
==== Front
Acta Biochim Biophys Sin (Shanghai)
Acta Biochim Biophys Sin (Shanghai)
ABBS
Acta Biochimica et Biophysica Sinica
1672-9145
1745-7270
Science Press

38676398
10.3724/abbs.2024051
Research Article
miR-194-3p regulates epithelial-mesenchymal transition in embryonic epicardial cells via p120/β-catenin signaling
miR-194-3p regulates EMT via p120/β-catenin
Xiong Tianhua
Wang Dinghui
Yang Huiping
Liu Bin
Li Yingrui
Yu Wenlong
Wang Jing
She Qiang *
Department of Cardiology The Second Affiliated Hospital of Chongqing Medical University Chongqing 400010 China
Correspondence address. Tel: +86-13508393602; qshe98@cqmu.edu.cn
26 4 2024
25 5 2024
56 5 717729
31 10 2023
25 12 2023
© The Author(s) 2024.
2024
The Author(s)
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/).

The epicardium is integral to cardiac development and facilitates endogenous heart regeneration and repair. While miR-194-3p is associated with cellular migration and invasion, its impact on epicardial cells remains uncharted. In this work we use gain-of-function and loss-of-function methodologies to investigate the function of miR-194-3p in cardiac development. We culture embryonic epicardial cells in vitro and subject them to transforming growth factor β (TGF-β) treatment to induce epithelial-mesenchymal transition (EMT) and monitor miR-194-3p expression. In addition, the effects of miR-194-3p mimics and inhibitors on epicardial cell development and changes in EMT are investigated. To validate the binding targets of miR-194-3p and its ability to recover the target gene-phenotype, we produce a mutant vector p120-catenin-3′UTR-MUT. In epicardial cells, TGF-β-induced EMT results in a notable overexpression of miR-194-3p. The administration of miR-194-3p mimics promotes EMT, which is correlated with elevated levels of mesenchymal markers. Conversely, miR-194-3p inhibitor attenuates EMT. Further investigations reveal a negative correlation between miR-194-3p and p120-catenin, which influences β-catenin level in the cell adhesion pathway. The suppression of EMT caused by the miR-194-3p inhibitor is balanced by silencing of p120-catenin. In conclusion, miR-194-3p directly targets p120-catenin and modulates its expression, which in turn alters β-catenin expression, critically influencing the EMT process in the embryonic epicardial cells via the cell adhesion mechanism.

embryonic epicardial cells
epithelial-mesenchymal transition
development
miR-194-3p
p120-catenin
the grants from the Key Project of Technology Innovation and Application Development in ChongqingNo. CSTB2023TIAD-KPX0048 the Construction of Graduate Tutor Team in Chongqing Medical UniversityNo. cqmudstd202205 the National Natural Science Foundation of China Youth Science Fund ProjectNo. 81800254 and the Postdoctoral Project of Chongqing Natural Science FoundationNo. CSTB2022NSCQ-BHX0626 This work was supported by the grants from the Key Project of Technology Innovation and Application Development in Chongqing (No. CSTB2023TIAD-KPX0048), the Construction of Graduate Tutor Team in Chongqing Medical University (No. cqmudstd202205), the National Natural Science Foundation of China Youth Science Fund Project (No. 81800254), and the Postdoctoral Project of Chongqing Natural Science Foundation (No. CSTB2022NSCQ-BHX0626).CitationT Xiong, D Wang, H Yang, B Liu, Y Li, W Yu, J Wang, et al. miR-194-3p regulates epithelial-mesenchymal transition in embryonic epicardial cells via p120/β-catenin signaling. Acta Biochim Biophys Sin, 2024, Vol.: fpage–lpage, https://doi.org/10.3724/abbs.2024051
Crossmark2024/4/8 11:43:29
AuthorMarkT Xiong
AuthorMarkCiteT Xiong, D Wang, H Yang, B Liu, Y Li, W Yu, J Wang, et al.
article-titlemiR-194-3p regulates epithelial-mesenchymal transition in embryonic epicardial cells via p120/β-catenin signaling
==== Body
pmcIntroduction

Cardiovascular illnesses continue to be one of the most serious global health threats, endangering the lives of millions of people. Central to the heart’s function is the epicardium, an integral component that plays an essential role in cardiac development and endogenous regenerative processes [1]. A single layer of precursor epicardial cells develops into smooth muscle and fibroblasts, which in turn formcardiac endothelial cells and interstitial cells [ 2, 3]. By embryonic day (E) 9.5 in mice, precursor epicardial cells attach to the myocardium and crease in the epithelial layer to form a single cell layer that envelops the entire myocardium [4]. By E11.5, the heart is fully covered by epicardial cells, exhibiting a cuboidal epithelial phenotype [5]. Membrane adhesion molecules such as β-catenin and E-cadherin are expressed to preserve the integrity and top-to-base polarity of the epicardial cell layer [6]. Numerous genes encoding transcription factors, such as Wilms tumor 1 (Wt1) [7], transcription factor 21 (Tcf21) [8], and T-box transcription factor 18 (Tbx18) [9], are expressed in the epicardium.

Epithelial-mesenchymal transition (EMT), which occurs as the epicardium differentiates, is followed by stratification, which results in the formation of cells derived from the epicardium that span the gap between the epicardium and myocardium. These cells form the sub-epicardial mesenchyme and infiltrate the myocardium, where they evolve into supporting cells of the heart [ 10‒ 13]. TGF-β is among the most extensively studied upstream regulatory molecules for EMT and extracellular matrix (ECM) production [14]. TGF-β1–3 isoforms are expressed in the epicardium of mice at E12.5, and they bind to the same receptor complex, collectively inducing epithelial cell EMT [ 15‒ 18]. The transition of primary epithelial tissue into highly motile mesenchymal cells is a characteristic feature of the development of multicellular organisms. It promotes the growth and development of organisms by enabling epithelial cells to migrate inside the ECM and build tissues at particular sites [11]. Notably, the molecular mechanisms underlying the differentiation of epicardium-derived cells into distinct cell types during cardiac development remain elusive. Interestingly, adult epicardial cells are mostly quiescent, but when they are subjected to damage, they become active and aid in repair by re-expressing the adult heart’s developmental programs [19].

MicroRNAs, comprising 19–25 nucleotides, constitute a vital subset of small noncoding RNAs pivotal in post-transcriptional regulation of gene expression by targeting the 3′UTR of coding RNAs, resulting in the inhibition of protein translation and facilitation of mRNA degradation [20]. The essential involvement of miR-194-3p in cellular migratory and invasive activities has been shown in recent scientific reports [ 21‒ 23]. However, the precise modulatory role of miR-194-3p in the EMT of the epicardium during cardiac embryogenesis still needs to be addressed. Notably, while many in vitro models have been established to investigate epicardial EMT [ 24, 25], the regulatory orchestration of microRNAs, especially that of miR-194-3p, in this physiological transition has yet to be explored. Based on our research, we propose that miR-194-3p plays a crucial role in mediating epicardial EMT, possibly by influencing the cell adhesion signaling pathway.

