid from glycerol as a sole carbon source using metabolically engineered Escherichia coli Biotechnol Bioeng 2020 117 7 2139 52 10.1002/bit.27344 32227471
Kim JW, Ko YS, Chae TU, Lee SY. High-level production of 3-hydroxypropionic acid from glycerol as a sole carbon source using metabolically engineered Escherichia coli. Biotechnol Bioeng. 2020;117(7):2139–52.32227471 10.1002/bit.27344
19. Arifin Y Sabri S Sugiarto H Kromer JO Vickers CE Nielsen LK Deletion of cscR in Escherichia coli W improves growth and poly-3-hydroxybutyrate (PHB) production from sucrose in fed batch culture J Biotechnol 2011 156 4 275 8 10.1016/j.jbiotec.2011.07.003 21782859
Arifin Y, Sabri S, Sugiarto H, Kromer JO, Vickers CE, Nielsen LK. Deletion of cscR in Escherichia coli W improves growth and poly-3-hydroxybutyrate (PHB) production from sucrose in fed batch culture. J Biotechnol. 2011;156(4):275–8.21782859 10.1016/j.jbiotec.2011.07.003
20. Seo SW Yang JS Kim I Yang J Min BE Kim S Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency Metab Eng 2013 15 67 74 10.1016/j.ymben.2012.10.006 23164579
Seo SW, Yang JS, Kim I, Yang J, Min BE, Kim S, et al. Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency. Metab Eng. 2013;15:67–74.23164579 10.1016/j.ymben.2012.10.006
21. LaFleur TL Hossain A Salis HM Automated model-predictive design of synthetic promoters to control transcriptional profiles in bacteria Nat Commun 2022 13 1 5159 10.1038/s41467-022-32829-5 36056029
LaFleur TL, Hossain A, Salis HM. Automated model-predictive design of synthetic promoters to control transcriptional profiles in bacteria. Nat Commun. 2022;13(1):5159.36056029 10.1038/s41467-022-32829-5
22. Registry of Standard Biological Parts. https://parts.igem.org/Promoters/Catalog/Ecoli/Constitutive
23. Lin DW Liu Y Lee YQ Yang PJ Ho CT Hong JC Construction of intracellular asymmetry and asymmetric division in Escherichia coli Nat Commun 2021 12 1 888 10.1038/s41467-021-21135-1 33563962
Lin DW, Liu Y, Lee YQ, Yang PJ, Ho CT, Hong JC, et al. Construction of intracellular asymmetry and asymmetric division in Escherichia coli. Nat Commun. 2021;12(1):888.33563962 10.1038/s41467-021-21135-1
24. Zhao M Li Y Wang F Ren Y Wei D A CRISPRi mediated self-inducible system for dynamic regulation of TCA cycle and improvement of itaconic acid production in Escherichia coli Synth Syst Biotechnol 2022 7 3 982 8 10.1016/j.synbio.2022.05.008 35782485
Zhao M, Li Y, Wang F, Ren Y, Wei D. A CRISPRi mediated self-inducible system for dynamic regulation of TCA cycle and improvement of itaconic acid production in Escherichia coli. Synth Syst Biotechnol. 2022;7(3):982–8.35782485 10.1016/j.synbio.2022.05.008
25. Zhou L Ding Q Jiang GZ Liu ZN Wang HY Zhao GR Chromosome engineering of Escherichia coli for constitutive production of salvianic acid A Microb Cell Fact 2017 16 1 84 10.1186/s12934-017-0700-2 28511681
Zhou L, Ding Q, Jiang GZ, Liu ZN, Wang HY, Zhao GR. Chromosome engineering of Escherichia coli for constitutive production of salvianic acid A. Microb Cell Fact. 2017;16(1):84.28511681 10.1186/s12934-017-0700-2
26. Chen YJ Liu P Nielsen AA Brophy JA Clancy K Peterson T Characterization of 582 natural and synthetic terminators and quantification of their design constraints Nat Methods 2013 10 7 659 64 10.1038/nmeth.2515 23727987
Chen YJ, Liu P, Nielsen AA, Brophy JA, Clancy K, Peterson T, et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nat Methods. 2013;10(7):659–64.23727987 10.1038/nmeth.2515
27. Jung MY Jung HM Lee J Oh MK Alleviation of carbon catabolite repression in Enterobacter aerogenes for efficient utilization of sugarcane molasses for 2,3-butanediol production Biotechnol Biofuels 2015 8 106 10.1186/s13068-015-0290-3 26236395
Jung MY, Jung HM, Lee J, Oh MK. Alleviation of carbon catabolite repression in Enterobacter aerogenes for efficient utilization of sugarcane molasses for 2,3-butanediol production. Biotechnol Biofuels. 2015;8:106.26236395 10.1186/s13068-015-0290-3
28. Yao RK Shimizu H Effect of cra gene mutation on the metabolism of Escherichia coli for a mixture of multiple carbon sources Adv Bioscience Biotechnol 2013 4 10 10.4236/abb.2013.43A063