At the forefront of this research gap, our work aimed to clarify the effects of miR-194-3p on cardiac development by analyzing the molecular mechanisms underlying its modulation of epicardial cell EMT using cultured embryonic epicardial cells.

Materials and Methods

Animals

C57BL/6J mice (males and females, 8 weeks old, weight: 20–25 g each) were provided by Chongqing Medical University Animal Breeding Center (Chongqing, China) and were kept under ideal conditions (humidity 40%±10%, temperature 23±2°C, and 12 h light-dark cycle). All the breeding and experimental procedures were conducted in accordance with protocols approved by the Animal Protection and Use Committee of Chongqing Medical University. All animal studies adhered to the ARRIVE guidelines [26]. C57BL/6J female and male mice were co-housed at a ratio of 1:2 or 1:3 starting at 8 p.m. for mating. When a vaginal plug was found in the female mice by 8 a.m. on the next day, the embryonic age was recorded as E0.5.

In vitro culture of embryonic epicardial cells and primary neonatal mouse cardiomyocytes

Sterilized 1% gelatin (BioFroxx, Einhausen, Germany) was applied to 12-well plates, and the plates were left to air dry. For immunofluorescence samples, a 14 mm×14 mm coverslip was placed in the plate prior to gelatin coating. Embryonic mouse hearts were harvested at E12.5, and the ventricles were transferred to a pre-cooled DMEM medium (Gibco, Waltham, USA). These ventricles were then precisely positioned in the gelatin-coated plate and covered with a coverslip. After addition of complete cell culture medium, the plates were incubated at 37°C with 5% CO 2. After 1–2 days, the emergence of cobblestone-like epicardial cells was observed around the ventricles. The coverslips were subsequently rotated, the ventricles were removed, and the wells were washed with PBS before addition of fresh culture medium. The medium was refreshed every two days, and cell morphology was continuously monitored.

Neonatal cardiomyocytes were isolated from 1-day-old C57BL/6J mice. The mice were anesthetized with a 10-min cold exposure, then euthanized and their bodies were disinfected with 75% ethanol. The heart was exposed by an incision along the left side of the sternum and subsequently dissected in a sterile environment into an ice-cold enzyme-free dissociation solution. Atria and large vessels were removed over sterile gauze, and ventricular tissue was minced before being subjected to enzymatic digestion in a 37°C water bath with periodic agitation. The digested tissue was sequentially centrifuged (80 g, 37°C, and 5 min) in the presence of fetal bovine serum, and the supernatants were discarded. After multiple digestion steps, cells from all collections were pooled, filtered through a 40-μm mesh and centrifuged (80 g, 37°C, and 5 min). The resulting cell pellet was resuspended in fresh culture medium and allowed to adhere for 60 min. The non-adherent cells were collected and seeded into 6-well plates that had been coated with 1% gelatin under aseptic conditions. Cells were cultured at 37°C with 5% CO 2, with medium changed every two days.

Cell treatment

Primary epicardial cells isolated from embryos were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) (Gibco), 100 U/mL penicillin (Beyotime Biotechnology, Shanghai, China), and 100 μg/mL streptomycin (Beyotime Biotechnology) in a humidified atmosphere at 37°C with 5% CO 2. For TGF-β treatment experiments, after two days in culture, cells were exposed to fresh complete culture medium containing TGF-β1 recombinant protein (Abcam, Cambridge, UK) at a concentration of 10 ng/mL. After 48 h of treatment, cellular changes were observed to assess TGF-β-induced differentiation.

Immunocytochemistry assay

The cells were washed with phosphate-buffered saline (PBS) three times, fixed in 4% paraformaldehyde (Boster Biological Technology Co., Ltd, Wuhan, China) for 10 min, and permeabilized using 0.25% Triton X-100 (Solarbio Science & Technology Co., Ltd, Beijing, China) for 10 min. After being blocked with 10% goat serum solution (Beyotime Biotechnology) for 30 min, they were incubated with the primary antibody (1:100 dilution) overnight at 4°C. The antibodies used included anti-Tbx18 (Abcam), anti-Wilms Tumor Protein antibody (Abcam), anti-Vimentin (Cell Signaling Technology, Danvers, USA) and anti-PDGFRα (Cell Signaling Technology). After another wash with PBS, cells were exposed to goat anti-rabbit IgG H&L-FITC (Abcam) or goat anti-mouse IgG H&L-TRITC (Abcam) secondary antibody (1:100 dilution) at 37°C for 45 min. Nuclear staining was performed with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime Biotechnology) for 5 min. Finally, anti-fade reagents (Beyotime Biotechnology) were used to mount the specimens, and mages were captured with a confocal fluorescence microscope (Nikon, Tokyo, Japan).

Transfection and dual-luciferase reporter assay

For miRNA and siRNA transfection, RFect PM primary cell small nucleic acid transfection reagent (BaiDai Biotech, Changzhou, China) was utilized. A mixture of RFect PM reagent and the desired miR-194 mimic (or inhibitor) or p120 siRNA (sense strand sequence: 5′-GAGGUGCCGCCUGAUCAGUAC-3′, antisense strand sequence: 5′-ACUGAUCAGGCGGCACCUCUU-3′) diluted in Opti-MEM medium (Gibco) was prepared. After incubation at room temperature for a specific period, the mixture was added to the cells. Following a brief incubation period, the medium was then replaced by a fresh complete medium. Subsequent to transfection, cells in a 96-well plate were cotransfected with a dual-luciferase reporter vector containing the 3′UTR of the target gene harboring the putative miRNA binding site, along with the respective miR-194 mimic (guide strand sequence: 5′-CCAGUGGAGCUGCUGUUACUUC-3′, passenger strand sequence: 5′-GAAGUAACAGCAGCUCCACUGG-3′)miR-194 mimic NC (guide strand sequence: 5′-UUCUCCGAACGUGUCACGU-3′, passenger strand sequence: 5′-ACGUGACACGUUCGGAGAA-3′), miR-194 inhibitor (sequence: 5′-GAACAAGCAGCUCCACUGG-3′), or miR-194 inhibitor NC (sequence: 5′-CAGUACUUUUGUGUAGUACAA-3′). For normalization, reporter constructs containing a mutated 3′UTR miRNA binding site were used as controls. Approximately 48 h after transfection, the cells were lysed, and the luciferase activity was assessed using a Dual-Luciferase Reporter Assay System (Sangon Biotech, Shanghai, China). Firefly luciferase readings were standardized against Renilla luciferase activity.

Wound healing assay

Embryonic epicardial cells were transfected with miRNA mimic or inhibitor and incubated for 48 h. These cells were cultured in 12-well plates. A straight scratch wound was created in the center of each well using a sterile 200-μL pipette tip. After removal of cell debris by gentle washing with PBS, the remaining cells in the plate were cultured in fresh medium. The wound was photographed at time intervals of 0, 4, 8, and 12 h using an inverted microscope (Nikon). The initial wound width and the width at each time point were compared to calculate the migration rate.

Western blot analysis

Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (Beyotime Biotechnology) supplemented with protease and phosphatase inhibitors. The total protein concentration was determined using the Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime Biotechnology). Equal amounts of protein from each sample were separated by 10% SDS-PAGE and subsequently electrotransferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories, Inc., Hercules, USA). The membrane was blocked for 1 h at room temperature with 5% non-fat milk in TBST (Tris-buffered saline with 0.1% Tween 20), and then incubated overnight at 4°C with specific primary antibodies diluted in blocking buffer. The antibodies used included anti-delta 1 catenin (Abcam), anti-E-cadherin (Cell Signaling Technology), anti-vimentin (Cell Signaling Technology), anti-PDGFRα (Cell Signaling Technology), and anti-β-actin (Cell Signaling Technology). Membranes were washed three times with TBST and then incubated with the corresponding horseradish peroxidase-conjugated anti-rabbit IgG H&L secondary antibody (Abcam) for 1 h at room temperature. Following three times wash with TBST, protein bands were visualized using Omni-ECL TM Enhanced Pico Light Chemiluminescence Kit (Epizyme Biotech, Shanghai, China) and band intensities were measured by densitometry using β-actin as a loading control.

Quantitative real-time PCR (qRT-PCR) analysis

Total RNA was extracted from primary embryonic epicardial cells using the TRIzol (TM) Reagent (Thermo Fisher Scientific, Waltham, USA). RNA (1 μg) from each sample was reverse transcribed into cDNA using the HiScript II Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd, Nanjing, China), and qPCR was performed using the HiPlex Robustic SYBR Green Mix (Nuhigh Biotechnologies Co., Ltd, Suzhou, China) on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, USA). The expression levels of the mRNAs and miRNAs were normalized to those of the endogenous reference genes GAPDH and U6, respectively, and relative expression levels were determined using the 2 –ΔΔCt method. The primer sequences are listed in Table 1. Table 1 Sequences of primers used in qRT-PCR

Gene

	Primer sequence (5′→3′)

	
Tbx18

	Forward

	CAGCTGACTATTCGGCCTGT

	
	Reverse

	GAGTCCTAGGTGGGGCAAAG

	
E-cadherin

	Forward

	CAGGTCTCCTCATGGCTTTGC

	
	Reverse

	CTTCCGAAAAGAAGGCTGTCC

	
N-cadherin

	Forward

	GTGGAGGCTTCTGGTGAAATTG

	
	Reverse

	TCCTTCGTGCACATCCTTCG

	
Vimentin

	Forward

	CTCCTACCGCAGGATGTTCG

	
	Reverse

	CGTGTGGACGTGGTCACATA

	
PDGFRα

	Forward

	AGTGGCTACATCATCCCCCT

	
	Reverse

	CCGAAGTCTGTGAGCTGTGT

	
Snail

	Forward

	CCATTCTCCTGCTCCCACT

	
	Reverse

	CCTGGCACTGGTATCTCTTCA

	
Slug

	Forward

	AGAAGCCCAACTACAGCGAA

	
	Reverse

	ATAGGGCTGTATGCTCCCGA

	
α-SMA

	Forward

	GGGAGTAATGGTTGGAATGG

	
	Reverse

	GGTGATGATGCCGTGTTCTA

	
Fn1

	Forward

	ATGTGGACCCCTCCTGATAGT

	
	Reverse

	GCCCAGTGATTTCAGCAAAGG

	
cTnT

	Forward

	AGCCCACATGCCTGCTTAAA

	
	Reverse

	TCTGAACAGGGACTGCACAC

	
Kras

	Forward

	CAAGAGCGCCTTGACGATACA

	
	Reverse

	CCAAGAGACAGGTTTCTCCATC

	
Camk2b

	Forward

	TGATGTCCTGAGCTTGGTGAG

	
	Reverse

	GGGGGCTAATGGGAACTGG

	
p120

	Forward

	GTGGAAACCTACACCGAGGAG

	
	Reverse

	CGTCTAGTGGTCCCATCATCTG

	
GAPDH

	Forward

	TGGCCTCCAAGGAGTAAGAAAC

	
	Reverse

	GGCCTCTCTCTTGCTCTCAGTATC

	

Gene ontology (GO) analysis

Following identification, the anticipated target genes were subjected to a thorough Gene Ontology (GO) analysis to understand their putative biological roles and mechanisms. For the annotation and functional enrichment analysis, we employed Metascape [27], an integrated tool optimized for deciphering multifaceted biological insights.

Protein-protein interaction (PPI) network analysis

The nodes in the PPI network represent proteins, while associations are represented by the connections between nodes. Since proteins are the products of gene expression, the connections between protein molecules can determine the relationships between molecules, the relationships between genes can be understood, and the core regulatory genes can be mined. PPI was analyzed by STRING ( https://cn.string-db.org/), and a PPI network was constructed by Cytoscape, an open-source software platform for visualizing complex networks and integrating these networks with any attribute data. Cytoscape was used to analyze further and visualize the PPI network.

Statistical analysis

Each experiment was performed at least in triplicate. Data are presented as the mean±standard deviation (SD). Student’s t test (Mann-Whitney U test) was used for comparison between two groups, and analysis of variance (ANOVA) was used for compariosn amomg several groups. The statistical analyses were performed using GraphPad Prism v9.0 software (GraphPad Software, Inc., La Jolla, USA) and the R package (version 4.2.1). P<0.05 was considered statistically significant.

Results

In vitro culture of embryonic epicardial cells

In vitro culture of E12.5 ventricular tissue for 24 h resulted in the migration of epicardial cells from the tissue periphery ( Figure 1A). After 48 h, we noted a multilayered emergence of these cells ( Figure 1B), which, post tissue removal, rapidly proliferated into a "cobblestone" arrangement after another 48 h ( Figure 1C). Further confirmation of the identity of these cells as embryonic epicardial cells was achieved via Tbx18 and Wt1 immunofluorescence staining respectively ( Figure 1D,E). Additionally, qPCR analysis verified the expression level of Tbx18 and minimal cardiac troponin T (cTnT) in embryonic epicardial cells, distinguishing them from primary cardiomyocytes ( Figure 1F). These results verified that the cells we cultivated with our technique are embryonic epicardial cells positive for Tbx18. Figure 1

In vitro culture and validation of embryonic epicardial cells

(A) After 24 h of culture, E12.5 ventricular tissue showed epicardial cells migrating from the tissue periphery. (B) After 48 h, more than ten layers of epicardial cells were observed emanating from the tissue edge. (C) Following the removal of ventricular tissue and an additional 48-h culture, the cells exhibited a “cobblestone” epithelial cell arrangement. Immunofluorescence staining results showing high levels of Tbx18 (D) and Wt1 (E) protein expression in the cultured cells. (F) qRT-PCR assays illustrating elevated Tbx18 mRNA levels in cultured cells compared to those in primary cardiomyocytes. In contrast, cardiomyocytes had high cTnT expression and minimal Tbx18 expression.