Yao RK, Shimizu H. Effect of cra gene mutation on the metabolism of Escherichia coli for a mixture of multiple carbon sources. Adv Bioscience Biotechnol. 2013;4:10.10.4236/abb.2013.43A063
29. Kim D Seo SW Gao Y Nam H Guzman GI Cho BK Systems assessment of transcriptional regulation on central carbon metabolism by Cra and CRP Nucleic Acids Res 2018 46 6 2901 17 10.1093/nar/gky069 29394395
Kim D, Seo SW, Gao Y, Nam H, Guzman GI, Cho BK, et al. Systems assessment of transcriptional regulation on central carbon metabolism by Cra and CRP. Nucleic Acids Res. 2018;46(6):2901–17.29394395 10.1093/nar/gky069
30. Shimada T Fujita N Maeda M Ishihama A Systematic search for the Cra-binding promoters using genomic SELEX system Genes Cells 2005 10 9 907 18 10.1111/j.1365-2443.2005.00888.x 16115199
Shimada T, Fujita N, Maeda M, Ishihama A. Systematic search for the Cra-binding promoters using genomic SELEX system. Genes Cells. 2005;10(9):907–18.16115199 10.1111/j.1365-2443.2005.00888.x
31. Deutscher J Ake FM Derkaoui M Zebre AC Cao TN Bouraoui H The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions Microbiol Mol Biol Rev 2014 78 2 231 56 10.1128/MMBR.00001-14 24847021
Deutscher J, Ake FM, Derkaoui M, Zebre AC, Cao TN, Bouraoui H, et al. The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions. Microbiol Mol Biol Rev. 2014;78(2):231–56.24847021 10.1128/MMBR.00001-14
32. Deutscher J Francke C Postma PW How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria Microbiol Mol Biol Rev 2006 70 4 939 1031 10.1128/MMBR.00024-06 17158705
Deutscher J, Francke C, Postma PW. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 2006;70(4):939–1031.17158705 10.1128/MMBR.00024-06
33. Wang CY Lempp M Farke N Donati S Glatter T Link H Metabolome and proteome analyses reveal transcriptional misregulation in glycolysis of engineered E. Coli Nat Commun 2021 12 1 4929 10.1038/s41467-021-25142-0 34389727
Wang CY, Lempp M, Farke N, Donati S, Glatter T, Link H. Metabolome and proteome analyses reveal transcriptional misregulation in glycolysis of engineered E. Coli. Nat Commun. 2021;12(1):4929.34389727 10.1038/s41467-021-25142-0
34. Bley Folly B Ortega AD Hubmann G Bonsing-Vedelaar S Wijma HJ van der Meulen P Assessment of the interaction between the flux-signaling metabolite fructose-1,6-bisphosphate and the bacterial transcription factors CggR and Cra Mol Microbiol 2018 109 3 278 90 10.1111/mmi.14008 29923648
Bley Folly B, Ortega AD, Hubmann G, Bonsing-Vedelaar S, Wijma HJ, van der Meulen P, et al. Assessment of the interaction between the flux-signaling metabolite fructose-1,6-bisphosphate and the bacterial transcription factors CggR and Cra. Mol Microbiol. 2018;109(3):278–90.29923648 10.1111/mmi.14008
35. Ramseier TM Bledig S Michotey V Feghali R Saier MH Jr. The global regulatory protein FruR modulates the direction of carbon flow in Escherichia coli Mol Microbiol 1995 16 6 1157 69 10.1111/j.1365-2958.1995.tb02339.x 8577250
Ramseier TM, Bledig S, Michotey V, Feghali R, Saier MH. Jr. The global regulatory protein FruR modulates the direction of carbon flow in Escherichia coli. Mol Microbiol. 1995;16(6):1157–69.8577250 10.1111/j.1365-2958.1995.tb02339.x
36. Ow DS Lee RM Nissom PM Philp R Oh SK Yap MG Inactivating FruR global regulator in plasmid-bearing Escherichia coli alters metabolic gene expression and improves growth rate J Biotechnol 2007 131 3 261 9 10.1016/j.jbiotec.2007.07.508 17719117
Ow DS, Lee RM, Nissom PM, Philp R, Oh SK, Yap MG. Inactivating FruR global regulator in plasmid-bearing Escherichia coli alters metabolic gene expression and improves growth rate. J Biotechnol. 2007;131(3):261–9.17719117 10.1016/j.jbiotec.2007.07.508
37. RegulonDB. Available from. https://regulondb.ccg.unam.mx/
38. Chen M Liang H Han C Zhou P Xing Z Chen Q Engineering of global transcription factor FruR to redirect the carbon flow in Escherichia coli for enhancing L-phenylalanine biosynthesis Microb Cell Fact 2022 21 1 222 10.1186/s12934-022-01954-7 36289548