TGF-β induces EMT and modulates miR-194-3p expression in epicardial cells

After treating epicardial cells with 10 ng/mL TGF-β1 for 48 h, a clear morphological shift was observed, with cells transitioning from an epithelial-like state ( Figure 2A) to a more spindle-shaped or irregular mesenchymal phenotype ( Figure 2B). The qPCR analysis showed TGF-β treatment decreased E-cadherin expression but elevated the levels of mesenchymal markers such as Snail, vimentin, Fn1, and α-SMA ( Figure 2C), indicating that TGF-β induced epithelial-to-mesenchymal transition in these cells. The expression of miR-194-3p was significantly increased after TGF-β-induced EMT in epicardial cells ( Figure 2D). Figure 2

TGF- β induces EMT and modulates miR-194-3p expression in epicardial cells

(A) Epicardial cell morphology of the control group. (B) Cell morphology of epicardial cells induced by 10 ng/mL TGF-β1 for 48 h. (C) qPCR was used to detect the alteration of EMT marker expression levels. *P<0.05, **P<0.01, ***P<0.001. (D) Quantitative analysis of miR-194-3p expression levels following TGF-β-induced EMT. TGF-β, transforming growth factor-β; α-SMA, α-smooth muscle actin; Fn1, fibronectin 1.

miR-194-3p induces EMT process in epicardial cells

The expression of miR-194-3p at several embryonic stages, such as E10.5, E12.5, and E14.5, was subjected to qPCR analysis. The results showed significant alterations, suggesting that miR-194-3p is involved in the EMT process throughout these crucial periods of cardiac development ( Figure 3A). After transfecting miR-194-3p mimics into embryonic epicardial cells , the upregulation of miR-194-3p was confirmed ( Figure 3B), which led to a loss of epithelial arrangement, indicating a mesenchymal shift ( Figure 3C). qPCR results showed that the level of E-cadherin was decreased and the mesenchymal markers such as N-cadherin, Snail, and vimentin were increased ( Figure 3D). Western blot analysis further supported these findings, showing reduced E-cadherin and increased vimentin and PDGFRα levels ( Figure 3E and Supplementary Figure S1A‒D). Immunofluorescence revealed more vimentin and PDGFRα in miR-194-3p-overexpressing cells than in control cells ( Figure 3F,G). Furthermore, in the wound healing assays, these cells migrated more readily ( Figure 3H). In epicardial cells, miR-194-3p overexpression can generally induce EMT. Figure 3

miR-194-3p promotes EMT in epicardial cells

(A) qPCR analysis showing significant changes in miR-194-3p expression at different embryonic stages (E10.5, E12.5, and E14.5). n=3, *P<0.05, **P<0.01. (B) Validation of miR-194-3p overexpression after transfection. (C) Morphological changes to a mesenchymal phenotype. (D) qPCR results showed decreased E-cadherin level and increased levels of mesenchymal markers. *P<0.05, **P<0.01, ***P<0.001; ns, not significant. (E) Western blot analysis showing a reduction in E-cadherin expression and an increase in vimentin and PDGFRα expressions. n=3, *P<0.05, **P<0.01. (F,G) Enhanced vimentin and PDGFRα fluorescence in miR-194-3p-overexpressing cells. (H) Wound healing assay was used to detect cell migration after scratching for 0, 4, 8, or 12 h, respectively. n=3, ****P<0.0001. E, embryonic days

Inhibition of miR-194-3p suppresses EMT in epicardial cells

We used inhibitors to limit the expression of miR-194-3p to investigate its inhibitory effect on epicardial cell EMT. After miR-194-3p inhibitor transfection, miR-194-3p expression was reduced significantly ( Figure 4A). These cells showed a denser arrangement ( Figure 4B), increased E-cadherin expression, and decreased expressions of mesenchymal markers, such as N-cadherin and Snail ( Figure 4C). Western blot analysis confirmed that the level of E-cadherin was increased and vimentin and PDGFRα levels were reduced ( Figure 4D and Supplementary Figure S2A‒D). Immunofluorescence staining results highlighted fewer vimentin and PDGFRα-expressing cells ( Figure 4E,F). The miR-194-3p-inhibited cells also showed reduced migration after 8 h, as revealed by wound healing assay ( Figure 4G). These results suggest that miR-194-3p inhibition hinders EMT in epicardial cells. Figure 4

Inhibition of miR-194-3p suppresses EMT in epicardial cells

(A) Decreased miR-194-3p expression post-inhibitor transfection. (B) Denser cellular arrangement upon miR-194-3p suppression. (C) Alteration of EMT markers detected by qPCR after the inhibition of miR-194. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; ns, not significant. (D) Altered levels of EMT markers detected by western blot analysis after miR-194 inhibition. n=3, **P<0.01, ****P<0.0001. (E,F) Reduced fluorescence of vimentin and PDGFRα post miR-194-3p inhibition. (G) Wound healing assay was used to detect cell migration after scratching for 0, 4, 8, or 12 h, respectively. n=3, **P<0.01; ns, not significant.

Bioinformatics analysis and target prediction of miR-194-3p

We used TargetScan, miRWalk, and miRDB, three online databases in concert to identify the downstream target genes of miR-194-3p effectively. Ninety-one frequently predicted target genes were obtained by using a Venn diagram to show where the predictions from various databases intersected ( Figure 5A). Subsequent Gene Ontology (GO) analysis, performed using Metascape, revealed an enrichment of the predicted target genes in roles associated with the regulation of developmental growth, regulation of protein localization to the membrane, and secretion ( Figure 5B). Further analysis illustrated a pronounced enrichment in biological processes, including developmental processes, signaling, growth, and multicellular organismal processes ( Figure 5C). Additionally, hub genes among the predicted targets were identified based on the PPI network analysis using the CytoHubba app within the Cytoscape software ( Figure 5D). Figure 5

Bioinformatics prediction and analysis of miR-194-3p targets

(A) Venn diagram depicting the overlap of target genes from three database predictions. (B) GO enrichment network for predicted targets; nodes represent specific functional ontology terms, with node size reflecting the number of genes within that term. (C) Enrichment analysis detailing the predicted biological processes associated with the target genes. (D) Hub genes from the predicted targets were identified using the CytoHubba app within Cytoscape; node color transitions from yellow to red based on hub gene scores.

miR-194-3p regulates epicardial cell EMT via targeting p120/β-catenin

In the context of the previously elucidated potential target genes, we selected three prominent candidates: Kras, Camk2b, and p120-catenin. Notably, when miR-194-3p was overexpressed, there was a significant decline in p120-catenin mRNA expression. On the other hand, there was little change in the levels of Kras and Camk2b, suggesting that miR-194-3p and p120-catenin may have a regulatory relationship ( Figure 6A). Luciferase reporter assay confirmed that miR-194-3p and p120-catenin have a direct interaction by using wild-type and mutant constructs of the p120-catenin 3′UTR( Figure 6B,C). The expression of p120-catenin was significantly inhibited at both the mRNA and protein levels by p120-catenin siRNA ( Figure 6D,E and Supplementary Figure S3A,B). Remarkably, rescue experiments demonstrated that silencing of p120-catenin with siRNA could reverse the EMT inhibition caused by the miR-194-3p inhibitor, underscoring p120-catenin’s critical role in miR-194-3p-mediated epicardial cell EMT ( Figure 6F,G and Supplementary Figure S4A‒D). Figure 6

Regulation of epicardial cell EMT by miR-194-3p through the p120/β-catenin pathway

(A) Altered expression of downstream predicted target genes detected by qPCR after overexpression of miR-194-3p. n=3, ****P<0.0001; ns, not significant. (B) Construction of wild-type and mutated 3′UTR variants of p120-catenin. (C) Decreased luciferase activity after co-transfection with the miR-194-3p mimic and the wild-type 3′UTR of p120-catenin, highlighting a direct interaction. n=7, *P<0.01, ****P<0.0001; ns, not significant. (D) qPCR assays showing the effect of p120-catenin siRNA on gene silencing. n=4, ***P<0.001. (E) Western blot anlaysis of the protein inhibition effect of p120-catenin siRNA. n=3, **P<0.01. (F) Rescue experiment showing the reversal of the EMT-suppressing phenotype caused by miR-194-3p inhibition. *P<0.05, **P<0.01, ****P<0.0001; ns, not significant. (G) Results consistent with those of the rescue experiment at the protein level. n=3, *P<0.05, **P<0.01, ***P<0.001; ns, not significant. (H) Altered p120-catenin and β-catenin levels upon modulation of miR-194-3p expression. *P<0.05, **P<0.01, ****P<0.0001. (I) The regulatory relationship between p120-catenin and β-catenin was confirmed by a rescue experiment. *P<0.05, **P<0.01; ns, not significant.

To confirm the role of p120-catenin in cell adhesion via E-cadherin, we further explored its potential interaction with β-catenin. Overexpression of miR-194-3p led to reduced p120-catenin level and elevated β-catenin level, while its inhibition showed the opposite effect ( Figure 6H). Furthermore, the reduced β-catenin expression induced by the miR-194 inhibitor was rescued by p120-catenin siRNA ( Figure 6I), confirming that p120-catenin acts upstream of β-catenin. All of these results implied the possibility that miR-194-3p stimulates epicardial cell EMT through p120-catenin inhibition, which in turn activates β-catenin.

Discussion

The mesothelial layer of the heart, known as the epicardium, has long been acknowledged as a special structure that is crucial for both endogenous regenerative repair and cardiac growth. Over the past decade, abundant research has confirmed the involvement of epicardial cells in vascular system stabilization [ 28, 29], conduction system formation [30], and myocardial compaction processes [ 31, 32]. The consequences of disrupted epicardial formation, such as thinning of the myocardial wall and coronary artery defects, underscore the importance of the epicardium in heart development [ 33, 34]. The function of microRNAs in controlling the development of the embryonic heart is still poorly understood today. Accumulating evidence suggests that a restricted set of microRNAs might regulate Twist [35] and/or Zeb1/Zeb2 [36] during development and/or tissue homeostasis. In the process of endocardial cushion formation, three microRNAs, namely miR-23, miR-126, and miR-199, have been implicated in EMT [ 37– 39], all of which act as suppressors. The conserved functional characteristics of these genes across species such as mice, chickens, and zebrafish further bolster the widespread evolutionary conservation theory. Regrettably, our comprehension of microRNA regulation during epicardial-to-mesenchymal transition remains markedly deficient [ 40– 42]. It is noteworthy that reduced epicardial development has been associated with the loss of the Dicer enzyme, which is essential for microRNA processing but does not negatively impact EMT [42].

The role of miR-194-3p in the development of the embryonic heart and its regulatory effects on EMT are documented for the first time in our current investigation. Research on miR-194-3p has been limited. In specific cancer contexts, miR-194-3p primarily mitigates the TGF-β-induced EMT promotion [43] and inhibits cell migration and invasion [ 21, 22, 44– 47]. Intriguingly, our findings, veriying miR-194-3p as a promoter of epicardial cell EMT and migration, are in stark contrast to these earlier observations. This discrepancy may stem from the different contexts of carcinogenesis versus embryonic development. Our initial research suggested a potential link between autophagy and the developmental differentiation of epicardial cells [48]. Recent insights suggested the potential regulatory role of miR-194-3p via autophagy [49], yet a deeper exploration into its precise mechanisms is warranted. In addition to the modulation of EMT-related signaling pathways and key transcriptional regulators by microRNAs, emerging studies have spotlighted the direct regulatory effect of microRNAs on cell-cell adhesion and cytoskeletal proteins. For instance, miR-122, miR-24, and miR-1291 have been shown to directly target RhoA expression [ 50– 52], while miR-22 impacts actin filament expression [53], thereby providing cues for cytoskeletal remodeling during epithelial-to-mesenchymal transition. It is known that a number of microRNAs affect the expressions of claudins and cadherins, which are essential for cell-cell junctions. Notably, both miR-10b and miR-214 have been documented to directly target the 3′ UTR of E-cadherin [ 54, 55], while indirect regulation of E-cadherin has been attributed to numerous microRNAs, including the miR-200 family [ 56– 59]. Furthermore, miR-27a has been identified to regulate vascular endothelial-cadherin directly [60], while miR-199a has been implicated in modulating the expression of N-cadherin [61]. Furthermore, miR-155 and miR-30a, two microRNAs, directly target Claudin 1 and Claudin 5, respectively [ 62, 63].

The cooperative utilization of three online databases identified 91 putative downstream targets for miR-194-3p, highlighting its potentially complex function in the development of the embryonic heart. Notably, the PPI analysis spotlighted Kras, Camk2b, and p120-catenin as the hub genes, which intriguingly have not been previously reported in the context of embryonic epicardial cell EMT. The involvement of these genes could introduce a novel layer of complexity and regulation in the EMT process, warranting further investigation to elucidate their specific roles and interactions mediated by miR-194-3p. The adhesive junctions of epithelial cells play an indispensable role in their growth and developmental trajectory. These junctions serve as the hubs for the interactions between cells and are essential regulators of cell migration, proliferation, polarization, and survival [ 64, 65]. Within the cellular milieu, E-cadherin engages in the interactions with members of the catenin family, among which p120-catenin is crucial for the stability of cadherins. Research using animal models and cell culture has indicated that E-cadherin serves as a tumor suppressor and barrier against invasion, which is consistent with its importance in normal development and homeostasis.