Chen M, Liang H, Han C, Zhou P, Xing Z, Chen Q, et al. Engineering of global transcription factor FruR to redirect the carbon flow in Escherichia coli for enhancing L-phenylalanine biosynthesis. Microb Cell Fact. 2022;21(1):222.36289548 10.1186/s12934-022-01954-7
39. Jung IY Lee JW Min WK Park YC Seo JH Simultaneous conversion of glucose and xylose to 3-hydroxypropionic acid in engineered Escherichia coli by modulation of sugar transport and glycerol synthesis Bioresour Technol 2015 198 709 16 10.1016/j.biortech.2015.09.079 26441028
Jung IY, Lee JW, Min WK, Park YC, Seo JH. Simultaneous conversion of glucose and xylose to 3-hydroxypropionic acid in engineered Escherichia coli by modulation of sugar transport and glycerol synthesis. Bioresour Technol. 2015;198:709–16.26441028 10.1016/j.biortech.2015.09.079
40. Lim HG Noh MH Jeong JH Park S Jung GY Optimum rebalancing of the 3-Hydroxypropionic acid production pathway from glycerol in Escherichia coli ACS Synth Biol 2016 5 11 1247 55 10.1021/acssynbio.5b00303 27056171
Lim HG, Noh MH, Jeong JH, Park S, Jung GY. Optimum rebalancing of the 3-Hydroxypropionic acid production pathway from glycerol in Escherichia coli. ACS Synth Biol. 2016;5(11):1247–55.27056171 10.1021/acssynbio.5b00303
41. Martinez I Zhu J Lin H Bennett GN San KY Replacing Escherichia coli NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) with a NADP-dependent enzyme from Clostridium acetobutylicum facilitates NADPH dependent pathways Metab Eng 2008 10 6 352 9 10.1016/j.ymben.2008.09.001 18852061
Martinez I, Zhu J, Lin H, Bennett GN, San KY. Replacing Escherichia coli NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) with a NADP-dependent enzyme from Clostridium acetobutylicum facilitates NADPH dependent pathways. Metab Eng. 2008;10(6):352–9.18852061 10.1016/j.ymben.2008.09.001
42. Zhao P Tian P Biosynthesis pathways and strategies for improving 3-hydroxypropionic acid production in bacteria World J Microbiol Biotechnol 2021 37 7 117 10.1007/s11274-021-03091-6 34128152
Zhao P, Tian P. Biosynthesis pathways and strategies for improving 3-hydroxypropionic acid production in bacteria. World J Microbiol Biotechnol. 2021;37(7):117.34128152 10.1007/s11274-021-03091-6
43. Kildegaard KR Jensen NB Schneider K Czarnotta E Ozdemir E Klein T Engineering and systems-level analysis of Saccharomyces cerevisiae for production of 3-hydroxypropionic acid via malonyl-CoA reductase-dependent pathway Microb Cell Fact 2016 15 53 10.1186/s12934-016-0451-5 26980206
Kildegaard KR, Jensen NB, Schneider K, Czarnotta E, Ozdemir E, Klein T, et al. Engineering and systems-level analysis of Saccharomyces cerevisiae for production of 3-hydroxypropionic acid via malonyl-CoA reductase-dependent pathway. Microb Cell Fact. 2016;15:53.26980206 10.1186/s12934-016-0451-5
44. Batista RS Chaves GL Oliveira DB Pantaleao VL Neves J da Silva AJ Glycerol as substrate and NADP(+)-dependent glyceraldehyde-3-phosphate dehydrogenase enable higher production of 3-hydroxypropionic acid through the beta-alanine pathway in E. Coli Bioresour Technol 2024 393 130142 10.1016/j.biortech.2023.130142 38049020
Batista RS, Chaves GL, Oliveira DB, Pantaleao VL, Neves J, da Silva AJ. Glycerol as substrate and NADP(+)-dependent glyceraldehyde-3-phosphate dehydrogenase enable higher production of 3-hydroxypropionic acid through the beta-alanine pathway in E. Coli. Bioresour Technol. 2024;393:130142.38049020 10.1016/j.biortech.2023.130142
45. Seok JY Han YH Yang JS Yang J Lim HG Kim SG Synthetic biosensor accelerates evolution by rewiring carbon metabolism toward a specific metabolite Cell Rep 2021 36 8 109589 10.1016/j.celrep.2021.109589 34433019
Seok JY, Han YH, Yang JS, Yang J, Lim HG, Kim SG, et al. Synthetic biosensor accelerates evolution by rewiring carbon metabolism toward a specific metabolite. Cell Rep. 2021;36(8):109589.34433019 10.1016/j.celrep.2021.109589
46. Matsakas LH, Rova K, Christakopoulos U. P. Biological Production of 3-Hydroxypropionic Acid: an update on the current status. Fermentation. 2018;4(1).