Intracellularly, E-cadherin interacts with p120 through its juxta membrane domain (JMD) and with β-catenin via its catenin-binding domain [66]. β-Catenin, in turn, links E-cadherin to the actin cytoskeleton through interactions with α-catenin. JMD targets E-cadherin for endocytosis and proteasomal breakdown through endocytic processes and docking sites for the ubiquitin ligase Hakai [65]. By shielding these sites, p120 emerges as a principal regulator of E-cadherin stability [ 67‒ 69]. In our study, the observed effects of miR-194-3p overexpression on epicardial cell EMT and cell adhesiveness align with the reduced level of p120-catenin, an integral player in cell adhesion signaling. This relationship between miR-194-3p and p120-catenin is intriguing, as it appears to initiate a cascade of changes, notably in β-catenin dynamics. A compensatory increase in signaling molecules, such as β-catenin, which are known to play roles in the advancement of epithelial-mesenchymal transition, may be triggered by the loss of cell adhesion, as indicated by the increase in free β-catenin that follows the decrease in p120-catenin. Our findings contribute to a understanding of how microRNAs influence cell behavior by modulating key adhesion molecules. However, a complete understanding of the specific molecular relationship between β-catenin dynamics and decreased p120-catenin level is still pending. Future studies should aim to directly quantify the binding between p120-catenin and β-catenin to unravel this complex regulatory relationship, providing valuable insights into the molecular intricacies of EMT, not only in the context of cardiac development but also in pathological states where EMT plays a critical role.

In conclusion, our study sheds light on the complex functions of the cytoskeleton, developmental signaling pathways, and microRNA-associated cell junctions while offering a novel understanding of the expression of miR-194-3p during epicardial development. However, the emphasis on miR-194-3p may obscure other influential microRNAs, and while our findings are rooted in ex vivo models, in vivo validation remains imperative. This basic information not only opens up new research directions for the study of noncoding RNAs in general and cardiac development in particular, but it also points to possible treatment approaches for heart diseases.

Supporting information

519Supplementary_data

COMPETING INTERESTS

The authors declare that they have no conflict of interest.

Supplementary Data

Supplementary data is available at Acta Biochimica et Biophysica Sinica online.
==== Refs
1 Cao J Poss KD The epicardium as a hub for heart regeneration Nat Rev Cardiol 2018 15 631 647 10.1038/s41569-018-0046-4 29950578
2 Mikawa T Fischman DA Retroviral analysis of cardiac morphogenesis: discontinuous formation of coronary vessels Proc Natl Acad Sci USA 1992 89 9504 9508 10.1073/pnas.89.20.9504 1409660
3 Gittenberger-de Groot AC Vrancken Peeters MPFM Mentink MMT Gourdie RG Poelmann RE Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions Circ Res 1998 82 1043 1052 10.1161/01.res.82.10.1043 9622157
4 Männer J Experimental study on the formation of the epicardium in chick embryos Anat Embryol 1993 187 281 289 10.1007/BF00195766
5 Velecela V Torres-Cano A García-Melero A Ramiro-Pareta M Müller-Sánchez C Segarra-Mondejar M Chau YY et al. Epicardial cell shape and maturation are regulated by Wt1 via transcriptional control of Bmp4 Development 2019 146 dev178723 10.1242/dev.178723 31624071
6 Wu M Smith CL Hall JA Lee I Luby-Phelps K Tallquist MD Epicardial spindle orientation controls cell entry into the myocardium Dev Cell 2010 19 114 125 10.1016/j.devcel.2010.06.011 20643355
7 Wessels A van den Hoff MJB Adamo RF Phelps AL Lockhart MM Sauls K Briggs LE et al. Epicardially derived fibroblasts preferentially contribute to the parietal leaflets of the atrioventricular valves in the murine heart Dev Biol 2012 366 111 124 10.1016/j.ydbio.2012.04.020 22546693
8 Acharya A Baek ST Huang G Eskiocak B Goetsch S Sung CY Banfi S et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors Development 2012 139 2139 2149 10.1242/dev.079970 22573622
9 Cai CL Martin JC Sun Y Cui L Wang L Ouyang K Yang L et al. A myocardial lineage derives from Tbx18 epicardial cells Nature 2008 454 104 108 10.1038/nature06969 18480752
10 von Gise A Zhou B Honor LB Ma Q Petryk A Pu WT WT1 regulates epicardial epithelial to mesenchymal transition through β-catenin and retinoic acid signaling pathways Dev Biol 2011 356 421 431 10.1016/j.ydbio.2011.05.668 21663736
11 Smits AM Dronkers E Goumans MJ The epicardium as a source of multipotent adult cardiac progenitor cells: their origin, role and fate Pharmacol Res 2018 127 129 140 10.1016/j.phrs.2017.07.020 28751220
12 Dettman RW Denetclaw Jr W Ordahl CP Bristow J Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart Dev Biol 1998 193 169 181 10.1006/dbio.1997.8801 9473322
13 Lie-Venema H van den Akker NMS Bax NAM Winter EM Maas S Kekarainen T Hoeben RC et al. Origin, fate, and function of epicardium-derived cells (EPDCs) in normal and abnormal cardiac development Sci World J 2007 7 1777 1798 10.1100/tsw.2007.294
14 Xu J Lamouille S Derynck R TGF-β-induced epithelial to mesenchymal transition Cell Res 2009 19 156 172 10.1038/cr.2009.5 19153598
15 Molin DGM Bartram U Van der Heiden K Van Iperen L Speer CP Hierck BP Poelmann RE et al. Expression patterns of Tgfβ1–3 associate with myocardialisation of the outflow tract and the development of the epicardium and the fibrous heart skeleton Dev Dyn 2003 227 431 444 10.1002/dvdy.10314 12815630
16 Miettinen PJ Ebner R Lopez AR Derynck R TGF-beta induced transdifferentiation of mammary epithelial cells to mesenchymal cells: involvement of type I rec. 1994 127 2021 2036 10.1083/jcb.127.6.2021 J Cell Biol 7806579
17 Piek E Moustakas A Kurisaki A Heldin CH Dijke P TGF-β type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells J Cell Sci 1999 112 4557 4568 10.1242/jcs.112.24.4557 10574705
18 Valcourt U Kowanetz M Niimi H Heldin CH Moustakas A TGF-β and the smad signaling pathway support transcriptomic reprogramming during epithelial-mesenchymal cell transition Mol Biol Cell 2005 16 1987 2002 10.1091/mbc.e04-08-0658 15689496
19 Dronkers E Wauters MMM Goumans MJ Smits AM Epicardial TGFβ and bmp signaling in cardiac regeneration: what lesson can we learn from the developing heart? Biomolecules 2020 10 404 10.3390/biom10030404 32150964
20 Bartel DP MicroRNAs Cell 2004 116 281 297 10.1016/S0092-8674(04)00045-5 14744438
21 Abuduaini R, Miao X, Xu J, Che L, Zhou W, Guo Z, Sun J. MicroRNA-194-3p inhibits the metastatic biological behaviors of spinal osteosarcoma cells by the repression of matrix metallopeptidase 9 . Int J Clin Exp Pathol2018, 11: 5257–5264
22 Liu T, Fang Y. MiR-194-3p modulates the progression of colorectal cancer by targeting KLK10 . Histol Histopathol. 2022, 37: 301–309.
23 Tian Z Wang R Zhang X Deng B Mi C Liang T Ling Y et al. Benzo[a]pyrene-7,8-diol-9,10-epoxide suppresses the migration and invasion of human extravillous trophoblast Swan 71 cells due to the inhibited filopodia formation and down-regulated PI3K/AKT/CDC42/PAK1 pathway mediated by the increased miR-194-3p Toxicol Sci 2018 166 25 38 10.1093/toxsci/kfy182 30011042
24 Compton LA Potash DA Mundell NA Barnett JV Transforming growth factor‐β induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells Dev Dyn 2006 235 82 93 10.1002/dvdy.20629 16258965
25 Austin AF Compton LA Love JD Brown CB Barnett JV Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFβ Dev Dyn 2008 237 366 376 10.1002/dvdy.21421 18213583
26 Kilkenny C Browne W Cuthill IC Emerson M Altman DG Animal research: reporting in vivo experiments: the ARRIVE guidelines Br J Pharmacol 2010 160 1577 1579 10.1111/j.1476-5381.2010.00872.x 20649561
27 Zhou Y Zhou B Pache L Chang M Khodabakhshi AH Tanaseichuk O Benner C et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets Nat Commun 2019 10 1523 10.1038/s41467-019-09234-6 30944313
28 Zamora M Männer J Ruiz-Lozano P Epicardium-derived progenitor cells require β-catenin for coronary artery formation Proc Natl Acad Sci USA 2007 104 18109 18114 10.1073/pnas.0702415104 17989236
29 Gittenberger-de Groot AC Winter EM Poelmann RE Epicardium derived cells (EPDCs) in development, cardiac disease and repair of ischemia J Cell Mol Med 2010 14 1056 1060 10.1111/j.1582-4934.2010.01077.x 20646126
30 Kelder TP Duim SN Vicente-Steijn R Végh AMD Kruithof BPT Smits AM van Bavel TC et al. The epicardium as modulator of the cardiac autonomic response during early development J Mol Cell Cardiol 2015 89 251 259 10.1016/j.yjmcc.2015.10.025 26527381
31 Chen THP Chang TC Kang JO Choudhary B Makita T Tran CM Burch JBE et al. Epicardial induction of fetal cardiomyocyte proliferation via a retinoic acid-inducible trophic factor Dev Biol 2002 250 198 207 10.1006/dbio.2002.0796 12297106
32 Weeke-Klimp A Bax NAM Bellu AR Winter EM Vrolijk J Plantinga J Maas S et al. Epicardium-derived cells enhance proliferation, cellular maturation and alignment of cardiomyocytes J Mol Cell Cardiol 2010 49 606 616 10.1016/j.yjmcc.2010.07.007 20655924
33 Männer J Schlueter J Brand T Experimental analyses of the function of the proepicardium using a new microsurgical procedure to induce loss‐of‐proepicardial‐function in chick embryos Dev Dyn 2005 233 1454 1463 10.1002/dvdy.20487 15977171
34 Gittenberger-de Groot AC Vrancken Peeters MPFM Bergwerff M Mentink MMT Poelmann RE Epicardial outgrowth inhibition leads to compensatory mesothelial outflow tract collar and abnormal cardiac septation and coronary formation Circ Res 2000 87 969 971 10.1161/01.res.87.11.969 11090540
35 Khanbabaei H Teimoori A Mohammadi M The interplay between microRNAs and Twist1 transcription factor: a systematic review Tumour Biol 2016 37 7007 7019 10.1007/s13277-016-4960-y 26880587