47. Kumar V Ashok S Park S Recent advances in biological production of 3-hydroxypropionic acid Biotechnol Adv 2013 31 6 945 61 10.1016/j.biotechadv.2013.02.008 23473969
Kumar V, Ashok S, Park S. Recent advances in biological production of 3-hydroxypropionic acid. Biotechnol Adv. 2013;31(6):945–61.23473969 10.1016/j.biotechadv.2013.02.008
48. Kim K Hou CY Choe D Kang M Cho S Sung BH Adaptive laboratory evolution of Escherichia coli W enhances gamma-aminobutyric acid production using glycerol as the carbon source Metab Eng 2022 69 59 72 10.1016/j.ymben.2021.11.004 34775076
Kim K, Hou CY, Choe D, Kang M, Cho S, Sung BH, et al. Adaptive laboratory evolution of Escherichia coli W enhances gamma-aminobutyric acid production using glycerol as the carbon source. Metab Eng. 2022;69:59–72.34775076 10.1016/j.ymben.2021.11.004
49. Bernal V Castano-Cerezo S Canovas M Acetate metabolism regulation in Escherichia coli: carbon overflow, pathogenicity, and beyond Appl Microbiol Biotechnol 2016 100 21 8985 9001 10.1007/s00253-016-7832-x 27645299
Bernal V, Castano-Cerezo S, Canovas M. Acetate metabolism regulation in Escherichia coli: carbon overflow, pathogenicity, and beyond. Appl Microbiol Biotechnol. 2016;100(21):8985–9001.27645299 10.1007/s00253-016-7832-x
50. Zhu LZ Wang H Screening a panel of acid-producing strains by developing a high-throughput Method Biotechnol Bioprocess Eng 2022 27 8 10.1007/s12257-022-0146-1
Zhu LZ, Wang H. Screening a panel of acid-producing strains by developing a high-throughput Method. Biotechnol Bioprocess Eng. 2022;27:8.10.1007/s12257-022-0146-1
51. Enjalbert B Millard P Dinclaux M Portais JC Letisse F Acetate fluxes in Escherichia coli are determined by the thermodynamic control of the Pta-AckA pathway Sci Rep 2017 7 42135 10.1038/srep42135 28186174
Enjalbert B, Millard P, Dinclaux M, Portais JC, Letisse F. Acetate fluxes in Escherichia coli are determined by the thermodynamic control of the Pta-AckA pathway. Sci Rep. 2017;7:42135.28186174 10.1038/srep42135
52. Valgepea K Adamberg K Nahku R Lahtvee PJ Arike L Vilu R Systems biology approach reveals that overflow metabolism of acetate in Escherichia coli is triggered by carbon catabolite repression of acetyl-CoA synthetase BMC Syst Biol 2010 4 166 10.1186/1752-0509-4-166 21122111
Valgepea K, Adamberg K, Nahku R, Lahtvee PJ, Arike L, Vilu R. Systems biology approach reveals that overflow metabolism of acetate in Escherichia coli is triggered by carbon catabolite repression of acetyl-CoA synthetase. BMC Syst Biol. 2010;4:166.21122111 10.1186/1752-0509-4-166
53. Wang X, Cui Z, Sun X, Wang Z, Chen T. Production of 3-Hydroxypropionic acid from renewable substrates by metabolically Engineered microorganisms: a review. Molecules. 2023;28(4).
54. de Fouchecour F Sanchez-Castaneda AK Saulou-Berion C Spinnler HE Process engineering for microbial production of 3-hydroxypropionic acid Biotechnol Adv 2018 36 4 1207 22 10.1016/j.biotechadv.2018.03.020 29608950
de Fouchecour F, Sanchez-Castaneda AK, Saulou-Berion C, Spinnler HE. Process engineering for microbial production of 3-hydroxypropionic acid. Biotechnol Adv. 2018;36(4):1207–22.29608950 10.1016/j.biotechadv.2018.03.020
55. Zhang Y Yun J Zabed HM Dou Y Zhang G Zhao M High-level co-production of 3-hydroxypropionic acid and 1,3-propanediol from glycerol: metabolic engineering and process optimization Bioresour Technol 2023 369 128438 10.1016/j.biortech.2022.128438 36470488
Zhang Y, Yun J, Zabed HM, Dou Y, Zhang G, Zhao M, et al. High-level co-production of 3-hydroxypropionic acid and 1,3-propanediol from glycerol: metabolic engineering and process optimization. Bioresour Technol. 2023;369:128438.36470488 10.1016/j.biortech.2022.128438