36 Kim T Veronese A Pichiorri F Lee TJ Jeon YJ Volinia S Pineau P et al. p53 regulates epithelial–mesenchymal transition through microRNAs targeting ZEB1 and ZEB2 J Exp Med 2011 208 875 883 10.1084/jem.20110235 21518799
37 Lagendijk AK Goumans MJ Burkhard SB Bakkers J MicroRNA-23 restricts cardiac valve formation by inhibiting has2 and extracellular hyaluronic acid production Circ Res 2011 109 649 657 10.1161/CIRCRESAHA.111.247635 21778427
38 Bonet F Dueñas Á López‐Sánchez C García‐Martínez V Aránega AE Franco D MiR‐23b and miR‐199a impair epithelial‐to‐mesenchymal transition during atrioventricular endocardial cushion formation Dev Dyn 2015 244 1259 1275 10.1002/dvdy.24309 26198058
39 Stankunas K Ma GK Kuhnert FJ Kuo CJ Chang CP VEGF signaling has distinct spatiotemporal roles during heart valve development Dev Biol 2010 347 325 336 10.1016/j.ydbio.2010.08.030 20816797
40 Brønnum H Andersen DC Schneider M Sandberg MB Eskildsen T Nielsen SB Kalluri R et al. miR-21 promotes fibrogenic epithelial-to-mesenchymal transition of epicardial mesothelial cells involving programmed cell death 4 and sprouty-1 PLoS One 2013 8 e56280 10 10.1371/journal.pone.0056280 23441172
41 Brønnum H Andersen DC Schneider M Yaël Nossent A Nielsen SB Sheikh SP Islet-1 is a dual regulator of fibrogenic epithelial-to-mesenchymal transition in epicardial mesothelial cells Exp Cell Res 2013 319 424 435 10.1016/j.yexcr.2012.12.019 23270756
42 Singh MK Lu MM Massera D Epstein JA MicroRNA-processing enzyme dicer is required in epicardium for coronary vasculature development J Biol Chem 2011 286 41036 41045 10.1074/jbc.M111.268573 21969379
43 Zhang Q Liu F Qin L Liao Z Song J Liang H Chen X et al. Characterization of TGFβ-associated molecular features and drug responses in gastrointestinal adenocarcinoma BMC Gastroenterol 2021 21 284 10.1186/s12876-021-01869-4 34247571
44 Liu B Tian Y Chen M Shen H Xia J Nan J Yan T et al. CircUBAP2 promotes MMP9-mediated oncogenic effect via sponging miR-194-3p in hepatocellular carcinoma Front Cell Dev Biol 2021 9 675043 10.3389/fcell.2021.675043 34239873
45 Xia W Mao Q Chen B Wang L Ma W Liang Y Zhang T et al. The TWIST1-centered competing endogenous RNA network promotes proliferation, invasion, and migration of lung adenocarcinoma Oncogenesis 2019 8 62 10.1038/s41389-019-0167-6 31645542
46 Yi L Ouyang L Wang S Li SS Yang XM Long noncoding RNA PTPRG‐AS1 acts as a microRNA‐194‐3p sponge to regulate radiosensitivity and metastasis of nasopharyngeal carcinoma cells via PRC1 J Cell Physiol 2019 234 19088 19102 10.1002/jcp.28547 30993702
47 Zhou Q Guo J Huang W Yu X Xu C Long X Linc‐ROR promotes the progression of breast cancer and decreases the sensitivity to rapamycin through miR‐194‐3p targeting MECP2 Mol Oncol 2020 14 2231 2250 10.1002/1878-0261.12700 32335998
48 Liu Y Liu B Li Y Li Y Du J Deng S Jing X et al. Autophagy is involved in the differentiation of epicardial progenitor cells into vascular smooth muscle cells in mice Exp Cell Res 2019 375 60 71 10.1016/j.yexcr.2018.12.025 30611740
49 Fan L Li B Li Z Sun L Identification of autophagy related circRNA-miRNA-mRNA-subtypes network with radiotherapy responses and tumor immune microenvironment in non-small cell lung cancer Front Genet 2021 12 730003 10.3389/fgene.2021.730003 34567080
50 Papadimitriou E Vasilaki E Vorvis C Iliopoulos D Moustakas A Kardassis D Stournaras C Differential regulation of the two RhoA-specific GEF isoforms Net1/Net1A by TGF-β and miR-24: role in epithelial-to-mesenchymal transition Oncogene 2012 31 2862 2875 10.1038/onc.2011.457 21986943
51 Wang SC Lin XL Li J Zhang TT Wang HY Shi JW Yang S et al. MicroRNA-122 triggers mesenchymal-epithelial transition and suppresses hepatocellular carcinoma cell motility and invasion by targeting RhoA PLoS One 2014 9 e101330 10 10.1371/journal.pone.0101330 24992599
52 Xu Q Duan H Gan L Liu X Chen F Shen X Tang YQ et al. MicroRNA-1291 promotes endometrial fibrosis by regulating the ArhGAP29-RhoA/ROCK1 signaling pathway in a murine model Mol Med Rep 2017 16 4501 4510 10.3892/mmr.2017.7210 28849001
53 Li W Jiang G Zhou J Wang H Gong Z Zhang Z Min K et al. Down-regulation of miR-140 induces emt and promotes invasion by targeting slug in esophageal cancer Cell Physiol Biochem 2014 34 1466 1476 10.1159/000366351 25322669
54 Liu M Liu L Bai M Zhang L Ma F Yang X Sun S Hypoxia-induced activation of Twist/miR-214/E-cadherin axis promotes renal tubular epithelial cell mesenchymal transition and renal fibrosis Biochem Biophys Res Commun 2018 495 2324 2330 10.1016/j.bbrc.2017.12.130 29277613
55 Zhang L Sun J Wang B Ren JC Su W Zhang T MicroRNA-10b triggers the epithelial–mesenchymal transition (EMT) of laryngeal carcinoma hep-2 cells by directly targeting the e-cadherin Appl Biochem Biotechnol 2015 176 33 44 10.1007/s12010-015-1505-6 25875782
56 Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of e-cadherin transcriptional repressors ZEB1 and ZEB2 J Biol Chem 2008 283 14910 14914 10.1074/jbc.C800074200 18411277
57 Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2 Genes Dev 2008 22 894 907 10.1101/gad.1640608 18381893
58 Cong N Du P Zhang A Shen F Su J Pu P Wang T et al. Downregulated microRNA-200a promotes EMT and tumor growth through the Wnt/β-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastric adenocarcinoma Oncol Rep 2013 29 1579 1587 10.3892/or.2013.2267 23381389
59 Asakura T Yamaguchi N Ohkawa K Yoshida K Proteasome inhibitor-resistant cells cause EMT-induction via suppression of E-cadherin by miR-200 and ZEB1 Int J Oncol 2015 46 2251 2260 10.3892/ijo.2015.2916 25738863
60 Liu S Cui J Liao G Zhang Y Ye K Lu T Qi J et al. miR-137 regulates epithelial-mesenchymal transition in gastrointestinal stromal tumor Tumour Biol 2014 35 9131 9138 10.1007/s13277-014-2177-5 25027394
61 Suzuki T Mizutani K Minami A Nobutani K Kurita S Nagino M Shimono Y et al. Suppression of the TGF‐β1‐induced protein expression of SNAI 1 and N‐cadherin by miR‐199a Genes Cells 2014 19 667 675 10.1111/gtc.12166 25041364
62 Chung YH Li SC Kao YH Luo HL Cheng YT Lin PR Tai MH et al. MiR-30a-5p inhibits epithelial-to-mesenchymal transition and upregulates expression of tight junction protein claudin-5 in human upper tract urothelial carcinoma cells Int J Mol Sci 2017 18 1826 10.3390/ijms18081826 28829370
63 Zhang GJ Xiao HX Tian HP Liu ZL Xia SS Zhou T Upregulation of microRNA-155 promotes the migration and invasion of colorectal cancer cells through the regulation of claudin-1 expression Int J Mol Med 2013 31 1375 1380 10.3892/ijmm.2013.1348 23588589
64 Nelson WJ, Dickinson DJ, Weis WI. Roles of cadherins and catenins in cell-cell adhesion and epithelial cell polarity . Prog Mol Biol Transl Sci2013, 116: 3–23.
65 Harris TJC Tepass U Adherens junctions: from molecules to morphogenesis Nat Rev Mol Cell Biol 2010 11 502 514 10.1038/nrm2927 20571587
66 Shapiro L Weis WI Structure and biochemistry of cadherins and catenins Cold Spring Harb Perspect Biol 2009 1 a003053 10.1101/cshperspect.a003053 20066110
67 Ireton RC Davis MA van Hengel J Mariner DJ Barnes K Thoreson MA Anastasiadis PZ et al. A novel role for p120 catenin in E-cadherin function J Cell Biol 2002 159 465 476 10.1083/jcb.200205115 12427869
68 Davis MA Ireton RC Reynolds AB A core function for p120-catenin in cadherin turnover J Cell Biol 2003 163 525 534 10.1083/jcb.200307111 14610055
69 Nanes BA Chiasson-MacKenzie C Lowery AM Ishiyama N Faundez V Ikura M Vincent PA et al. p120-catenin binding masks an endocytic signal conserved in classical cadherins J Cell Biol 2012 199 365 380 10.1083/jcb.201205029 23071156
